{"paper_id":"38f8c512-7151-4ac1-a3b4-37b9ceade20a","body_text":"Estrogen regulates Scribble localization in endometrial epithelial cells through acyl protein thioesterase (APT)-mediated S-palmitoylation in adenomyosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Estrogen regulates Scribble localization in endometrial epithelial cells through acyl protein thioesterase (APT)-mediated S-palmitoylation in adenomyosis zhixing jin, Juan Wang, Youguo Chen This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2943175/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Aug, 2023 Read the published version in Reproductive Sciences → Version 1 posted 4 You are reading this latest preprint version Abstract Despite its prevalence and the severity of symptoms, little is known about the pathogenesis and etiology of adenomyosis. In our previous study, Scribble localization has been found to be partially translocated to cytoplasm, however, its regulatory mechanism is known. In consideration of the important role of supraphysiologic estrogen production in the endometrium in the development of adenomyosis, we analyzed the effect and mechanism of estrogen on Scribble localization in vivo and in vitro. Firstly, we found Scribble translocation from the basolateral membrane to the cytoplasm was easily to be seen in women and mice with adenomyosis (68% vs 27%, 60% vs 10% separately). After treatment with the S-palmitoylation inhibitor 2-Bromopalmitate for 48H, cytoplasmic enrichment of Scribble and the reduced level of palm-Scribble was observed by immunofluorescence, Western blot and acyl-biotin exchange palmitoylation assay. High estrogen exposure could not only induce partially cytoplasmic translocation of Scribble but also decrease the expression level of palm-Scribble, which can be recovered by estrogen receptor inhibitor ICI182,780. Based on following experiments, we found that estrogen regulated Scribble localization by APT through S-palmitoylation of Scribble protein. At last, IHC was performed to verify the expression of APT1 and APT2 in human clinical tissue specimens and found that they were all increased dramatically. Furthermore, positive correlations were found between APT1 or APT2 and aromatase P450. Therefore, our research may provide a new understanding of the pathogenesis of adenomyosis. Adenomyosis Estrogen Scribble S-palmitoylation Endometrial epithelial cells Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Adenomyosis (ADE) is a common estrogen-dependent benign gynecological disease, which is characterized by the presence of ectopic endometrial tissue (endometrial glands and/or stroma) in the myometrium surrounded by hyperplastic and hypertrophic smooth muscle [1]. It’s reported that ADE has detrimental effects on 20 to 35% of reproductive-aged women' quality of life and consumes substantial healthcare resources [2]. Due to the nonspecific symptoms and the lack of a specific and effective test method, its incidence is actually much higher than what is known at present and has a younger and rising trend in recent years. Due to the unknown mechanisms, no drug is currently labeled for adenomyosis and there are no specific guidelines to follow for the best management [3]. Hysterectomy is currently considered the most effective treatment for adenomyosis, however, it is only applicable to older, nearly menopausal women with no fertility requirements [4]; drug treatment using suppressive hormone aiming for the hypothalamic-pituitary-ovarian (HPO) axis could induce regression of adenomyosis and improve the symptoms, but symptom recurrence after drug discontinuation, obvious side effects and pregnancy limitation becomes the principal drawbacks of these medical options [5]. Supraphysiologic estrogen production in the endometrium is widely considered to be closely related to the occurrence of adenomyosis [6]. In adenomyosis, abnormal production of local estrogen is thought to be the result of increased aromatase activity and decreased estrogen metabolism in the endometrium [7]. Researchers have found that estrogen can not only contribute to hyperplasia and epithelial mesenchymal transformation of endometrial glandular epithelium but also promote oxytocin-mediated uterine contractions, which could cause hyperperistalsis and tissue microtrauma in the junction zone and eventual activation of the tissue injury and repair (TIAR) mechanism [8, 9]. However, the underlying molecular mechanism is unclear. Our previous research has found that estrogen can disrupt the polarity of endometrial glandular epithelial cells through E3 ubiquitin ligase HECW1-mediated Scribble degradation. Also, Scribble was observed to be mislocated to cytoplasm in adenomyosis [10]. The polarity protein Scribble, a member of the LAP family proteins, contains 16 LRRs at the N terminus, followed by two LAP-specific domains (LAPSD) and 4 PDZ domains, which is located at the basolateral membrane in endometrial epithelial cells of healthy women [11]. It plays an important role in establishing and maintaining apical-basal polarity, controlling tissue growth, differentiation and cell directed migration [12]. In breast cancer and liver cancer, genetically normal Scribble mislocated from cell-cell junctions to the cytoplasm, correlating with enhanced growth signaling and malignancy [13, 14]. In addition, Scribble intracellular localization changes can also cooperate with oncogenes (Ras or Myc) to promote tumorigenesis [15]. Despite the critical role for Scribble membrane localization, little is known about the role and molecular mechanism of Scribble re-localization in the development of adenomyosis. Protein S-palmitoylation is a post-translational lipidation with a reversible thioester bond between a cysteine residue and 16-carbon fatty acid, palmitate, which is important in regulating trafficking and localization of many peripheral and integral membrane proteins [16]. S-palmitoylation is dynamically regulated by two opposite types of enzymes, protein S-acyl transferases (PATs) and acyl protein thioesterases (APTs). PATs mainly refer to zDHHC enzymes due to their predicted Zn 2+ -binding and conserved Asp-His-HisCys motif and work in catalyzing protein S-palmitoylation [17]. 