{"paper_id":"393bc907-676a-48a6-bed4-19fa9ec4749e","body_text":"SAMHD1 promotes SARS-CoV-2 infection by enhancing HNF1-dependent ACE2 expression in lung epithelial cells | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return\"[object Function]\"==o.call(a)}function e(a){return\"string\"==typeof a}function f(){}function g(a){return!a||\"loaded\"==a||\"complete\"==a||\"uninitialized\"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){(\"c\"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){\"img\"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),\"object\"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height=\"0\",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),\"img\"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||\"j\",e(a)?i(\"c\"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName(\"script\")[0],o={}.toString,p=[],q=0,r=\"MozAppearance\"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&\"[object Opera]\"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?\"object\":l?\"script\":\"img\",v=l?\"script\":u,w=Array.isArray||function(a){return\"[object Array]\"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split(\"!\"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split(\"=\"),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(\".\").pop().split(\"?\").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split(\"/\").pop().split(\"?\")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&\"css\"==i.url.split(\".\").pop().split(\"?\").shift()?\"c\":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results SAMHD1 promotes SARS-CoV-2 infection by enhancing HNF1-dependent ACE2 expression in lung epithelial cells Pak-Hin Hinson Cheung , Pearl Chan , Hua Yang , Shravya Honne , Baek Kim , Stanley Perlman , View ORCID Profile Li Wu doi: https://doi.org/10.1101/2025.10.23.684143 Pak-Hin Hinson Cheung 1 Department of Microbiology and Immunology, Carver College of Medicine, University of Iowa , Iowa City, Iowa, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: pakhinhinson-cheung{at}uiowa.edu li-wu{at}uiowa.edu Pearl Chan 1 Department of Microbiology and Immunology, Carver College of Medicine, University of Iowa , Iowa City, Iowa, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Hua Yang 1 Department of Microbiology and Immunology, Carver College of Medicine, University of Iowa , Iowa City, Iowa, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Shravya Honne 2 Department of Pediatrics, School of Medicine, Emory University , Atlanta, Georgia , USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Baek Kim 2 Department of Pediatrics, School of Medicine, Emory University , Atlanta, Georgia , USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Stanley Perlman 1 Department of Microbiology and Immunology, Carver College of Medicine, University of Iowa , Iowa City, Iowa, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Li Wu 1 Department of Microbiology and Immunology, Carver College of Medicine, University of Iowa , Iowa City, Iowa, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Li Wu For correspondence: pakhinhinson-cheung{at}uiowa.edu li-wu{at}uiowa.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Sterile alpha motif and HD domain-containing protein 1 (SAMHD1) restricts a board spectrum of viruses through multifaceted mechanisms. It also limits spontaneous- and virus-induced innate immune responses by suppressing proinflammatory cytokine and type-I interferon (IFN-I) production. Some viruses escape SAMHD1 restriction by utilizing SAMHD1-mediated innate immune suppression to establish effective infection through viral antagonism. Our previous studies showed that SAMHD1 is a proviral factor facilitating replication of severe acute respiratory syndrome coronavirus (SARS-CoV-2) in human macrophages, monocytic THP-1 and epithelial-like HEK293T cell lines by suppressing IFN responses. However, it is unclear about the function of SAMHD1 in lung epithelial cells during SARS-CoV-2 infection. Here, we report that SAMHD1 facilitates SARS-CoV-2 replication in lung epithelial Calu-3 cells by enhancing endogenous expression of the viral receptor angiotensin-converting enzyme 2 (ACE2) via hepatocyte nuclear factor 1-alpha (HNF1α) and HNF1β. Using pseudotyped SARS-CoV-2 and lentiviral vectors, we found that SARS-CoV-2 spike protein-mediated viral entry was suppressed in Calu-3 cells with SAMHD1 knockout (KO). SAMHD1 KO repressed ACE2 expression in Calu-3 cells at mRNA and protein levels. Functional analyses revealed that HNF1α and HNF1β were crucial for the endogenous ACE2 expression in Calu-3 cells. Additionally, SAMHD1 KO led to a reduction in the expression levels and ACE2-promoting function of HNF1α and HNF1β. Inhibition of IFN antiviral response by baricitinib, a Janus kinase 1 and 2 (JAK 1/2) inhibitor, did not revert the suppression of SARS-CoV-2 in SAMHD1 KO Calu-3 cells. Our findings demonstrate that SAMHD1 facilitates HNF1-mediated ACE2 expression and SARS-CoV-2 replication in Calu-3 cells via a novel mechanism beyond its IFN-suppressive function. Author Summary During viral infection, SAMHD1 acts as a viral restriction factor and a suppressor of the innate immune system, controlling viral replication while also ensuring immune homeostasis. The innate immune suppressive function of SAMHD1 can be proviral for some viruses. SAMHD1 has been shown to facilitate SARS-CoV-2 infection in human macrophages, THP-1 and HEK293T cell lines by promoting IFN antagonism, but its role in lung epithelial cells is unclear. Here, we demonstrated that SAMHD1 promotes SARS-CoV-2 replication in human lung epithelial Calu-3 cells by enhancing expression of the major viral receptor ACE2. We found that SAMHD1 facilitated HNF1-medaited ACE2 expression that was required for spike protein-mediated SARS-CoV-2 entry. However, inhibiting IFN signaling in SAMHD1 KO Calu-3 cells was not sufficient to revert SARS-CoV-2 replication. Our findings shed light on the differential proviral function of SAMHD1 in ACE2 expressing cells and suggest that SAMHD1 can facilitate SARS-CoV-2 infection beyond enhancing IFN antagonism. Introduction SAMHD1 is the only deoxynucleoside triphosphohydrolase (dNTPase) of mammalian cells to be a restriction factor against human immunodeficient virus type 1 (HIV-1) infection in resting CD4 + T cells and terminally differentiated immune cells, such as macrophages and dendritic cells [ 1 – 3 ]. Increasing evidence suggests that SAMHD1 restricts different viruses including human T cell leukemia virus type 1 [ 4 ], DNA viruses such as herpesviruses (herpes simplex virus 1, human cytomegalovirus and Epstein-Barr virus), hepatitis B virus, human papillomavirus and poxviruses [ 5 – 10 ] as well as RNA viruses including influenza A virus, enteroviruses, and flaviviruses [ 11 – 13 ]. The viral restriction functions of SAMHD1 encompass both dNTPase-dependent and - independent mechanisms according to the target virus and the contexts of the host cells such as cell type, differentiation status, IFN-I response and the expression of other host restriction factors that cooperate with SAMHD1 in cells [ 14 ]. SAMHD1 suppresses innate immune responses [ 15 ]. Loss-of-function mutation of SAMHD1 correlates with the development of the Aicardi-Goutières syndrome which is an autoimmune disease implicating central nervous system [ 16 ]. SAMHD1 prevents spontaneous activation of innate immune responses to self-RNA and self-DNA species that respectively activate retinoic acid-inducible gene I (RIG-I)-like receptor signaling and cyclic GMP-AMP synthase (cGAS)- stimulator of interferon genes (STING) signaling [ 17 – 24 ]. Similarly, SAMHD1 prevents inflammation- or virus-induced innate immune responses [ 25 , 26 ]. SAMHD1 suppresses pattern recognition receptor signal pathways by interacting with various signal proteins such as mitochondrial antiviral-signaling protein (MAVS), inhibitor of nuclear factor kappa-B kinase subunit alpha (IKKα), IKKβ, IKKε as well as transcription factors including p100 and p105 in the NF-κB pathway which drives proinflammatory cytokine expression and interferon regulatory factor 7 (IRF7) which promotes IFN-I expression [ 25 , 27 , 28 ]. SARS-CoV-2 caused the COVID-19 pandemic, claiming more than 7 million lives worldwide [ 29 , 30 ]. SARS-CoV-2 suppresses IFN antiviral responses through multiple strategies to facilitate viral infection [ 31 ]; however, the precise mechanisms remain to be elucidated. Previously, we reported that SARS-CoV-2 infection was suppressed upon depletion of SAMHD1 expression in HEK293T, differentiated THP-1 cells, and primary human macrophages [ 32 ]. Suppression of IFN signaling of SAMHD1-defective HEK293T cells by baricitinib, a JAK1/2 inhibitor, alleviated the repression of SARS-CoV-2 replication, suggesting that SARS-CoV-2 exploits SAMHD1 for IFN antagonism, thereby facilitating its infection [ 32 ]. It remains to be determined if SAMHD1-mediated immunosuppression promotes SARS-CoV-2 replication in the primary target cell type, such as epithelial cells expressing the major viral entry factors ACE-2 and transmembrane protease, serine 2 (TMPRSS2) [ 33 , 34 ]. In this study, we found that SAMHD1 KO in Calu-3 cells conferred resistance to SARS-CoV-2 infection, independent of IFN signaling, by reducing the expression of transcription factors HNF1α and HNF1β, which in turn lowered ACE2 levels and inhibited S-mediated viral entry. Our findings shed light on a novel function of SAMHD1 in upregulating ACE2 expression to facilitate SARS-CoV-2 infection in human lung epithelial cells. Results Generation and characterization of stable SAMHD1 KO Calu-3 cell lines To generate SAMHD1 KO Calu-3 cells, CRISPR/Cas9 technology based on the lentiCRISPRv2 system was employed [ 35 ]. Two target sequences of the single guide RNAs (sgRNAs) were obtained from CHOPCHOP v3 with no off-target effect at less than four mismatches [ 36 ]. With sgRNA 1 and sgRNA 2, the Streptococcus pyogenes Cas9 nuclease (SpCas9) was targeted to the SAMHD1 gene, resulting in cleavage sites that encode 11 Lysine and 150 Leucine, respectively ( Fig. 1A ). 11 Lysine was the first residue of the nuclear localizing signal (NLS) of SAMHD1 protein and 150 Leucine was in the HD domain before the dNTPase active site. Calu-3 cells were transduced with the lentiviral vectors, selected by puromycin and clonal purified with limiting dilution. Several purified cell clones were obtained and tested for SAMHD1 protein expression ( Fig. 1B ). We obtained clone 4 and clone 3 of the respective cell populations treated with sgRNA1 or sgRNA2 having the lowest expression of SAMHD1 compared with the Ctrl clones ( Fig. 1B ). Therefore, clone 1 of the Ctrl population, clone 4 of the sgRNA1-treated population and clone 3 of the sgRNA2-treated population were used for the subsequent study and named Ctrl, KO1 and KO2, respectively. Download figure Open in new tab Figure 1. Generation and characterization of SAMHD1 KO Calu-3 cell lines. (A) Schematic diagram of human SAMHD1 protein domains showing the target sites of sgRNA1 or sgRNA2. (B) SAMHD1 expression of Calu-3 cells transduced to express SpCas9 without the expression of any sgRNA (Ctrl, two single clones) or with the expression of sgRNA1 (five single clones) or sgRNA2 (three single clones). GAPDH detection was used as normalization control. The relative band intensities of SAMHD1 were calculated by dividing them with GAPDH bands and were normalized to Ctrl clone 1. Clone 1 of Ctrl, clone 4 of sgRNA1- and clone 3 of sgRNA 2-treated groups were chosen for all subsequent experiments and respectively named Ctrl, KO1 and KO2. (C) Levels of IL-6, IFNβ, OAS1 and ISG15 mRNA were measured with RT-qPCR. 18S RNA was used as internal control. Biological sextuplicate experiments were performed. One-way ANOVA multiple comparisons test was used to evaluate the statistical significance of the difference between Ctrl and KO1 or KO2. * P<0.05, *** P<0.001, **** P<0.0001. ns, not significant. The genomic DNA sequences at the SpCas9 cleavage sites of KO1 cells (Fig. S1A) and KO2 cells (Fig. S1B) were obtained through sanger sequencing and compared with Ctrl cells. We found that a single nucleotide insertion occurred near the SpCas9 cleavage sites, which frameshifted the SAMHD1 coding sequence thereafter (Red arrows, Fig. S1A and S1B). It was noted that multiple signal peaks were observed after the SpCas9 cleavage sites of KO1 and KO2 which may indicate the existence of more than one mutant in the clonal purified population. To confirm whether SAMHD1 KO functionally affected intracellular dNTP levels, cellular dATP levels were measured (Fig. S1C) as an example [ 37 ]. We found that the mean values of the intracellular dATP levels of KO1 and KO2 were 8.9- and 7.8-fold more than that of the Ctrl cells (Fig. S1C). This result suggests that KO1 and KO2 were deprived of dNTPase activity of SAMHD1. SAMHD1 depletion may enhance innate immune response even in the absence of extrinsic stimuli depending on cell types [ 19 , 24 , 25 , 32 , 38 – 40 ]. To examine if SAMHD1 KO promoted innate immune responses of Calu-3 cells, the mRNA levels of proinflammatory cytokine IL-6 as well as IFNβ and two IFN-stimulated genes (ISGs) OAS1 and ISG15 of KO1 