{"paper_id":"3a82bbd8-91d8-4327-8291-9341fcaa663a","body_text":"ARTICLE IN PRESS\nArticle in Press\nDysregulated Fas/Fas ligand expression in \nendometrial stromal cells and mononuclear cells \nin endometriosis\nScientific Reports\nReceived: 4 September 2025\nAccepted: 16 June 2026\nCite this article as: Mohammadi T., \nKhodaverdi S., Noormohammadi M. et al. \nDysregulated Fas/Fas ligand expression \nin endometrial stromal cells and \nmononuclear cells in endometriosis. \nSci Rep (2026). https://doi.org/10.1038/\ns41598-026-58780-9\nTahereh Mohammadi, Sepideh Khodaverdi, Morvarid Noormohammadi, Pooya \nFarhangnia, Kiana Sohrabi & Ali-Akbar Delbandi\nWe are providing an unedited version of this manuscript to give early access to its \nfindings. Before final publication, the manuscript will undergo further editing. Please \nnote there may be errors present which affect the content, and all legal disclaimers \napply.\nIf this paper is publishing under a Transparent Peer Review model then Peer \nReview reports will publish with the final article.\nhttps://doi.org/10.1038/s41598-026-58780-9\n© The Author(s) 2026. Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International \nLicense, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit \nto the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do \nnot have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this \narticle are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the \narticle’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain \npermission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.\n\nTitle: Dysregulated Fas/Fas Ligand Expression in Endometrial Stromal Cells \nand Mononuclear Cells in Endometriosis\nRunning Title: Endometriosis and Apoptosis\nAuthors: Tahereh Mohammadi 1, Sepideh Khodaverdi 1, Morvarid \nNoormohammadi1, Pooya Farhangnia 1, 2, Kiana Sohrabi 1, Ali-Akbar \nDelbandi1,3,4*\nAffiliations:\n1- Department of Immunology, School of Medicine, Iran University of Medical \nSciences, Tehran, Iran\n2- Antimicrobial Resistance Research Center, Institute of Immunology and \nInfectious Diseases, Iran University of Medical Sciences, Tehran, Iran\n3- Reproductive Sciences and Technology Research Center, Department of \nImmunology, School of Medicine, Iran University of Medical Sciences, \nTehran, Iran\n4- Immunology Research Center, Institute of Immunology and Infectious \nDiseases, Iran University of Medical Sciences, Tehran, Iran\n*Corresponding Author: Ali-Akbar Delbandi, Ph.D.| Department of \nImmunology, School of Medicine, Iran University of Medical Sciences, \nHemmat Broadway, Tehran, Iran | Postal code: 1449614535 | Postal box: \n14665-354 | Tel: +982186703287 | Fax: +982188622652 | E-mails: \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nDelbandi.ak@iums.ac.ir, Delbandi@yahoo.com | ORCID ID: [0000-0003-\n0012-9333]\nAbstract\nApoptosis plays a paramount role in endometriosis pathogenesis. This \nprocess may be disrupted in endometrial stromal cells (ESCs) of women with \nendometriosis, causing them to continue developing in ectopic locations. This \nstudy investigates the role of apoptosis in endometriosis by comparing the \nprotein expression of Fas (CD95) and Fas ligand (FasL) in ESCs of women \nwith endometriosis to that of healthy controls. Additionally, it examines the \ngene expression levels of Fas and FasL in peritoneal fluid mononuclear cells \n(PFMCs) and peripheral blood mononuclear cells (PBMCs) from both groups. \nLastly, it assesses the levels of soluble FasL (sFasL) released by ESCs and \nPFMCs. ESCs were isolated from ectopic (n = 11) and eutopic samples (n = \n17) of endometriosis patients and control (n = 10), alongside peritoneal fluid \nand blood samples from 10 patients and 10 controls. Using Western blot, Fas \nand FasL protein expression were assessed in ectopic endometrial stromal \ncells (EESCs), eutopic endometrial stromal cells (EuESCs), and control \nendometrial stromal cells (CESCs). Additionally, quantitative real-time PCR \nwas used to evaluate Fas and FasL gene expression in PFMCs and PBMCs. \nLastly, an enzyme-linked immunosorbent assay (ELISA) was conducted to \nassess the concentration of sFasL molecules in the supernatants of EESCs, \nEuESCs, CESCs, and PFMCs. Importantly, Fas protein levels in EESCs and \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nEuESCs were lower than in CESCs (p < 0.01). Conversely, FasL protein levels \nwere elevated in EESCs compared to both EuESCs and CESCs (p < 0.01 and \np < 0.05 , respectively). Additionally, patients with endometriosis exhibited \nhigher Fas gene expression in PFMCs ( p < 0.05 ) and lower expression in \nPBMCs (p < 0.01) compared to controls, along with reduced FasL expression \nin PFMCs ( p < 0.01 ). Moreover, the concentration of sFasL molecules \nreleased from EESCs was significantly higher compared to EuESCs (p < 0.01) \nand CESCs (p < 0.05). All in all, our findings shed light on the understanding \nof the involvement of the Fas/FasL pathway in endometriosis pathogenesis.\nKeywords: Endometriosis, Apoptosis, Endometrial stromal cell, Ectopic \nendometrium, Eutopic endometrium, Fas ligand, sFasL\n1. Introduction\nEndometriosis is a chronic disease characterized by inflammation and \ndefined by the presence of ectopic endometrium-like tissue in areas outside \nthe uterus, including the fallopian tubes and peritoneal cavity 1–3. It affects \n10–25% of female patients of reproductive age 3–5. The prevalence of \nendometriosis ranges from 0.2% to 71.4% 6 and is reported to be \napproximately 18% in Iran 7. Affected patients experience a lower quality of \nlife and exhibit symptoms such as chronic pelvic pain and infertility, as well \nas a higher risk of developing ovarian cancer 8. According to Sampson's \ntheory, retrograde menstruation through the fallopian tubes into the \nperitoneal cavity leads to the growth of ectopic endometrial tissue 9. \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nAdditionally, the reduced apoptosis of the ectopic endometrium in these \npatients, compared to healthy individuals, allows for the survival of \nendometrial cells10. Furthermore, in our previous study, we investigated the \nexpression of molecules involved in apoptosis, including Bcl-2, Bcl-xL, Bax, \nand caspase-3. The study indicated that there is a decreased tendency toward \napoptosis in ectopic endometrial stromal cells (EESCs) 11. Also, the elevated \napoptosis of immune cells in the peritoneal cavity is another significant factor \ncontributing to the pathogenesis of the disease10.