{"paper_id":"3a2f893c-1af8-4a1f-aa0e-d43188fa5378","body_text":"The up-regulated expression level of deubiquitinating enzyme USP46 induces the apoptosis of A549 cells by TRAF6 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The up-regulated expression level of deubiquitinating enzyme USP46 induces the apoptosis of A549 cells by TRAF6 Xuan Zhao, Yanan Li, Dandan Gu, Xiaoru Wang, Guangxin Han, Yasen Yao, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5366056/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 23 Apr, 2025 Read the published version in Investigational New Drugs → Version 1 posted 7 You are reading this latest preprint version Abstract This study investigates the function of Ubiquitin-specific protease 46 (USP46), a deubiquitinase, in the context of lung cancer, particularly its role in regulating cell proliferation via the ubiquitination of TRAF6. In A549 lung cancer cells, analysis revealed a significant downregulation of USP46 expression, while TRAF6 levels were notably elevated. These findings were corroborated by Western blotting, which confirmed the altered expression patterns. To further assess the implications of these changes, several experimental assays, including the Cell Counting Kit-8, transwell migration assays, and flow cytometry, were conducted to evaluate cell viability and apoptosis rates. Co-immunoprecipitation experiments demonstrated a direct interaction between USP46 and TRAF6, implicating USP46 in the modulation of TRAF6 ubiquitination, a process that is fundamental to tumor physiology. The results indicated that decreased USP46 expression led to an increase in the levels of the anti-apoptotic protein Bcl-2, while there was a corresponding decrease in key pro-apoptotic proteins such as caspase-3, caspase-9, and Bax. Additionally, the study found elevated levels of phosphorylated AKT and mTOR, which suggest the activation of survival signaling pathways in the cancer cells. These findings collectively suggest that the up-regulated USP46 promotes apoptosis in lung cancer cells through the regulation of TRAF6. Therefore, targeting the USP46/TRAF6 signaling pathway presents a promising therapeutic strategy for lung cancer treatment, potentially offering new avenues for intervention in cancer progression and cell survival mechanisms. USP46 Apoptosis TRAF6 A549 Deubiquitinating enzyme Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction In the past few years, the incidence rate and mortality of cancer have been among the highest among malignant tumors worldwide [1]. At present, there are many mature cancer treatment methods, but the specific treatment effects are still unsatisfactory [2]. Tumor necrosis factor receptor-associated factor 6 (TRAF6) is a vital node protein downstream of inflammatory stimulation signals, such as TNF-α and IL-1β, and participates in the regulation of tumor inflammatory response and tumor progression. Compared with other anti-tumor targets, TRAF6 is a typical RING domain E3 ubiquitin ligase which is highly expressed in multiple tumor cells, such as esophageal squamous cell carcinoma, lung cancer, colon cancer, breast cancer, glioma, and malignant osteosarcoma [3]. The activation of TRAF6 can induce the activation of TAK1 and AKT and activate the downstream NF-κB, p38MAPK, mTOR, STAT3, and AP-1 signaling pathways, which exert a synergistic effect in regulating cell proliferation and apoptosis in multiple ways [4–6]. As a RING domain-containing E3 ubiquitin ligase, TRAF6 can catalyze K63-linked polyubiquitination in conjunction with the Ubc13-Uev1A complex, and inhibition of TRAF6 ubiquitination has been confirmed to significantly down-regulates the proliferation of tumor cells [7, 8]. Various types of deubiquitinating enzymes (DUBs) can block the ubiquitination of their corresponding proteins [9]. Among the deubiquitinating enzymes, USPs have the most members and the most diverse structures. Studies have found that various USPs can exert anti-tumor effects in tumor cells [10, 11]. In our previous studies, ubiquitin-specific peptidase 46 (USP46), a critical molecule that binds TRAF6 in A549 cells, was identified by mass spectrometry. USP46 contains highly conserved binding domains: Cys, Asp, and His, consistent with the characteristics of ubiquitin-specific proteases. Like other USPs members, USP46 plays a crucial role in the proliferation and metastasis of various cancer cells [12–14]. Therefore, the influence of USP46 on tumors has attracted increasing interest. Previous researches have shown that decreased USP46 expression in renal and colon cancer cells can inhibit cell proliferation [10, 15, 16]. Despite growing evidence that USP46 plays a crucial role in a variety of human tumors, the specific biological functions of USP46 in lung cancer remain unknown. The objective of this study was to investigate the interaction between USP46 and TRAF6 in A549 cells and to demonstrate the molecular mechanism by which USP46 downregulation significantly inhibits A549 cell proliferation. This may provide a new direction for targeted anti-tumor research. Materials and methods Reagents Fetal bovine serum (FBS) and ECL detection reagent were purchased from Thermo FisherScientifc (USA). Cell Counting Kit‑8 (CCK‑8, #C0037) was purchased from Beyotime (China). Antibodies against TRAF6 (cat. no. #8028s), AKT (cat. no. #4691), phosphorylation-AKT (cat. no. #4060), mTOR (cat. no. #2983), phosphorylation-mTOR (cat. no.#5536), ubiquitin (1:1000), Caspase-9 (cat. no.7237), Caspase-3 (cat. no.14220,), Bax (cat. no. #41162), Bcl-2 (cat. no. #15071), GADPH (cat. no.5174) were purchased from Cell Signaling Technology (CST, USA). Antibodies against USP46 (ab88795) was purchased from Abcam (UK). Apoptosis Detection Kit was purchased from Becton-Dickinson, USA. MG132 reagent was provided by Sigma, USA. Cell culture All human lung cancer cell lines (A549, HCC827, Calu-1, and DMS53) and human normal cell line (LL24) were purchased from Shanghai Institute of Cell Biology, China. The cells were cultured in RPMI‑1640 supplemented with 10% FBS. All the cells were maintained in a humidified atmosphere containing 5% CO2 at 37 ˚C. Cell transfection Sangon Biotech (Shanghai) Co., Ltd. designed and synthesized the si‑USP46 (5'‑TGATGGTTGGTCTCTAATA‑3') and si‑TRAF6 (5'‑ TTCTCCGAACGTGTCACGTTTC‑3'), or over‑expression (OE)‑USP46 (His-USP46) and OE‑TRAF6 plasmids, as well as si‑NC (GCAAGCTGACCCTGAAGTT) or OE‑NC (empty plasmid). When the cells reached 80% confluence, the plasmids were transfected into cells using Lipofectamine® Max (Thermo Fisher Scientific, Inc.). Cell Counting Kit‑8 (CCK‑8) assay Cells (0.8×10 4 cells/well) which were transfected with His-USP46 and His-vector were inoculated into 96‑well plates and incubated for 48 h. Then, 10 µl of CCK‑8 reagent was added, and cells were incubated for 2 h in the incubator. The microplate reader (Infinite® M1000 Pro, Tecan) was used to measure the absorbance at 450 nm. The data were carried out from three independent experiments. Flow cytometric analysis Cells transfected with His-USP46 and His-vector were plated in a 6-well plate with a density of 1.5×10 5 cells/ml for 48 h at 37˚C. The cells were collected and washed with ice-cold phosphate-buffered saline (PBS). Subsequently, the cells were resuspended in 1×binding buffer and then stained with 5 µL Annexin V and 5 µL propidium iodide at RT for 30 min in the dark. The results were immediately determined using a FACSCalibur flow cytometer (BD Biosciences) in three independent experiments. In vitro migration assays Cells (4×10 5 ) were inoculated into the upper chamber with serum-free medium, and RPMI-1640 containing 15% FBS was added to the lower chamber. After incubating the chamber at 37˚C for 48 h, cells were fixed with 10% formalin. Then, 0.1% crystal violet solution was used to stain the cells in the lower chamber, the cells in five random fields were randomly chosen and the migrate cells were quantified using ImageJ software. Co-immunoprecipitation Transfected cells were incubated for 24 h and then exposed to MG132 (15 mM) treatment for 4 h prior to harvesting. Total protein was collected and incubated with primary antibody (1:1000) for 4–6 h. Protein A beads were added and incubated over nigh at 4 ˚C in a rotary incubator. The mixture was then centrifuged and immunoprecipitated. Finally, the immunoprecipitates were resuspended for western blot analysis. Western blotting Proteins were collected and lysed in RIPA buffer containing 50 mM HEPES (pH 7.4), 150 mM NaCl, and 1% NP-40. Proteins were separated by 12% SDS-PAGE and then transferred onto polyvinylidene fluoride (PVDF) membranes. After blocking with 5% skim milk solution for 1 h at room temperature, the PVDF