23 zDHHC genes have been identified in human genome databases. De-palmitoylation is catalyzed by one or more HDFP-sensitive hydrolases, mainly referring to APT1 and APT2 [18]. PATs or APTs small molecule inhibitors such as 2-Bromopalmitate (2-BP), Palmostatin B can be used in the treatment of diseases by regulating the level of S-palmitoylation modification of proteins [19, 20]. Scribble has been identified as palmitoylated by zDHHC7 in MCF10A human epithelial cells and APT2 inhibition restores Scribble localization and S-palmitoylation in Snail-transformed breast epithelial cells [21, 22], suggesting that Scribble participates in an active S-palmitoylation cycle similar to that of palmitoylated Ras, where zDHHCs add and APTs remove S-palmitoyl groups from Scribble. Therefore, we hypothesize that estrogen promotes cytoplasmic translocation though down-regulating Scribble S-palmitoylation in the development of adenomyosis and promoting Scribble localization restoration by regulating its S-palmitoylation may be a newly and effectively method for adenomyosis treatment. Materials and methods Ethics statement This study complied with the tenets of the Helsinki Declaration and the National Guidelines for Animal Use in Research (China). All experiments were performed under the guidelines of the National Research Council Guide for the Care and Use of Laboratory Animals and approved by the Medical Ethics Committee of the First Affiliated Hospital of Soochow University (Suzhou, China). All tissue samples were obtained after written, full and informed consent from recruited subjects. Patients and human tissue collection After informed written consent, totally 19 human endometrial samples from adenomyosis patients were collected at the First Affiliated Hospital of Soochow University (Suzhou, China), from June, 2021 to June, 2022. Their diagnoses were made by transvaginal ultrasound before surgery and histologically confirmed post-operatively. For controls, endometrial tissue samples were collected from 15 women who had undergone hysterectomy because of cervical intraepithelial neoplasia (CIN)-III, cervical carcinoma in situ or stage IA1 cervical cancer but free of endometriosis, adenomyosis and uterine fibroids. All the recruited women in both study and control groups had regular cycles and had not received any hormonal or anti-platelet treatment for at least 3 months prior to tissue collection. Two wedges of tissue from the lumen to the muscular myometrial layer that included superficial and basal endometrium as well as myometrium was taken from the detached uterus, then immediately fixed in 10% buffered formalin at room temperature for 48H and embedded in paraffin for hematoxylin and eosin (HE) or immunohistochemical staining. Information on uterine size, severity of dysmenorrhea, amount of menses, cycle length, reproductive history and age was also recorded (Table 1 ). Table 1 Characteristics of recruited patients with and without adenomyosis. Variable name Control group n = 15 Adenomyosis group n = 19 p-value Age (years) Mean (± S.D.) 45.73 ± 4.464 47.68 ± 4.7 0.1195 Live births Median (range) 1.5(0–3) 1(1–3) 0.1900 Miscarriages Median (range) 1.5(1–4) 1(0–3) 0.2405 Cycle length (days) Median (range) 28(25–30) 30(23–35) 0.6689 Amount of menses Light & Moderate Heavy 14(93.33%) 1(6.67%) 9(47.37%) 10(52.63%) 0.0083 Dysmenorrhea severity None Mild Moderate Severe 13(86.67%) 2(13.33%) 0(0%) 0(0%) 2(10.53%) 3(15.79%) 4(21.05%) 10(52.63%) < 0.0001 Uterine size (in cm3) Mean (± S.D.) 129.8 ± 58.72 529.7 ± 262.3 < 0.0001 Preparation of drugs and animals Using tamoxifen orally on Institute of Cancer Research (ICR) newborn mice is a classic method for establishment of experimental adenomyosis [23]. Tamoxifen was purchased from Fudan Forward Pharmaceutical Company (Shanghai, China). Pregnant ICR mice were purchased from Shanghai Laboratory Animal Corporation (Shanghai, China). Each dam and her pups were housed in the same cage under controlled conditions (12:12 light/dark cycle with lights on at 6:00 a.m.) and had access to chow and fresh water ad libitum. We obtained 20 female neonatal mice from 6 pregnant ICR mice. They were randomly divided into two groups: the control group and the adenomyosis model (ADE) group. From day 1 to day 5 after birth, female neonatal mice in the ADE group received 1mg/kg tamoxifen suspended in a peanut oil/lecithin/condensed milk mixture (2:0.2:3, by volume) at a dose volume of 5µl/g body weight. The control neonatal mice were fed similarly with the same amount of solvent, without tamoxifen. When the mice reached 3 weeks of age, they were weaned and separated from the dams. The uterine samples were harvested at 