and KO2 were detected by RT-qPCR and compared with Ctrl cells ( Fig. 1C ). We found that KO1 and KO2 cells constitutively expressed higher levels of IL-6 in the absence of any extrinsic stimuli. Interestingly, we found that the expression levels of IFNβ , OAS1 and ISG15 were significantly upregulated in KO2, but not in KO1 clone ( Fig. 1C ). Thus, SAMHD1 KO promoted proinflammatory cytokine production from Calu-3 cells in both KO1 and KO2 clones, while strong constitutive IFN-I response was only observed in KO2 clone. SAMHD1 promotes SARS-CoV-2 replication independent of IFN signaling To test if SAMHD1 affected SARS-CoV-2 replication in Calu-3 cells, kinetics of ancestral SARS-CoV-2 (Wuhan-Hu-1) replication was examined in Ctrl, KO1 and KO2 cells. We found that the kinetics of infectious virus production was suppressed in both KO1 and KO2 ( Fig. 2A ) despite only KO2 cells having a higher constitutive IFN-I response than Ctrl cells ( Fig. 1C ). Similarly, significant suppression of the levels of released viral genome was observed in both KO1 and KO2 clones ( Fig. 2B ). The expressions of intracellular viral nucleoprotein (N) and spike protein (S) were significantly reduced in the infected KO1 and KO2 cells ( Fig. 2C ). Moreover, intracellular viral RNA levels were suppressed in the infected KO1 and KO2 cells which did not produce higher levels of IFNβ, IFNλ or OAS1 in response to SARS-CoV-2 infection ( Fig. 2D ). To confirm if IFN signaling contributed to the hindered replication of SARS-CoV-2 in SAMHD1 KO Calu-3 cells, infected cells were treated with or without baricitinib to test if suppressing IFN signaling can rescue SARS-CoV-2 replication in KO1 and KO2 cells. We found that baricitinib did not rescue SARS-CoV-2 replication in Calu-3 cells in terms of released infectious viral titer ( Fig. 2E ), intracellular viral N protein ( Fig. 2F ), and intracellular viral N mRNA, although baricitinib efficiently suppressed virus-induced OAS1 expression in Ctrl and KO2 cells ( Fig. 2G ) as well as virus-induced protein expression of STAT1 and Ser727-phosphorylated STAT1 ( Fig. 2F ). Therefore, SAMHD1 expression is required for SARS-CoV-2 replication in Calu-3 cells independent of its suppressive function to IFN. Download figure Open in new tab Figure 2. Suppression of SARS-CoV-2 infection by SAMHD1 depletion independent to IFN antiviral response. (A, B) Calu-3 Ctrl, KO1 or KO2 cells were infected with authentic SARS-CoV-2 at MOI=0.05. Culture supernatant was collected at 0, 24, 48 or 72 hpi. (A) Infectious titer or (B) viral copy number of the conditioned media were respectively measured by plaque assay or RT-qPCR. Statistical comparison was performed at each time point between Ctrl and KO1 or KO2. (C) Viral N and S proteins of infected Ctrl, KO1 or KO2 cells (SARS-CoV-2, MOI=1) were detected at 24 hpi. GAPDH was detected as an input control. The relative band intensities of viral N and viral S were calculated by dividing them with GAPDH bands and were normalized to Ctrl cells. (D) The levels of viral RNA (N), IFNβ mRNA, IFNλ mRNA and OAS1 mRNA of infected Ctrl, KO1 or KO2 cells (SARS-CoV-2, MOI=1, 0 or 24 hpi) were quantified with RT-qPCR. 18S RNA was used as internal control. (E, F and G) Calu-3 Ctrl, KO1 or KO2 cells treated with 10 μM baricitinib or DMSO (added 4 hrs before infection) were infected with authentic SARS-CoV-2 at MOI=1. At 24 hpi, culture supernatant, cellular protein and cellular RNA were harvested and respectively tested with (E) plaque assay, (F) Western blot or (G) RT-qPCR. For (F), viral N protein, total STAT1 or S727-phosphorylated STAT1 (p-STAT1) were detected and GAPDH was used as input control. The relative band intensities of viral N, STAT1, or p-STAT1 were calculated by dividing them with GAPDH bands and were normalized to Ctrl cells treated with DMSO. For (G), viral N RNA and OAS1 mRNA were detected. 18S RNA was used as normalization control. For (A), (B), (D) and (G), biological triplicate experiment was performed. For (E), biological quadruplicate experiment was performed. For (A), (B), (D), (E) and (G), two-way ANOVA multiple comparisons test was performed. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001. ns, not significant. SAMHD1 facilitates spike protein-mediated viral entry of SARS-CoV-2 To understand how SAMHD1 promoted SARS-CoV-2 infection, we employed a previously developed single cycle SARS-CoV-2 which was S-defective and pseudotyped with vesicular stomatitis virus glycoprotein (VSV-G), namely, ΔS-VRP(G) [ 41 ]. ΔS-VRP(G) infection bypasses S-protein mediated viral entry and infects cell types that do not support authentic SARS-CoV-2 infection. Firstly, we confirmed that remdesivir, a nucleoside analogue inhibiting viral RNA-dependent RNA polymerase (RdRP) [ 42 ], can efficiently suppress intracellular viral RNA levels (N and E genes) of ΔS-VRP(G) in Calu-3 Ctrl cells, suggesting that ΔS-VRP(G) infection depended on RdRP activity ( Fig. 3A ). Next, we asked if SAMHD1 deficiency suppressed ΔS-VRP(G) infection similarly as that observed in the authentic SARS-CoV-2 infections ( Fig. 2 ). Interestingly, we found that the intracellular viral N and E RNA levels of ΔS-VRP(G) were not suppressed in KO1 or KO2 cells compared with Ctrl cells at 24 and 48 hrs post-infection (hpi) ( Fig. 3B ). Comparatively, we observed that intracellular viral N protein expression by ΔS-VRP(G) infection was minimally affected in KO1 cells but was slightly reduced in KO2 cells ( Fig. 3C ), although the difference was much less than that observed in the authentic SARS-CoV-2 infection ( Fig. 2C ). ΔS-VRP(G) expresses a dual reporter gene ( Gaussia luciferase-T2A-neon GFP) through the transcriptional regulatory sequence of S gene [ 41 ]. Detection to the Gaussia luciferase activity reflects the infectivity of ΔS-VRP(G) [ 41 ]. We found that ΔS-VRP(G) infection produced similar levels of Gaussia luciferase in Ctrl, KO1 and KO2 cells ( Fig. 3D ). Although ΔS-VRP(G) infection had a trend of producing less Gaussia luciferase in KO2 cells than KO1 and Ctrl, we did not observe significant reductions in both KO1 and KO2 cells ( Fig. 3D ). Therefore, unlike authentic SARS-CoV-2, SAMHD1 deficiency did not inhibit ΔS-VRP(G) infection. Download figure Open in new tab Figure 3. SAMHD1 depletion suppresses spike protein-mediated viral entry. (A) Viral RNA levels (N and E genes) of Calu-3 Ctrl cells infected with ΔS-VRP(G) at 1.2 x 10 5 copy number per cell and treated with 5 μM remdesivir (RDV) or DMSO were quantified with RT-qPCR at 24 hpi. 18S RNA was used as normalization control. Biological triplicate experiments were performed. (B, C and D) Calu-3 Ctrl, KO1 or KO2 cells were infected with ΔS-VRP(G) at 1.2 x 10 5 copy number per cell. (B) Viral RNA levels (N and E genes) were quantified with RT-qPCR at indicated time points. 18S RNA was used as normalization control. Biological triplicate experiments were performed. (C) Viral N protein was detected with Western blot at indicated time points. GAPDH was used as input control. The relative band intensities of viral N were calculated by dividing them with GAPDH bands and were normalized to Ctrl cells at 24 hpi. (D) The activities of secreted Guassia luciferase at indicated time points were assayed through Pierce™ Gaussia Luciferase Flash Assay Kit. Biological quadruplicate experiments were performed. (E) Cellular luciferase activities of HIV-1-spike-Luc/ZsGreen infected Calu-3 Ctrl, KO1 or KO2 cells (12.5 TCID 50 per cell) were measured at 48 hpi. Biological sextuplicate experiments were performed. For (A), (B) and (D), two-way ANOVA multiple comparisons test was performed. For (E), one-way ANOVA multiple comparisons test was used. * P<0.05, ** P<0.01, *** P<0.001. ns, not significant. One possible explanation for the selective suppression of authentic SARS-CoV-2 infection but not ΔS-VRP(G) in SAMHD1 KO cells was due to abolished S-protein-mediated viral entry, which was not required for ΔS-VRP(G) infection. To validate the possibility, we employed a SARS-CoV-2 S protein-pseudotyped HIV-1-based reporter virus, namely HIV-1-spike-Luc/ZsGreen [ 43 , 44 ]. Successful infection of HIV-1-spike-Luc/ZsGreen depended on S-protein mediated viral entry and the subsequent viral gene expression driven by HIV-1 single-cycle infection. The infectivity of HIV-1-spike-Luc/ZsGreen can be measured by detecting the expression of the firefly luciferase 2 [ 43 , 44 ]. We found that HIV-1-spike-Luc/ZsGreen infected KO1 or KO2 cells produced significantly less luciferase activity than the Ctrl cells ( Fig. 3E ). This suggested that SAMHD1 expression promoted S protein-mediated viral entry, which in turn facilitated infection of authentic SARS-CoV-2 and HIV-1-spike-Luc/ZsGreen but not ΔS-VRP(G). SAMHD1 maintains the expression of viral receptor ACE2 of Calu-3 cells To gain mechanistic insight into how SAMHD1 facilitated spike-protein mediated viral entry, the transcriptomic profiles of Ctrl, KO1 and KO2 cells were obtained by mRNA-Sequencing (mRNA-seq). Firstly, principal component analysis (PCA) was performed to cluster Ctrl, KO1 and KO2 cells. Biological triplicate experiment was performed. Nine PCs were therefore obtained, in which PC1 (61%) and PC2 (37%) covered 98% of the total variance (Fig. S2A). Ctrl, KO1 and KO2 cells were well clustered based on PC1 and PC2 (Fig. S2B). Along PC1 axis, KO1 and KO2 cells were clearly clustered and separated from Ctrl cells in the same direction. KO2 cells were separated from KO1 and Ctrl cells along the PC2 axis which however minimally distinguished KO1 and Ctrl cells, suggesting clonal specific transcriptomic profile for KO2. A PCA biplot on the top ten most influential loading genes for the PCA clustering was plotted (Fig. S2C). The PCA biplot indicated that the major loading contributors of PC1 were cell surface proteins (CEACAM6, LGALS4 (or Galectin 4), and GJA1) and proteins implicating extracellular matrix (CST6 (Cystatin E/M) and FAM20C). For PC2, the expression changes of ISGs including OAS2, IFI27, IFITM1 and IF16 as well as MHC class II β-chain component HLA-DPB1 distinguished KO2 from Ctrl and KO1 but had minimal contribution to PC1 axis (Fig. S2C). In summary, KO1 and KO2 were distinguished from Ctrl along PC1 which was mainly influenced by the mRNA expression of genes implicating cell surface and extracellular matrix while KO2 was further distinguished from Ctrl and KO1 along PC2 which was mainly influenced by the expressions of ISGs. Next, by analyzing the differential expressed genes (DEGs) implicated in both KO1 and KO2 having more than 2-fold change and with false discovery rate (FDR)-adjusted P values < 0.01 (Table S1), we found that 806 DEGs were commonly observed in KO1 and KO2 compared with Ctrl cells ( Fig. 4A ). Among the 806 DEGs, 681 DEGs were of the same direction of change (Table S2). We searched for known and validated entry factors of SARS-CoV-2 infection. We found that the expressions of ACE2 and TMPRSS2 were decreased in both KO1 and KO2 ( Fig. 4B ). Both ACE2 and TMPRSS2 transcripts were more suppressed in KO1 than in KO2. Other known SARS-CoV-2 entry factors were, however, not on the list. Those included alternative receptors Transmembrane protein 106B (TMEM106B) [ 45 ], transferrin receptor [ 46 ], CD147 [ 47 ], AXL receptor tyrosine kinase (AXL) [ 48 ], kringle containing transmembrane protein 1 (KREMEN1), and asialoglycoprotein receptor 1 (ASGR1) [ 49 ], attachment factors Neuropilin-1 [ 50 ], Niemann-Pick C1 (NPC1) [ 51 ], lectin receptors [ 52 ], and endosomal protease cathepsin L [ 53 ] (Table S2). Interestingly, we noticed both KO1 and KO2 had enhanced expression of furin protease ( Fig. 4B ), which may facilitate S protein priming in infected cells [ 54 ]. Download figure Open in new tab Figure 4. SAMHD1 depletion downregulates the expression of SARS-CoV-2 receptor ACE2. (A) Calu-3 Ctrl, KO1 and KO2 cells were subjected to mRNA-Seq using Element Aviti24. Biological triplicate was performed. DEGs were identified and selected based on the following criteria: FDR-adjusted P <0.01 and log 2 fold change >1. The number of DEGs in the three different comparison groups were plotted on a Venn diagram (i.e. Ctrl vs KO1, Ctrl vs KO2 and KO1 vs KO2). 