membranes were incubated with primary antibodies overnight at 4 ˚C. The PVDF membranes were incubated with secondary HRP‑conjugated antibodies for 1 h at RT after washing with TBST three times. Finally, an ECL detection reagent was used to investigate protein expression. The density of the blots was determined using ImageJ (version 1.8.0; National Institutes of Health). Statistical analysis All analyses were analyzed using GraphPad Prism version 9.0 software (USA). Statistical analyses between two groups were conducted using the Student's t-test. One‑way ANOVA with Tukey's post-hoc test was adopted to analyze the statistical differences between multiple groups. Data were expressed as means ± standard deviation (SD). Statistical significance was set at P < 0.05. Results USP46 restrains proliferation, migration, and early apoptosis of A549 cells significantly. USP46 is a widespread deubiquitinating enzyme expressed in various human cells. The research findings confirmed that the expression level of USP46 was remarkably lower in lung cancer cells than normal pneumonocytes (Fig. 1 A). These results indicated that USP46 may be a potential target gene for anti-cancer. Therefore, the USP46 overexpression plasmid (His-USP46) was transfected into A549 cells (Fig. 1 B), and the CCK-8 assay revealed that USP46 overexpression restrained the proliferation capacity (Fig. 1 C). Next, examined whether USP46 influences the migration of A549 cells. As shown in Fig. 1 D and 1 E, the migration of A549 cells was significantly suppressed, and after treating cells with His-USP46 plasmid, the early apoptosis rate was remarkably increased compared with the His‑vector transfected cells and untransfected cells (Fig. 1 F and 1 G). The relationship between USP46 and TRAF6. Based on previous mass spectrometry experiments, the interaction between USP46 and TRAF6 was confirmed. As we all know, TRAF6 is overexpressed in various cancer cells. As shown in Fig. 2 A and 2 B, the expression level of TRAF6 was increased compared to that in normal pneumonocytes. Hence, a co-immunoprecipitation assay was conducted to explore the mechanism of the mutual combination of USP46 and TRAF6. Exogenous USP46 and TRAF6 plasmids were transfected into the cells. The lysates were immunoprecipitated using different antibodies. From Fig. 2 C and 2 D, the interaction between TRAF6 and USP46 was confirmed. These results speculated that USP46 interacts with TRAF6 and affects downstream signal transduction in lung cancer A549 cells. Influence of USP46 on the expression level of TRAF6. The expression level of TRAF6 was probed after transfection of the USP46 plasmid into the A549 cells. Previous findings have certificated that TRAF6 can be polyubiquitinated and degraded by USP46. As shown in the Fig. 3 A, USP46 restrained the ubiquitination standard of TRAF6. In addition, after exposure to cycloheximide (CHX), degradation of TRAF6 protein was checked and measured in USP46 overexpressing cells. As shown in Fig. 3 B, the increasing expression of USP46 suppressed the degeneration of TRAF6 protein in A549 cells. USP46 sensitized the activity of Bcl‑2/caspase‑3 signaling pathway and deactivated AKT. To explore the signaling pathway of USP46 regulating cell proliferation and apoptosis, western blotting was used to analyze the expression levels of caspase‑3, caspase‑9, Bcl‑2, and Bax following the transfection of cells with si‑USP46 or OE‑USP46 (over expression USP46) plasmids. Compared to the si-NC transfection group, the expression level of Bcl-2 was increased, while the expression levels of caspase-3, caspase-9, and Bax were decreased. (Fig. 4A). In contrast, the expression levels of Bcl‑2 were enhanced while the expression levels of caspase‑3, caspase‑9, and Bax were reduced compared to those in the OE-USP46 transfection (Fig. 4C). Additionally, the impact of USP46 on apoptosis and AKT signaling pathway activity was probably mediated by TRAF6. Thus, the downregulation of TRAF6 leads to an increase in si‑USP46‑induced p‑AKT and downstream p‑mTOR levels (Fig. 4B). Instead, transfection with OE‑TRAF6 resulted in OE‑USP46‑induced repression of p‑AKT and p‑mTOR expression levels (Fig. 4D). Figure 4. Effects of USP46 on apoptosis and the AKT/mTOR signaling pathway were regulated by TRAF6. (A) The expression levels of Bcl-2, Bax, Caspase-3, and Caspase-9 in A549 cells were transfected with si-NC, siUSP46 and siUSP46 accompany with siTRAF6. (B) Protein expression levels of p-mTOR, mTOR, p-AKT, and AKT in A549 cells transfected with SiUSP46 plasmid with or without SiTRAF6 plasmid. (C) The expression levels of Bcl-2, Bax, Caspase-3, and Caspase-9 in A549 cells were transfected with OE-NC, OEUSP46 and OEUSP46 accompany with OETRAF6. (D) Protein expression levels of p-mTOR, mTOR, p-AKT, and AKT in A549 cells transfected with OEUSP46 plasmid with or without OETRAF6 plasmid. *P < 0.05. Discussion As a deubiquitinase, USP46 is expressed in various cells [17]. However, no information is available to confirm the molecular mechanism of USP46 in A549 cells. Western blot analysis, revealed that USP46 expression was lower in lung cancer cells than in normal pneumonocytes (Fig. 1 A). In addition, after over-expression plasmid (His-USP46) was transfected, the proliferation and migration of cells were notably downregulated while early apoptosis was increased (Fig. 1 B- 1 G). These outcomes suggested that the expression of USP46 might conduct an important role in the physiological activity of cells and may be a potential anticancer target. TRAF6 has a C-terminal TRAF domain and an N-terminal excitation domain, which can act as a ubiquitin ligase and combine with the ubiquitin conjugase to promote polyubiquitination of the downstream protein [18–20]. It could interact with the tumor necrosis factor receptor (TNFR) superfamily and interleukin-1 (IL-1)/Toll-like receptor superfamily members directly or indirectly [21]. Meanwhile, TRAF6 can interact with transcription factors such as the NF-κB, AP-1, JNK/p38, and PI3K/AKT pathways, which could participate in cell production, proliferation, and apoptosis [22, 23]. Some researchers have found that blocking the binding of TRAF6 to Ubc13 using small molecular compounds can effectively down-regulate the ubiquitination of TRAF6 and inhibit the proliferation of tumor cells [7, 24]. As we all know, many types of deubiquitinating enzymes can block the ubiquitination of the corresponding protein [9]. USP46 is the most active deubiquitinating enzyme that interacts with TRAF6. Hence, we explored how USP46 regulates proliferation, migration, and apoptosis via TRAF6. TRAF6 is a member of the tumor necrosis factor receptor-associated factor family and is present in various biological cells. Many experiments have shown that TRAF6 is overexpressed in almost all reported tumor cell lines and regulates the malignant behavior of tumor cells [25, 26]. From the result of Fig. 2 A and 2 B, the expression of TRAF6 in lung cancer cells were significantly increased. To confirm the interaction between USP46 and TRAF6 in A549 cells, USP46 and TRAF6 plasmids were transfected into A549 cells. Reciprocal co-IP assays with overexpressed His-USP46 and Flag-TRAF6 further corroborated the direct interaction between them (Fig. 2 C and 2 D). These results suggested that USP46 might act on TRAF6 and influence the proliferation and migration of A549 cells. Indeed, several researches have suggested that inhibition of TRAF6 ubiquitination in tumor cells significantly downregulates tumor cell proliferation and migration [27]. In the present research, co-IP assays confirmed that USP46 overexpression inhibited TRAF6 ubiquitination (Fig. 3 A), implying that USP46 plays an important role in A549 cells by regulating TRAF6. Besides, USP46 has been shown to inhibit cancer by primarly down-regulating the AKT pathway [10, 15]. In the present research, USP46 was found to suppress the ubiquitination of TRAF6 and stabilize its expression of TRAF6 (Fig. 3 B), which further broadens the application of USP46 in cancer research. Bcl-2 participates in the inherent apoptosis pathway by inhibiting the oligomerization of Bax, thereby promoting cell proliferation and growth [28]. Bax induces mitochondrial outer membrane permeability, activates caspase family members, and is involved in apoptotic signal transduction [29, 30]. The results of this experiment indicated that USP46 knockdown upregulated the expression of Bcl-2 and downregulated the expression of Bax, Caspase-3, and Caspase-9. On the other hand, USP46 overexpression triggered opposing effects on the expression levels of apoptosis‑related factors. The findings indicated that USP46 might regulate the proliferation of A549 cells through the