42 days of age. All the mice have normal estrus cycle. Cell lines The endometrial cancer cell line Ishikawa was purchased from the National Infrastructure of Cell Line Resource (China) and cultured in DMEM/F12 medium, supplemented with 10% fetal bovine serum (FBS). Drug intervention The following drugs were used for cell interventions as indicated: 2-Bromopalmitate (21604; Sigma Aldrich, USA), Palmostatin B (178501; Sigma Aldrich, USA), 17β-estrogen (E2758; Sigma Aldrich, USA), ICI182,780 (HY-13636; MedchemExpress, New Jersey, USA) and vehicles including ethanol and dimethyl sulfoxide (DMSO). Prior to E2 intervention, cells were cultured in phenol red-free medium supplemented with 10% charcoal-stripped FBS. Real-time polymerase chain reaction (RT-PCR) Total RNA was isolated from endometrial tissues using DNA/RNA/Protein isolation kit (Tiangen, China) and 1µg of the purified total RNA was reverse transcribed into cDNA with PrimeScript RT Master Mix kit (Takara, Japan), following the manufacturer’s protocol. RT-PCR was performed with the CFX96 Real-time PCR Detection system (Bio-rad, USA) using the TB Green Premix Ex Taq II kit (Takara, Japan). The primers used in the experiment are shown in Table 2 . Relative expression of each gene was calculated using the delta–delta Ct method, with GAPDH as the endogenous control. Table 2 Primer sequences. Gene Species Sense primer Antisense primer ZDHHC1 Human ACAGTGTTGCATCCGCTTTAC GTTGACAAAGAACTCCACGAAGA ZDHHC2 Human TGATGCAGTCCAGGTATCTAA AGTGTCTTCTGTTGGCATTG ZDHHC3 Human CACTCGCATGAGAACTTAATTG CACAGGCAGGGTTTATGGT ZDHHC4 Human GCAAGGGATGGTTTATACTGAG GGCAGAAGAAGGTAATGCAA ZDHHC5 Human CACCACCTCCACCTCCTATAA ACTCAAAATCAGGGCTGTCTG ZDHHC6 Human TAAACAGGTATTTACGTGGTCAG TGGTGACAGCCTTCTCTTACT ZDHHC7 Human CCTTAAACTTGCCTGGTTTGT GGAGACGCCAACTTCTCTTAG ZDHHC8 Human CTGGGCTGTGGCTCTACAT GAGAATGGTTTTGTGGCTTTC ZDHHC9 Human GAGCAGGAATGGCAGTAATAA GGAGTCTGAGGGGATAGTGTT ZDHHC11 Human GAAATACATTGCCTACGTGGTG TCATGAGTCTGACATTGGAGTC ZDHHC12 Human GCTTCAAGTCAGACAGATCCC GTCCTTTTCTTCCCCTTCTTC ZDHHC13 Human CATCCGACAAGGACATTTACC TTGAAACAATACTGCCAGGTG ZDHHC14 Human CTCTGTCTGGTCCATCGTTG GTCCTCATTTGTTGTCTGGTTG ZDHHC15 Human GGGTTTTCAGAGTGATTTTCA GTGCTAATCCTCAGGCTAATG ZDHHC16 Human CTCAGGCAAACAGAAGTTCCAA CAGCACTGGGCAAGGTAGGTA ZDHHC17 Human ACCACTTACACCAAGGATGGA TAATACAGCCACCCACATGAA ZDHHC18 Human GCCAGAGTGTAGAAAGCCATAA AGAGGGAGCATATCAGCGTAG ZDHHC19 Human TGGGTCAATAACTGCATCGGTC GAAGGGCAGGTGGGTTGTG ZDHHC20 Human TCCTCCTGGCTGTCAGTTG AGTCAGACTTCAGACTGTGCGT ZDHHC21 Human CAGAGCCAAGTGAAGATCACC CCCAGTACCCACTGCTACTACA ZDHHC22 Human GAGCAGAGATTGGGAGGACTTTA TGAGTGAAGGAATGAGTATGGGA ZDHHC23 Human GGCAGTCTCAACAATCGCACAAC GCACACCAGTCCTCCTTCGCT ZDHHC24 Human CATGTGTCTCCAGCAGCTTACTGAG AGCATTGAGCCTGAGGTGTTGATG GAPDH Human GGGAAGGTGAAGGTCGGAGT GGGGTCATTGATGGCAACA Immunohistochemistry (IHC) IHC staining was performed as previously described [24]. Primary antibodies used included Scribble (1:1000 dilution; HPA023557; Sigma Aldrich, USA), APT1 (1:100 dilution; 16055-1-AP; Proteintech, USA), APT2 (1:100 dilution; TA365341; Origene, USA) and aromatase P450 (1:50 dilution; SAB4500606; Sigma Aldrich, USA). Quantification of immunoreactivity was performed with Image Pro-Plus 6.0 software (Media Cybernetics, Inc.), as described previously. Immunofluorescence Cell immunofluorescent staining was performed as previously described [25]. Primary antibodies against Scribble (1:1000 dilution; HPA023557; Sigma Aldrich, USA) was incubated with cells overnight at 4℃ followed by incubation with secondary fluorescent-tagged antibody (1:1000 dilution; anti-rabbit Alexa Fluor 488; Abcam, USA) for 1 h. Nuclei were stained with DAPI (Beyotime, China) for 5 min. Fluorescence was detected using laser scanning confocal microscopy (Leica) and inverted fluorescence microscope (Nikon). Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting Cell proteins were extracted and Mem-PER™ Plus kit (89842; Thermo Fisher Scientific, USA) was used for separating the membranous protein. Then SDS-PAGE and immunoblotting were carried out as previously described [26]. Primary antibodies used included anti-GAPDH (1:1000 dilution; ab181602; Abcam, USA), anti-tubulin (1:1000 dilution; 2146; Cell Signaling Technology, USA), anti-Na+-K+-APTase (1:1000 dilution; ab76020; Abcam, USA), LDHA (1:1000 dilution; 2012; Cell Signaling Technology, USA), Scribble (1:1000 dilution; 4475; Cell Signaling Technology, USA), ZDHHC7 (1:1000 dilution; ab138210; Abcam, USA), APT1 (1:5000 dilution; ab91606; Abcam, USA), APT2 (1:1000 dilution; ab151578; Abcam, USA). Acyl-biotin exchange palmitoylation assay Briefly, cells were lysed by lysis buffer (Beyotime, China) with protease inhibitor (B14001; Bimake, USA) and 50mM N-Ethylmaleimide (Sigma-Aldrich, USA). Endogenous Scribble is then purified by specific antibodies and beads. Purified Scribble protein were divided into two groups, and one treated with lysis buffer + 1M hydroxylamine (467804; Sigma-Aldrich, USA) for 1 hour at room temperature. Finally, the beads were gently washed by lysis buffer pH 6.2 and incubated with lysis buffer pH 6.2 + 2µM Biotin-BMCC (21900; Thermo Fisher Scientific, USA) for 1 hour at 4℃. Proteins were washed 3 times and proceeded for IB analysis. Statistical analysis All experiments were repeated at least three times in this study. Statistical differences were analyzed using Statistical Package for the Social Sciences (SPSS) software (19.0) (SPSS Inc., Chicago, IL, USA). The two-tailed