681 common DEGs of Ctrl vs KO1 and Ctrl vs KO2 were found to have consistent direction of change. (B) The 681 DEGs described in (A) were plotted on two volcano plots with FDR-adjusted P values against log 2 fold change according to the values of KO1 vs Ctrl (left) or KO2 vs Ctrl (right). Three known viral entry factors ACE2, TMPRSS2 and Furin were identified. The values of log 2 fold change were labelled adjacent to the corresponding data points. (C) mRNA levels of ACE2 (primer pair 1, Table S5) and TMPRSS2 of Ctrl, KO1 or KO2 cells were quantified with RT-qPCR. 18S RNA was used as normalization control. Biological sextuplicate experiments were performed. (D) Protein levels of ACE2 and TMPRSS2 were measured with Western blot. GAPDH was used as the input control. Triangle (⊲) and asterisk (*) symbols respectively represented the zymogen (∼55 kDa) and active form (∼31 kDa) of TMPRSS2. The relative band intensities of ACE2, TMPRSS2 zymogen and TMPRSS2 active form were calculated by dividing them with GAPDH bands and were normalized to Ctrl. For (C), one-way ANOVA multiple comparisons test was used to evaluate the statistical significance of the difference between Ctrl and KO1 or KO2. **** P<0.0001, ns, not significant. Finally, ACE2 and TMPRSS2 mRNA and protein expressions were validated respectively by RT-qPCR ( Fig. 4C ) and Western blot ( Fig. 4D ). For ACE2, we designed a primer pair targeting the full-length isoforms but not the N-terminally truncated ACE2 (dACE2) that is not a functional receptor to SARS-CoV-2 [ 55 ]. We employed a monoclonal ACE2 antibody that detected an N-terminal region (peptide sequence surrounding Asp201) that is absent in dACE2. For TMRPSS2, we designed a primer pair that can detect isoform 1 to 3. We employed a monoclonal TMPRSS2 antibody that detected the protease domain which is present in both zymogen (∼ 55 kDa) and active form (∼ 31 kDa). We found that the full length ACE2 mRNA and protein expressions were significantly reduced in KO1 and KO2 cells ( Fig. 4C and 4D ). We confirmed the decreased full length ACE2 mRNA expression in KO1 and KO2 by another qPCR primer pair [ 55 ] (Fig. S3A). Interestingly, we found that KO2, but not KO1 cells, expressed significantly higher levels of dACE2 (Fig. S3B), which is known to be induced by IFN-I [ 55 , 56 ]. In contrast, we found that TMPRSS2 mRNA and protein expressions were only downregulated in KO1 but not in KO2 cells ( Fig. 4C and 4D ). Indeed, mRNA-seq results showed that TMPRSS2 transcripts were marginally defined as DEG in KO2 cells with log 2 fold change equal to -1.01 ( Fig. 4B , right panel). Therefore, only the expression of full-length ACE2 but not TMPRSS2 was confirmed to be commonly repressed in SAMHD1 KO Calu-3 cells. This suggested that SAMHD1 expression was important to maintain full length ACE2 expression that facilitated S protein-mediated viral entry and SARS-CoV-2 infection. SAMHD1 expression does not affect ACE2 mRNA stability ACE2 mRNA levels were downregulated in SAMHD1 KO cells ( Fig. 4B - 4C , S3A). To test whether SAMHD1 KO affected ACE2 mRNA stability, an actinomycin D (actD) treatment assay was performed [ 57 , 58 ]. Ctrl, KO1 and KO2 cells were treated with actD that inhibited transcription. At various time points following the treatment, the ACE2 mRNA levels were measured by three specific qPCR primer pairs: the same qPCR primer pair used in Fig. 4C for full length ACE2 targeting exon 2/3 junction and exon 4 ( Fig. 5A , primer pair 1 in Table S5), a qPCR primer pair targeting the 5’ end of ACE2 mRNA at exon 1/2 junction ( Fig. 5B , primer pair 2 in Table S5), and a qPCR primer pair targeting the 3’ end of ACE2 mRNA at exon 19 ( Fig. 5C , primer pair 3 in Table S5). We found that ACE2 mRNA was relatively stable over time that more than 50% of it remained by 8 hrs of actD treatment ( Fig. 5A - 5C ), similar to the observation by others [ 59 ]. We included additional controls to validate the actD treatment assay. The mRNA stability of a proapoptotic gene BCL-2 interacting killer (BIK) is suppressed by La-related protein 1 (LARP1), a protein highly expressed in cancer cells [ 60 , 61 ]. We found that BIK mRNA in Calu-3 Ctrl cells exhibited rapid decay following actD treatment, with levels decreasing to below 50% by 4 hrs and approximately 10% remaining at 8 hrs ( Fig. 5D ). Comparatively, 18S ribosomal RNA, which is a structural component of ribosome and more stable than mRNA, was found to remain above 50% of the initial levels during the actD treatment assay ( Fig. 5E ). These results confirmed that the actD treatment assay was valid in distinguishing unstable RNA species. We found that ACE2 mRNA in actD-treated KO1 or KO2 cells were similarly stable as compared with that of the Ctrl cells with over 50% of ACE2 mRNA remaining in both KO1 and KO2 cells ( Fig. 5A - 5C ). Therefore, SAMHD1 expression does not affect ACE2 mRNA stability. Download figure Open in new tab Figure 5. SAMHD1 KO does not affect ACE2 mRNA stability. (A-C) The levels of ACE2 mRNA of actinomycin D (10 µg/mL) treated Calu-3 Ctrl, KO1 or KO2 cells were quantified with RT-qPCR using (A) primer pair 1, (B) primer pair 2 or (C) primer pair 3 (Table S5) at indicated time points. (D) BIK mRNA and (E) 18S RNA were detected with RT-qPCR as controls to the experiment. Total RNA (1 µg) was used for reverse transcription. mRNA levels were normalized to 0 hr. The one phase decay curves for KO1 (blue), KO2 (red) and Ctrl cells (black) were plotted. SAMHD1 maintains HNF1α, HNF1β and HNF4α expressions in Calu-3 cells Next, we questioned how SAMHD1 KO affected ACE2 transcription. The ACE2 promoter is a bipartite promoter that is controlled by various transcription factors depending on cell types [ 62 ]. Analysis of human lung tissues and immortalized lung 16HBE cells revealed STAT3 transcriptionally controlled ACE2 expression [ 63 ]. HNF1α and HNF1β were found to cooperate and promote ACE2 expression transcriptionally in HEK293 and pancreatic islet cells [ 64 , 65 ]. HNF4α was found to be a transcription repressor or activator of ACE2 expression depending on different cell types and experiment settings [ 66 – 68 ]. Sp1 was found to transcriptionally promote ACE2 expression in immortalized human type II alveolar epithelial cells [ 68 ]. FOXA2 was found to promote ACE2 transcription in 832/13 insulinoma cells or mouse pancreatic islets [ 69 ]. Ikaros was found to drive ACE2 expression in human cardiac fibroblasts in response to Ang II stimulation by binding to ATTTGGA sequence of the proximal promoter [ 70 ]. The exact transcription factors regulating endogenous ACE2 expression in Calu-3 cells remain unclear. To the best of our knowledge, GATA6 was the only experimentally identified transcription factor in Calu-3 cells promoting ACE2 expression and facilitating SARS-CoV-2 infection [ 71 ]. GATA6 was identified by CRISPR/Cas9-KO library screening for surviving cells upon SARS-CoV-2 infection. Two additional independent studies identified HNF1β as a significant candidate to reduce surviving cells upon SARS-CoV-2 infection by CRISPR/Cas9-activation library screening [ 72 , 73 ]. However, unlike GATA6, the role of HNF1β in regulating ACE2 expression in Calu-3 cells was not further validated. Other known ACE2 transcription factors as mentioned above were not on the candidate list of the three screening studies [ 71 – 73 ]. Our RT-qPCR analysis revealed that the mRNA levels of HNF1β were reduced in KO1 and KO2 cells ( Fig. 6B ), while GATA6 mRNA level was unchanged in KO1 and KO2 cells compared to Ctrl cells ( Fig. 6D ). Download figure Open in new tab Figure 6. SAMHD1 KO decreases the expression HNF1α, HNF1β and HNF4α. mRNA levels of (A) HNF1α, (B) HNF1β, (C) HNF4α and (D) GATA6 were measured with RT-qPCR. 18S RNA was used as normalization control. (E) Protein levels of HNF1α, HNF1β and HNF4α were detected with Western blot. GAPDH was detected for input control. The relative band intensities of HNF1α, HNF1β and HNF4α were calculated by dividing them with GAPDH bands and were normalized to Ctrl cells. For (A)-(D), one-way ANOVA multiple comparisons test was used to evaluate the statistical significance of the difference between Ctrl and KO1 or KO2. ** P<0.01, *** P<0.001, **** P<0.0001. ns, not significant. HNF1α, HNF1β, and HNF4α are core transcription factors that establish a complex and interdependent regulatory network during liver and pancreas development [ 74 , 75 ]. Particularly in hepatocytes, HNF1α and HNF1β can transcriptionally promote the expression of HNF4α [ 76 ]. In return, HNF4α promotes HNF1α’s expression [ 77 , 78 ] and transcriptional activity [ 79 ]. This network in lung cells is unclear. We found that the mRNA levels of HNF1α ( Fig. 6A ) and HNF4α ( Fig. 6C ) were also downregulated in KO1 and KO2 cells. Western blot analysis showed that the protein levels of HNF1α, HNF1β and HNF4α were reduced in KO1 and KO2 cells compared to Ctrl cells ( Fig. 6E ). These results suggest that endogenous SAMHD1 maintains the expression of the HNF1α, HNF1β and HNF4α in Calu-3 cells. HNF1α and HNF1β promote endogenous ACE2 expression in Calu-3 cells Whether HNF1α, HNF1β and HNF4α controlled the endogenous ACE2 expression in Calu-3 cells was unclear. To address this question, HNF1α, HNF1β and HNF4α were knocked down individually in Calu-3 cells. Dicer-substrate siRNAs (DsiRNA) transfection efficiently reduced the target gene expression by more than 50% ( Fig. 7A - 7C and S4A). We noticed that knocking down HNF1β, but not HNF1α, suppressed HNF4α mRNA and protein expression in Calu-3 cells. Knocking down HNF4α suppressed HNF1α mRNA but not protein ( Fig. 7B and 7C ). Regarding endogenous ACE2 expression, we found that knocking down HNF1α and HNF1β, but not HNF4α, significantly suppressed ACE2 protein expression ( Fig. 7A - 7B and S4A). Interestingly, only knocking down HNF1α led to a significant reduction of ACE2 mRNA expression ( Fig. 7C ). Knocking down HNF1β suppressed ACE2 protein expression ( Fig. 7A - 7B , S4A) but not mRNA expression in Calu-3 cells ( Fig. 7C ). Finally, we found that knocking down either HNF1α or HNF1β significantly suppressed SARS-CoV-2 infection in Calu-3 cells ( Fig. 7D ). Therefore, HNF1α and HNF1β are required to promote the expression of ACE2 and support SARS-CoV-2 infection in Calu-3 cells. Download figure Open in new tab Figure 7. Knocking down HNF1α and HNF1β downregulates ACE2 expression and suppresses SARS-CoV-2 infection. (A) ACE2, HNF1α, HNF1β or HNF4α proteins of Calu-3 cells (4 x 10 5 ) treated with DsiRNA (24 pmol, 72 hpt) targeting HNF1α, HNF1β, HNF4α or NC were detected with Western blot. GAPDH was detected for input control. A representative blot was shown. (B) ACE2, HNF1α, HNF1β or HNF4α protein band intensities of three independent experiments (i.e. (A) and Supplementary S4A) were quantified by densitometry analysis and divided by GAPDH and normalized to NC control. (C) Cells were treated similarly as in (A). The mRNA levels of ACE2 (primer pair 1, Table S5), HNF1α, HNF1β or HNF4α were quantified with RT-qPCR. 18S RNA was used as normalization control. (D) Calu-3 cells (3.2 x 10 6 ) transfected DsiRNA (192 pmol, 72 hpt) targeting HNF1α, HNF1β or NC were infected with authentic SARS-CoV-2 at MOI=0.05. Released viral progenies in culture supernatants were quantified with plaque assay. Biological triplicate experiments were performed. For (B-C), unpaired T-test was used to evaluate the statistical significance of the difference between sample groups and NC. For (D), two-way ANOVA multiple comparisons test was performed comparing Ctrl and KO1 or KO2 at various time points. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001. ns, not significant. HNF1-dependent ACE2 expression is suppressed in SAMHD1 KO Calu-3 cells We hypothesized that the functions of HNF1α and HNF1β in promoting endogenous ACE2 expression was suppressed in the SAMHD1 KO Calu-3 cells. To test the hypothesis, transient HNF1α and HNF1β knockdown was performed in SAMHD1 KO cells to examine if the ACE2 expression was less dependent on HNF1α and HNF1β when their expression was suppressed upon SAMHD1 deficiency. We found that HNF1α and HNF1β protein expression in KO1 and KO2 cells could still be suppressed by DsiRNA knockdown despite their lower expression levels compared to Ctrl cells ( Fig. 8A - 8C and S4B). Knocking down HNF1α and HNF1β significantly reduced ACE2 protein expression in Ctrl cells ( Fig. 8A , 8D and S4B). In the case of KO1 and KO2 cells, the suppression of ACE2 protein expression by HNF1α and HNF1β knockdown was mitigated. Knocking down HNF1α, but not HNF1β, reduced ACE2 mRNA expression in Ctrl cells ( Fig. 8E ). In contrast, HNF1α knockdown was less potent in further suppressing ACE2 mRNA in KO1 and KO2 cells ( Fig. 8E ). Given that endogenous ACE2 expression was more dependent on HNF1α and HNF1β in Calu-3 Ctrl cells ( Fig. 8D and 8E ), our data suggest that SAMHD1 expression promotes HNF1-dependent ACE2 expression in Calu-3 cells. Download figure Open in new tab Figure 8. SAMHD1 deficiency mitigates the effect of HNF1α and HNF1β knockdown in further suppressing ACE2 expression. (A) ACE2, HNF1α and HNF1β proteins of Ctrl, KO1 or KO2 cells (2 x 10 5 ) treated with DsiRNA (12 pmol, 72 hpt) targeting HNF1α, HNF1β or NC were detected with Western blot. GAPDH was detected for input control. A representative blot was shown. (B) HNF1α, (C) HNF1β and (D) ACE2 protein band intensities of three independent experiments (i.e. (A) and Supplementary S4B) were quantified by densitometry analysis, divided by GAPDH bands and normalized to Ctrl NC. (E) Cells were treated similarly as in (A). The mRNA levels of ACE2 (primer pair 1, Table S5) were quantified with RT-qPCR. 18S RNA was used as normalization control. One-way ANOVA multiple comparisons test was used to evaluate the statistical significance of the difference between sample groups. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001. ns, not significant. Discussion In this study, we investigated the role of SAMHD1 in SARS-CoV-2 infection of Calu-3 cells, which expressed endogenous ACE2 and supported productive viral replication. Similar to our previous study using other cell types [ 32 ], SARS-CoV-2 replication was enhanced in SAMHD1 expressing Calu-3 cells. Previous study showed that inhibition of IFN signaling by the JAK1/2 inhibitor baricitinib alleviated the replication restraint of SARS-CoV-2 in HEK293T cells with SAMHD1 KO [ 32 ], while in the current study, baricitinib treatment did not promote SARS-CoV-2 replication in SAMHD1 KO Calu-3 cells. We noticed that baricitinib treatment promoted the intracellular viral N RNA and protein levels of SARS-CoV-2 in Calu-3 Ctrl cells but did not change the production of infectious progeny viruses. In contrast, baricitinib treatment enhanced neither the viral RNA nor viral protein levels in SAMHD1 KO1 and KO2 cells, suggesting that some fundamental mechanisms to SARS-CoV-2 replication were disrupted in KO1 and KO2 cells rather than IFN signaling. HEK293T cells support productive replication of SARS-CoV-2 despite negligible expression of ACE2 and TMPRSS2 [ 80 – 82 ]. Through a CRISPR/Cas9 KO library screen, an alternative viral receptor TMEM106B was found to be required for SARS-CoV-2 replication in HEK293T cells [ 82 ]. In contrast, SARS-CoV-2 infection in Calu-3 cells exhibits a strong dependence on ACE2 expression, as evidenced by multiple CRISPR/Cas9 library screens where ACE2 was consistently the most critical host factor identified [ 71 – 73 ]. We found that compared to other known viral entry factors, ACE2 expression was significantly reduced in SAMHD1 KO Calu-3 cells, with consistent results observed in both the KO1 and KO2 lines. SAMHD1 KO significantly hindered SARS-CoV-2 S protein-mediated viral entry in Calu-3 cells; however, once this barrier was bypassed by VSV-G pseudotyping, the single-cycle infection of SARS-CoV-2 replicon was restored. Therefore, SAMHD1 KO abolished ACE2-dependent and S-mediated viral entry which is required for SARS-CoV-2 infection of Calu-3 cells, but not HEK293T cells. We questioned how SAMHD1 promoted ACE2 expression in Calu-3 cells. We found that SAMHD1 KO repressed ACE2 mRNA expression in Calu-3 cells, but ACE2 mRNA stability was unaffected. This suggests that SAMHD1 KO might pre-transcriptionally or transcriptionally suppress ACE2 mRNA expression. We found that SAMHD1 KO suppressed the expression levels of HNF1α and HNF1β, which in turn downregulated the expression of ACE2 and SARS-CoV-2 infection. We functionally validated the inhibition of HNF1-mediated endogenous ACE2 expression in SAMHD1 KO Calu-3 cells. To the best of our scope, this is the first study functionally confirming the role of HNF1α and HNF1β in promoting ACE2 expression in lung epithelial cells. Interestingly, although HNF1α and HNF1β were previously defined to be transcription factors of ACE2 by binding to the HNF1 response element of the proximal promoter [ 64 , 65 ], we found that only HNF1α was required for ACE2 mRNA expression in Calu-3 cells. HNF1β was however required for ACE2 protein but not mRNA expression. These findings implied that SAMHD1 KO contributed to suppress ACE2 mRNA and protein levels through downregulation of HNF1α and HNF1β expression, respectively (summarized mechanisms in Fig. 9 ). Download figure Open in new tab Figure 9. SAMHD1 promotes SARS-CoV-2 infection via HNF1-mediated ACE2 expression. SAMHD1 supports the expression of HNF1α and HNF1β which respectively promote mRNA and protein expression of ACE2 in human lung epithelial cells (Calu-3). Upon infection, SARS-CoV-2 binds to ACE2 receptor via its surface spike protein to initiate viral entry. In the absence of SAMHD1 expression (i.e. SAMHD1 KO), cellular stresses are induced such as proinflammatory cytokine expression (thunder symbols). The expression levels of HNF1α and HNF1β are reduced. In turn, ACE2 expression is reduced which blocks SARS-CoV-2 infection via spike protein-mediated viral entry. Whether and how proinflammatory cytokines produced by SAMHD1 KO Calu-3 cells (e.g. IL-6, IL-1, CSF2, or IL-11) suppress HNF-1-mediated ACE2 expression remains unclear and requires further studies. It is still in question how SAMHD1 promotes the expression and activity of HNF1α and HNF1β in driving ACE2 expression. SAMHD1 is a nuclear protein that has not been identified to have direct transcriptional function. SAMHD1 mainly interacts with single-stranded RNA or DNA but had low affinity to double-stranded DNA [ 83 , 84 ]. It is possible that SAMHD1 depletion may have created some cellular stresses that inhibit the expression of HNF1α and HNF1β. We found that SAMHD1 KO Calu-3 cells spontaneously express higher IL-6 than Ctrl cells. Indeed, the expression of several proinflammatory cytokines including IL-1α, IL-1β, CSF2 and IL-11 were also upregulated in both KO1 and KO2 clones (Table S2). Some studies suggest that HNF1α and HNF1β expressions are suppressed upon inflammation. Firstly, the expression of HNF1α in hepatocytes was suppressed through a positive feedback circuit when mice were treated with dimethylnitrosamine that induced liver inflammation followed by hepatic fibrogenesis [ 85 ]. Secondly, the expression of HNF1β was downregulated by IFN-γ in kidney cells HK-2, while lipopolysaccharide injection downregulated HNF1β expression in mouse kidney cells [ 86 ]. Thirdly, we found that HNF4α knockdown reduced HNF1α mRNA expression in Calu-3 cells although the protein change was not observed ( Fig. 7A - 7C ). One recent study suggests HNF4α is transcriptionally suppressed by inflammatory stimuli such as IL-6 and IL-1β in differentiated HepaRG cells [ 87 ]. It is possible that the enhanced expression of proinflammatory cytokines of SAMHD1 KO Calu-3 cells suppresses HNF4α expression, thereby decreasing the expression of HNF1α. We also found that HNF1β positively regulated HNF4α expression ( Fig. 7B - 7C ). It is possible that HNF1β plays an upstream role in the expression of HNF1α and HNF4α in Calu-3 cells. SAMHD1 expression prevents spontaneous proinflammatory cytokine production mainly through inhibition of NF-kB signaling [ 25 , 28 ] and preventing RIG-I like receptor signaling and cGAS-STING activation by self-RNA or self-DNA species [ 17 – 24 ]. Therefore, SAMHD1 expression maintains innate immune homeostasis, which sustains the endogenous expressions of HNF1α and HNF1β to support ACE2 expression. Further investigation is needed to confirm the idea. We noticed that several cell surface proteins and proteins related to extracellular matrix distinguished SAMHD1 KO Calu-3 cells from Ctrl cells through the PCA (Fig. S2C). Similarly, gene ontology (GO) enrichment analysis (GOEA) of cellular components to the 681 common DEGs of SAMHD1 KO Calu-3 cells suggest that cell periphery was the best enriched term having the lowest FDR-adjusted P value (Fig. S5 and table S3). Among the top ten GO terms, four terms were correlated with cell surface membranes in addition to cell periphery (including plasma membrane, apical plasma membrane and cell surface) while five terms were correlated with extracellular matrix (including extracellular matrix, external encapsulating structure, extracellular region, extracellular space, collagen-containing extracellular matrix). Although we did not observe any validated SARS-CoV-2 entry factors on the 681 common DEGs except ACE2, TMPRSS2 and furin in which only ACE2 was found to be consistently downregulated in both KO1 and KO2 clones, it might be possible that the changes in cell surface and extracellular matrix structures contribute to the suppressed SARS-CoV-2 infection and viral entry in SAMHD1 KO Calu-3 cells. Any combinatorial effects of the DEGs contributing to the changes in cell surface and extracellular structures that may potentially suppress SARS-CoV-2 infection shall be valuable in future investigation (Table S4). Why SAMHD1 depletion affected the expression of so many genes encoding cell surface and extracellular matrix proteins remains unclear. One study suggests SAMHD1 expression promotes focal adhesion kinase (FAK) signaling by binding to cortactin, and in turn activated Rac family small GTPase 1 (Rac1)-mediated lamellipodia formation in human clear cell renal cell carcinoma [ 88 ]. It is possible that SAMHD1 KO Calu-3 had lower activity of FAK and Rac-1. Interestingly, Rac-1 was found to promote SARS-CoV-2 entry via macropinocytosis in ACE2-expressing cells [ 89 ]. Thus, SAMHD1 may enhance SARS-CoV-2 infection by macropinocytosis through cortactin, FAK and Rac-1, in addition to promoting HNF1-mediated ACE2 expression. Further investigation is required for the detailed mechanism by which SAMHD1 promotes SARS-CoV-2 infection in physiologically relevant cell types. We were surprised to find that only KO2 but not KO1 clone had spontaneous IFN-I responses ( Fig. 1C ). Indeed, based on PCA, KO2 cells were clustered away from Ctrl and KO1 cells mainly by several ISGs (Fig. S2C). IFN-I production requires activation of IRF3/7 in addition to NF-κB signal pathway [ 90 ]. KO1 cells exhibited complete absence of SAMHD1 protein since expression was abolished with sgRNA1 frameshifting exon 1 at 11 Lysine ( Fig. 1A , 1B and S1A). KO2 cells may express a truncated protein consisting of the first 1-149 amino acids of SAMHD1. Whether the truncated SAMHD1 protein (aa. 1-149) contributes to IFN-I activation and ISG expression in Calu-3 cells is unclear and will require further investigation. In summary, we found that SAMHD1 is a proviral factor to SARS-CoV-2 infection in Calu-3 cells by enhancing S protein-mediated viral entry through maintaining HNF1-mediated ACE2 expression. Our study shed light on a novel function and mechanism of SAMHD1 in facilitating SARS-CoV-2 infection in lung epithelial cells. Materials and Methods Cell culture Cell culture was performed as previously described [ 91 , 92 ]. The original wildtype Calu-3 cells were obtained from ATCC (HTB-55™). Wild-type Calu-3 cells as well as Ctrl, KO1 and KO2 cells were maintained in DMEM/F12 (ThermoFisher Scientific, Cat. no. 11320033) with 20% FBS, 100 U/mL penicillin (Gibco, Cat. no. 15140122), and 100 µg/mL streptomycin (Gibco, Cat. no. 15140122). Huh7.5 cells were kindly provided by Dr. Balaji Manicassamy (University of Iowa) [ 41 ]. Vero-hTMPRSS2 cells were cultured in DMEM (ThermoFisher Scientific, Cat. no. 11965092) with 10% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin and 5 μg/mL blasticidin (Gibco, Cat. no. A1113903) as previously described [ 93 ]. Huh7.5 cells were cultured in DMEM with 10% FBS, 100 U/mL penicillin, 100 µg/mL streptomycin. Actinomycin D (SellekChemicals, Cat. no. S8964), remdesivir (MCE, Cat. no.: HY-104077) and baricitinib (MCE, Cat. no.: HY-15315) were dissolved in dimethyl sulfoxide (DMSO) and stored at -20°C. Generation of SAMHD1 KO Calu-3 cells SAMHD1 KO Calu-3 cells were generated similarly as previously described with some modifications [ 91 , 92 ]. Briefly, third generation lentiviral particles were rescued from HEK293T cells (1 x 10 7 ) transfected with lentiCRISPR v2-puro empty vector, lentiCRISPR v2-puro-sgRNA1, or lentiCRISPR v2-puro-sgRNA2 together with psPAX2, and pMD2.G (ratio 4:3:1) by PEI (1:5 ratio). The target sequence of sgRNA 1 guided SpCas9 cutting at exon 1 of SAMHD1 gene (chr20: 36,951,611/36,951,612) while that of sgRNA 2 targeted SpCas9 for exon 4 (chr20: 36,935,087/36,935,088). The template sequence for sgRNA1 was 5’- GTCATCGCAACGGGGACGCTTGG and sgRNA2 was 5’-CTTCGATACATCAAACAGCTGGG . At 24 hrs post-transfection (hpt), the culture supernatant was replenished with fresh media. At 72 hpt, the 12 mL culture supernatant was cleared by 500 x g 5 min centrifugation followed with 0.45 µm filtering and concentrated by lenti-concentrator (ORIGENE, Cat. no TR30026) into 1mL media. A day before transduction, 4 x 10 5 Calu-3 cells were seeded in 12 well plates. On the day of transduction, the culture supernatant of the Calu-3 cells was replaced with the 1mL concentrated virus. At 24 hpi, the culture supernatant was replaced with fresh DMEM/F12 with 20% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin. At 72 hpi, cells were selected against 1 µg/mL puromycin. The survival cells of the transduced populations were purified by limited dilution on a 96 well plate. Finally, the purified cell clones were verified for expression of SAMHD1 and genotyping. RNA interference and transfection DsiRNAs were oligo-duplex and the sequences were predesigned by Integrated DNA Technologies (IDT) [ 94 ]. Cells were transfected with DsiRNA with Lipofectamine RNAiMAX Reagent (ThermoFisher Scientific, Cat. no. 13778150). In brief, equal volume of OPTIMEM- (Gibco, Cat. no. 31985070) diluted DsiRNA (150 µl for 24 well format and 300 µl for 12 well format) and OPTIMEM-diluted lipofectamine RNAiMAX (1:3 ratio) were mixed and incubated for 20 min at room temperature. Cell suspension (0.5 mL in 24 well format and 1 mL in 12 well format) was mixed with the 600 µl DsiRNA/lipofectamine RNAiMax complex. At 24 hpt, culture supernatant was replaced with fresh medium. Cells were harvested at indicated time points. The DsiRNA sequences used in the current study were listed in Table S5. Virus stocks Authentic SARS-CoV-2 (Wuhan-Hu-1) was rescued from Vero-hTMPRSS2 transfected with bacterial artificial chromosome carrying SARS-CoV-2 genome (BAC-SARS-CoV-2) as previously described with some modifications [ 95 ]. In brief, 1 x 10 7 Vero-hTMPRSS2 cells were seeded in a T75 flask a day before transfection without blasticidin. Vero-hTMPRSS2 cells were transfected with 