Bcl‑2/Bax/Caspase‑9/Caspase-3 signaling pathway. Inhibition of TRAF6 ubiquitination can induce cell apoptosis by regulating various tumor-related signaling pathways [31–33]. As we all know, the PI3K/AKT/mTOR signaling pathway is crucial for cell proliferation and apoptosis by regulating the downstream signaling pathways [34]. The present research suggested that the phosphorylation of AKT and mTOR were induced by downregulation of USP46 expression. Instead, USP46 overexpression restrained the phosphorylation levels of AKT and mTOR (Fig. 4C and 4D). These results speculated that the proliferation, apoptosis, and migration of A549 cells were influenced by AKT/mTOR phosphorylation, thereby regulating the Bcl‑2/Bax/Caspase‑9/Caspase-3 signaling pathway, and finally regulating the proliferation and apoptosis of lung cancer. Conclusions In conclusion, the combination of USP46 and TRAF6 reduced the polyubiquitination of TRAF6, stabilized TRAF6 and caused USP46 to affect cell proliferation and apoptosis by regulating the Bcl‑2/caspase‑3 signaling pathway and phosphorylation levels of AKT/ mTOR in A549 cells. Thus, the results suggested that USP46 may be a potential target for the treatment of lung cancer. Declarations Author contributions Xuan Zhao, and Yonghao Qi conceived and designed the study. Yanan Li, Dandan Gu, Xiaoru Wang, Guangxin Han and Yasen Yao analyzed the data and draw the figures. Limei Ren, Yanan Li, and Dandan Gu drafted the manuscript. Yonghao Qi, Qingguo Yao and Xiaobing Li Zhang revised the manuscript. All authors reviewed and approved the submitted version of the manuscript. Funding This study was financially supported by the Natural Science Foundation of Hebei Province (No. H2022106006) and the Shijiazhuang Science and Technology Research and Development Program (No. 211200973). Data availability No datasets were generated or analysed during the current study. Ethical approval Since the study is based on public data, the informed consent and ethical proof are not required. Consent for publication All authors gave their consent for publication Competing interests The authors declare no competing interests. References Hirsch FR, Scagliotti GV, Mulshine JL et al (2021) Lung cancer: current therapies and new targeted treatments. Lancet 389(10066): 299-311. https://doi.org/10.1016/S0140-6736(16)30958-8 Cheng Y, Mo F, Li Q et al (2021) Targeting CXCR2 inhibits the progression of lung cancer and promotes therapeutic effect of cisplatin. Mol Cancer 20(1): 62. http://doi.org/ 10.1186/s12943-021-01355-1 Zucchelli S, Codrich M, Marcuzzi F et al (2010) TRAF6 promotes atypical ubiquitination of mutant DJ-1 and alpha-synuclein and is localized to Lewy bodies in sporadic Parkinson's disease brains. Hum Mol Genet 19(19): 3759-3770. https://doi.org/ 10.1093/hmg/ddq290 Oaa A, Smi A, Hhsb C, Kandil EA (2020) Antiulcerogenic effect of melittin via mitigating TLR4/TRAF6 mediated NF-κB and p38MAPK pathways in acetic acid-induced ulcerative colitis in mice. Chem Biol Interact 331: 109276. https://doi.org/10.1016/j.cbi.2020.109276 Oduro PK, Zheng X, Wei J et al (2022) The cGAS-STING signaling in cardiovascular and metabolic diseases: Future novel target option for pharmacotherapy. Acta Pharm Sin B 12(1): 50-75. https://doi.org/ 10.1016/j.apsb.2021.05.011 Kim SH, Baek SI, Jung J et al (2022) Chemical inhibition of TRAF6-TAK1 axis as therapeutic strategy of endotoxin-induced liver disease. Biomed Pharmacother 155: 113688. https://doi.org/ 10.1016/j.biopha.2022.113688 Qi YH, Zhao X, Chen JY et al (2018) In vitro and in vivo cancer cell apoptosis triggered by competitive binding of Cinchona alkaloids to the RING domain of TRAF6. Biosci Biotechnol Biochem 83(6): 1011-1026. https://doi.org/ 10.1080/09168451.2018.1559030 Zhao X, Ren L, Wang X et al (2022) Benzoyl-xanthone derivative induces apoptosis in MCF-7 cells by binding TRAF6. Exp Ther Med 23(2): 181. https://doi.org/ 10.3892/etm.2021.11104 Park HB, Baek KH (2022) E3 ligases and deubiquitinating enzymes regulating the MAPK signaling pathway in cancers. Biochim Biophys Acta Rev Cancer 1877(3): 188736. https://doi.org/10.1016/j.bbcan.2022.188736 Gui D, Peng W, Jiang W et al (2019) Ubiquitinspecific peptidase 46 (USP46) suppresses renal cell carcinoma tumorigenesis through AKT pathway inactivation. Biochem Biophys Res Commun 519(4): 689-696. https://doi.org/ 0.1016/j.bbrc.2019.09.036 Kiran S, Dar A, Singh SK et al (2018) The deubiquitinase USP46 is essential for proliferation and tumor growth of HPV-transformed cancers. Mol Cell 72(5): 823-835. https://doi.org/ 10.1016/j.molcel.2018.09.019 Qiu Y, Huang D, Sheng Y et al (2021) Deubiquitinating enzyme USP46 suppresses the progression of hepatocellular carcinoma by stabilizing MST1. Exp Cell Res 405(1): 112646. https://doi.org/ 10.1016/j.yexcr.2021.112646 Tian M, Zhu R, Ding F (2020) Ubiquitin-specific peptidase 46 promotes tumor metastasis through stabilizing ENO1 in human esophageal squamous cell carcinoma. Exp Cell Res 395(1): 112188. https://doi.org/ 10.1016/j.yexcr.2020.112188 Xu L, Zhang B, Li W (2021) Downregulated expression levels of USP46 promote the resistance of ovarian cancer to cisplatin and are regulated by PUM2. Mol Med Rep 23(4): 263. https://doi.org/ 10.3892/mmr.2021.11902 Li X, Stevens PD, Yang H et al (2013) The deubiquitination enzyme USP46 functions as a tumor suppressor by controlling PHLPP-dependent attenuation of Akt signaling in colon cancer. Oncogene 32(4): 471-478. https://doi.org/ 10.1038/onc.2012.66 Wang W, Chen M, Xu H et al (2020) USP46 inhibits cell proliferation in lung cancer through PHLPP1/AKT pathway. Biomed Res Int 2020: 2509529. https://doi.org/ 10.1155/2020/2509529 Ohashi M, Holthaus AM, Calderwood MA et al (2015) The EBNA3 family of Epstein-Barr virus nuclear proteins associates with the USP46/USP12 deubiquitination complexes to regulate lymphoblastoid cell line growth. PLoS Pathog 11(4): e1004822. https://doi.org/ 10.1371/journal.ppat.1004822 Brenke JK, Popowicz GM, Schorpp K et al (2018) Targeting TRAF6 E3 ligase activity with a small-molecule inhibitor combats autoimmunity. J Biol Chem 293(34): 13191-13203. https://doi.org/ 10.1074/jbc.RA118.002649 Ni X, Kou W, Gu J et al (2019) TRAF6 directs FOXP3 localization and facilitates regulatory T-cell function through K63-linked ubiquitination. EMBO J 38(9): 213-231. https://doi.org/ 10.15252/embj.201899766. Wu Y, Wu W, Lin L et al (2018) Bortezomib enhances radiosensitivity in oral cancer through inducing autophagy mediated TRAF6 oncoprotein degradation. J Exp Clin Cancer Res 37(1): 91-104. https://doi.org/ 10.1186/s13046-018-0760-0 Zhu S, Jin J, Gokhale S et al (2018) Affiliations expand. Genetic alterations of TRAF proteins in human cancers. Front Immunol 9: 2111. https://doi.org/ 10.3389/fimmu.2018.02111 Hamidi A, Song J, Thakur N et al (2017) TGF-beta promotes PI3K-AKT signaling and prostate cancer cell migration through the TRAF6-mediated ubiquitylation of p85α. Sci Signal 10(486): eaal4186. https://doi.org/ 10.1126/scisignal.aal4186 Yang WL, Wang J, Chan CH et al (2009) The E3 ligase TRAF6 regulates AKT ubiquitination and activation. Science 325(5499): 1134-1138. https://doi.org/ 10.1126/science.1175065 Qi YH, Pradipta AR, Li M et al (2017) Cinchonine induces apoptosis of HeLa and A549 cells through targeting TRAF6. J Exp Clin Cancer Res 36(1): 35. https://doi.org/ 10.1186/s13046-017-0502-8 He H, Liu J, Li L et al (2021) Helicobacter pylori CagA interacts with SHP-1 to suppress the immune response by targeting TRAF6 for K63-linked ubiquitination. J Immunol 206(6): 1161-1170. https://doi.org/ 10.4049/jimmunol.2000234 Guo Y, Zhang X, Zeng W et al (2021) TRAF6 activates fibroblasts to cancer-associated fibroblasts through FGF19 in tumor microenvironment to benefit the malignant phenotype of melanoma cells. J Invest Dermatol 140(11): 2268-2279. https://doi.org/ 10.1016/j.jid.2020.03.950 Zhu G, Cheng Z, Lin C et al (2020) The effects of TRAF6 on growth and progression in colorectal cancer are regulated by miRNA-140. Onco Targets Ther 13: 11991-12001. https://doi.org/ 10.2147/OTT.S257733 Li Z, Qu L, Zhong H et al (2014) Low expression of Mig‑6 is associated with poor survival outcome in NSCLC and inhibits cell apoptosis via ERK‑mediated upregulation of Bcl‑2. Oncol Rep 31(4): 1707-1714. https://doi.org/ 10.3892/or.2014.3050. Feng X, Liu N, Deng S et al (2017) miR‑199a modulates cisplatin resistance in ovarian cancer by targeting Hif1α. Onco Targets Ther 10: 5899‑5906. https://doi.org/ 10.2147/OTT.S145833 Zhang R, Shi H, Ren F et al (2016) Knockdown of MACC1 expression increases cisplatin sensitivity in cisplatin‑resistant epithelial ovarian cancer cells. Oncol Rep 35(4): 2466‑2472. https://doi.org/ 10.3892/or.2016.4585 Ding JN, Zang