unpaired Student’s t-test, Mann-Whitney test, one-way ANOVA test followed by Tukey's multiple comparisons test, Pearson correlation test and Chi-Squared test were used for further analyses. P-values of 0.05 were considered statistically significant. Results 1. Mislocalization of polarity protein Scribble in eutopic endometrium of adenomyosis patients and tamoxifen-induced adenomyosis mice. The characteristics of the recruited patients with adenomyosis and the control subjects are listed in Table 1 . As shown in the table, the patients in different groups were comparable in age, live births, miscarriages and cycle length. However, patients with adenomyosis had significantly bigger uterine sizes, heavier menses and more severe dysmenorrhea. Using IHC, the subcellular Scribble localization in endometrial biopsies of control and adenomyosis patients were investigated. As shown in the Fig. 1 A, although Scribble was localized at the plasma membrane in eutopic endometrium of women without adenomyosis in 73% of all cases (11/15), partially translocation to cytoplasm of Scribble was detectable in 68% of adenomyosis cases (13/19). In order to find out whether the subcellular Scribble localization in mouse has the similar change to that found in the human endometrium. Tamoxifen was used to induce adenomyosis in newborn ICR mice. The complete absence of any ectopic endometrium in the myometrium is considered as successful establishment of adenomyosis mouse model. At day 42, all mice in the tamoxifen-induced group showed endometrial invasion into the myometrium, while no ectopic endometrium was observed in the myometrium of the control group. Compared with mice in the control group (9/10), mislocalization of Scribble was observed in 60% of adenomyosis cases (6/10). (Fig. 1 B) 2. S-palmitoylation of Scribble regulates its membrane localization in endometrial epithelial cells Since Scribble requires S-palmitoylation for membrane recruitment in MDCK, we explored if defects in Scribble S-palmitoylation might provide a potential mechanism for mislocalization in endometrial epithelial cells. After treating Ishikawa cells with different concentrations (25µM, 50µM or 75µM) of the general palmitoylation inhibitor 2-BP for 48H, the expression of membranous and cytoplasmic Scribble was detected by immunofluorescence and cytoplasmic enrichment has been seen following different concentrations of 2-BP (Fig. 2 A). Then we separated the membranous and cytoplasmic protein by Mem-PER ™ Plus kit and found membranous Scribble was decreased significantly and cytoplasmic Scribble was increased significantly after 25µM 2-BP treatment (Fig. 2 B& 2 D), compared with the control group. Meanwhile, the reduced level of palm-Scribble caused by 25µM 2-BP was further verified by western blot. (Fig. 2 C-D) 3. Estrogen regulates Scribble localization and S-palmitoylation in endometrial epithelial cells. Supraphysiologic estrogen production in the endometrium is considered to be the culprit of adenomyosis. Therefore, we treated Ishikawa cells with 10 -6 M estrogen or/and estrogen receptor inhibitor ICI182,780 for 48H and the result demonstrated that estrogen contributed to Scribble mislocalization which can be recovered by estrogen receptor inhibitor ICI182,780 (Fig. 3 A). A significantly decrease in membranous Scribble and a significantly increase in cytoplasmic Scribble was further verified by western blot (Fig. 3 B& 3 D). Moreover, the expression level of palm-Scribble was dramatically decreased with estrogen treatment compared with the control group. (Fig. 3 C-D) 4. Screening and verification of PATs or APTs induced by estrogen. We hypothesized that estrogen may perturb the Scribble S-palmitoylation cycle equilibrium by disrupting normal PATs or APTs expression. To explore this question, total RNA was isolated from control and estrogen-treated cells for RT-PCR of all 23 zDHHCs. Surprisingly, estrogen treatment did not affect the mRNA level of any zDHHCs. (Fig. 4 A) Both APT1 and APT2 are annotated as protein de-palmitoylases and are widely expressed and active across nearly all tissues. Then, we detected the effect of estrogen on the protein level of APT1, APT2 and zDHHC7 which has been reported to have a regulatory effect on Scribble palmitoylation in MDCK and found the expression levels of both APT1 and APT2 were increased significantly, while the expression of zDHHC7 had no dramatically change, compared with control group (Fig. 4 B-C), suggesting their possible role in the regulation of Scribble S-palmitoylation caused by estrogen. 5. APT inhibition rescues Scribble plasma membrane localization and S-palmitoylation induced by estrogen. We next explored if inhibiting de-palmitoylation might restore Scribble membrane localization and its S-palmitoylation cycle balance. Ishikawa cells were treated with 10 − 6 M estrogen or/and the APT inhibitor Palmostatin B (25µM) for 48H. The result demonstrated that when Palmostatin B was added in, estrogen did not have a significant effect on Scribble plasma membrane localization and its S-palmitoylation any more (Fig. 5 ), which suggested the important role of APTs in estrogen-induced Scribble cytoplasmic translocation and reduction of Scribble S-palmitoylation. 