10 µg BAC-SARS-CoV-2 with lipofectamine 3000 (ThermoFisher Scientific, Cat. no. L3000008). At 24 hpi, the culture supernatant was replaced with serum-free DMEM. At 72 hpi, 80% cytopathic effect was observed. The crude culture supernatant was collected for one freeze-thaw cycle. Then, the supernatant was cleared by pelleting debris at 2,000 x g, 10 min, 4°C. The viral containing supernatant was aliquoted and frozen at -80°C for subsequent studies. ΔS-VRP(G) was rescued from Huh7.5 transfected with BAC carrying spike-defective SARS-CoV-2 genome (BAC-ΔS-Gluc-T2A-nGFP) together with VSV-G expression plasmid similarly as previously described [ 41 , 96 ]. HIV-1-spike-Luc/ZsGreen (BEI resources, Cat. no. NR-53818) was a generous gift donated by Dr. Jesse Bloom (Fred Hutchinson Cancer Center) and Dr. Alejandro Benjamin Balazs (Harvard University) and available on BEI resources. The titration of the stock batch (Lot: 70042784) was 4.99 × 10 5 relative luciferase tissue culture infectious dose 50% (TCID 50 ) units in HEK293-hACE2 cells at 48 hpi. Virus infection assays For authentic SARS-CoV-2, cells were seeded a day prior to infection. The culture supernatant was replaced with serum free DMEM prior to infection. Then, the cells were incubated with SARS-CoV-2 at appropriate MOI for 1 hr. Then, the virus inoculum was aspirated. The cells were washed twice with DPBS (Gibco, Cat. no. 14190144). Then, cells were replenished with serum free DMEM. The culture supernatants or infected cells were harvested at indicated time points. For ΔS-VRP(G), cells were infected as previously described [ 41 , 96 ] and similarly as that of the authentic SARS-CoV-2 but with 2 hr virus inoculation instead of 1 hr. After virus inoculation, infected cells were washed twice with DPBS. Cells were then replenished with DMEM/F12 with 20% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin. The culture supernatants or infected cells were harvested at indicated time points. For HIV-1-spike-Luc/ZsGreen, cells were infected as previously described [ 43 , 44 ]. Cells were incubated with the virus in the presence of 5 µg/ml polybrene for 1 hr in DMEM/F12 with 20% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin. Then, virus inoculum was removed. Fresh DMEM/F12 with 20% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin was added. At 48 hpi, infected cells were harvested for downstream analysis. Plaque assay A day before infection, 4 x 10 5 or 8 x 10 5 Vero-hTMPRSS2 cells were seeded respectively on 12- or 6-well plates. Vero-hTMPRSS2 cells were infected with serially diluted viral stocks for 1 hr. Then, the virus inoculum was removed. Infected cells were overlayed with 1% agarose in DMEM/ DPBS (1:1). At 72 hpi, infected cells were overnight fixed with 4% paraformaldehyde/PBS (ThermoFisher Scientific, Cat. no. J19943.K2). Then, the overlay was removed, and the cells were stained with 0.5% crystal violet in 10% methanol for at least 5 min. Plaques were visualized. Virus concentration was calculated based on the number of plaques in the countable dilution. Viral copy number detection Viral RNA was extracted by RNeasy Plus kit (QIAGEN, Cat. no. 74134) in which viral containing solutions and RLT plus lysis buffer was in 1:4 ratio. Viruses were lysed in RLT plus lysis buffer for 10 min at room temperature. The purified viral RNA was reverse transcribed using the iScript cDNA Synthesis Kit (BIO-RAD, Cat. no. 1708891). Viral RNA was detected by the qPCR primer pair targeting the viral RdRP (Table S5) with iTaq™ Universal SYBR® Green Supermix (BIO-RAD, Cat. no.1725124) [ 97 , 98 ]. Standard curve for the number of single stranded DNA against Ct value was generated using the BAC-SARS-CoV-2 DNA. The copy number of single stranded RNA was estimated from the copy number of cDNA in each sample. Genomic DNA sequencing The genome DNA of Ctrl, KO1 and KO2 cells were purified with DNeasy Blood and Tissue Kits for DNA Isolation (QIAGEN, Cat. no. 69504). Exon 1 and exon 4 regions encompassing the Cas9 cleavage sites were amplified by Phusion High-Fidelity DNA Polymerase (NEB, Cat. no. M0530L). The sequences of the PCR primer pair for amplifying exon 1 was 5’- CGAAGGGCTCAACTGTCAGT (forward) and 5’-CTCGGGTCTTCCTTTCCTCG (reverse) and that of exon 4 was 5’-TGATCTGTCTGGTAGTGATACCT (forward) and 5’- CGATTGTGTGAAGCTCCTGG (reverse). Then, the PCR products were submitted for sanger sequencing services provided by Genomics Division of Iowa Institute of Human Genetics (University of Iowa) using the forward primers. Cellular dATP detection Cellular dATP levels were measured by a single nucleotide RT incorporation assay previously described [ 37 , 40 , 92 ]. In brief, 2 x 10 6 cells were harvested for dNTP extraction with 50% methanol. Methanol extract was dried at 80°C for 1 hr and then reconstituted in reaction buffer at appropriate dilution within linear range of the assay as previously described for dATP levels detection. The levels of cellular dATP were calculated by extrapolating the relative band intensity to the standard curve created by the parallel reactions. Western blot analysis Upon harvest, cells were washed once with DPBS and lysed with 1 x cell lysis buffer (Cell Signaling Technology, Cat. no. 9803) with phosphatase and protease inhibitor (ThermoFisher Scientific, Cat. no. A32961) for 10 to 30 min until complete lysis. Cell debris was removed by centrifugation at 16.1 kg for 10 min at 4°C. Total protein concentration was estimated by Pierce™ BCA Protein Assay Kit (ThermoFisher Scientific, Cat. no. 23225). Protein samples with normalized total protein levels were mixed with 5 x protein sample buffer (0.25 M Tris-Cl pH 6.8, 20% glycerol, 10% SDS and 1% saturated bromophenol blue) to the final concentration of 1 x and heat-denatured at 98°C for 10 min. Cellular protein (10 to 25 µg) was loaded onto polyacrylamide gels for Western blot analysis as previous described [ 91 ]. Primary antibodies used were as follows: Anti-GAPDH (BIORAD, Cat. no. AHP1628), anti-viral N (BEI resources, Cat. no. NR-56223), anti-viral S (ThermoFisher Scientific, Cat. no. PA5114451), anti-SAMHD1 (Abcam, Cat. no. ab117908), anti-STAT1 (Cell Signaling Technology, Cat. no. 9172T), anti-p-STAT1 (Cell Signaling Technology, Cat. no. 8826T), anti-ACE2 (Cell Signaling Technology, Cat. no. 92485T), anti-TMPRSS2 (Santa Cruz Biotechnology, Cat. no. sc-515727), anti-HNF1α (Cell Signaling Technology, Cat. no. 89670T), anti-HNF1β (Proteintech, Cat no. 12533-1-AP) and anti-HNF4α (Cell Signaling Technology, Cat. no.3113T). For secondary antibody, goat anti-mouse IgG (H+L) HRP (Promega, Cat. no. W4021) or goat anti-rabbit IgG (H+L) HRP (Promega, W401B) was used. Immunoblots were developed with Odyssey Fc Imager. Protein band intensity was quantified by Image Studio™. RNA extraction and RT-qPCR Cellular RNA extraction was performed with RNeasy Plus Kits according to the manufacturer’s instructions. Upon harvest, cells were washed once with DPBS and lysed with RLT plus lysis buffer. After column purification, 1 µg of purified RNA was used for reverse transcription through iScript cDNA Synthesis Kit. The cDNA product was used for qPCR quantification with iTaq Universal SYBR Green supermix. SYBR signal was quantified by QuantStudio™ 3 Real-Time PCR or CFX Duet Real-Time PCR System. The qPCR primer pairs were either previously designed (including Viral E [ 99 ], 18S RNA [ 100 ], IL-6 [ 25 ], OAS1 [ 101 ], ACE2 and dACE2 [ 55 ]), predesigned by PrimerBank [ 102 ] or designed in-house based on NCBI primer-BLAST with Primer3 adjustment (Table S5). Luciferase detection To detect secreted Guassia luciferease activity, 20 µl of culture supernatant was incubated with 50 µl of the working solution of Pierce™ Gaussia Luciferase Flash Assay Kit (ThermoFisher Scientific, Cat. no. 16158) for quantification of the resulting chemiluminescence following manufacturer’s instruction. To detect cellular firefly luciferase 2 activity, cells were washed once with DPBS and lysed in 1 x passive lysis buffer (Promega, Cat. no. E1941) supplemented with phosphatase and protease inhibitor. At 30 min lysis, cell debris were removed by centrifugation at 16.1 kg for 10 min at 4°C. Total protein concentration was estimated by Pierce™ BCA Protein Assay Kit. 10 µl of the PLB lysate was incubated with 100 µl of LAR-II substrate reagent of the Dual-Luciferase® Reporter Assay System following manufacturer’s instruction to quantify the resulting chemiluminescence (Promega, Cat. no. E1980). The cellular firefly luciferase 2 activities were calculated as follow: (RLU infected per one microgram protein) – (RLU uninfected per one microgram protein). mRNA-sequencing Calu-3 Ctrl, KO1 and KO2 cells (8 x 10 5 ) were seeded in 6 well plates in biological triplicate. Cells were cultured in 2 mL DMEM/F12 with 20% FBS, 100 U/mL penicillin, and 100 µg/mL streptomycin. At 20 hrs after seeding, cells were washed once with DPBS and lysed with RLT plus lysis buffer. Cellular RNA was purified with RNeasy Plus kit following manufacturer’s instructions. All RNA samples got RNA integrity Number (RIN) scores equal to or more than 9.9 as determined by Agilent BioAnalyzer by Genomics Division of Iowa Institute of Human Genetics (University of Iowa). The subsequent steps of the mRNA-Seq were performed by the Genomics Division using manufacturer recommended protocols. Briefly, at least 500 ng of DNase I-treated total RNA was used to prepare sequencing libraries using the Illumina stranded mRNA library preparation kit (Illumina, Cat. no. 20040534). Barcoded libraries were quantified using a Qubit fluorometer (ThermoFisher Scientific) and pooled together to give the same molar concentration per sample. The pooled libraries were sequenced on the Element AVITI24 sequencing platform on a Cloudbreak FS 150 cycle (2 x 75 bp) medium output sequencing flow cell (Element Biosciences, Cat. no. 860-00014) to generate at least 30M paired-end sequencing reads per sample. The raw base files were converted to FASTQ files using the Bases2fastq v2.1 tool. The mRNA-seq data have been deposited in the Gene Expression Omnibus (GEO) and an accession number will be obtained. Bioinformatic analysis for mRNA-sequencing The bioinformatic analysis to the raw FASTQ data obtained from mRNA-sequencing was performed by Bioinformatics Division, Iowa Institute of Human Genetics (University of Iowa). In brief, PCA including PCA plot, PCA biplot and DEG analysis were generated by SALMON DeSeq2. Pathway analysis including GOEA was performed by iPathwayGuide platform (ADVAITABIO). Statistical analysis At least biological triplicate was performed for each experiment throughout the study. Statistical analysis was performed by GraphPad Prism. For the dataset of the mRNA-seq experiment, FDR-adjusted P value was obtained. Only changes that had P values less than 0.05 were considered statistically significant. Author Contributions Conceptualization: Pak Hin Hinson Cheung, Li Wu. Data curation: Pak Hin Hinson Cheung, Shravya Honne. Formal analysis: Pak Hin Hinson Cheung, Shravya Honne. Funding acquisition: Li Wu, Baek Kim, Stanley Perlman. Investigation: Pak Hin Hinson Cheung, Shravya Honne. Methodology: Pak Hin Hinson Cheung, Pearl Chan, Hua Yang, Baek Kim, Li Wu. Project administration: Li Wu, Baek Kim. Resources: Li Wu, Pearl Chan, Baek Kim, Stanley Perlman. Supervision: Li Wu, Baek Kim, Stanley Perlman. Writing – original draft: Pak Hin Hinson Cheung, Li Wu. Writing – review & editing: Pak Hin Hinson Cheung, Hua Yang, Pearl Chan, Li Wu. Funding This work was supported in part by National Institutes of Health grants R21AI181742 (to L.W.), R01AI129269 (to S.P.), and R01AI136581 and R01AI162633 (to B.K.). L.W. is also supported by the NIH grants R01AI189220, R33AI169659, and P30CA086862-25S1. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Figure legends of 5 supplementary figures Download figure Open in new tab Supplementary Fig. S1. Validation of SAMHD1 deficiency in SAMHD1 KO Calu-3 cells. (A and B) The sanger sequencing results to the regions of SpCas9 cleavage sites directed by respectively sgRNA1 or sgRNA2 of (A) KO1 and (B) KO2 cells were shown and compared with that of the Ctrl cells. Red arrows indicated one base pair insertion near the SpCas9 cleavage site. (C) dATP levels of Calu-3 Ctrl, KO1 or KO2 cells were measured with HIV-1 RT based single nucleotide incorporation assay. For (C), one-way ANOVA multiple comparisons test was used to evaluate the statistical significance of the difference between Ctrl and KO1 or KO2. ** P<0.01. ns, not significant. Download figure Open in new tab Supplementary Fig. S2. PCA clustering of Calu-3 Ctrl, KO1 and KO2 cells based on the mRNA-seq profiles. Nine samples of the mRNA-seq analysis gave nine PCs (i.e. Ctrl, KO1 and KO2 cells, biological triplicate). The influence of each PC was plotted based on their contributing variance (%). The cumulative variances from 1 to 9 were plotted above and joined by a curve. PC1 and PC2 gave 98% coverage of all PCs. (B) Individual samples from Ctrl, KO1 and KO2 cells were plotted along the PC1 and PC2 based on the net scores of loading genes obtained from PCA. (C) A PCA biplot was generated by top ten loading genes influencing PC1 and PC2. Download figure Open in new tab Supplementary Fig. S3. Confirming ACE2 and dACE2 mRNA expressions in SAMHD1 KO Calu-3 cells. The mRNA levels of (A) ACE2 and (B) dACE2 of Ctrl, KO1 and KO2 cells were measured by RT-qPCR with qPCR primer pairs previously described [ 55 ]. For ACE2, primer pair 4 listed in Table S5 was used. Biological triplicate experiment was performed. One-way ANOVA multiple comparisons test was used to evaluate the statistical significance of the difference between Ctrl and KO1 or KO2. ** P<0.01, *** P<0.001. ns, not significant. Download figure Open in new tab Supplementary Fig. S4. Independent experiments performed for protein band calculation of Fig. 7B and Fig. 8B - 8D . The Western blot results to two more independent experiment replicates for the same experiment conducted in Fig. 7A and Fig. 8A were respectively shown in (A) and (B). Download figure Open in new tab Supplementary Fig. S5. Gene ontology enrichment analysis to cellular components to the common DEGs of SAMHD1 KO Calu-3 cells. 