YF, Ding YL (2021) MiRNA-146b-5p inhibits the malignant progression of gastric cancer by targeting TRAF6. Eur Rev Med Pharmacol Sci 25(8): 3151. https://doi.org/ 10.26355/eurrev_202104_25718 Huang H, Li X, Yu L et al (2021) Wogonoside inhibits TNF receptor-associated factor 6 (TRAF6) mediated-tumor microenvironment and prognosis of pancreatic cancer. Ann Transl Med 9(18): 1460. https://doi.org/ 10.21037/atm-21-4164 Wang J, Dong Y, Wei Z et al (2023) Deubiquitinase OTUB2 promotes intrahepatic cholangiocarcinoma progression by stabilizing the CTNNB1-ZEB1 axis. Exp Cell Res 425(1): 113537. https://doi.org/ 10.1016/j.yexcr.2023.113537 Xie J, Lin W, Huang L et al (2018) Bufalin suppresses the proliferation and metastasis of renal cell carcinoma by inhibiting the PI3K/AKT/mTOR signaling pathway. Oncol Lett 16(3): 3867‑373. https://doi.org/ 10.3892/ol.2018.9111 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 23 Apr, 2025 Read the published version in Investigational New Drugs → Version 1 posted Editorial decision: Revision requested 11 Mar, 2025 Reviews received at journal 11 Mar, 2025 Reviewers agreed at journal 16 Feb, 2025 Reviewers invited by journal 05 Nov, 2024 Editor assigned by journal 05 Nov, 2024 Submission checks completed at journal 05 Nov, 2024 First submitted to journal 31 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-5366056\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":377204000,\"identity\":\"6f666314-292c-4206-85a4-a8c3f23bbb3e\",\"order_by\":0,\"name\":\"Xuan Zhao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Bioengineering, School of Chemical Engineering, Shijiazhuang University, Shijiazhuang, Hebei, China, 050035\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xuan\",\"middleName\":\"\",\"lastName\":\"Zhao\",\"suffix\":\"\"},{\"id\":377204001,\"identity\":\"8ecd6951-1c76-44dd-a990-50ee5dbade66\",\"order_by\":1,\"name\":\"Yanan Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Neurosurgery, Second Hospital of Hebei Medical University, Shijiazhuang, Hebei, China, 050000\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yanan\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":377204002,\"identity\":\"b58e3f27-0372-4bdb-9bd8-1e7bced697f0\",\"order_by\":2,\"name\":\"Dandan Gu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Bioengineering, School of Chemical Engineering, Shijiazhuang University, Shijiazhuang, Hebei, China, 050035\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dandan\",\"middleName\":\"\",\"lastName\":\"Gu\",\"suffix\":\"\"},{\"id\":377204004,\"identity\":\"46fd44f0-33aa-4a3e-86a7-c9975f59b989\",\"order_by\":3,\"name\":\"Xiaoru Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Bioengineering, School of Chemical Engineering, Shijiazhuang University, Shijiazhuang, Hebei, China, 050035\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaoru\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":377204006,\"identity\":\"9f4affab-d1cc-4e22-851f-16eea05021d0\",\"order_by\":4,\"name\":\"Guangxin Han\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Bioengineering, School of Chemical Engineering, Shijiazhuang University, Shijiazhuang, Hebei, China, 050035\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Guangxin\",\"middleName\":\"\",\"lastName\":\"Han\",\"suffix\":\"\"},{\"id\":377204008,\"identity\":\"f9abab30-9d1f-435c-83ef-1a49d317f3d5\",\"order_by\":5,\"name\":\"Yasen Yao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Bioengineering, School of Chemical Engineering, Shijiazhuang University, Shijiazhuang, Hebei, China, 050035\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yasen\",\"middleName\":\"\",\"lastName\":\"Yao\",\"suffix\":\"\"},{\"id\":377204010,\"identity\":\"150070f0-f845-4d4d-b617-fdd361c354ac\",\"order_by\":6,\"name\":\"Limei Ren\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Bioengineering, School of Chemical Engineering, Shijiazhuang University, Shijiazhuang, Hebei, China, 050035\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Limei\",\"middleName\":\"\",\"lastName\":\"Ren\",\"suffix\":\"\"},{\"id\":377204012,\"identity\":\"12648302-2469-4b98-838f-723680ec781e\",\"order_by\":7,\"name\":\"Qingguo Yao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Bioengineering, School of Chemical Engineering, Shijiazhuang University, Shijiazhuang, Hebei, China, 050035\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qingguo\",\"middleName\":\"\",\"lastName\":\"Yao\",\"suffix\":\"\"},{\"id\":377204014,\"identity\":\"5f603678-1d9d-4d34-899b-9726e9c158a1\",\"order_by\":8,\"name\":\"Xiaobing Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Bioengineering, School of Chemical Engineering, Shijiazhuang University, Shijiazhuang, Hebei, China, 050035\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaobing\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":377204015,\"identity\":\"053e11c2-3176-48d2-8add-79d3c75ae0e3\",\"order_by\":9,\"name\":\"Yonghao Qi\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7klEQVRIiWNgGAWjYDACZjB5AMhgbDjwoUJCTp54LezMBx/OOGNhbNhAnF1ALfxsyca8bRWJIDZewHecx/Bxwa878vzMPGbSvPMkEhgbmB8+uoFHi+RhHmPjmX3PDGc285hJzt0mkcfOwGZsnINHi8FhkOE9hxk3ABkSb7dJFDM28LBJE6PFHqyFd45EYsMBYrTw/DicuOEwW7IhbwMRWiQPsxUb8zYcTp7ZDArkYxLGhs0E/MJ3/vDGxzx/Dtv28x8ERmVNnZw8e/PDx/i0MBzgMGBgbEMWYcanHKyF/QEDwx9CqkbBKBgFo2BEAwBu4U78lFCvTQAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Department of Bioengineering, School of Chemical Engineering, Shijiazhuang University, Shijiazhuang, Hebei, China, 050035\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Yonghao\",\"middleName\":\"\",\"lastName\":\"Qi\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-10-31 08:38:26\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-5366056/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-5366056/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1007/s10637-025-01532-9\",\"type\":\"published\",\"date\":\"2025-04-23T15:57:18+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":69244885,\"identity\":\"96ab5931-fab3-4e58-8846-e218ac540805\",\"added_by\":\"auto\",\"created_at\":\"2024-11-18 10:54:11\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":298198,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eUSP46 restrains the proliferation and growth of A549 cells. (A) Western blot analysis of USP46 expression in normal pneumonocyte and lung cancer cell lines. (B) Western blot analyses were performed to explore the expression level of USP46 in A549 cells after transfected with His-USP46. (C) The cell viability of A549 cells post‑transfection with His‑USP46 or His‑vector plasmid was detected using a CCK‑8 assay. (D) and (E) Transwell migration assays of A549 cells transfected with His‑USP46 or His‑vector. *P \\u0026lt; 0.05, **P \\u0026lt; 0.01. (F) and (G) The apoptotic rate was analyzed following the transfected with His‑USP46 or His‑vector in treating with A549 cells. *P \\u0026lt; 0.05, **P \\u0026lt; 0.01.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5366056/v1/3b76096428c7ff80b9855461.png\"},{\"id\":69244887,\"identity\":\"88a576d1-19fc-4a77-8803-4b47fd0194af\",\"added_by\":\"auto\",\"created_at\":\"2024-11-18 10:54:13\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":174436,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe interaction between USP46 and TRAF6. (A) and (B) Western blot analysis of TRAF6 expression in normal pneumonocyte and lung cancer cell lines. (C) and (D) A549 cells were transfected with His-USP46 and Flag-TRAF6 in the indicated combinations. Immunoprecipitation was carried out to explore the interaction between USP46 and TRAF6.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5366056/v1/154ce1923e591044bec46194.png\"},{\"id\":69244888,\"identity\":\"eba3ed35-9f9e-43e1-9ede-037945391dc5\",\"added_by\":\"auto\",\"created_at\":\"2024-11-18 10:54:13\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":203392,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eUSP46 inhibited the ubiquitination of TRAF6 and stabilized the expression of TRAF6. (A) Overexpression of USP46 affected the ubiquitination of TRAF6. Cells in each group were treated with the proteasomal inhibitor MG132. Cell lysates were collected and subjected to immunoprecipitation with the anti-TRAF6 antibody. The levels of ubiquitin-conjugated TRAF6 were detected by Western blot. (B) Western blot revealed that USP46 overexpression suppresses the degeneration of TRAF6 protein in A549 cells. Cells were treated with cycloheximide (CHX, 100 mg/mL) and subjected to Western blot analysis. *P \\u0026lt; 0.05.