\nApoptosis removes cells without inducing an inflammatory reaction 10. It is a \nprincipal process for maintaining endometrial tissue and cell homeostasis, \nensuring that they function appropriately by eradicating senescent cells 12. \nFas (CD95) is one of the death receptors from the tumor necrosis factor \nreceptor (TNFR) superfamily13. Fas ligand (FasL) is a TNF family cell surface \nprotein that induces apoptosis in Fas-expressing cells when it binds to its \nreceptor, by signaling through the adaptor protein Fas-associated death \ndomain (FADD). FADD interacts with procaspase-8 via the death effector \ndomain (DED) 14. Together, Fas, FADD, and procaspase-8 form the death-\ninducing signaling complex (DISC) 13. Subsequently, apoptosis is initiated \nafter the degradation of procaspase-8 to caspase-8 and the activation of the \ncaspase cascade15.\nFas and FasL are proteins that exist in both membrane-bound and soluble \nforms. Membrane-bound FasL induces apoptosis when it binds to Fas, while \nsoluble Fas (sFas) inhibits this process by blocking death signals. Soluble \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nFasL (sFasL), generated through proteolytic cleavage, promotes apoptosis16. \nIn endometriosis, patients show lower serum levels of sFas, whereas those \nwith moderate to severe disease have higher levels of sFasL in serum and \nperitoneal fluid17.\nThe reduced expression of Fas in ectopic endometrial cells, along with \nincreased FasL expression, leads to their survival and disease progression18. \nMoreover, ectopic endometrial cells induce apoptosis in Fas-expressing \nimmune cells by expressing FasL19. The pro-inflammatory environment of the \nperitoneal cavity in women affected by endometriosis may trigger FasL \nexpression by retrograde endometrial cells20. This evidence demonstrates the \nvital role of apoptosis as a key factor in endometriosis pathogenesis 2. \nTherefore, designing future studies in this context is an unmet need. \nAdditionally, the interaction between Fas and FasL on endometrial stromal \ncells (ESCs) and peritoneal fluid mononuclear cells (PFMCs) ultimately might \ndetermine apoptosis in either the mononuclear or stromal cells. To the best \nof our knowledge, no study has simultaneously examined these two cases.\nOur previous study demonstrated reduced apoptotic activity in ESCs 1. This \nfinding raises two key questions: first, whether there is a bidirectional \ndifference in Fas and FasL expression between ESCs and PFMCs within the \nperitoneal cavity that could affect their relative apoptotic capacities; and \nsecond, whether such immune dysregulation is compartment specific, \nparticularly given the advanced stage (III/IV) of the disease. We therefore \nhypothesize that bidirectional Fas/FasL expression differences exist between \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nESCs and mononuclear cells, potentially contributing to an imbalance in \napoptotic activity. The present study extends our prior findings by \nsystematically characterizing Fas/FasL expression patterns in ectopic, \neutopic, and mononuclear cell populations.\nTherefore, we aimed to determine the protein expression of Fas/FasL in the \nEESCs and eutopic endometrial stromal cells (EuESCs) of women with \nendometriosis compared to endometrial stromal cells from healthy controls \n(CESCs). Additionally, we examined the gene expression levels of Fas and \nFasL in PFMCs and peripheral blood mononuclear cells (PBMCs) from both \ngroups.\n2. Materials and Methods\n2-1. Participants\nThis case-control experimental study was conducted at Rasool Akram \nHospital in Tehran, Iran. Seventeen patients with endometriosis (stage III-IV) \nwere entered into the study. Among the studied patients, 12 had stage IV \n(70.6%) and 5 had stage III (29.4%) endometriosis. Endometriosis was first \nassessed by a clinician through laparoscopy and subsequently verified \nthrough histopathological analysis. Its stage and severity were classified \nbased on the revised criteria of the American Society for Reproductive \nMedicine (rASRM)21. Ten healthy participants were selected from individuals \nwith benign gynaecological conditions, and the same laparoscopic surgeon \nconfirmed the absence of endometriotic lesions. The control group consisted \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nof women undergoing laparoscopy for benign gynecological conditions (e.g., \nuterine fibroids, ovarian simple cysts) with no pelvic pathology. Eligible \npatients were aged 19–45 years and were in the proliferative phase of the \nmenstrual cycle. The study excluded individuals with endometrial anomalies \nand hyperplasia, irregular menstrual cycles, pelvic inflammatory disease, \nthyroid disease, nephropathy, liver disease, adenomyosis, malignancy, \nautoimmune conditions, pregnancy or lactation, those who smoked \ncigarettes, or those who had received hormones, GnRH agonist therapy, or \nimmunomodulatory therapy in the three months prior to surgery.\nThis study was confirmed by the Human Research Ethics Committee of Iran \nUniversity of Medical Sciences and signed informed consent was obtained \nfrom all participants in this research. All procedures were performed \naccording to the 1964 Helsinki Declaration and its later amendments.