6. Expression of APT1 and APT2 was verified in human specimens of adenomyosis patients. Finally, we verified the expression of APT1 and APT2 in adenomyosis patients and their correlation with estrogen production. We revealed that APT1 and APT2 staining was mainly seen in endometrial epithelial cells and mostly localized in the cytoplasm and cytomembrane, while aromatase P450, a key enzyme for estrogen synthesis was seen both in epithelial and stromal cells and was mostly localized in the cytoplasm and nucleus (Fig. 6 A). Compared with control endometrium, the expression of aromatase P450, APT1 and APT2 in the eutopic endometrium of patients with adenomyosis was all increased significantly (Fig. 6 B). Furthermore, a positive correlation was found not only between APT1 and aromatase P450 but also between APT2 and aromatase P450 (Pearson’s r = 0.3475/P = 0.0440 and r = 0.4763/P = 0.0044 respectively; Fig. 6 C-D). Discussion ADE is an often-overlooked heterogeneous gynecologic condition that causes infertility, pelvic pain, abnormal uterine bleeding and dysmenorrhea. It is generally recognized that supraphysiologic estrogen production in the eutopic endometrium plays an important role in the pathophysiology of adenomyosis, however little is known about its effects on the direction of gland epithelial cell growth that is related to cell polarity. In our previous research, the subcellular localization of Scribble has been found to be partially translocated to cytoplasm, suggesting its possible involvement in the development of adenomyosis. In this study, we first verified the subcellular localization of Scribble in adenomyosis patients and tamoxifen-induced adenomyosis mice. Scribble translocation from the basolateral membrane to the cytoplasm was easily to be seen in women with adenomyosis (68% vs 27%). At day 42, when all the mice in the tamoxifen-treated group successfully formed lesions of adenomyosis and the similar change of Scribble localization was also found in adenomyosis model mice (60% vs 10%). As an important part of the Scribble polarity complex, Scribble contributes to multiple physiological processes. In epithelial tumors, Scribble is often considered as a tumor suppressor. Downregulation of Scribble was observed in endometrial cancer [27], non-small cell lung cancer [28] and prostate cancer [29] which was closely related to positive lymph node metastasis, chemotherapy resistance and poor prognosis. Knockdown of Scribble has been verified to accelerate the migration and invasion of tumor cells in vitro. Furthermore, Scribble localization is also necessary for polarized cells. Scribble localizes to the basolateral membrane, yet is mislocalized to the cytosol in most epithelial cancers, correlating with disrupted cell polarity, enhanced growth signaling, and transformation [30]. Despite the critical role for Scribble membrane localization, little is known about how Scribble re-localizes to the cytosol in adenomyosis. Since it’s reported that Scribble requires S-palmitoylation for membrane recruitment, we then explored if defects in Scribble S-palmitoylation might provide a potential mechanism for mislocalization in adenomyosis. Further in vitro investigation was conducted in Ishikawa cell lines and found Scribble re-localizes from the membrane to the cytosol along with decreased expression of palm-Scribble after treating with 2-Bromopalmitate, the general palmitoylation inhibitor by inhibiting the function of PATs, indicating that the S-palmitoylation cycle may be also involved in the translocation process of Scribble in adenomyosis. In view of the importance of estrogen in the pathogenesis of adenomyosis, we tried to illustrate the effect of estrogen on the subcellular localization and S-palmitoylation of Scribble in endometrial epithelial cells. Our study found that high concentration of estrogen could not only reduce the expression of palm-Scribble in glandular epithelial cells but also changed its intracellular localization which was consistent with what we found in mice and patients with adenomyosis, suggesting that estrogen functionally targets the S-palmitoylation machinery, which cooperates in disrupting cell polarity and the displacement of Scribble from the plasma membrane. In order to screen the PAT that may contribute to the perturbation of Scribble S-palmitoylation cycle equilibrium induced by estrogen, total RNA was isolated from control and estrogen treated cells for RT-PCR of all 23 zDHHC PATs. Surprisingly, all zDHHC mRNAs had no significantly change after high concentration of estrogen exposure. Although zDHHC7 was recently reported to participate in Scribble plasma membrane localization, we found neither mRNA levels nor protein levels of zDHHC7 were changed significantly followed estrogen treatment, suggesting estrogen either attenuates zDHHC7 activity or bypasses zDHHC7-dependent Scribble S-palmitoylation. APT1 and APT2 are annotated as protein de-palmitoylases and are targets of several classes of covalent serine hydrolase inhibitors, including β-lactones [31], triazole ureas [32] and N-hydroxyhydantoin carbamates [33]. In the following experiment, estrogen has been found to lead to a 1.5-fold increase of APT1 and a 2-fold or greater increase of APT2 at their protein levels, potentially shifting the balance of the S-palmitoylation cycle. Given the observed dynamic S-palmitoylation of Scribble in endometrial epithelial cells, we hypothesized that de-palmitoylase inhibition might enhance Scribble S-palmitoylation levels and restore plasma membrane localization in estrogen treated cells. The β-lactone inhibitor Palmostatin B is the most widely used APT inhibitor, and is