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5366056/v1/96516296b2bc7fa4f270ff40.png\"},{\"id\":69244879,\"identity\":\"4ca4f4a4-b0e2-44c6-a0c6-e4b7c78fdea9\",\"added_by\":\"auto\",\"created_at\":\"2024-11-18 10:54:09\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":247672,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffects of USP46 on apoptosis and the AKT/mTOR signaling pathway were regulated by TRAF6. (A) The expression levels of Bcl‑2, Bax, Caspase‑3, and Caspase‑9 in A549 cells were transfected with si-NC, si‑USP46 and si‑USP46 accompany with si‑TRAF6. (B) Protein expression levels of p-mTOR, mTOR, p-AKT, and AKT in A549 cells transfected with Si‑USP46 plasmid with or without Si‑TRAF6 plasmid. (C) The expression levels of Bcl‑2, Bax, Caspase‑3, and Caspase‑9 in A549 cells were transfected with OE-NC, OE‑USP46 and OE‑USP46 accompany with OE‑TRAF6. (D) Protein expression levels of p-mTOR, mTOR, p-AKT, and AKT in A549 cells transfected with OE‑USP46 plasmid with or without OE‑TRAF6 plasmid. *P\\u0026lt;0.05.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5366056/v1/e75fa0c1dac658007597c0e8.png\"},{\"id\":81569815,\"identity\":\"20eed362-c3df-4578-85b8-8bb10ee277b1\",\"added_by\":\"auto\",\"created_at\":\"2025-04-28 16:11:32\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1577086,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5366056/v1/96f7c11b-19ba-40a9-83c1-0b588ef69d61.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"The up-regulated expression level of deubiquitinating enzyme USP46 induces the apoptosis of A549 cells by TRAF6\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eIn the past few years, the incidence rate and mortality of cancer have been among the highest among malignant tumors worldwide [1]. At present, there are many mature cancer treatment methods, but the specific treatment effects are still unsatisfactory [2].\\u003c/p\\u003e \\u003cp\\u003eTumor necrosis factor receptor-associated factor 6 (TRAF6) is a vital node protein downstream of inflammatory stimulation signals, such as TNF-α and IL-1β, and participates in the regulation of tumor inflammatory response and tumor progression. Compared with other anti-tumor targets, TRAF6 is a typical RING domain E3 ubiquitin ligase which is highly expressed in multiple tumor cells, such as esophageal squamous cell carcinoma, lung cancer, colon cancer, breast cancer, glioma, and malignant osteosarcoma [3]. The activation of TRAF6 can induce the activation of TAK1 and AKT and activate the downstream NF-κB, p38MAPK, mTOR, STAT3, and AP-1 signaling pathways, which exert a synergistic effect in regulating cell proliferation and apoptosis in multiple ways [4\\u0026ndash;6]. As a RING domain-containing E3 ubiquitin ligase, TRAF6 can catalyze K63-linked polyubiquitination in conjunction with the Ubc13-Uev1A complex, and inhibition of TRAF6 ubiquitination has been confirmed to significantly down-regulates the proliferation of tumor cells [7, 8].\\u003c/p\\u003e \\u003cp\\u003eVarious types of deubiquitinating enzymes (DUBs) can block the ubiquitination of their corresponding proteins [9]. Among the deubiquitinating enzymes, USPs have the most members and the most diverse structures. Studies have found that various USPs can exert anti-tumor effects in tumor cells [10, 11]. In our previous studies, ubiquitin-specific peptidase 46 (USP46), a critical molecule that binds TRAF6 in A549 cells, was identified by mass spectrometry. USP46 contains highly conserved binding domains: Cys, Asp, and His, consistent with the characteristics of ubiquitin-specific proteases. Like other USPs members, USP46 plays a crucial role in the proliferation and metastasis of various cancer cells [12\\u0026ndash;14]. Therefore, the influence of USP46 on tumors has attracted increasing interest. Previous researches have shown that decreased USP46 expression in renal and colon cancer cells can inhibit cell proliferation [10, 15, 16]. Despite growing evidence that USP46 plays a crucial role in a variety of human tumors, the specific biological functions of USP46 in lung cancer remain unknown.\\u003c/p\\u003e \\u003cp\\u003eThe objective of this study was to investigate the interaction between USP46 and TRAF6 in A549 cells and to demonstrate the molecular mechanism by which USP46 downregulation significantly inhibits A549 cell proliferation. This may provide a new direction for targeted anti-tumor research.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eReagents\\u003c/h2\\u003e \\u003cp\\u003eFetal bovine serum (FBS) and ECL detection reagent were purchased from Thermo FisherScientifc (USA). Cell Counting Kit‑8 (CCK‑8, #C0037) was purchased from Beyotime (China). Antibodies against TRAF6 (cat. no. #8028s), AKT (cat. no. #4691), phosphorylation-AKT (cat. no. #4060), mTOR (cat. no. #2983), phosphorylation-mTOR (cat. no.#5536), ubiquitin (1:1000), Caspase-9 (cat. no.7237), Caspase-3 (cat. no.14220,), Bax (cat. no. #41162), Bcl-2 (cat. no. #15071), GADPH (cat. no.5174) were purchased from Cell Signaling Technology (CST, USA). Antibodies against USP46 (ab88795) was purchased from Abcam (UK). Apoptosis Detection Kit was purchased from Becton-Dickinson, USA. MG132 reagent was provided by Sigma, USA.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eCell culture\\u003c/h3\\u003e\\n\\u003cp\\u003eAll human lung cancer cell lines (A549, HCC827, Calu-1, and DMS53) and human normal cell line (LL24) were purchased from Shanghai Institute of Cell Biology, China. The cells were cultured in RPMI‑1640 supplemented with 10% FBS. All the cells were maintained in a humidified atmosphere containing 5% CO2 at 37 ˚C.\\u003c/p\\u003e\\n\\u003ch3\\u003eCell transfection\\u003c/h3\\u003e\\n\\u003cp\\u003eSangon Biotech (Shanghai) Co., Ltd. designed and synthesized the si‑USP46 (5'‑TGATGGTTGGTCTCTAATA‑3') and si‑TRAF6 (5'‑ TTCTCCGAACGTGTCACGTTTC‑3'), or over‑expression (OE)‑USP46 (His-USP46) and OE‑TRAF6 plasmids, as well as si‑NC (GCAAGCTGACCCTGAAGTT) or OE‑NC (empty plasmid). When the cells reached 80% confluence, the plasmids were transfected into cells using Lipofectamine\\u0026reg; Max (Thermo Fisher Scientific, Inc.).\\u003c/p\\u003e\\n\\u003ch3\\u003eCell Counting Kit‑8 (CCK‑8) assay\\u003c/h3\\u003e\\n\\u003cp\\u003eCells (0.8\\u0026times;10\\u003csup\\u003e4\\u003c/sup\\u003e cells/well) which were transfected with His-USP46 and His-vector were inoculated into 96‑well plates and incubated for 48 h. Then, 10 \\u0026micro;l of CCK‑8 reagent was added, and cells were incubated for 2 h in the incubator. The microplate reader (Infinite\\u0026reg; M1000 Pro, Tecan) was used to measure the absorbance at 450 nm. The data were carried out from three independent experiments.\\u003c/p\\u003e\\n\\u003ch3\\u003eFlow cytometric analysis\\u003c/h3\\u003e\\n\\u003cp\\u003eCells transfected with His-USP46 and His-vector were plated in a 6-well plate with a density of 1.5\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e cells/ml for 48 h at 37˚C. The cells were collected and washed with ice-cold phosphate-buffered saline (PBS). Subsequently, the cells were resuspended in 1\\u0026times;binding buffer and then stained with 5 \\u0026micro;L Annexin V and 5 \\u0026micro;L propidium iodide at RT for 30 min in the dark. The results were immediately determined using a FACSCalibur flow cytometer (BD Biosciences) in three independent experiments.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eIn vitro migration assays\\u003c/h2\\u003e \\u003cp\\u003eCells (4\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e) were inoculated into the upper chamber with serum-free medium, and RPMI-1640 containing 15% FBS was added to the lower chamber. After incubating the chamber at 37˚C for 48 h, cells were fixed with 10% formalin. Then, 0.1% crystal violet solution was used to stain the cells in the lower chamber, the cells in five random fields were randomly chosen and the migrate cells were quantified using ImageJ software.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eCo-immunoprecipitation\\u003c/h3\\u003e\\n\\u003cp\\u003eTransfected cells were incubated for 24 h and then exposed to MG132 (15 mM) treatment for 4 h prior to harvesting. Total protein was collected and incubated with primary antibody (1:1000) for 4\\u0026ndash;6 h. Protein A beads were added and incubated over nigh at 4 ˚C in a rotary incubator. The mixture was then centrifuged and immunoprecipitated. Finally, the immunoprecipitates were resuspended for western blot analysis.\\u003c/p\\u003e\\n\\u003ch3\\u003eWestern blotting\\u003c/h3\\u003e\\n\\u003cp\\u003eProteins were collected and lysed in RIPA buffer containing 50 mM HEPES (pH 7.4), 150 mM NaCl, and 1% NP-40. Proteins were separated by 12% SDS-PAGE and then transferred onto polyvinylidene fluoride (PVDF) membranes. After blocking with 5% skim milk solution for 1 h at room temperature, the PVDF membranes were incubated with primary antibodies overnight at 4 ˚C. The PVDF membranes were incubated with secondary HRP‑conjugated antibodies for 1 h at RT after washing with TBST three times. Finally, an ECL detection reagent was used to investigate protein expression. The density of the blots was determined using ImageJ (version 1.8.0; National Institutes of Health).