\n2-2. Sample Collection\nThe ectopic and eutopic endometrial samples were obtained through \nlaparoscopy and biopsy curettage, respectively. The peritoneal fluid samples \nwere collected via aspiration during the surgery. Peripheral blood samples \nwere drawn from an angiocatheter. The samples were promptly delivered to \nthe laboratory in a tissue culture medium containing antibiotics. \nSubsequently, the samples were frozen at −80 °C in Dulbecco's Modified \nEagle's Medium (DMEM)/F-12 (Gibco, USA), supplemented with 10% fetal \nbovine serum (FBS; Gibco, USA) and 20% dimethyl sulfoxide (DMSO; Sigma, \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nUSA). Liquid nitrogen was used to preserve the samples until the isolation of \nstromal cells. Endometrioma was confirmed by pathology on a sample from \neach tissue type. Stromal cells from 17 eutopic and 11 ectopic endometrial \nsamples from participants with endometriosis, as well as 10 eutopic \nendometrial samples from healthy controls, were used for stromal cell \nisolation. The EESCs group had fewer samples because not all ectopic \nsamples yielded sufficient numbers of EESCs, whereas all eutopic samples \nprovided suitable cell numbers. Additionally, peritoneal fluid and blood \nsamples from 10 participants in each group (patient and control) were \nobtained.\n2-3. Endometrial Stromal Cell (ESC) Culture\nThe detailed protocol of the study is described elsewhere1. Briefly, the tissue \nsamples were minced into small pieces and incubated with 2 mg/ml \ncollagenase A (Sigma, USA) and 300 μg/ml DNase (Roche, Germany) for 1.5 \nhours at 37°C in a 5% CO₂ atmosphere, with vortexing every 10 minutes. To \neliminate undigested tissue fragments, the cell suspension was filtered \nthrough a 100 μm mesh (Becton Dickinson Biosciences). The resulting single-\ncell suspension was then washed twice with culture medium. For thorough \npurification, the cells were seeded into T25 culture flasks for 6 hours; \nnonadherent cells were removed with two washes using warm medium, \nallowing adherent stromal cells to continue growing. The adherent ESCs \nwere cultured until reaching approximately 80-90% confluence in DMEM/F-\n12 (Gibco, USA) supplemented with 10% FBS (Gibco, USA) and 1% penicillin-\nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nstreptomycin antibiotics, maintained at 37°C in a humidified atmosphere \ncontaining 5% CO₂. As previously described, ESCs were identified and \npurified using flow cytometry and immunofluorescent staining with a specific \npanel of antibodies22.\nESCs were seeded in a 6-well plate (8 × 10 5 cells/well) in 2 ml DMEM/F-12 \n(Gibco, USA) supplemented with 10% FBS (Gibco, USA). To stimulate the \nESCs, lipopolysaccharide (LPS; 100 ng/ml; Sigma-Aldrich, Germany) was \napplied for 48 hours 23. To mimic the inflammatory microenvironment in \nendometriosis, the cells were treated with LPS24.\n2-4. Isolation and Culture of PFMCs and PBMCs\nPFMCs and PBMCs were isolated by density gradient centrifugation using \nFicoll-Hypaque (Sigma-Aldrich, St. Louis, MO, USA). Briefly, peritoneal fluid \nor peripheral blood was carefully layered over an equal volume of Ficoll-\nHypaque in a 15 mL tube and centrifuged at 400 × g for 30 minutes at room \ntemperature with the brake off. The mononuclear cell layer at the interface \nwas collected, washed twice with sterile PBS (300 × g, 10 minutes), and \nresuspended in RPMI 1640 medium supplemented with 10% FBS and 1% \npenicillin‑streptomycin.\nPFMCs and PBMCs, approximately 1 × 106 cells/ml, were cultured in 24-well \nplates in RPMI 1640 medium (Gibco, USA) supplemented with 10% FBS \n(Gibco, USA). To stimulate the cells, lipopolysaccharide (LPS; 100 ng/ml; \nSigma-Aldrich, Germany) was applied for 48 hours. Finally, the cell \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nsuspension was collected and after centrifugation at 17,000×g at 4 °C, the \nsupernatant of PFMCs was aliquoted and frozen at -80 °C until the ELISA test \nwas performed. Also, the pellet of PFMCs and PBMCs was used for gene \nexpression by RT-qPCR.\n2-5. Western Blot\nESCs were lysed with RIPA lysis buffer for total protein collection (Santa \nCruz, USA). The lysate was separated using 12% (w/v) SDS–polyacrylamide \ngel electrophoresis. Subsequently, proteins were transferred onto \nnitrocellulose membranes (Millipore, USA). The membranes were blocked \nwith skim milk and probed with dilutions of 1:3000 and 1:2000 of mouse \nmonoclonal antibodies against Fas and FasL, respectively (Abcam, USA), for \n2 hours, followed by a 1-hour incubation in a 1:15,000 dilution of horseradish \nperoxidase (HRP)-conjugated rabbit anti-mouse Ig (Sina Biotech, Iran). \nSignals were visualized using the ECL detection kit (Amersham, UK) \naccording to the manufacturer's instructions. The membranes were stripped \nand re-probed with mouse monoclonal anti-human beta-Actin antibody \n(Abcam, USA) and processed as described above.\n2-6. Total RNA Extraction, Complementary DNA (cDNA) Synthesis, \nand Quantitative Real-time Polymerase Chain Reaction (RT-qPCR)\nThe total RNA isolation was performed according to the provided protocol \nusing RNA-Bee Reagent (BioSite, Sweden). The purity and concentration of \nRNA samples were determined using a PicoDrop spectrophotometer \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\n(Picopetol, UK). One microgram of total RNA was reverse transcribed to yield \ncDNA following the specified protocol 25. The GAPDH gene was analyzed as \nthe internal control. Real-time PCR analyses were conducted using the SYBR \nGreen dye-based detection system (BIOFACT, South Korea) on the Rotor-\nGene Q (QIAGEN thermocycler with fluorescence detection, Germany). \nReactions were held at 95 °C for 15 minutes, followed by 35-45 cycles \n(dependent on the gene of interest) of 95 °C for 20 seconds and 40 seconds \nof extension at 59 °C. Subsequently, a melting curve analysis was conducted, \nand gel electrophoresis was used to verify the accuracy of the amplification \nof the PCR products. Reactions were performed independently in triplicate. \nThe primer sequences and the sizes of the amplicons are shown in Table 1.