primarily selective for both APT1 and APT2 at low micromolar concentrations [34]. Treatment with Palmostatin B reportedly blocks the Ras S-palmitoylation cycle, restoring epithelial-like features to HRasG12V-transformed MDCK cells [31]. Research highlighted a central role for MC1R palmitoylation in protecting against melanoma found inhibition of de-palmitoylation by Palmostatin B might be a potential clinical prevention strategy for melanoma [19]. In our study, Palmostatin B treatment promoted Scribble membrane re-localization and increase Scribble S-palmitoylation levels in estrogen treated cells, without having significant effects on Scribble localization in control cells, limiting the response to the estrogen-induced cells. Overall, we found that Scribble is regulated by an APT-dependent S-palmitoylation cycle, which is necessary for efficient membrane localization. Finally, we verified the expression of APT1, APT2 and aromatase P450 in human specimens and found that they all increased significantly in eutopic endometrium of humans with adenomyosis. Furthermore, positive correlations between APT1 or APT2 and aromatase P450 have been found using Pearson’s correlation test. Our study has two limitations. First, all ADE patients enrolled in our study were diffuse type, whether our conclusion can be extended to focal ADE remains to be demonstrated. Second, although reestablishment of cellular polarity is to our knowledge not possible, specific downstream effector mechanisms may represent promising therapeutic target structures for a subgroup of patients with distinct alterations of cell polarity factors. Therefore, future researches may be focused on biologic behavior and downstream effector mechanisms via mutated Scribble with enforced cytoplasmic enrichment. In summary, we demonstrated that estrogen-induced Scribble mislocalization in endometrial epithelial cells through APT-mediated S-palmitoylation might be one of the key mechanisms in the development of adenomyosis, which may provide a new understanding of the pathogenesis of adenomyosis. Declarations Acknowledgements We are grateful to the women who participated in this study and Shanghai Key Laboratory of Female Reproductive Endocrine Related Disease, Fudan University (Shanghai, China) for providing experimental platform. Graphical abstract was created with BioRender.com Ethics Approval Appropriate ethical approvals were obtained for the study. Consent to Participate Informed consent was obtained from the study participants. Consent for publication This manuscript has not been published or presented elsewhere and is not under consideration by another journal. All study participants provided informed consent and approved it for publication. Conflicts of interest All authors declare that there are no competing financial interests associated with this work. Availability of data and material The datasets used or analyzed during the current study are available from the corresponding author on reasonable request. Code availability Not applicable Funding This work was supported by funding from the National Natural Science Foundation of China (No. 82001523) and Gusu Health Talent Project (No. GSWS2021004). Authors' contributions Z.J. performed the lab experiments and wrote the manuscript. J.W. designed the study and edited the manuscript. Y.C. supervised the research project and gave final approval. All authors reviewed the manuscript. References Bulun SE, Yildiz S, Adli M, Wei JJ. Adenomyosis pathogenesis: insights from next-generation sequencing. Hum Reprod Update 2021; 27(6):1086-1097. Upson K, Missmer SA. Epidemiology of Adenomyosis. Semin Reprod Med 2020; 38(2-03):89-107. Sharara FI, Kheil MH, Feki A, Rahman S, Klebanoff JS, Ayoubi JM, Moawad GN. Current and Prospective Treatment of Adenomyosis J Clin Med. 2021; 10:15. Osada H. Uterine adenomyosis and adenomyoma: the surgical approach. Fertil Steril 2018; 109(3):406-417. Fan Y, Zhu S, Liang X. Conservative surgical and drug therapies for adenomyosis Medicine. Reprod Biol 2022; 22(3):100664. Rižner TL. The Important Roles of Steroid Sulfatase and Sulfotransferases in Gynecological Diseases. Front Pharmacol 2016; 7 :30. Artymuk N, Zotova O, Gulyaeva L. Adenomyosis: genetics of estrogen metabolism. Horm Mol Biol Clin I 2019; 37:2. Leyendecker G, Wildt L. A new concept of endometriosis and adenomyosis: tissue injury and repair (TIAR). Horm Mol Biol Clin I 2011; 5(2):125-142. Chen YJ, Li HY, Huang CH, Twu NF, Yen MS, Wang PH, Chou TY, Liu YN, Chao KC, Yang MH. Oestrogen-induced epithelial-mesenchymal transition of endometrial epithelial cells contributes to the development of adenomyosis. J Pathol 2010; 222(3):261-270. Jin Z, Liu H, Xu C. Estrogen degrades Scribble in endometrial epithelial cells through E3 ubiquitin ligase HECW1 in the development of diffuse adenomyosis. Biol Reprod 2020; 102(2):376-387. Buckley CE, St JD. Apical-basal polarity and the control of epithelial form and function. Nat Rev Mol Cell Bio 2022; 23(8):559-577. Bonello TT, Peifer M. Scribble: A master scaffold in polarity, adhesion, synaptogenesis, and proliferation. J Cell Biol 2019; 218(3):742-756. Wan S, Meyer AS, Weiler S, Rupp C, Tóth M, Sticht C, Singer S, Thomann S, Roessler S, Schorpp-Kistner M, Schmitt J, Gretz N, et al. Cytoplasmic localization of the cell polarity factor scribble supports liver tumor formation and tumor cell invasiveness. Hepatology 2018 ;67(5):1842-1856. Feigin ME, Akshinthala