681 consistent DEGs obtained from SAMHD1 KO Calu-3 cells as shown in Fig. 4A were used for gene ontology enrichment analysis to the category of “Cellular component”. Top ten GO terms with the best FDR-adjusted P values were plotted on a bubble plot against the rich ratio (i.e. number of DEGs per all annotated genes of the GO term). The number of counts of DEGs was shown in terms of the size of the bubble. The bubble plot was generated with the online resources SR plot ( https://www.bioinformatics.com.cn/srplot ). Information of supplementary Table S1-S5 Supplementary Table S1. DEGs observed in the mRNA-seq data sets on the three comparison pairs (Ctrl vs KO1, Ctrl vs KO2 and KO1 vs KO2 cells). Supplementary Table S2. The 681 common DEGs observed in both Calu-3 KO1 and KO2 cells as shown in Fig. 4A . Supplementary Table S3. All GO terms in the category of “Cellular component” enriched based on the 681 common DEGs shown in Fig. 4A . Supplementary Table S4. Enriched DEGs of the top ten GO terms as shown in Fig. S5. Supplementary Table S5. DsiRNA and RT-qPCR primer sequences and related information. Acknowledgements We thank Drs. Balaji Manicassamy and Patrick Sinn for their invaluable support during this study. We thank Drs. Jesse Bloom and Alejandro Benjamin Balazs for the resources donated to Biodefense and Emerging Infections Research Resources Repository (BEI Resources). The following reagents were obtained through BEI Resources, NIAID, NIH: (1) SARS-Related Coronavirus 2, Wuhan-Hu-1 Spike-Pseudotyped Lentivirus, Luc2/ZsGreen, NR-53818 and (2) Monoclonal Anti-SARS-Related Coronavirus 2 Nucleocapsid Protein (produced in vitro), NR-56223. The mRNA seq data herein were obtained at the Genomics Division (RRID: SCR_023422) and the Bioinformatics Division of the Iowa Institute of Human Genetics which are supported, in part, by the University of Iowa Carver College of Medicine. We also thank Mr. Fernando William Moreira Santana for technical assistance. We appreciate valuable discussions with the members of Dr. Wu’s, Dr. Perlman’s, and Dr. Sinn’s laboratories at the University of Iowa as well as Dr. Constanza Espada from the University of Missouri. Funder Information Declared National Institutes of Health, https://ror.org/01cwqze88 , R21AI181742 (to L.W.), R01AI129269 (to S.P.), R01AI136581 and R01AI162633 (to B.K.) Footnotes Added five Supplementary Table S1-S5 as xslx files. Updated manuscript with high-resolution figures 1-9 and supplementary figures S1-S4. References 1. ↵ Hrecka K , Hao C , Gierszewska M , Swanson SK , Kesik-Brodacka M , Srivastava S , et al. Vpx relieves inhibition of HIV-1 infection of macrophages mediated by the SAMHD1 protein . Nature . 2011 ; 474 ( 7353 ): 658 - 61 . Epub 20110629. doi: 10.1038/nature10195 . PubMed PMID: 21720370 ; PubMed Central PMCID: PMCPMC3179858 . OpenUrl CrossRef PubMed Web of Science 2. Laguette N , Sobhian B , Casartelli N , Ringeard M , Chable-Bessia C , Ségéral E , et al. SAMHD1 is the dendritic- and myeloid-cell-specific HIV-1 restriction factor counteracted by Vpx . Nature . 2011 ; 474 ( 7353 ): 654 - 7 . Epub 20110525. doi: 10.1038/nature10117 . PubMed PMID: 21613998 ; PubMed Central PMCID: PMCPMC3595993 . OpenUrl CrossRef PubMed Web of Science 3. ↵ Baldauf HM , Pan X , Erikson E , Schmidt S , Daddacha W , Burggraf M , et al. SAMHD1 restricts HIV-1 infection in resting CD4(+) T cells . Nat Med . 2012 ; 18 ( 11 ): 1682 – 7 . doi: 10.1038/nm.2964 . PubMed PMID: 22972397 ; PubMed Central PMCID: PMCPMC3828732 . OpenUrl CrossRef PubMed 4. ↵ Sze A , Belgnaoui SM , Olagnier D , Lin R , Hiscott J , van Grevenynghe J . Host restriction factor SAMHD1 limits human T cell leukemia virus type 1 infection of monocytes via STING-mediated apoptosis . Cell Host Microbe . 2013 ; 14 ( 4 ): 422 – 34 . doi: 10.1016/j.chom.2013.09.009 . PubMed PMID: 24139400 . OpenUrl CrossRef PubMed Web of Science 5. ↵ Sommer AF , Rivière L , Qu B , Schott K , Riess M , Ni Y , et al. Restrictive influence of SAMHD1 on Hepatitis B Virus life cycle . Sci Rep . 2016 ; 6 : 26616 . Epub 20160527. doi: 10.1038/srep26616 . PubMed PMID: 27229711 ; PubMed Central PMCID: PMCPMC4882586 . OpenUrl CrossRef PubMed 6. Businger R , Deutschmann J , Gruska I , Milbradt J , Wiebusch L , Gramberg T , et al. Human cytomegalovirus overcomes SAMHD1 restriction in macrophages via pUL97 . Nat Microbiol . 2019 ; 4 ( 12 ): 2260 – 72 . Epub 20190923. doi: 10.1038/s41564-019-0557-8 . PubMed PMID: 31548682 . OpenUrl CrossRef PubMed 7. Zhang K , Lv DW , Li R . Conserved Herpesvirus Protein Kinases Target SAMHD1 to Facilitate Virus Replication . Cell Rep . 2019 ; 28 ( 2 ): 449 – 59 .e5. doi: 10.1016/j.celrep.2019.04.020 . PubMed PMID: 31291580 ; PubMed Central PMCID: PMCPMC6668718 . OpenUrl CrossRef PubMed 8. Kim ET , White TE , Brandariz-Núñez A , Diaz-Griffero F , Weitzman MD . SAMHD1 restricts herpes simplex virus 1 in macrophages by limiting DNA replication . J Virol . 2013 ; 87 ( 23 ): 12949 – 56 . Epub 20130925. doi: 10.1128/jvi.02291-13 . PubMed PMID: 24067963 ; PubMed Central PMCID: PMCPMC3838123 . OpenUrl Abstract / FREE Full Text 9. Sliva K , Martin J , von Rhein C , Herrmann T , Weyrich A , Toda M , et al. Interference with SAMHD1 Restores Late Gene Expression of Modified Vaccinia Virus Ankara in Human Dendritic Cells and Abrogates Type I Interferon Expression . J Virol . 2019 ; 93 ( 22 ). Epub 20191029. doi: 10.1128/jvi.01097-19 . PubMed PMID: 31462561 ; PubMed Central PMCID: PMCPMC6819912 . OpenUrl Abstract / FREE Full Text 10. ↵ James CD , Youssef A , Prabhakar AT , Otoa R , Roe JD , Witt A , et al. Human papillomavirus 16 replication converts SAMHD1 into a homologous recombination factor and promotes its recruitment to replicating viral DNA . J Virol . 2024 ; 98 ( 9 ): e0082624 . Epub 20240828. doi: 10.1128/jvi.00826-24 . PubMed PMID: 39194246 ; PubMed Central PMCID: PMCPMC11406955 . OpenUrl CrossRef PubMed 11. ↵ Zhao Z , Han S , Zhang Q , Wang Y , Yue K , Abbas S , et al. Impaired influenza A virus replication by the host restriction factor SAMHD1 which inhibited by PA-mediated dephosphorylation of the host transcription factor IRF3 . Virol J . 2024 ; 21 ( 1 ): 33 . Epub 20240129. doi: 10.1186/s12985-024-02295-0 . PubMed PMID: 38287375 ; PubMed Central PMCID: PMCPMC10826253 . OpenUrl CrossRef PubMed 12. Zhao Z , Li Z , Huan C , Liu X , Zhang W . SAMHD1 Inhibits Multiple Enteroviruses by Interfering with the Interaction between VP1 and VP2 Proteins . J Virol . 2021 ; 95 ( 13 ): e0062021 . Epub 20210610. doi: 10.1128/jvi.00620-21 . PubMed PMID: 33883225 ; PubMed Central PMCID: PMCPMC8316000 . OpenUrl Abstract / FREE Full Text 13. ↵ An N , Ge Q , Shao H , Li Q , Guo F , Liang C , et al. Interferon-inducible SAMHD1 restricts viral replication through downregulation of lipid synthesis . Front Immunol . 2022 ; 13 : 1007718 . Epub 20221130. doi: 10.3389/fimmu.2022.1007718 . PubMed PMID: 36532074 ; PubMed Central PMCID: PMCPMC9755837 . OpenUrl CrossRef PubMed 14. ↵ Cheung PH , Yang H , Wu L . dNTP depletion and beyond: the multifaceted nature of SAMHD1-mediated viral restriction . J Virol . 2025 ; 99 ( 5 ): e0030225 . Epub 20250425. doi: 10.1128/jvi.00302-25 . PubMed PMID: 40277359 ; PubMed Central PMCID: PMCPMC12090746 . OpenUrl CrossRef PubMed 15. ↵ Chen S , Bonifati S , Qin Z , St Gelais C , Wu L . SAMHD1 Suppression of Antiviral Immune Responses . Trends Microbiol . 2019 ; 27 ( 3 ): 254 – 67 . Epub 20181015. doi: 10.1016/j.tim.2018.09.009 . PubMed PMID: 30336972 ; PubMed Central PMCID: PMCPMC6377309 . OpenUrl CrossRef PubMed 16. ↵ White TE , Brandariz-Nuñez A , Martinez-Lopez A , Knowlton C , Lenzi G , Kim B , et al. A SAMHD1 mutation associated with Aicardi-Goutières syndrome uncouples the ability of SAMHD1 to restrict HIV-1 from its ability to downmodulate type I interferon in humans . Hum Mutat . 2017 ; 38 ( 6 ): 658 – 68 . Epub 20170502. doi: 10.1002/humu.23201 . PubMed PMID: 28229507 ; PubMed Central PMCID: PMCPMC5738905 . OpenUrl CrossRef PubMed 17. ↵ Coquel F , Silva MJ , Técher H , Zadorozhny K , Sharma S , Nieminuszczy J , et al. SAMHD1 acts at stalled replication forks to prevent interferon induction . Nature . 2018 ; 557 ( 7703 ): 57 - 61 . Epub 20180418. doi: 10.1038/s41586-018-0050-1 . PubMed PMID: 29670289 . OpenUrl CrossRef PubMed 18. Maharana S , Kretschmer S , Hunger S , Yan X , Kuster D , Traikov S , et al. SAMHD1 controls innate immunity by regulating condensation of immunogenic self RNA . Mol Cell . 2022 ; 82 ( 19 ): 3712 – 28 .e10. Epub 20220922. doi: 10.1016/j.molcel.2022.08.031 . PubMed PMID: 36150385 . OpenUrl CrossRef PubMed 19. ↵ Rabinowitz J , Vila IK , Luchsinger C , Bertelli C , Schüssler M , Taffoni C , et al. The ability of SAMHD1-deficient monocytes to trigger the Type I IFN response depends on cGAS and mitochondrial DNA . J Biol Chem . 2025 ; 301 ( 8 ): 110430 . Epub 20250626. doi: 10.1016/j.jbc.2025.110430 . PubMed PMID: 40581121 ; PubMed Central PMCID: PMCPMC12312027 . OpenUrl CrossRef PubMed 20. Schumann T , Ramon SC , Schubert N , Mayo MA , Hega M , Maser KI , et al. Deficiency for SAMHD1 activates MDA5 in a cGAS/STING-dependent manner . J Exp Med . 2023 ; 220 ( 1 ). Epub 20221108. doi: 10.1084/jem.20220829 . PubMed PMID: 36346347 ; PubMed Central PMCID: PMCPMC9648672 . OpenUrl CrossRef PubMed 21. Maelfait J , Bridgeman A , Benlahrech A , Cursi C , Rehwinkel J . Restriction by SAMHD1 Limits cGAS/STING-Dependent Innate and Adaptive Immune Responses to HIV-1 . Cell Rep . 2016 ; 16 ( 6 ): 1492 – 501 . Epub 20160728. doi: 10.1016/j.celrep.2016.07.002 . PubMed PMID: 27477283 ; PubMed Central PMCID: PMCPMC4978700 . OpenUrl CrossRef PubMed 22. Rehwinkel J , Maelfait J , Bridgeman A , Rigby R , Hayward B , Liberatore RA , et al. SAMHD1-dependent retroviral control and escape in mice . Embo j . 2013 ; 32 ( 18 ): 2454 – 62 . Epub 20130719. doi: 10.1038/emboj.2013.163 . PubMed PMID: 23872947 ; PubMed Central PMCID: PMCPMC3770946 . OpenUrl Abstract / FREE Full Text 23. Behrendt R , Schumann T , Gerbaulet A , Nguyen LA , Schubert N , Alexopoulou D , et al. Mouse SAMHD1 has antiretroviral activity and suppresses a spontaneous cell-intrinsic antiviral response . Cell Rep . 2013 ; 4 ( 4 ): 689 – 96 . Epub 20130822. doi: 10.1016/j.celrep.2013.07.037 . PubMed PMID: 23972988 ; PubMed Central PMCID: PMCPMC4807655 . OpenUrl CrossRef PubMed Web of Science 24. ↵ Oh C , Ryoo J , Park K , Kim B , Daly MB , Cho D , et al. A central role for PI3K-AKT signaling pathway in linking SAMHD1-deficiency to the type I interferon signature . Sci Rep . 2018 ; 8 ( 1 ): 84 . Epub 20180108. doi: 10.1038/s41598-017-18308-8 . PubMed PMID: 29311560 ; PubMed Central PMCID: PMCPMC5758801 . OpenUrl CrossRef PubMed 25. ↵ Chen S , Bonifati S , Qin Z , St Gelais C , Kodigepalli KM , Barrett BS , et al. SAMHD1 suppresses innate immune responses to viral infections and inflammatory stimuli by inhibiting the NF-κB and interferon pathways . Proc Natl Acad Sci U S A . 2018 ; 115 ( 16 ):E3798-e807. Epub 20180402. doi: 10.1073/pnas.1801213115 . PubMed PMID: 29610295 ; PubMed Central PMCID: PMCPMC5910870 . OpenUrl Abstract / FREE Full Text 26. ↵ Xu B , Sui Q , Hu H , Hu X , Zhou X , Qian C , et al. SAMHD1 Attenuates Acute Inflammation by Maintaining Mitochondrial Function in Macrophages via Interaction with VDAC1 . Int J Mol Sci . 2023 ; 24 ( 9 ). Epub 20230426. doi: 10.3390/ijms24097888 . PubMed PMID: 37175593 ; PubMed Central PMCID: PMCPMC10177872 . OpenUrl CrossRef PubMed 27. ↵ Espada CE , Sari L , Cahill MP , Yang H , Phillips S , Martinez N , et al. SAMHD1 impairs type I interferon induction through the MAVS, IKKε, and IRF7 signaling axis during viral infection . J Biol Chem . 2023 ; 299 ( 7 ): 104925 . Epub 20230614. doi: 10.1016/j.jbc.2023.104925 . PubMed PMID: 37328105 ; PubMed Central PMCID: PMCPMC10404699 . OpenUrl CrossRef PubMed 28. ↵ Yang H , Espada CE , Phillips S , Martinez N , Kenney AD , Yount JS , et al. The host antiviral protein SAMHD1 suppresses NF-κB activation by interacting with the IKK complex during inflammatory responses and viral infection . J Biol Chem . 2023 ; 299 ( 6 ): 104750 . Epub 20230424. doi: 10.1016/j.jbc.2023.104750 . PubMed PMID: 37100289 ; PubMed Central PMCID: PMCPMC10318468 . OpenUrl CrossRef PubMed 29. ↵ Programme WHE . Number of COVID-19 deaths reported to WHO (cumulative total) : World Health Organisation ; 2025 . Available from: https://data.who.int/dashboards/covid19/deaths . 