\n2-7. Enzyme-Linked Immunosorbent Assay (ELISA)\nThe concentration of sFasL molecules present in the cell culture supernatants \nof EESCs, EuESCs, CESCs, and PFMCs stimulated with LPS was measured \nusing a conventional ELISA kit (Duoset; R&D Systems, Minneapolis, MN, \nUSA), following the instructions provided by the manufacturer.\n2-8. Statistical Analysis\nAll statistical analyses were performed using GraphPad Prism software \nversion 8. The Kolmogorov–Smirnov test was used to assess the normality of \nthe distributions. To compare two independent groups, the independent t-test \nand Mann–Whitney U test were applied, depending on whether the data met \nthe normality assumption. For comparisons involving three groups, the \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nKruskal–Wallis test followed by Dunn post hoc analysis was conducted. The \nprotein expression of Fas and FasL was determined by Western blotting and \nquantified using AlphaEaseFC software. After normalizing to the GAPDH \ncontrol, mRNA expression was quantitatively analyzed using the 2 −ΔΔCt \nmethod. All data are described as mean ± standard deviation (SD). A p-value \nof less than 0.05 was deemed statistically significant.\n3. Results\n3-1. Fas Protein Expression in EESCs, EuESCs, and CESCs, and Fas \nGene Expression in PFMCs and PBMCs\nFas protein expression in the EESCs, EuESCs, and CESCs was detected using \nWestern blotting. All samples revealed distinct bands of approximately 45 \nkDa. In addition, a specific band was identified for beta-Actin at around 42 \nkDa. Ramose cell lysate was used as positive control (Fig. 1a). The results \nshowed that Fas protein expression in the EESCs or EuESCs ( p < 0.01) was \nsignificantly lower than that in CESCs (Fig. 1b). There was no significant \ndifference in Fas protein expression between the EESCs and EuESCs (Fig. \n1b).\nRT-PCR was conducted to assess the expression of the Fas gene in PFMCs \nand PBMCs from both the endometriosis and control groups. In the \nendometriosis group, Fas gene expression in the PFMCs was significantly \nhigher in comparison with control group ( p < 0.05 ; Fig. 1c). Furthermore, \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nFas gene expression in the PBMCs of the endometriosis group was \nsignificantly lower than that in the control group (p < 0.01; Fig. 1d).\n3-2. FasL Protein Expression in EESCs, EuESCs, and CESCs, and FasL \nGene Expression in PFMCs and PBMCs\nFasL protein expression in the EESCs, EuESCs, and CESCs was detected \nusing Western blotting. All samples revealed distinct bands of approximately \n40 kDa. Additionally, a specific band was identified for beta-Actin at around \n42 kDa. MCF-7 lysate was used as positive control (Fig. 2a). Results revealed \nthat FasL protein expression in the EESCs was significantly higher compared \nto both the EuESCs (p < 0.01) and CESCs (p < 0.05; Fig. 2b). There was no \nsignificant difference in FasL protein expression between the EuESCs and \nCESCs (Fig. 2b).\nThe expression of FasL gene in PFMCs and PBMCs was assessed as described \nfor Fas gene expression. Results indicated that FasL gene expression in the \nPFMCs of the endometriosis group was significantly lower compared to that \nof control group (p < 0.01; Fig. 2c), while in the PBMCs of the endometriosis \ngroup, it was higher than in control group; however, this difference was not \nstatistically significant (Fig. 2d).\n3-3. sFasL Molecules Released from EESCs, EuESCs, CESCs, and \nPFMCs\nThe concentration of sFasL molecules released by EESCs, EuESCs, and \nCESCs stimulated with LPS was measured using ELISA on their respective \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nsupernatants. The results demonstrated that the concentration of sFasL \nmolecules in the supernatant from EESCs was significantly higher compared \nto EuESCs (p < 0.01) and CESCs (p < 0.05; Fig. 3a).\nThe concentration of sFasL molecules released by PFMCs stimulated with \nLPS was also measured using ELISA. The results showed no statistically \nsignificant difference in the sFasL levels in the supernatant of PFMCs \nbetween the endometriosis group and the control group (Fig. 3b).\n4. Discussion\nTo the best of our knowledge, this is the first study to simultaneously \ninvestigate and demonstrate differences in Fas/FasL protein expression \namong EESCs, EuESCs, and CESCs, as well as differences in Fas/FasL gene \nexpression in local (PFMCs) and systemic (PBMCs) mononuclear cells from \nendometriosis patients. Fas protein expression in the EESCs was lower than \nin the CESCs. Conversely, FasL protein expression in the EESCs was higher \nthan in the CESCs. This dual dysregulation creates an environment in which \nendometriotic cells can survive and evade immune clearance. In \nendometriosis patients, Fas mRNA was higher in PFMCs but lower in PBMCs, \nwhile FasL mRNA was reduced in PFMCs compared to controls. Finally, \nelevated sFasL levels were detected from EESCs.\nReduced apoptosis susceptibility enables refluxed endometrial cells that \nsuccessfully attach to peritoneal mesothelium to proliferate, promote \nneo‑angiogenesis, and form ectopic implants, whereas cells failing to attach \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nto extracellular matrix (ECM) undergo apoptosis 26. Fas and FasL are co-\nexpressed on the endometrial tissue during the secretory phase, and higher \nFasL expression in endometrial cells during this phase compared to the \nproliferative phase enhances apoptosis in Fas-expressing cells, including \nimmune cells27.