\\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eAll analyses were analyzed using GraphPad Prism version 9.0 software (USA). Statistical analyses between two groups were conducted using the Student's t-test. One‑way ANOVA with Tukey's post-hoc test was adopted to analyze the statistical differences between multiple groups. Data were expressed as means\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation (SD). Statistical significance was set at P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003eUSP46 restrains proliferation, migration, and early apoptosis of A549 cells significantly.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eUSP46 is a widespread deubiquitinating enzyme expressed in various human cells. The research findings confirmed that the expression level of USP46 was remarkably lower in lung cancer cells than normal pneumonocytes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). These results indicated that USP46 may be a potential target gene for anti-cancer. Therefore, the USP46 overexpression plasmid (His-USP46) was transfected into A549 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB), and the CCK-8 assay revealed that USP46 overexpression restrained the proliferation capacity (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). Next, examined whether USP46 influences the migration of A549 cells. As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD and \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eE, the migration of A549 cells was significantly suppressed, and after treating cells with His-USP46 plasmid, the early apoptosis rate was remarkably increased compared with the His‑vector transfected cells and untransfected cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eF and \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eG).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eThe relationship between USP46 and TRAF6.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eBased on previous mass spectrometry experiments, the interaction between USP46 and TRAF6 was confirmed. As we all know, TRAF6 is overexpressed in various cancer cells. As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB, the expression level of TRAF6 was increased compared to that in normal pneumonocytes. Hence, a co-immunoprecipitation assay was conducted to explore the mechanism of the mutual combination of USP46 and TRAF6. Exogenous USP46 and TRAF6 plasmids were transfected into the cells. The lysates were immunoprecipitated using different antibodies. From Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD, the interaction between TRAF6 and USP46 was confirmed. These results speculated that USP46 interacts with TRAF6 and affects downstream signal transduction in lung cancer A549 cells.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eInfluence of USP46 on the expression level of TRAF6.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe expression level of TRAF6 was probed after transfection of the USP46 plasmid into the A549 cells. Previous findings have certificated that TRAF6 can be polyubiquitinated and degraded by USP46. As shown in the Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA, USP46 restrained the ubiquitination standard of TRAF6. In addition, after exposure to cycloheximide (CHX), degradation of TRAF6 protein was checked and measured in USP46 overexpressing cells. As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB, the increasing expression of USP46 suppressed the degeneration of TRAF6 protein in A549 cells.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eUSP46 sensitized the activity of Bcl‑2/caspase‑3 signaling pathway and deactivated AKT.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eTo explore the signaling pathway of USP46 regulating cell proliferation and apoptosis, western blotting was used to analyze the expression levels of caspase‑3, caspase‑9, Bcl‑2, and Bax following the transfection of cells with si‑USP46 or OE‑USP46 (over expression USP46) plasmids. Compared to the si-NC transfection group, the expression level of Bcl-2 was increased, while the expression levels of caspase-3, caspase-9, and Bax were decreased. (Fig.\\u0026nbsp;4A). In contrast, the expression levels of Bcl‑2 were enhanced while the expression levels of caspase‑3, caspase‑9, and Bax were reduced compared to those in the OE-USP46 transfection (Fig.\\u0026nbsp;4C). Additionally, the impact of USP46 on apoptosis and AKT signaling pathway activity was probably mediated by TRAF6. Thus, the downregulation of TRAF6 leads to an increase in si‑USP46‑induced p‑AKT and downstream p‑mTOR levels (Fig.\\u0026nbsp;4B). Instead, transfection with OE‑TRAF6 resulted in OE‑USP46‑induced repression of\\u003c/p\\u003e \\u003cp\\u003e p‑AKT and p‑mTOR expression levels (Fig.\\u0026nbsp;4D).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eFigure 4.\\u003c/b\\u003e Effects of USP46 on apoptosis and the AKT/mTOR signaling pathway were regulated by TRAF6. (A) The expression levels of Bcl-2, Bax, Caspase-3, and Caspase-9 in A549 cells were transfected with si-NC, siUSP46 and siUSP46 accompany with siTRAF6. (B) Protein expression levels of p-mTOR, mTOR, p-AKT, and AKT in A549 cells transfected with SiUSP46 plasmid with or without SiTRAF6 plasmid. (C) The expression levels of Bcl-2, Bax, Caspase-3, and Caspase-9 in A549 cells were transfected with OE-NC, OEUSP46 and OEUSP46 accompany with OETRAF6. (D) Protein expression levels of p-mTOR, mTOR, p-AKT, and AKT in A549 cells transfected with OEUSP46 plasmid with or without OETRAF6 plasmid. *P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eAs a deubiquitinase, USP46 is expressed in various cells [17]. However, no information is available to confirm the molecular mechanism of USP46 in A549 cells.\\u003c/p\\u003e \\u003cp\\u003eWestern blot analysis, revealed that USP46 expression was lower in lung cancer cells than in normal pneumonocytes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). In addition, after over-expression plasmid (His-USP46) was transfected, the proliferation and migration of cells were notably downregulated while early apoptosis was increased (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB-\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eG). These outcomes suggested that the expression of USP46 might conduct an important role in the physiological activity of cells and may be a potential anticancer target.\\u003c/p\\u003e \\u003cp\\u003eTRAF6 has a C-terminal TRAF domain and an N-terminal excitation domain, which can act as a ubiquitin ligase and combine with the ubiquitin conjugase to promote polyubiquitination of the downstream protein [18\\u0026ndash;20]. It could interact with the tumor necrosis factor receptor (TNFR) superfamily and interleukin-1 (IL-1)/Toll-like receptor superfamily members directly or indirectly [21]. Meanwhile, TRAF6 can interact with transcription factors such as the NF-κB, AP-1, JNK/p38, and PI3K/AKT pathways, which could participate in cell production, proliferation, and apoptosis [22, 23]. Some researchers have found that blocking the binding of TRAF6 to Ubc13 using small molecular compounds can effectively down-regulate the ubiquitination of TRAF6 and inhibit the proliferation of tumor cells [7, 24]. As we all know, many types of deubiquitinating enzymes can block the ubiquitination of the corresponding protein [9]. USP46 is the most active deubiquitinating enzyme that interacts with TRAF6. Hence, we explored how USP46 regulates proliferation, migration, and apoptosis via TRAF6.