30. ↵ Williams BA , Jones CH , Welch V , True JM . Outlook of pandemic preparedness in a post-COVID-19 world . NPJ Vaccines . 2023 ; 8 ( 1 ): 178 . Epub 20231120. doi: 10.1038/s41541-023-00773-0 . PubMed PMID: 37985781 ; PubMed Central PMCID: PMCPMC10662147 . OpenUrl CrossRef PubMed 31. ↵ Sievers BL , Cheng MTK , Csiba K , Meng B , Gupta RK . SARS-CoV-2 and innate immunity: the good, the bad, and the “goldilocks” . Cell Mol Immunol . 2024 ; 21 ( 2 ): 171 – 83 . Epub 20231120. doi: 10.1038/s41423-023-01104-y . PubMed PMID: 37985854 ; PubMed Central PMCID: PMCPMC10805730 . OpenUrl CrossRef PubMed 32. ↵ Oo A , Zandi K , Shepard C , Bassit LC , Musall K , Goh SL , et al. Elimination of Aicardi-Goutières syndrome protein SAMHD1 activates cellular innate immunity and suppresses SARS-CoV-2 replication . J Biol Chem . 2022 ; 298 ( 3 ): 101635 . Epub 20220125. doi: 10.1016/j.jbc.2022.101635 . PubMed PMID: 35085552 ; PubMed Central PMCID: PMCPMC8786443 . OpenUrl CrossRef PubMed 33. ↵ Ahn JH , Kim J , Hong SP , Choi SY , Yang MJ , Ju YS , et al. Nasal ciliated cells are primary targets for SARS-CoV-2 replication in the early stage of COVID-19 . J Clin Invest . 2021 ; 131 ( 13 ). doi: 10.1172/jci148517 . PubMed PMID: 34003804 ; PubMed Central PMCID: PMCPMC8245175 . OpenUrl CrossRef PubMed 34. ↵ Hui KPY , Ho JCW , Cheung MC , Ng KC , Ching RHH , Lai KL , et al. SARS-CoV-2 Omicron variant replication in human bronchus and lung ex vivo . Nature . 2022 ; 603 ( 7902 ): 715 - 20 . Epub 20220201. doi: 10.1038/s41586-022-04479-6 . PubMed PMID: 35104836 . OpenUrl CrossRef PubMed 35. ↵ Sanjana NE , Shalem O , Zhang F . Improved vectors and genome-wide libraries for CRISPR screening . Nat Methods . 2014 ; 11 ( 8 ): 783 – 4 . doi: 10.1038/nmeth.3047 . PubMed PMID: 25075903 ; PubMed Central PMCID: PMCPMC4486245 . OpenUrl CrossRef PubMed Web of Science 36. ↵ Labun K , Montague TG , Krause M , Torres Cleuren YN , Tjeldnes H , Valen E . CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing . Nucleic Acids Res . 2019 ; 47 ( W1 ): W171 – w4 . doi: 10.1093/nar/gkz365 . PubMed PMID: 31106371 ; PubMed Central PMCID: PMCPMC6602426 . OpenUrl CrossRef PubMed 37. ↵ Diamond TL , Roshal M , Jamburuthugoda VK , Reynolds HM , Merriam AR , Lee KY , et al. Macrophage tropism of HIV-1 depends on efficient cellular dNTP utilization by reverse transcriptase . J Biol Chem . 2004 ; 279 ( 49 ): 51545 – 53 . Epub 20040926. doi: 10.1074/jbc.M408573200 . PubMed PMID: 15452123 ; PubMed Central PMCID: PMCPMC1351161 . OpenUrl Abstract / FREE Full Text 38. ↵ Martinez-Lopez A , Martin-Fernandez M , Buta S , Kim B , Bogunovic D , Diaz-Griffero F . SAMHD1 deficient human monocytes autonomously trigger type I interferon . Mol Immunol . 2018 ; 101 : 450 – 60 . Epub 20180809. doi: 10.1016/j.molimm.2018.08.005 . PubMed PMID: 30099227 ; PubMed Central PMCID: PMCPMC6258080 . OpenUrl CrossRef PubMed 39. Espada CE , St Gelais C , Bonifati S , Maksimova VV , Cahill MP , Kim SH , et al. TRAF6 and TAK1 Contribute to SAMHD1-Mediated Negative Regulation of NF-êB Signaling . J Virol . 2021 ; 95 ( 3 ). Epub 20210113. doi: 10.1128/jvi.01970-20 . PubMed PMID: 33177202 ; PubMed Central PMCID: PMCPMC7925110 . OpenUrl Abstract / FREE Full Text 40. ↵ Qin Z , Bonifati S , St Gelais C , Li TW , Kim SH , Antonucci JM , et al. The dNTPase activity of SAMHD1 is important for its suppression of innate immune responses in differentiated monocytic cells . J Biol Chem . 2020 ; 295 ( 6 ): 1575 – 86 . Epub 20191230. doi: 10.1074/jbc.RA119.010360 . PubMed PMID: 31914403 ; PubMed Central PMCID: PMCPMC7008377 . OpenUrl Abstract / FREE Full Text 41. ↵ Malicoat J , Manivasagam S , Zuñiga S , Sola I , McCabe D , Rong L , et al. Development of a Single-Cycle Infectious SARS-CoV-2 Virus Replicon Particle System for Use in Biosafety Level 2 Laboratories . J Virol . 2022 ; 96 ( 3 ): e0183721 . Epub 20211201. doi: 10.1128/jvi.01837-21 . PubMed PMID: 34851142 ; PubMed Central PMCID: PMCPMC8826801 . OpenUrl CrossRef PubMed 42. ↵ Kokic G , Hillen HS , Tegunov D , Dienemann C , Seitz F , Schmitzova J , et al. Mechanism of SARS-CoV-2 polymerase stalling by remdesivir . Nat Commun . 2021 ; 12 ( 1 ): 279 . Epub 20210112. doi: 10.1038/s41467-020-20542-0 . PubMed PMID: 33436624 ; PubMed Central PMCID: PMCPMC7804290 . OpenUrl CrossRef PubMed 43. ↵ Crawford KHD , Eguia R , Dingens AS , Loes AN , Malone KD , Wolf CR , et al. Protocol and Reagents for Pseudotyping Lentiviral Particles with SARS-CoV-2 Spike Protein for Neutralization Assays . Viruses . 2020 ; 12 ( 5 ). Epub 20200506. doi: 10.3390/v12050513 . PubMed PMID: 32384820 ; PubMed Central PMCID: PMCPMC7291041 . OpenUrl CrossRef PubMed 44. ↵ Crawford KHD , Dingens AS , Eguia R , Wolf CR , Wilcox N , Logue JK , et al. Dynamics of Neutralizing Antibody Titers in the Months After Severe Acute Respiratory Syndrome Coronavirus 2 Infection . J Infect Dis . 2021 ; 223 ( 2 ): 197 - 205 . doi: 10.1093/infdis/jiaa618 . PubMed PMID: 33535236 ; PubMed Central PMCID: PMCPMC7543487 . OpenUrl CrossRef PubMed 45. ↵ Baggen J , Jacquemyn M , Persoons L , Vanstreels E , Pye VE , Wrobel AG , et al. TMEM106B is a receptor mediating ACE2-independent SARS-CoV-2 cell entry . Cell . 2023 ; 186 ( 16 ): 3427 - 42 .e22. Epub 20230707. doi: 10.1016/j.cell.2023.06.005 . PubMed PMID: 37421949 ; PubMed Central PMCID: PMCPMC10409496 . OpenUrl CrossRef PubMed 46. ↵ Liao Z , Wang C , Tang X , Yang M , Duan Z , Liu L , et al. Human transferrin receptor can mediate SARS-CoV-2 infection . Proc Natl Acad Sci U S A . 2024 ; 121 ( 10 ): e2317026121 . Epub 20240226. doi: 10.1073/pnas.2317026121 . PubMed PMID: 38408250 ; PubMed Central PMCID: PMCPMC10927525 . OpenUrl CrossRef PubMed 47. ↵ Wang K , Chen W , Zhang Z , Deng Y , Lian JQ , Du P , et al. CD147-spike protein is a novel route for SARS-CoV-2 infection to host cells . Signal Transduct Target Ther . 2020 ; 5 ( 1 ): 283 . Epub 20201204. doi: 10.1038/s41392-020-00426-x . PubMed PMID: 33277466 ; PubMed Central PMCID: PMCPMC7714896 . OpenUrl CrossRef PubMed 48. ↵ Wang S , Qiu Z , Hou Y , Deng X , Xu W , Zheng T , et al. AXL is a candidate receptor for SARS-CoV-2 that promotes infection of pulmonary and bronchial epithelial cells . Cell Res . 2021 ; 31 ( 2 ): 126 – 40 . Epub 20210108. doi: 10.1038/s41422-020-00460-y . PubMed PMID: 33420426 ; PubMed Central PMCID: PMCPMC7791157 . OpenUrl CrossRef PubMed 49. ↵ Gu Y , Cao J , Zhang X , Gao H , Wang Y , Wang J , et al. Receptome profiling identifies KREMEN1 and ASGR1 as alternative functional receptors of SARS-CoV-2 . Cell Res . 2022 ; 32 ( 1 ): 24 – 37 . Epub 20211126. doi: 10.1038/s41422-021-00595-6 . PubMed PMID: 34837059 ; PubMed Central PMCID: PMCPMC8617373 . OpenUrl CrossRef PubMed 50. ↵ Cantuti-Castelvetri L , Ojha R , Pedro LD , Djannatian M , Franz J , Kuivanen S , et al. Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity . Science . 2020 ; 370 ( 6518 ): 856 - 60 . Epub 20201020. doi: 10.1126/science.abd2985 . PubMed PMID: 33082293 ; PubMed Central PMCID: PMCPMC7857391 . OpenUrl Abstract / FREE Full Text 51. ↵ Khan I , Li S , Tao L , Wang C , Ye B , Li H , et al. Tubeimosides are pan-coronavirus and filovirus inhibitors that can block their fusion protein binding to Niemann-Pick C1 . Nat Commun . 2024 ; 15 ( 1 ): 162 . Epub 20240102. doi: 10.1038/s41467-023-44504-4 . PubMed PMID: 38167417 ; PubMed Central PMCID: PMCPMC10762260 . OpenUrl CrossRef PubMed 52. ↵ Lempp FA , Soriaga LB , Montiel-Ruiz M , Benigni F , Noack J , Park YJ , et al. Lectins enhance SARS-CoV-2 infection and influence neutralizing antibodies . Nature . 2021 ; 598 ( 7880 ): 342 - 7 . Epub 20210831. doi: 10.1038/s41586-021-03925-1 . PubMed PMID: 34464958 . OpenUrl CrossRef PubMed 53. ↵ Ou T , Mou H , Zhang L , Ojha A , Choe H , Farzan M . Hydroxychloroquine-mediated inhibition of SARS-CoV-2 entry is attenuated by TMPRSS2 . PLoS Pathog . 2021 ; 17 ( 1 ): e1009212 . Epub 20210119. doi: 10.1371/journal.ppat.1009212 . PubMed PMID: 33465165 ; PubMed Central PMCID: PMCPMC7845965 . OpenUrl CrossRef PubMed 54. ↵ Essalmani R , Jain J , Susan-Resiga D , Andréo U , Evagelidis A , Derbali RM , et al. Distinctive Roles of Furin and TMPRSS2 in SARS-CoV-2 Infectivity . J Virol . 2022 ; 96 ( 8 ): e0012822 . Epub 20220328. doi: 10.1128/jvi.00128-22 . PubMed PMID: 35343766 ; PubMed Central PMCID: PMCPMC9044946 . OpenUrl CrossRef PubMed 55. ↵ Onabajo OO , Banday AR , Stanifer ML , Yan W , Obajemu A , Santer DM , et al. Interferons and viruses induce a novel truncated ACE2 isoform and not the full-length SARS-CoV-2 receptor . Nat Genet . 2020 ; 52 ( 12 ): 1283 – 93 . Epub 20201019. doi: 10.1038/s41588-020-00731-9 . PubMed PMID: 33077916 ; PubMed Central PMCID: PMCPMC9377523 . OpenUrl CrossRef PubMed 56. ↵ Ng KW , Attig J , Bolland W , Young GR , Major J , Wrobel AG , et al. Tissue-specific and interferon-inducible expression of nonfunctional ACE2 through endogenous retroelement co-option . Nat Genet . 2020 ; 52 ( 12 ): 1294 – 302 . Epub 20201019. doi: 10.1038/s41588-020-00732-8 . PubMed PMID: 33077915 ; PubMed Central PMCID: PMCPMC7610354 . OpenUrl CrossRef PubMed 57. ↵ Ratnadiwakara M , Änkö ML . mRNA Stability Assay Using transcription inhibition by Actinomycin D in Mouse Pluripotent Stem Cells . Bio Protoc . 2018 ; 8 ( 21 ): e3072 . Epub 20181105. doi: 10.21769/BioProtoc.3072 . PubMed PMID: 34532533 ; PubMed Central PMCID: PMCPMC8342049 . OpenUrl CrossRef PubMed 58. ↵ Huang S , Zhao Y , Phillips S , Warrick Julia E , Kearse Michael G , He C , et al. Single-base m6A epitranscriptomics reveals novel HIV-1 host interaction targets in primary CD4+ T cells . Journal of Virology . 2025 ; 0 ( 0 ): e01536 – 25 . doi: 10.1128/jvi.01536-25 . OpenUrl CrossRef 59. ↵ Wang L , Wang S , Wu L , Li W , Bray W , Clark AE , et al. PCIF1-mediated deposition of 5’-cap N(6),2’-O-dimethyladenosine in ACE2 and TMPRSS2 mRNA regulates susceptibility to SARS-CoV-2 infection . Proc Natl Acad Sci U S A . 2023 ; 120 ( 5 ): e2210361120 . Epub 20230123. doi: 10.1073/pnas.2210361120 . PubMed PMID: 36689652 ; PubMed Central PMCID: PMCPMC9945940 . OpenUrl CrossRef PubMed 60. ↵ Hopkins TG , Mura M , Al-Ashtal HA , Lahr RM , Abd-Latip N , Sweeney K , et al. The RNA-binding protein LARP1 is a post-transcriptional regulator of survival and tumorigenesis in ovarian cancer . Nucleic Acids Res . 2016 ; 44 ( 3 ): 1227 – 46 . Epub 20151229. doi: 10.1093/nar/gkv1515 . PubMed PMID: 26717985 ; PubMed Central PMCID: PMCPMC4756840 . OpenUrl CrossRef PubMed 61. ↵ Mura M , Hopkins TG , Michael T , Abd-Latip N , Weir J , Aboagye E , et al. LARP1 post-transcriptionally regulates mTOR and contributes to cancer progression . Oncogene . 2015 ; 34 ( 39 ): 5025 – 36 . Epub 20141222. doi: 10.1038/onc.2014.428 . PubMed PMID: 25531318 ; PubMed Central PMCID: PMCPMC4430325 . OpenUrl CrossRef PubMed 62. ↵ Wang CW , Chuang HC , Tan TH . ACE2 in chronic disease and COVID-19: gene regulation and post-translational modification . J Biomed Sci . 2023 ; 30 ( 1 ): 71 . Epub 20230822. doi: 10.1186/s12929-023-00965-9 . PubMed PMID: 37608279 ; PubMed Central PMCID: PMCPMC10464117 . OpenUrl CrossRef PubMed 63. ↵ Liang LJ , Wang D , Yu H , Wang J , Zhang H , Sun BB , et al. Transcriptional regulation and small compound targeting of ACE2 in lung epithelial cells . Acta Pharmacol Sin . 2022 ; 43 ( 11 ): 2895 – 904 . Epub 20220425. doi: 10.1038/s41401-022-00906-6 . PubMed PMID: 35468992 ; PubMed Central PMCID: PMCPMC9035780 . OpenUrl CrossRef PubMed 64. ↵ Senkel S , Lucas B , Klein-Hitpass L , Ryffel GU . Identification of target genes of the transcription factor HNF1beta and HNF1alpha in a human embryonic kidney cell line . Biochim Biophys Acta . 2005 ; 1731 ( 3 ): 179 – 90 . Epub 20051102. doi: 10.1016/j.bbaexp.2005.10.003 . PubMed PMID: 16297991 . OpenUrl CrossRef PubMed 65. ↵ Pedersen KB , Chhabra KH , Nguyen VK , Xia H , Lazartigues E . The transcription factor HNF1á induces expression of angiotensin-converting enzyme 2 (ACE2) in pancreatic islets from evolutionarily conserved promoter motifs . Biochim Biophys Acta . 2013 ; 1829 ( 11 ): 1225 – 35 . Epub 20131005. doi: 10.1016/j.bbagrm.2013.09.007 . PubMed PMID: 24100303 ; PubMed Central PMCID: PMCPMC3838857 . OpenUrl CrossRef PubMed 66. ↵ Niehof M , Borlak J . HNF4alpha dysfunction as a molecular rational for cyclosporine induced hypertension . PLoS One . 2011 ; 6 ( 1 ): e16319 . Epub 20110127. doi: 10.1371/journal.pone.0016319 . PubMed PMID: 21298017 ; PubMed Central PMCID: PMCPMC3029342 . OpenUrl CrossRef PubMed 67. Chen L , Marishta A , Ellison CE , Verzi MP . Identification of Transcription Factors Regulating SARS-CoV-2 Entry Genes in the Intestine . Cell Mol Gastroenterol Hepatol . 2021 ; 11 ( 1 ): 181 – 4 . Epub 20200815. doi: 10.1016/j.jcmgh.2020.08.005 . PubMed PMID: 32810597 ; PubMed Central PMCID: PMCPMC7428702 . OpenUrl CrossRef PubMed 68. ↵ Han H , Luo RH , Long XY , Wang LQ , Zhu Q , Tang XY , et al. Transcriptional regulation of SARS-CoV-2 receptor ACE2 by SP1 . Elife . 2024 ; 13 . Epub 20240220. doi: 10.7554/eLife.85985 . PubMed PMID: 38375778 ; PubMed Central PMCID: PMCPMC10878691 . OpenUrl CrossRef PubMed 69. ↵ Pedersen KB , Chodavarapu H , Lazartigues E . Forkhead Box Transcription Factors of the FOXA Class Are Required for Basal Transcription of Angiotensin-Converting Enzyme 2 . J Endocr Soc . 