\nApoptosis plays a crucial role in maintaining endometrial tissue homeostasis \nduring the late secretory and menstrual phases of the menstrual cycle by \neliminating senescent cells from the functional layer of the uterine \nendometrium12,28. In women with endometriosis, the apoptosis process is \ndisrupted in both eutopic and ectopic endometrial cells12. Our previous study \nreported that EESCs exhibit a lower tendency for apoptosis and an increased \npropensity for angiogenesis11. The reduced apoptosis in the endometrial cells \nof women with endometriosis facilitates ectopic implantation and survival. \nFurthermore, there is an indirect association between the rate of apoptosis \nin endometrial cells and the severity of the disease29. Sbracia et al. reported \nthat in women with severe endometriosis, FasL expression was higher in \nectopic epithelial cells regardless of menstrual phase, whereas Fas \nexpression was consistently lower in ectopic versus eutopic tissue18.\nThe inflammatory environment of the peritoneal cavity in women with \nendometriosis may be a primary factor driving the higher FasL expression in \nectopic endometrial cells 20. Garcia-Velasco et al. showed that macrophage-\nderived growth factors elevated in endometriosis dose‑dependently increase \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nFasL expression in ESCs, whereas bFGF, another macrophage factor not \nelevated in endometriosis, does not have the same effect20.\nOur previous study demonstrated that the production of interleukin (IL)-6 and \nIL-8 by EESCs is higher than that in EuESCs and CESCs22. IL‑8 is elevated in \nthe peritoneal cavity of endometriosis patients and may promote ESC \nproliferation; Selam et al. further showed that IL‑8 enhances FasL \nexpression30. Additionally, the adhesion of ectopic endometrial cells to ECM \nproteins such as laminin, fibronectin, and collagen IV may also contribute to \nthe higher FasL expression observed in these cells 31. IL-8 facilitates the \nadhesion of ESCs and may act as a significant factor in the pathogenesis of \nendometriosis by increasing metalloproteinase activity in endometrial cells32. \nThe adhesion of ESCs to the ECM and the interaction between Fas and FasL \nlead to an increased expression of IL-8 33,34. Thus, elevated FasL in EuESCs \nand EESCs may indirectly promote ESC adhesion.\nOur observed aberrant Fas/FasL pattern (low Fas in EESCs/EuESCs, high \nFasL in EESCs) may affect T‑cell homeostasis, consistent with known immune \ndysregulation in endometriosis35,36. A recent study by our group revealed that \nthe levels of T helper 17 (TH17) cells and IL-17-producing cells are increased \nin the blood and tissues of patients with endometriosis, respectively35. EESCs \nexpressing high levels of FasL might induce apoptosis in infiltrating T cells, \npotentially reducing clearance of endometriotic cells, although this remains \nto be directly demonstrated. Also, in some conditions, such as multiple \nsclerosis, T H17 cells may exhibit intrinsic resistance to Fas-induced \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\napoptosis37. As a result, in a deregulated Fas/FasL environment, T H17 cells \nmay accumulate, and their IL‑17 upregulates anti‑apoptotic Bcl‑2 and \nactivates ERK1/2, enhancing endometrial cell resistance to natural killer cell-\nmediated cytotoxicity, thereby promoting lesion persistence and \nprogression38.\nSturlese et al. found no difference in the percentage of Fas‑expressing \nPFMCs, but consistent with our data, Fas mRNA was higher and FasL mRNA \nlower in PFMCs from endometriosis patients39. Also, Gogacz et al. noted that \nmacrophages constitute more than 80% of peritoneal leukocytes and express \nFas protein at high levels, leading to their apoptosis by FasL-expressing \nectopic endometrial cells 40. TNF-α leads to increased Fas expression in \nperitoneal fluid macrophages and is suggested to be produced by these \nmacrophages22,40. Meanwhile, IL-18 expression in the peritoneal fluid of \nwomen with endometriosis is lower than that in healthy controls 41. IL-18 \nplays a positive role in increasing T cell cytolytic function via upregulating \nFasL expression 42. Thus, lower IL-18 in endometriosis might reduce FasL \nexpression in PFMCs, potentially contributing to prolonged survival of \nectopic cells.\nIn inflammatory conditions, the Fas/FasL pathway is usually dysregulated 43. \nThis dysregulation may partly justify our gene expression findings in PFMCs \nand PBMCs. In the systemic circulation, where inflammation is typically low, \nFas expression was lower and FasL expression was higher in the \nendometriosis group compared to controls. This suggests that circulating \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nimmune cells (PBMCs) with higher FasL expression may induce apoptosis \nunder mild inflammatory conditions (normal). To support our explanation, a \nstudy reported that PBMCs are more effective than peritoneal macrophages \nin eliminating EuESCs and EESCs 44, which may be attributed to differences \nin FasL expression. However, in PFMCs within the peritoneal fluid—where \ninflammation is severe and these cells tend to infiltrate the endometriotic \nmicroenvironment—the balance of Fas and FasL expression is disrupted. \nSpecifically, immune cells (PFMCs) exhibit higher Fas expression and lower \nFasL expression, suggesting increased apoptosis of these immune cells. \nConsequently, endometriotic cells might evade immune-mediated apoptosis, \npotentially contributing to disease persistence. It is important to note that \nour data represent mRNA levels only. Thus, while we observed increased Fas \nmRNA in PFMCs from endometriosis patients, whether this translates into \nhigher protein expression or functional susceptibility to apoptosis in \nperitoneal PFMCs remains to be determined; conclusions regarding actual \napoptosis in the peritoneal cavity are therefore speculative at this stage.