SD, Araki K, Rosenberg AZ, Muthuswamy LB, Martin B, Lehmann BD, Berman HK, Pietenpol JA, Cardiff RD, Muthuswamy SK. Mislocalization of the cell polarity protein scribble promotes mammary tumorigenesis and is associated with basal breast cancer. Cancer Res 2014; 74(11):3180-3194. Elsum IA, Humbert PO. Localization, not important in all tumor-suppressing properties: a lesson learnt from scribble. Cells Tissues Organs 2013 ;198(1):1-11. Blaskovic S, Blanc M, van der Goot FG. What does S-palmitoylation do to membrane proteins? FEBS J 2013; 280(12):2766-2774. De I, Sadhukhan S. Emerging Roles of DHHC-mediated Protein S-palmitoylation in Physiological and Pathophysiological Context. Eur J Cell Biol 2018; 97(5):319-338. Won SJ, Cheung SKM, Martin BR. Protein depalmitoylases. Crit Rev Biochem Mol 2018; 53(1):83-98. Chen S, Zhu B, Yin C, Liu W, Han C, Chen B, Liu T, Li X, Chen X, Li C, Hu L, Zhou J, et al. Palmitoylation-dependent activation of MC1R prevents melanomagenesis. Nature 2017; 549(7672):399-403. Batista CM, Kessler RL, Eger I, Soares MJ. Treatment of Trypanosoma cruzi with 2-bromopalmitate alters morphology, endocytosis, differentiation and infectivity. BMC Cell Biol 2018; 19(1):19. Hernandez JL, Davda D, Cheung SKM, Majmudar JD, Won SJ, Gang M, Pasupuleti SC, Choi AI, Bartkowiak CM, Martin BR. APT2 Inhibition Restores Scribble Localization and S-Palmitoylation in Snail-Transformed Cells. Cell Chem Biol 2017; 24(1):87-97. Chen B, Zheng B, DeRan M, Jarugumilli GK, Fu J, Brooks YS, Wu X. ZDHHC7-mediated S-palmitoylation of Scribble regulates cell polarity. Nat Chem Biol 2016; 12(9):686-693. Marquardt RM, Jeong JW, Fazleabas AT. Animal Models of Adenomyosis. Semin Reprod Med 2020; 38(2-03):168-178. Peng Y, Liu X, Jin Z, Liu H, Xu C. Scribble downregulation in adenomyosis compromises endometrial stromal decidualization by decreasing FOXO1 expression. Hum Reprod 2021; 37(1):93-108. Peng Y, Jin Z, Liu H, Xu C. Impaired decidualization of human endometrial stromal cells from women with adenomyosis. Biol Reprod 2021; 104(5):1034-1044. Jin Z, Wu X, Liu H, Xu C. Celecoxib, a selective COX-2 inhibitor, markedly reduced the severity of tamoxifen-induced adenomyosis in a murine model. Exp Ther Med 2020; 19(5):3289-3299. Ouyang Z, Zhan W, Dan L. hScrib, a human homolog of Drosophila neoplastic tumor suppressor, is involved in the progress of endometrial cancer. Oncol Res 2010; 18(11-12):593-599. Wang N, Song L, Xu Y, Zhang L, Wu Y, Guo J, Ji W, Li L, Zhao J, Zhang X, Zhan L, et al. Loss of Scribble confers cisplatin resistance during NSCLC chemotherapy via Nox2/ROS and Nrf2/PD-L1 signaling. Ebiomedicine 2019; 47:65-77. Pearson HB, Perez-Mancera PA, Dow LE, Ryan A, Tennstedt P, Bogani D, Elsum I, Greenfield A, Tuveson DA, Simon R, Humbert PO. SCRIB expression is deregulated in human prostate cancer, and its deficiency in mice promotes prostate neoplasia. J Clin Invest 2011; 121(11):4257-4267. Ellenbroek SI, Iden S, Collard JG. Cell polarity proteins and cancer. Semin Cancer Biol 2012; 22(3):208-215. Dekker FJ, Rocks O, Vartak N, Menninger S, Hedberg C, Balamurugan R, Wetzel S, Renner S, Gerauer M, Schölermann B, Rusch M, Kramer JW, et al. Small-molecule inhibition of APT1 affects Ras localization and signaling. Nat Chem Biol 2010; 6(6):449-456. Adibekian A, Martin BR, Wang C, Hsu KL, Bachovchin DA, Niessen S, Hoover H, Cravatt BF. Click-generated triazole ureas as ultrapotent in vivo-active serine hydrolase inhibitors. Nat Chem Biol 2011; 7(7):469-478. Cognetta AR, Niphakis MJ, Lee HC, Martini ML, Hulce JJ, Cravatt BF. Selective N-Hydroxyhydantoin Carbamate Inhibitors of Mammalian Serine Hydrolases. Chem Biol 2015; 22(7):928-937. Main A, Fuller W. Protein S-Palmitoylation: advances and challenges in studying a therapeutically important lipid modification. FEBS J 2022; 289(4):861-882. Supplementary Files Graphicalabstract.jpg Cite Share Download PDF Status: Published Journal Publication published 21 Aug, 2023 Read the published version in Reproductive Sciences → Version 1 posted Reviewers agreed at journal 02 Jun, 2023 Reviewers invited by journal 02 Jun, 2023 Editor assigned by journal 24 May, 2023 First submitted to journal 17 May, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-2943175\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":206379908,\"identity\":\"1caf637f-8fde-4d41-81ee-8ea1c84f8b5a\",\"order_by\":0,\"name\":\"zhixing jin\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBklEQVRIiWNgGAWjYBACxmYGBmYGAwYeEPNBQsUBsOiBB8RpYW4zeHDmAIjFcCCBgE3MEIq9QfJhG0QLAz4tzO28hz8XFByWMedf2GCQOO+OnL3Y4YdAW+zkdBtwOYwvwXiGQRqP5YyHDQ8Stz0z5pFOMwBqSTY2O4BLC49BMo+BDY/BjYNAW7YdTuyRTgBpOZC4DY+WwzwGEmAtEolzQFrSPxDSYtgMtuV8I1BLA0hLDkFbjJl5gH4xuMHYZpBw7LAxz+2cggMJBrj9Yth/xvgzz5/D9gbnjz9++KPmsBz77PTNHz5U2Mnh1NIAY0kkIIsbYFcOAvJwFj8OQ0fBKBgFo2AUAAB35WLqI+nY5AAAAABJRU5ErkJggg==\",\"orcid\":\"https://orcid.org/0000-0002-1241-1048\",\"institution\":\"Soochow University Affiliated No 1 People\\\\'s Hospital: First Affiliated Hospital of Soochow University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"zhixing\",\"middleName\":\"\",\"lastName\":\"jin\",\"suffix\":\"\"},{\"id\":206379909,\"identity\":\"6b902729-33e1-48af-841e-670bdbdd4c3b\",\"order_by\":1,\"name\":\"Juan Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Soochow University Affiliated No 1 People\\\\'s Hospital: First Affiliated Hospital of Soochow