2017 ; 1 ( 4 ): 370 – 84 . Epub 20170306. doi: 10.1210/js.2016-1071 . PubMed PMID: 29082356 ; PubMed Central PMCID: PMCPMC5656262 . OpenUrl CrossRef PubMed 70. ↵ Kuan TC , Yang TH , Wen CH , Chen MY , Lee IL , Lin CS . Identifying the regulatory element for human angiotensin-converting enzyme 2 (ACE2) expression in human cardiofibroblasts . Peptides . 2011 ; 32 ( 9 ): 1832 – 9 . Epub 20110816. doi: 10.1016/j.peptides.2011.08.009 . PubMed PMID: 21864606 . OpenUrl CrossRef PubMed 71. ↵ Israeli M , Finkel Y , Yahalom-Ronen Y , Paran N , Chitlaru T , Israeli O , et al. Genome-wide CRISPR screens identify GATA6 as a proviral host factor for SARS-CoV-2 via modulation of ACE2 . Nat Commun . 2022 ; 13 ( 1 ): 2237 . Epub 20220425. doi: 10.1038/s41467-022-29896-z . PubMed PMID: 35469023 ; PubMed Central PMCID: PMCPMC9039069 . OpenUrl CrossRef PubMed 72. ↵ Rebendenne A , Roy P , Bonaventure B , Chaves Valadão AL , Desmarets L , Arnaud-Arnould M , et al. Bidirectional genome-wide CRISPR screens reveal host factors regulating SARS-CoV-2, MERS-CoV and seasonal HCoVs . Nat Genet . 2022 ; 54 ( 8 ): 1090 – 102 . Epub 20220725. doi: 10.1038/s41588-022-01110-2 . PubMed PMID: 35879413 ; PubMed Central PMCID: PMCPMC11627114 . OpenUrl CrossRef PubMed 73. ↵ Biering SB , Sarnik SA , Wang E , Zengel JR , Leist SR , Schäfer A , et al. Genome-wide bidirectional CRISPR screens identify mucins as host factors modulating SARS-CoV-2 infection . Nat Genet . 2022 ; 54 ( 8 ): 1078 – 89 . Epub 20220725. doi: 10.1038/s41588-022-01131-x . PubMed PMID: 35879412 ; PubMed Central PMCID: PMCPMC9355872 . OpenUrl CrossRef PubMed 74. ↵ Lau HH , Ng NHJ , Loo LSW , Jasmen JB , Teo AKK . The molecular functions of hepatocyte nuclear factors - In and beyond the liver . J Hepatol . 2018 ; 68 ( 5 ): 1033 – 48 . Epub 20171124. doi: 10.1016/j.jhep.2017.11.026 . PubMed PMID: 29175243 . OpenUrl CrossRef PubMed 75. ↵ Ng NHJ , Ghosh S , Bok CM , Ching C , Low BSJ , Chen JT , et al. HNF4A and HNF1A exhibit tissue specific target gene regulation in pancreatic beta cells and hepatocytes . Nat Commun . 2024 ; 15 ( 1 ): 4288 . Epub 20240622. doi: 10.1038/s41467-024-48647-w . PubMed PMID: 38909044 ; PubMed Central PMCID: PMCPMC11193738 . OpenUrl CrossRef PubMed 76. ↵ Hatzis P , Talianidis I . Regulatory mechanisms controlling human hepatocyte nuclear factor 4alpha gene expression . Mol Cell Biol . 2001 ; 21 ( 21 ): 7320 – 30 . doi: 10.1128/mcb.21.21.7320-7330.2001 . PubMed PMID: 11585914 ; PubMed Central PMCID: PMCPMC99906 . OpenUrl Abstract / FREE Full Text 77. ↵ Tian JM , Schibler U . Tissue-specific expression of the gene encoding hepatocyte nuclear factor 1 may involve hepatocyte nuclear factor 4 . Genes Dev . 1991 ; 5 ( 12a ): 2225 – 34 . doi: 10.1101/gad.5.12a.2225 . PubMed PMID: 1748280 . OpenUrl Abstract / FREE Full Text 78. ↵ Lausen J , Thomas H , Lemm I , Bulman M , Borgschulze M , Lingott A , et al. Naturally occurring mutations in the human HNF4alpha gene impair the function of the transcription factor to a varying degree . Nucleic Acids Res . 2000 ; 28 ( 2 ): 430 – 7 . doi: 10.1093/nar/28.2.430 . PubMed PMID: 10606640 ; PubMed Central PMCID: PMCPMC102517 . OpenUrl CrossRef PubMed Web of Science 79. ↵ Eeckhoute J , Formstecher P , Laine B . Hepatocyte nuclear factor 4alpha enhances the hepatocyte nuclear factor 1alpha-mediated activation of transcription . Nucleic Acids Res . 2004 ; 32 ( 8 ): 2586 – 93 . Epub 20040511. doi: 10.1093/nar/gkh581 . PubMed PMID: 15141028 ; PubMed Central PMCID: PMCPMC419469 . OpenUrl CrossRef PubMed Web of Science 80. ↵ Chu H , Chan JF , Yuen TT , Shuai H , Yuan S , Wang Y , et al. Comparative tropism, replication kinetics, and cell damage profiling of SARS-CoV-2 and SARS-CoV with implications for clinical manifestations, transmissibility, and laboratory studies of COVID-19: an observational study . Lancet Microbe . 2020 ; 1 ( 1 ): e14 – e23 . Epub 2020/08/25. doi: 10.1016/s2666-5247(20)30004-5 . PubMed PMID: 32835326 ; PubMed Central PMCID: PMCPMC7173822 . OpenUrl CrossRef PubMed 81. Yan K , Dumenil T , Tang B , Le TT , Bishop CR , Suhrbier A , et al. Evolution of ACE2-independent SARS-CoV-2 infection and mouse adaption after passage in cells expressing human and mouse ACE2 . Virus Evol . 2022 ; 8 ( 2 ):veac063. Epub 20220727. doi: 10.1093/ve/veac063 . PubMed PMID: 35919871 ; PubMed Central PMCID: PMCPMC9338707 . OpenUrl CrossRef PubMed 82. ↵ Yan K , Dumenil T , Stewart R , Bishop CR , Tang B , Nguyen W , et al. TMEM106B-mediated SARS-CoV-2 infection allows for robust ACE2-independent infection in vitro but not in vivo . Cell Rep . 2024 ; 43 ( 11 ): 114921 . Epub 20241031. doi: 10.1016/j.celrep.2024.114921 . PubMed PMID: 39480813 . OpenUrl CrossRef PubMed 83. ↵ Seamon KJ , Sun Z , Shlyakhtenko LS , Lyubchenko YL , Stivers JT . SAMHD1 is a single-stranded nucleic acid binding protein with no active site-associated nuclease activity . Nucleic Acids Res . 2015 ; 43 ( 13 ): 6486 – 99 . Epub 20150622. doi: 10.1093/nar/gkv633 . PubMed PMID: 26101257 ; PubMed Central PMCID: PMCPMC4513882 . OpenUrl CrossRef PubMed 84. ↵ Simermeyer TL , Batalis S , Rogers LC , Zalesak OJ , Hollis T . Protein oxidation increases SAMHD1 binding ssDNA via its regulatory site . Nucleic Acids Res . 2023 ; 51 ( 13 ): 7014 – 24 . doi: 10.1093/nar/gkad447 . PubMed PMID: 37246644 ; PubMed Central PMCID: PMCPMC10359594 . OpenUrl CrossRef PubMed 85. ↵ Qian H , Deng X , Huang ZW , Wei J , Ding CH , Feng RX , et al. An HNF1α-regulated feedback circuit modulates hepatic fibrogenesis via the crosstalk between hepatocytes and hepatic stellate cells . Cell Res . 2015 ; 25 ( 8 ): 930 – 45 . Epub 20150714. doi: 10.1038/cr.2015.84 . PubMed PMID: 26169608 ; PubMed Central PMCID: PMCPMC4528057 . OpenUrl CrossRef PubMed 86. ↵ Casemayou A , Fournel A , Bagattin A , Schanstra J , Belliere J , Decramer S , et al. Hepatocyte Nuclear Factor-1β Controls Mitochondrial Respiration in Renal Tubular Cells . J Am Soc Nephrol . 2017 ; 28 ( 11 ): 3205 – 17 . Epub 20170724. doi: 10.1681/asn.2016050508 . PubMed PMID: 28739648 ; PubMed Central PMCID: PMCPMC5661272 . OpenUrl Abstract / FREE Full Text 87. ↵ Ehle C , Iyer-Bierhoff A , Wu Y , Xing S , Kiehntopf M , Mosig AS , et al. Downregulation of HNF4A enables transcriptomic reprogramming during the hepatic acute-phase response . Commun Biol . 2024 ; 7 ( 1 ): 589 . Epub 20240516. doi: 10.1038/s42003-024-06288-1 . PubMed PMID: 38755249 ; PubMed Central PMCID: PMCPMC11099168 . OpenUrl CrossRef PubMed 88. ↵ An S , Vo TTL , Son T , Choi H , Kim J , Lee J , et al. SAMHD1-induced endosomal FAK signaling promotes human renal clear cell carcinoma metastasis by activating Rac1-mediated lamellipodia protrusion . Exp Mol Med . 2023 ; 55 ( 4 ): 779 – 93 . Epub 20230403. doi: 10.1038/s12276-023-00961-x . PubMed PMID: 37009792 ; PubMed Central PMCID: PMCPMC10167369 . OpenUrl CrossRef PubMed 89. ↵ Zhang YY , Liang R , Wang SJ , Ye ZW , Wang TY , Chen M , et al. SARS-CoV-2 hijacks macropinocytosis to facilitate its entry and promote viral spike-mediated cell-to-cell fusion . J Biol Chem . 2022 ; 298 ( 11 ): 102511 . Epub 20220919. doi: 10.1016/j.jbc.2022.102511 . PubMed PMID: 36259516 ; PubMed Central PMCID: PMCPMC9484108 . OpenUrl CrossRef PubMed 90. ↵ McNab F , Mayer-Barber K , Sher A , Wack A , O’Garra A . Type I interferons in infectious disease . Nat Rev Immunol . 2015 ; 15 ( 2 ): 87 – 103 . doi: 10.1038/nri3787 . PubMed PMID: 25614319 ; PubMed Central PMCID: PMCPMC7162685 . OpenUrl CrossRef PubMed 91. ↵ Yang H , Cheung PH , Wu L . SAMHD1 enhances HIV-1-induced apoptosis in monocytic cells via the mitochondrial pathway . mBio . 2025 ; 16 ( 7 ): e0042525 . Epub 20250528. doi: 10.1128/mbio.00425-25 . PubMed PMID: 40434097 ; PubMed Central PMCID: PMCPMC12239581 . OpenUrl CrossRef PubMed 92. ↵ Bonifati S , Daly MB , St Gelais C , Kim SH , Hollenbaugh JA , Shepard C , et al. SAMHD1 controls cell cycle status, apoptosis and HIV-1 infection in monocytic THP-1 cells . Virology . 2016 ; 495 : 92 – 100 . Epub 20160514. doi: 10.1016/j.virol.2016.05.002 . PubMed PMID: 27183329 ; PubMed Central PMCID: PMCPMC4912869 . OpenUrl CrossRef PubMed 93. ↵ Odle A , Kar M , Verma AK , Sariol A , Meyerholz DK , Suthar MS , et al. Tissue-resident memory T cells contribute to protection against heterologous SARS-CoV-2 challenge . JCI Insight . 2024 ; 9 ( 23 ). Epub 20241206. doi: 10.1172/jci.insight.184074 . PubMed PMID: 39405115 ; PubMed Central PMCID: PMCPMC11623939 . OpenUrl CrossRef PubMed 94. ↵ Owczarzy R , Tataurov AV , Wu Y , Manthey JA , McQuisten KA , Almabrazi HG , et al. IDT SciTools: a suite for analysis and design of nucleic acid oligomers . Nucleic Acids Res . 2008 ; 36 (Web Server issue): W163 – 9 . Epub 20080425. doi: 10.1093/nar/gkn198 . PubMed PMID: 18440976 ; PubMed Central PMCID: PMCPMC2447751 . OpenUrl CrossRef PubMed Web of Science 95. ↵ Wong LR , Zheng J , Wilhelmsen K , Li K , Ortiz ME , Schnicker NJ , et al. Eicosanoid signalling blockade protects middle-aged mice from severe COVID-19 . Nature . 2022 ; 605 ( 7908 ): 146 - 51 . Epub 20220321. doi: 10.1038/s41586-022-04630-3 . PubMed PMID: 35314834 ; PubMed Central PMCID: PMCPMC9783543 . OpenUrl CrossRef PubMed 96. ↵ Phillips S , Mishra T , Khadka S , Bohan D , Espada CE , Maury W , et al. Epitranscriptomic N(6)-Methyladenosine Profile of SARS-CoV-2-Infected Human Lung Epithelial Cells . Microbiol Spectr . 2023 ; 11 ( 1 ): e0394322 . Epub 20230110. doi: 10.1128/spectrum.03943-22 . PubMed PMID: 36625663 ; PubMed Central PMCID: PMCPMC9927293 . OpenUrl CrossRef PubMed 97. ↵ Cheung PH , Ye ZW , Lui WY , Ong CP , Chan P , Lee TT , et al. Production of single-cycle infectious SARS-CoV-2 through a trans-complemented replicon . J Med Virol . 2022 ; 94 ( 12 ): 6078 – 90 . Epub 20220817. doi: 10.1002/jmv.28057 . PubMed PMID: 35941087 ; PubMed Central PMCID: PMCPMC9539037 . OpenUrl CrossRef PubMed 98. ↵ Mehyar N , Samman N , Al Gheribi S , Mashhour A , Chan P , Al-Kaysi RO , et al. First-in-class inhibitors of Nsp15 endoribonuclease of SARS-CoV-2: Modeling, synthesis, and enzymatic assay of thiazolidinedione and rhodanine analogs . J Biol Chem . 2025 ; 301 ( 8 ): 110409 . Epub 20250623. doi: 10.1016/j.jbc.2025.110409 . PubMed PMID: 40562099 ; PubMed Central PMCID: PMCPMC12303054 . OpenUrl CrossRef PubMed 99. ↵ Corman VM , Landt O , Kaiser M , Molenkamp R , Meijer A , Chu DK , et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR . Euro Surveill . 2020 ; 25 ( 3 ). doi: 10.2807/1560-7917.Es.2020.25.3.2000045 . PubMed PMID: 31992387 ; PubMed Central PMCID: PMCPMC6988269 . OpenUrl CrossRef PubMed 100. ↵ Zhao LM , Zheng ZX , Zhao X , Shi J , Bi JJ , Pei W , et al. Optimization of reference genes for normalization of the quantitative polymerase chain reaction in tissue samples of gastric cancer . Asian Pac J Cancer Prev . 2014 ; 15 ( 14 ): 5815 – 8 . doi: 10.7314/apjcp.2014.15.14.5815 . PubMed PMID: 25081706 . OpenUrl CrossRef PubMed 101. ↵ Chan P , Ye ZW , Zhao W , Ong CP , Sun XY , Cheung PH , et al. Mpox virus poxin-schlafen fusion protein suppresses innate antiviral response by sequestering STAT2 . Emerg Microbes Infect . 2025 ; 14 ( 1 ): 2477639 . Epub 20250318. doi: 10.1080/22221751.2025.2477639 . PubMed PMID: 40066622 ; PubMed Central PMCID: PMCPMC11921170 . OpenUrl CrossRef PubMed 102. ↵ Spandidos A , Wang X , Wang H , Seed B . PrimerBank: a resource of human and mouse PCR primer pairs for gene expression detection and quantification . Nucleic Acids Res . 2010 ; 38 (Database issue): D792 – 9 . Epub 20091111. doi: 10.1093/nar/gkp1005 . PubMed PMID: 19906719 ; PubMed Central PMCID: PMCPMC2808898 . OpenUrl CrossRef PubMed Web of Science View the discussion thread. Back to top Previous Next Posted October 26, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following SAMHD1 promotes SARS-CoV-2 infection by enhancing HNF1-dependent ACE2 expression in lung epithelial cells Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share SAMHD1 promotes SARS-CoV-2 infection by enhancing HNF1-dependent ACE2 expression in lung epithelial cells Pak-Hin Hinson Cheung , Pearl Chan , Hua Yang , Shravya Honne , Baek Kim , Stanley Perlman , Li Wu bioRxiv 2025.10.23.684143; doi: https://doi.org/10.1101/2025.10.23.684143 Share This Article: Copy Citation Tools SAMHD1 promotes SARS-CoV-2 infection by enhancing HNF1-dependent ACE2 expression in lung epithelial cells Pak-Hin Hinson Cheung , Pearl Chan , Hua Yang , Shravya Honne , Baek Kim , Stanley Perlman , Li Wu bioRxiv 2025.10.23.684143; doi: https://doi.org/10.1101/2025.10.23.684143 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Microbiology Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17691) Bioengineering (13892) Bioinformatics (41937) Biophysics (21452) Cancer Biology (18588) Cell Biology (25504) Clinical Trials (138) Developmental Biology (13378) Ecology (19899) Epidemiology (2067) Evolutionary Biology (24320) Genetics (15609) Genomics (22506) Immunology (17736) Microbiology (40394) Molecular Biology (17181) Neuroscience (88605) Paleontology (666) Pathology (2832) Pharmacology and Toxicology (4824) Physiology (7641) Plant Biology (15156) Scientific Communication and Education (2045) Synthetic Biology (4294) Systems Biology (9825) Zoology (2271)","source_license":"CC-BY-4.0","license_restricted":false}