\nFasL can be converted into its soluble (sFasL) form through the action of \nmatrix metalloproteinases (MMPs), which are actively secreted by the \nendometrial tissues45,46. These enzymes appear to play a role in the invasion \nof endometrial cells into the peritoneal ECM. Also, Garcia-Velasco et al. \nreported that elevated levels of sFasL molecules were observed in the \nperitoneal fluid of women diagnosed with endometriosis 17. Mechanistically, \nsFasL released by ESCs can trigger apoptosis in immune cells that would \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\notherwise attack and remove these ectopic cells, creating an \"immune-\nprivileged\" environment for endometriotic lesions 16,18. As a result, \nendometriotic cells are better protected against T cells, contributing to the \nprolonged survival of endometrial cells in the peritoneal cavity 27. Our \nfindings indicate an elevated concentration of sFasL molecules released by \nEESCs. This might contribute to an immune‑privileged environment, but \nformal proof requires functional studies. This pattern of Fas/FasL expression \nis consistent with an immune evasion mechanism that could facilitate the \npersistence and growth of endometriotic tissue.\nOur research group has investigated apoptosis in endometriosis previously. \nInitially, we reported dysregulated expression of key apoptosis‑related \nmolecules (Bcl‑2, Bcl‑xL, Bax, and caspase‑3) in ESCs from endometriosis \npatients11. Subsequently, we performed a functional apoptosis assay using \nAnnexin V/PI double staining by flow cytometry, demonstrating that ESCs \nfrom endometriosis patients exhibit reduced apoptotic activity in comparison \nwith CESCs1. The present study extends these findings by characterizing the \nFas/FasL expression patterns that may underlie the previously observed \nfunctional differences.\nThere are some suggestions and limitations to this study. The levels of sFasL \nwere only assessed, but not sFas. Also, our conclusions regarding PFMCs and \nPBMCs are based solely on mRNA expression; protein-level confirmation is \nneeded. Moreover, evaluating Fas/FasL expression in glandular epithelial \ncells may provide additional insights. Also, assessing the overall expression \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nprofile of apoptosis-related markers could offer a more comprehensive \nunderstanding of the role of apoptosis in endometriosis pathogenesis. \nAdditionally, conducting functional assays related to the specific Fas/FasL \napoptosis pathway (e.g., using recombinant FasL, anti-FasL antibodies, sFas, \nor sFasL neutralization in mononuclear cell-ESCs co-culture model) is \nrecommended.\n5. Conclusion\nThis study revealed a lower protein expression of Fas in the EuESCs. Also, \nthe increased protein expression of FasL in the EESCs, along with the \nelevated levels of sFasL molecules released by these cells—as demonstrated \nin the current study—highlights the potential role of these cells in eliminating \nimmune cells. Lastly, the lower expression of FasL in the PFMCs might \nsuggest a reduced function of these cells in eliminating EESCs in women with \nendometriosis. Therefore, the Fas/FasL pathway is a key player in \nendometriosis pathogenesis.\nAbbreviations: CESCs: Control endometrial stromal cells; ECM: \nExtracellular matrix; EESCs: Ectopic endometrial stromal cells; ESCs: \nEndometrial stromal cells; EuESCs: Eutopic endometrial stromal cells; FADD: \nFas-associated death domain; FasL: Fas ligand; PBMCs: Peripheral blood \nmononuclear cells; PFMCs: Peritoneal fluid mononuclear cells; RT-PCR: Real-\ntime polymerase chain reaction; sFasL: Soluble Fas ligand; T H17: T helper \n17; TNF: Tumor necrosis factor.\nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nData availability: The datasets generated during and/or analysed during the \ncurrent study are available from the corresponding author on reasonable \nrequest.\nAcknowledgements: We appreciate all the participants in the present study.\nFunding: This study was funded by Iran University of Medical Sciences with \nthe grant number 94-04-30-27007.\nContributions: TM: Conceptualization, Investigation, Data curation, Formal \nanalysis, Validation, Writing—review & editing. SKH: Sample collection and \npreparation. MN: Writing—original draft, Writing—review & editing. PF: \nWriting—original draft, Writing—review & editing, Data curation, Formal \nanalysis. KS: Investigation. AAD: Conceptualization, Methodology, \nInvestigation, Data curation, Formal analysis, Writing—review & editing, \nFunding acquisition, Supervision, Validation. All authors read and approved \nthe final version of the manuscript.\nConsent to participate and consent to publish: The study protocol was \napproved by the Ethics Committee of Medical Research of Iran University of \nMedical Sciences and all participants signed written informed consent before \nparticipating in the study. All methods were carried out in accordance with \nrelevant guidelines and regulations.\nConsent for publication: Not applicable.\nCompeting interests: The authors declare no competing interests.\nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nDeclaration of AI-assisted technologies in the writing process: While \npreparing this work, the author(s) used DeepSeek to refine the writing and \nimprove the manuscript's clarity. After using this tool/service, the author(s) \nreviewed and edited the content as needed and take full responsibility for the \ncontent of the published article.\nReferences:\n1. Rashidi, N., Arefi, S., Sadri, M. & Delbandi, A.-A. Effect of active vitamin \nD on proliferation, cell cycle and apoptosis in endometriotic stromal \ncells. Reprod. Biomed. Online 46, 436–445 (2022).