\\u003c/p\\u003e \\u003cp\\u003eTRAF6 is a member of the tumor necrosis factor receptor-associated factor family and is present in various biological cells. Many experiments have shown that TRAF6 is overexpressed in almost all reported tumor cell lines and regulates the malignant behavior of tumor cells [25, 26]. From the result of Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB, the expression of TRAF6 in lung cancer cells were significantly increased. To confirm the interaction between USP46 and TRAF6 in A549 cells, USP46 and TRAF6 plasmids were transfected into A549 cells. Reciprocal co-IP assays with overexpressed His-USP46 and Flag-TRAF6 further corroborated the direct interaction between them (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD). These results suggested that USP46 might act on TRAF6 and influence the proliferation and migration of A549 cells. Indeed, several researches have suggested that inhibition of TRAF6 ubiquitination in tumor cells significantly downregulates tumor cell proliferation and migration [27]. In the present research, co-IP assays confirmed that USP46 overexpression inhibited TRAF6 ubiquitination (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA), implying that USP46 plays an important role in A549 cells by regulating TRAF6. Besides, USP46 has been shown to inhibit cancer by primarly down-regulating the AKT pathway [10, 15]. In the present research, USP46 was found to suppress the ubiquitination of TRAF6 and stabilize its expression of TRAF6 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB), which further broadens the application of USP46 in cancer research.\\u003c/p\\u003e \\u003cp\\u003eBcl-2 participates in the inherent apoptosis pathway by inhibiting the oligomerization of Bax, thereby promoting cell proliferation and growth [28]. Bax induces mitochondrial outer membrane permeability, activates caspase family members, and is involved in apoptotic signal transduction [29, 30]. The results of this experiment indicated that USP46 knockdown upregulated the expression of Bcl-2 and downregulated the expression of Bax, Caspase-3, and Caspase-9. On the other hand, USP46 overexpression triggered opposing effects on the expression levels of apoptosis‑related factors. The findings indicated that USP46 might regulate the proliferation of A549 cells through the Bcl‑2/Bax/Caspase‑9/Caspase-3 signaling pathway.\\u003c/p\\u003e \\u003cp\\u003eInhibition of TRAF6 ubiquitination can induce cell apoptosis by regulating various tumor-related signaling pathways [31\\u0026ndash;33]. As we all know, the PI3K/AKT/mTOR signaling pathway is crucial for cell proliferation and apoptosis by regulating the downstream signaling pathways [34]. The present research suggested that the phosphorylation of AKT and mTOR were induced by downregulation of USP46 expression. Instead, USP46 overexpression restrained the phosphorylation levels of AKT and mTOR (Fig.\\u0026nbsp;4C and 4D). These results speculated that the proliferation, apoptosis, and migration of A549 cells were influenced by AKT/mTOR phosphorylation, thereby regulating the Bcl‑2/Bax/Caspase‑9/Caspase-3 signaling pathway, and finally regulating the proliferation and apoptosis of lung cancer.\\u003c/p\\u003e\"},{\"header\":\"Conclusions\",\"content\":\"\\u003cp\\u003eIn conclusion, the combination of USP46 and TRAF6 reduced the polyubiquitination of TRAF6, stabilized TRAF6 and caused USP46 to affect cell proliferation and apoptosis by regulating the Bcl‑2/caspase‑3 signaling pathway and phosphorylation levels of AKT/ mTOR in A549 cells. Thus, the results suggested that USP46 may be a potential target for the treatment of lung cancer.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eXuan Zhao, and\\u0026nbsp;Yonghao Qi\\u0026nbsp;conceived and designed the study.\\u0026nbsp;Yanan Li, Dandan Gu,\\u0026nbsp;Xiaoru Wang,\\u0026nbsp;Guangxin Han\\u0026nbsp;and\\u0026nbsp;Yasen Yao\\u0026nbsp;analyzed the data and draw the figures.\\u0026nbsp;Limei Ren,\\u0026nbsp;Yanan Li, and Dandan Gu drafted the manuscript.\\u0026nbsp;Yonghao Qi,\\u0026nbsp;Qingguo Yao\\u0026nbsp;and\\u0026nbsp;Xiaobing Li\\u0026nbsp;Zhang revised the manuscript. All authors reviewed and approved the submitted version of the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e\\u0026nbsp;\\u003c/sup\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study was financially supported by the Natural Science Foundation of Hebei Province (No. H2022106006) and the Shijiazhuang Science and Technology Research and Development Program (No. 211200973).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNo datasets were generated or analysed during the current study.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthical approval \\u0026nbsp;\\u003c/strong\\u003eSince the study is based on public data, the informed consent and ethical proof are not required.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication \\u0026nbsp;\\u003c/strong\\u003eAll authors gave their consent for publication\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests \\u0026nbsp;\\u003c/strong\\u003eThe authors declare no competing interests.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eHirsch FR, Scagliotti GV, Mulshine JL et al (2021) Lung cancer: current therapies and new targeted treatments. Lancet 389(10066): 299-311. https://doi.org/10.1016/S0140-6736(16)30958-8\\u003c/li\\u003e\\n\\u003cli\\u003eCheng Y, Mo F, Li Q et al (2021) Targeting CXCR2 inhibits the progression of lung cancer and promotes therapeutic effect of cisplatin. Mol Cancer 20(1): 62. http://doi.org/ 10.1186/s12943-021-01355-1\\u003c/li\\u003e\\n\\u003cli\\u003eZucchelli S, Codrich M, Marcuzzi F et al (2010) TRAF6 promotes atypical ubiquitination of mutant DJ-1 and alpha-synuclein and is localized to Lewy bodies in sporadic Parkinson\\u0026apos;s disease brains. Hum Mol Genet 19(19): 3759-3770. https://doi.org/ 10.1093/hmg/ddq290\\u003c/li\\u003e\\n\\u003cli\\u003eOaa A, Smi A, Hhsb C, Kandil EA (2020) Antiulcerogenic effect of melittin via mitigating TLR4/TRAF6 mediated NF-\\u0026kappa;B and p38MAPK pathways in acetic acid-induced ulcerative colitis in mice. Chem Biol Interact 331: 109276. https://doi.org/10.1016/j.cbi.2020.109276\\u003c/li\\u003e\\n\\u003cli\\u003eOduro PK, Zheng X, Wei J et al (2022) The cGAS-STING signaling in cardiovascular and metabolic diseases: Future novel target option for pharmacotherapy. Acta Pharm Sin B 12(1): 50-75. https://doi.org/ 10.1016/j.apsb.2021.05.011\\u003c/li\\u003e\\n\\u003cli\\u003eKim SH, Baek SI, Jung J et al (2022) Chemical inhibition of TRAF6-TAK1 axis as therapeutic strategy of endotoxin-induced liver disease. Biomed Pharmacother 155: 113688. https://doi.org/ 10.1016/j.biopha.2022.113688\\u003c/li\\u003e\\n\\u003cli\\u003eQi YH, Zhao X, Chen JY et al (2018) In vitro and in vivo cancer cell apoptosis triggered by competitive binding of Cinchona alkaloids to the RING domain of TRAF6. Biosci Biotechnol Biochem 83(6): 1011-1026. https://doi.org/ 10.1080/09168451.2018.1559030\\u003c/li\\u003e\\n\\u003cli\\u003eZhao X, Ren L, Wang X et al (2022) Benzoyl-xanthone derivative induces apoptosis in MCF-7 cells by binding TRAF6. Exp Ther Med 23(2): 181. https://doi.org/ 10.3892/etm.2021.11104\\u003c/li\\u003e\\n\\u003cli\\u003ePark HB, Baek KH (2022) E3 ligases and deubiquitinating enzymes regulating the MAPK signaling pathway in cancers. Biochim Biophys Acta Rev Cancer 1877(3): 188736. https://doi.org/10.1016/j.bbcan.2022.188736\\u003c/li\\u003e\\n\\u003cli\\u003eGui D, Peng W, Jiang W et al (2019) Ubiquitinspecific peptidase 46 (USP46) suppresses renal cell carcinoma tumorigenesis through AKT pathway inactivation. Biochem Biophys Res Commun 519(4): 689-696. https://doi.org/ 0.1016/j.bbrc.2019.09.036\\u003c/li\\u003e\\n\\u003cli\\u003eKiran S, Dar A, Singh SK et al (2018) The deubiquitinase USP46 is essential for proliferation and tumor growth of HPV-transformed cancers. Mol Cell 72(5): 823-835. https://doi.org/ 10.1016/j.molcel.2018.09.019\\u003c/li\\u003e\\n\\u003cli\\u003eQiu Y, Huang D, Sheng Y et al (2021) Deubiquitinating enzyme USP46 suppresses the progression of hepatocellular carcinoma by stabilizing MST1. Exp Cell Res 405(1): 112646. https://doi.org/ 10.1016/j.yexcr.2021.112646\\u003c/li\\u003e\\n\\u003cli\\u003eTian M, Zhu R, Ding F (2020) Ubiquitin-specific peptidase 46 promotes tumor metastasis through stabilizing ENO1 in human esophageal squamous cell carcinoma. Exp Cell Res 395(1): 112188. https://doi.org/ 10.1016/j.yexcr.2020.112188\\u003c/li\\u003e\\n\\u003cli\\u003eXu L, Zhang B, Li W (2021) Downregulated expression levels of USP46 promote the resistance of ovarian cancer to cisplatin and are regulated by PUM2. Mol Med Rep 23(4): 263. https://doi.org/ 10.3892/mmr.2021.11902\\u003c/li\\u003e\\n\\u003cli\\u003eLi X, Stevens PD, Yang H et al (2013) The deubiquitination enzyme USP46 functions as a tumor suppressor by controlling PHLPP-dependent attenuation of Akt signaling in colon cancer. Oncogene 32(4): 471-478. https://doi.org/ 10.1038/onc.2012.66\\u003c/li\\u003e\\n\\u003cli\\u003eWang W, Chen M, Xu H et al (2020) USP46 inhibits cell proliferation in lung cancer through PHLPP1/AKT pathway. Biomed Res Int 2020: 2509529. https://doi.org/ 10.1155/2020/2509529\\u003c/li\\u003e\\n\\u003cli\\u003eOhashi M, Holthaus AM, Calderwood MA et al (2015) The EBNA3 family of Epstein-Barr virus nuclear proteins associates with the USP46/USP12 deubiquitination complexes to regulate lymphoblastoid cell line growth. PLoS Pathog 11(4): e1004822. https://doi.org/ 10.1371/journal.ppat.1004822\\u003c/li\\u003e\\n\\u003cli\\u003eBrenke JK, Popowicz GM, Schorpp K et al (2018) Targeting TRAF6 E3 ligase activity with a small-molecule inhibitor combats autoimmunity. J Biol Chem 293(34): 13191-13203. https://doi.org/ 10.1074/jbc.RA118.002649\\u003c/li\\u003e\\n\\u003cli\\u003eNi X, Kou W, Gu J et al (2019) TRAF6 directs FOXP3 localization and facilitates regulatory T-cell function through K63-linked ubiquitination. EMBO J 38(9): 213-231. https://doi.org/ 10.15252/embj.201899766.