\n2. Farhangnia, P., Noormohammadi, M. & Delbandi, A.-A. Vitamin D and \nreproductive disorders: a comprehensive review with a focus on \nendometriosis. Reprod. Health 21, 61 (2024).\n3. Delbandi, A.-A., Mahmoudi, M., Shervin, A. & Zarnani, A.-H. 1,25-\nDihydroxy Vitamin D3 Modulates Endometriosis-Related Features of \nHuman Endometriotic Stromal Cells. Am. J. Reprod. Immunol. 75, 461–\n473 (2016).\n4. Mohagheghian Yaghoubi, H. et al. Immunomodulatory effects of vitamin \nD3 on gene expression of MDGF, EGF and PDGFB in endometriosis. \nReprod. Biomed. Online 41, 782–789 (2020).\n5. Heidari, S., Kolahdouz-Mohammadi, R., Khodaverdi, S., Mohammadi, T. & \nDelbandi, A.-A. Changes in MCP-1, HGF, and IGF-1 expression in \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nendometrial stromal cells, PBMCs, and PFMCs of endometriotic \nwomen following 1,25(OH)2D3 treatment. J. Cell. Mol. Med. 26, 5634–\n5646 (2022).\n6. Rowlands, I. J., Mishra, G. D. & Abbott, J. A. Global Epidemiological Data \non Endometriosis BT - Endometriosis and Adenomyosis: Global \nPerspectives Across the Lifespan. in Endometriosis and Adenomyosis \n(ed. Oral, E.) 15–28 (Springer International Publishing, Cham, 2022). \ndoi:10.1007/978-3-030-97236-3_2.\n7. Moradi, Y. et al. A systematic review on the prevalence of endometriosis \nin women. Indian J. Med. Res. 154, 446–454 (2021).\n8. Zondervan, K. T., Becker, C. M. & Missmer, S. A. Endometriosis. N. Engl. \nJ. Med. 382, 1244–1256 (2020).\n9. Lamceva, J., Uljanovs, R. & Strumfa, I. The Main Theories on the \nPathogenesis of Endometriosis. Int. J. Mol. Sci. 24, 4254 (2023).\n10. Taniguchi, F. et al. Apoptosis and endometriosis. Front. Biosci. (Elite \nEd). 3, 648–662 (2011).\n11. Delbandi, A.-A. et al. Evaluation of apoptosis and angiogenesis in ectopic \nand eutopic stromal cells of patients with endometriosis compared to \nnon-endometriotic controls. BMC Womens. Health 20, 3 (2020).\n12. Harada, T. et al. Apoptosis and endometriosis. Front. Biosci. 12, 3140–\n3151 (2007).\nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\n13. Guégan, J. P. et al. CD95/Fas and metastatic disease: What does not kill \nyou makes you stronger. Semin. Cancer Biol. 60, 121–131 (2020).\n14. Yamada, A., Arakaki, R., Saito, M., Kudo, Y. & Ishimaru, N. Dual Role of \nFas/FasL-Mediated Signal in Peripheral Immune Tolerance. Front. \nImmunol. 8, 403 (2017).\n15. Tummers, B. & Green, D. R. Caspase-8: regulating life and death. \nImmunol. Rev. 277, 76–89 (2017).\n16. Nasu, K., Yuge, A., Tsuno, A., Nishida, M. & Narahara, H. Involvement \nof resistance to apoptosis in the pathogenesis of endometriosis. Histol. \nHistopathol. 24, 1181–1192 (2009).\n17. Garcia-Velasco, J. A., Mulayim, N., Kayisli, U. A. & Arici, A. Elevated \nsoluble Fas ligand levels may suggest a role for apoptosis in women \nwith endometriosis. Fertil. Steril. 78, 855–859 (2002).\n18. Sbracia, M. et al. Fas and Fas-Ligand in Eutopic and Ectopic \nEndometrium of Women With Endometriosis: The Possible Immune \nPrivilege of Ectopic Endometrium. Reprod. Sci. 23, 81–86 (2016).\n19. Riccio, L. da G. C. et al. Immunology of endometriosis. Best Pract. Res. \nClin. Obstet. Gynaecol. 50, 39–49 (2018).\n20. Garcia-Velasco, J. A., Arici, A., Zreik, T., Naftolin, F. & Mor, G. \nMacrophage derived growth factors modulate Fas ligand expression in \ncultured endometrial stromal cells: a role in endometriosis. Mol. Hum. \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nReprod. 5, 642–650 (1999).\n21. Medicine, A. S. for R. Revised American Society for Reproductive \nMedicine classification of endometriosis: 1996. Fertil. Steril. 67, 817–\n821 (1997).\n22. Delbandi, A.-A. et al. Eutopic and ectopic stromal cells from patients \nwith endometriosis exhibit differential invasive, adhesive, and \nproliferative behavior. Fertil. Steril. 100, 761–769 (2013).\n23. Liu, L. et al. Berberine inhibits the LPS‑induced proliferation and \ninflammatory response of stromal cells of adenomyosis tissues \nmediated by the LPS/TLR4 signaling pathway. Exp Ther Med 14, \n6125–6130 (2017).\n24. Khan, K. N. et al. 17β-estradiol and lipopolysaccharide additively \npromote pelvic inflammation and growth of endometriosis. Reprod. \nSci. 22, 585–594 (2015).\n25. Heidari, S., Kolahdouz-Mohammadi, R., Khodaverdi, S., Tajik, N. & \nDelbandi, A.-A. Expression levels of MCP-1, HGF, and IGF-1 in \nendometriotic patients compared with non-endometriotic controls. \nBMC Womens. Health 21, 422 (2021).\n26. Agic, A., Djalali, S., Diedrich, K. & Hornung, D. Apoptosis in \nendometriosis. Gynecol. Obstet. Invest. 68, 217–223 (2009).\n27. Harada, T. et al. Apoptosis in human endometrium and endometriosis. \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nHum. Reprod. Update 10, 29–38 (2004).\n28. Huang, E., Wang, X. & Chen, L. Regulated Cell Death in Endometriosis. \nBiomolecules vol. 14 at https://doi.org/10.3390/biom14020142 (2024).\n29. Dmowski, W. P. et al. Apoptosis in endometrial glandular and stromal \ncells in women with and without endometriosis. Hum. Reprod. 16, \n1802–1808 (2001).\n30. Selam, B., Kayisli, U. A., Garcia-Velasco, J. A., Akbas, G. E. & Arici, A. \nRegulation of fas ligand expression by IL-8 in human endometrium. J. \nClin. Endocrinol. Metab. 87, 3921–3927 (2002).\n31. Selam, B., Kayisli, U. A., Garcia-Velasco, J. A. & Arici, A. Extracellular \nmatrix-dependent regulation of Fas ligand expression in human \nendometrial stromal cells. Biol. Reprod. 66, 1–5 (2002).\n32. Sikora, J., Smycz-Kubańska, M., Mielczarek-Palacz, A. & Kondera-Anasz, \nZ. Abnormal peritoneal regulation of chemokine activation-The role of \nIL-8 in pathogenesis of endometriosis. Am. J. Reprod. Immunol. 77, \n(2017).\n33. Garcia-Velasco, J. A. & Arici, A. Interleukin-8 expression in endometrial \nstromal cells is regulated by integrin-dependent cell adhesion. Mol. \nHum. Reprod. 5, 1135–1140 (1999).\n34. Abreu-Martin, M. T., Vidrich, A., Lynch, D. H. & Targan, S. R. Divergent \ninduction of apoptosis and IL-8 secretion in HT-29 cells in response to \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nTNF-alpha and ligation of Fas antigen. J. Immunol. 155, 4147–4154 \n(1995).\n35. Delbandi, A.-A. et al. Increased circulating T helper 17 (TH17) cells and \nendometrial tissue IL-17-producing cells in patients with endometriosis \ncompared with non-endometriotic subjects. Reprod. Biol. 25, 101019 \n(2025).\n36. Delbandi, A.-A. et al. Higher frequency of circulating, but not tissue \nregulatory T cells in patients with endometriosis. J. Reprod. Immunol. \n139, 103119 (2020).\n37. Volpe, E., Sambucci, M., Battistini, L. & Borsellino, G. Fas–Fas Ligand: \nCheckpoint of T Cell Functions in Multiple Sclerosis. Front. Immunol. \n7, 382 (2016).\n38. Kang, Y.-J. et al. IL-17A and Th17 Cells Contribute to Endometrial Cell \nSurvival by Inhibiting Apoptosis and NK Cell Mediated Cytotoxicity of \nEndometrial Cells via ERK1/2 Pathway. Immune Netw. 23, e14 (2023).\n39. Sturlese, E. et al. Dysregulation of the Fas/FasL system in mononuclear \ncells recovered from peritoneal fluid of women with endometriosis. J. \nReprod. Immunol. 92, 74–81 (2011).\n40. Gogacz, M. et al. Fas-Related Apoptosis of Peritoneal Fluid \nMacrophages in Endometriosis Patients: Understanding the Disease. J. \nImmunol. Res. 2017, 3175394 (2017).\nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\n41. Zhang, X., Lin, J., Qian, Y. & Deng, L. Decreased levels of interleukin-18 \nin peritoneal fluid but not in serum of patients with endometriosis. \nFertil. Steril. 81, 1229–1234 (2004).\n42. Shan, J., Ding, J., Li, D.-J. & Wang, X.-Q. The double-edged role of IL-18 \nin reproductive endocrine and reproductive immune related disorders. \nInt. Immunopharmacol. 147, 113859 (2025).\n43. Sica, M., Roussel, M. & Legembre, P. CD95/Fas stoichiometry in future \nprecision medicine. Cell Death Differ. 32, 1570–1577 (2025).\n44. Braun, D. P., Gebel, H., Rana, N. & Dmowski, W. P. Cytolysis of eutopic \nand ectopic endometrial cells by peripheral blood monocytes and \nperitoneal macrophages in women with endometriosis. Fertil. Steril. \n69, 1103–1108 (1998).\n45. Arablou, T. et al. The effects of resveratrol on the expression of VEGF, \nTGF-β, and MMP-9 in endometrial stromal cells of women with \nendometriosis. Sci. Rep. 11, 6054 (2021).\n46. Muharam, R. et al. Elevated MMP-9, Survivin, TGB1 and Downregulated \nTissue Inhibitor of TIMP-1, Caspase-3 Activities are Independent of the \nLow Levels miR-183 in Endometriosis. Int. J. Womens. Health 16, \n1733–1742 (2024).\nTables:\nTable 1. The Fas, FasL, and GAPDH primers sequences.\nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nSequence Name Sequence 5' to 3'\nAmplicon Size \n(bp)\nFas-Sense TGACCCTTGCACCAAATGTGA\nFas-Anti-sense AAGACAAAGCCACCCCAAGT\n109 bp\nFasL-Sense ATGGTTCTGGTTGCCTTGGT\nFasL-Anti-sense GCATCTGGCTGGTAGACTCTC\n100 bp\nGAPDH-Sense GCACCGTCAAGGCTGAGAAC\nGAPDH-Anti-sense TGGTGAAGACGCCAGTGGA\n138 bp\nbp: Base pair; FasL: Fas ligand; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.\nFigures and Legends:\nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nFigure 1. Evaluation of Fas protein expression in endometrial tissues, as well as Fas \ngene expression in peritoneal fluid mononuclear cells (PFMCs) and peripheral blood \nmononuclear cells (PBMCs), in both the endometriosis and control groups. (a) \nRepresentative results of Western blot analysis of Fas expression in ectopic, eutopic, and \ncontrol endometrial tissues. Ramose cell lysate was used as positive control. (b) \nDensitometry analysis of Western blot for Fas expression in endometrial tissues of study \ngroups. (c, d) The basal gene expression of Fas was measured in PFMCs (n = 10) and PBMCs \n(n = 10) from patients with endometriosis compared to PFMCs (n = 10) and PBMCs (n = 10) \nfrom non-endometriotic women (control). Data are presented as mean ± SD. EESCs: Ectopic \nendometrial stromal cells; EuESCs: Eutopic endometrial stromal cells; CESCs: Control \nendometrial stromal cells. *p < 0.05, **p < 0.01.\nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nFigure 2. Evaluation of FasL protein expression in endometrial tissues, as well as \nFasL gene expression in peritoneal fluid mononuclear cells (PFMCs) and peripheral \nblood mononuclear cells (PBMCs), in both the endometriosis and control groups. \n(a) Representative results of Western blot analysis of FasL expression in ectopic, eutopic, \nand control endometrial tissues. MCF-7 lysate was used as positive control. (b) Densitometry \nanalysis of Western blot for FasL expression in endometrial tissues of study groups. (c, d) \nThe basal gene expression of FasL was measured in PFMCs (n = 10) and PBMCs (n = 10) \nfrom patients with endometriosis compared to PFMCs (n = 10) and PBMCs (n = 10) from \nnon-endometriotic women (control). Data are presented as mean ± SD. EESCs: Ectopic \nendometrial stromal cells; EuESCs: Eutopic endometrial stromal cells; CESCs: Control \nendometrial stromal cells. *p < 0.05, **p < 0.01.\nFigure 3. Evaluation of soluble Fas ligand (sFasL) levels in the supernatants from \nendometrial stromal cells and peritoneal fluid mononuclear cells (PFMCs) in both \nthe endometriosis and control groups. (a) The concentration (pg/ml) of sFasL molecules \nreleased from ectopic endometrial stromal cells (EESCs), eutopic endometrial stromal cells \n(EuESCs), and control endometrial stromal cells (CESCs). (b) The concentration (pg/ml) of \nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nsFasL molecules released from PFMCs in the endometriosis and control groups. Data are \npresented as mean ± SD. *p < 0.05, **p < 0.01.\nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS\n\nACCEPTED MANUSCRIPT\nARTICLE IN PRESSARTICLE IN PRESS","source_license":"CC0","license_restricted":false}