\\u003c/li\\u003e\\n\\u003cli\\u003eWu Y, Wu W, Lin L et al (2018) Bortezomib enhances radiosensitivity in oral cancer through inducing autophagy mediated TRAF6 oncoprotein degradation. J Exp Clin Cancer Res 37(1): 91-104. https://doi.org/ 10.1186/s13046-018-0760-0\\u003c/li\\u003e\\n\\u003cli\\u003eZhu S, Jin J, Gokhale S et al (2018) Affiliations expand. Genetic alterations of TRAF proteins in human cancers. Front Immunol 9: 2111. https://doi.org/ 10.3389/fimmu.2018.02111\\u003c/li\\u003e\\n\\u003cli\\u003eHamidi A, Song J, Thakur N et al (2017) TGF-beta promotes PI3K-AKT signaling and prostate cancer cell migration through the TRAF6-mediated ubiquitylation of p85\\u0026alpha;. Sci Signal 10(486): eaal4186. https://doi.org/ 10.1126/scisignal.aal4186\\u003c/li\\u003e\\n\\u003cli\\u003eYang WL, Wang J, Chan CH et al (2009) The E3 ligase TRAF6 regulates AKT ubiquitination and activation. Science 325(5499): 1134-1138. https://doi.org/ 10.1126/science.1175065\\u003c/li\\u003e\\n\\u003cli\\u003eQi YH, Pradipta AR, Li M et al (2017) Cinchonine induces apoptosis of HeLa and A549 cells through targeting TRAF6. J Exp Clin Cancer Res 36(1): 35. https://doi.org/ 10.1186/s13046-017-0502-8\\u003c/li\\u003e\\n\\u003cli\\u003eHe H, Liu J, Li L et al (2021) Helicobacter pylori CagA interacts with SHP-1 to suppress the immune response by targeting TRAF6 for K63-linked ubiquitination. J Immunol 206(6): 1161-1170. https://doi.org/ 10.4049/jimmunol.2000234\\u003c/li\\u003e\\n\\u003cli\\u003eGuo Y, Zhang X, Zeng W et al (2021) TRAF6 activates fibroblasts to cancer-associated fibroblasts through FGF19 in tumor microenvironment to benefit the malignant phenotype of melanoma cells. J Invest Dermatol 140(11): 2268-2279. https://doi.org/ 10.1016/j.jid.2020.03.950\\u003c/li\\u003e\\n\\u003cli\\u003eZhu G, Cheng Z, Lin C et al (2020) The effects of TRAF6 on growth and progression in colorectal cancer are regulated by miRNA-140. Onco Targets Ther 13: 11991-12001. https://doi.org/ 10.2147/OTT.S257733\\u003c/li\\u003e\\n\\u003cli\\u003eLi Z, Qu L, Zhong H et al (2014) Low expression of Mig‑6 is associated with poor survival outcome in NSCLC and inhibits cell apoptosis via ERK‑mediated upregulation of Bcl‑2. Oncol Rep 31(4): 1707-1714. https://doi.org/ 10.3892/or.2014.3050.\\u003c/li\\u003e\\n\\u003cli\\u003eFeng X, Liu N, Deng S et al (2017) miR‑199a modulates cisplatin resistance in ovarian cancer by targeting Hif1\\u0026alpha;. Onco Targets Ther 10: 5899‑5906. https://doi.org/ 10.2147/OTT.S145833\\u003c/li\\u003e\\n\\u003cli\\u003eZhang R, Shi H, Ren F et al (2016) Knockdown of MACC1 expression increases cisplatin sensitivity in cisplatin‑resistant epithelial ovarian cancer cells. Oncol Rep 35(4): 2466‑2472. https://doi.org/ 10.3892/or.2016.4585\\u003c/li\\u003e\\n\\u003cli\\u003eDing JN, Zang YF, Ding YL (2021) MiRNA-146b-5p inhibits the malignant progression of gastric cancer by targeting TRAF6. Eur Rev Med Pharmacol Sci 25(8): 3151. https://doi.org/ 10.26355/eurrev_202104_25718\\u003c/li\\u003e\\n\\u003cli\\u003eHuang H, Li X, Yu L et al (2021) Wogonoside inhibits TNF receptor-associated factor 6 (TRAF6) mediated-tumor microenvironment and prognosis of pancreatic cancer. Ann Transl Med 9(18): 1460. https://doi.org/ 10.21037/atm-21-4164\\u003c/li\\u003e\\n\\u003cli\\u003eWang J, Dong Y, Wei Z et al (2023) Deubiquitinase OTUB2 promotes intrahepatic cholangiocarcinoma progression by stabilizing the CTNNB1-ZEB1 axis. Exp Cell Res 425(1): 113537. https://doi.org/ 10.1016/j.yexcr.2023.113537\\u003c/li\\u003e\\n\\u003cli\\u003eXie J, Lin W, Huang L et al (2018) Bufalin suppresses the proliferation and metastasis of renal cell carcinoma by inhibiting the PI3K/AKT/mTOR signaling pathway. Oncol Lett 16(3): 3867‑373. https://doi.org/ 10.3892/ol.2018.9111\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"investigational-new-drugs\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"drug\",\"sideBox\":\"Learn more about [Investigational New Drugs](https://www.springer.com/journal/10637)\",\"snPcode\":\"10637\",\"submissionUrl\":\"https://submission.nature.com/new-submission/10637/3\",\"title\":\"Investigational New Drugs\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"USP46, Apoptosis, TRAF6, A549, Deubiquitinating enzyme\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-5366056/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-5366056/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eThis study investigates the function of Ubiquitin-specific protease 46 (USP46), a deubiquitinase, in the context of lung cancer, particularly its role in regulating cell proliferation via the ubiquitination of TRAF6. In A549 lung cancer cells, analysis revealed a significant downregulation of USP46 expression, while TRAF6 levels were notably elevated. These findings were corroborated by Western blotting, which confirmed the altered expression patterns. To further assess the implications of these changes, several experimental assays, including the Cell Counting Kit-8, transwell migration assays, and flow cytometry, were conducted to evaluate cell viability and apoptosis rates. Co-immunoprecipitation experiments demonstrated a direct interaction between USP46 and TRAF6, implicating USP46 in the modulation of TRAF6 ubiquitination, a process that is fundamental to tumor physiology. The results indicated that decreased USP46 expression led to an increase in the levels of the anti-apoptotic protein Bcl-2, while there was a corresponding decrease in key pro-apoptotic proteins such as caspase-3, caspase-9, and Bax. Additionally, the study found elevated levels of phosphorylated AKT and mTOR, which suggest the activation of survival signaling pathways in the cancer cells. These findings collectively suggest that the up-regulated USP46 promotes apoptosis in lung cancer cells through the regulation of TRAF6. Therefore, targeting the USP46/TRAF6 signaling pathway presents a promising therapeutic strategy for lung cancer treatment, potentially offering new avenues for intervention in cancer progression and cell survival mechanisms.\\u003c/p\\u003e\",\"manuscriptTitle\":\"The up-regulated expression level of deubiquitinating enzyme USP46 induces the apoptosis of A549 cells by TRAF6\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-11-18 10:54:04\",\"doi\":\"10.21203/rs.3.rs-5366056/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2025-03-12T03:27:35+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-03-12T00:19:13+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"336257806264738406719226926133251905928\",\"date\":\"2025-02-17T01:46:21+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2024-11-05T14:31:09+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2024-11-05T06:19:44+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2024-11-05T06:19:16+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Investigational New Drugs\",\"date\":\"2024-10-31T08:36:36+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"investigational-new-drugs\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"drug\",\"sideBox\":\"Learn more about [Investigational New Drugs](https://www.springer.com/journal/10637)\",\"snPcode\":\"10637\",\"submissionUrl\":\"https://submission.nature.com/new-submission/10637/3\",\"title\":\"Investigational New Drugs\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"1ed92ce0-2c58-4142-9b33-be21acd6edc2\",\"owner\":[],\"postedDate\":\"November 18th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-04-28T16:04:50+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-5366056\",\"link\":\"https://doi.org/10.1007/s10637-025-01532-9\",\"journal\":{\"identity\":\"investigational-new-drugs\",\"isVorOnly\":false,\"title\":\"Investigational New Drugs\"},\"publishedOn\":\"2025-04-23 15:57:18\",\"publishedOnDateReadable\":\"April 23rd, 2025\"},\"versionCreatedAt\":\"2024-11-18 10:54:04\",\"video\":\"\",\"vorDoi\":\"10.1007/s10637-025-01532-9\",\"vorDoiUrl\":\"https://doi.org/10.1007/s10637-025-01532-9\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-5366056\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-5366056\",\"identity\":\"rs-5366056\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}