University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Juan\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":206379910,\"identity\":\"b96761f7-b4da-47bc-8532-5d3cea4168b8\",\"order_by\":2,\"name\":\"Youguo Chen\",\"email\":\"\",\"orcid\":\"https://orcid.org/0009-0000-3245-2093\",\"institution\":\"Soochow University Affiliated No 1 People\\\\'s Hospital: First Affiliated Hospital of Soochow University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Youguo\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2023-05-16 14:23:38\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-2943175/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-2943175/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1007/s43032-023-01319-4\",\"type\":\"published\",\"date\":\"2023-08-21T15:02:05+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":38097364,\"identity\":\"e3126c8b-6045-4ba2-bda7-428863c94793\",\"added_by\":\"auto\",\"created_at\":\"2023-06-06 14:10:42\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":12820517,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eMislocalization of Scribble in adenomyosis patients and tamoxifen-induced adenomyosis mice. (A) Representative immunostaining images of Scribble derived from patients with (n=19) or without adenomyosis (n=15). Scale bars: 200μm. The bar graph summarizes the results derived from all tissues. (B) Representative immunostaining images of Scribble derived from mice with or without adenomyosis (n=10). Scale bars: 50μm. The bar graph summarizes the results derived from all tissues. Chi-Squared test was used for statistical analyses. Symbols for statistical significance levels: *P \\u0026lt; 0.05\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2943175/v1/7aebd4de31811cecc6439632.png\"},{\"id\":38097363,\"identity\":\"e78fba35-29ad-4b74-8bfb-998cc9036777\",\"added_by\":\"auto\",\"created_at\":\"2023-06-06 14:10:42\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2754388,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eScribble membrane localization is regulated by its S-palmitoylation in endometrial epithelial cells. (A) Scribble immunofluorescence stains of Ishikawa cells after treated with different concentrations (25μM, 50μM or 75μM) of 2-BP for 48H. Blue-DAPI, Green-Scribble. Scale bars: 50μm. (B) Western immunoblotting of protein fractions isolated from control and 25μM 2-BP treated cells after membranous and cytoplasmic protein fractionation. Na+-K+-ATPase and LDHA served as loading controls for fractionation and the molecular weight of relevant marker for each band was labelled. (C) The acyl-biotin exchange assay of protein extracts isolated from control and 25μM 2-BP treated cells (palmitoylation assay). Cells not treated with hydroxylamine (HA) served as negative controls and the molecular weight of relevant marker for each band was labelled. (D) Quantitative analysis of membranous Scribble, cytoplasmic Scribble and the expression level of palm-Scribble after 2-BP treatment. Two-tailed unpaired Student’s t-test was used for statistical analyses. Symbols for statistical significance levels: *P \\u0026lt; 0.05 and **P \\u0026lt; 0.01 respectively.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2943175/v1/eb3f36642db372f7b77dd556.png\"},{\"id\":38098817,\"identity\":\"6e0e3b52-b5f8-495a-9f9a-e9341d47f419\",\"added_by\":\"auto\",\"created_at\":\"2023-06-06 14:18:42\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":4161472,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEstrogen regulates Scribble localization and S-palmitoylation in endometrial epithelial cells. (A) Representative images of Scribble tested by immunocytofluorescence after treatment with estrogen or estrogen receptor inhibitor ICI182,780 for 48H. Blue-DAPI, Green-Scribble. Scale bars: 50μm. (B) Western immunoblotting of protein fractions isolated from control and 10\\u003csup\\u003e-6\\u003c/sup\\u003eM estrogen treated cells after membranous and cytoplasmic protein fractionation. Na+-K+-ATPase and LDHA served as loading controls for fractionation and the molecular weight of relevant marker for each band was labelled. (C) The acyl-biotin exchange assay of protein extracts isolated from control and 10\\u003csup\\u003e-6\\u003c/sup\\u003eM estrogen treated cells (palmitoylation assay). Cells not treated with hydroxylamine (HA) served as negative controls and the molecular weight of relevant marker for each band was labelled. (D) Quantitative analysis of membranous Scribble, cytoplasmic Scribble and the expression level of palm-Scribble after estrogen treatment. Two-tailed unpaired Student’s t-test was used for statistical analyses. Symbols for statistical significance levels: *P \\u0026lt; 0.05 and **P \\u0026lt; 0.01 respectively.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2943175/v1/2ecff51f2f4aea8c745eb529.png\"},{\"id\":38097366,\"identity\":\"05916e07-77ff-4c47-93d1-c22fddd11324\",\"added_by\":\"auto\",\"created_at\":\"2023-06-06 14:10:42\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":703548,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eScreening and verification of PATs or APTs caused by estrogen. (A) Quantitative analysis of mRNA level of all 23 zDHHCs tested by RT-PCR after treatment with estrogen. (B-C) Protein level of APT1, APT2 and zDHHC7 detected by Western blot after 10\\u003csup\\u003e-6\\u003c/sup\\u003eM estrogen treatment. β-tubulin served as loading controls and the molecular weight of relevant marker for each band was labelled. Two-tailed unpaired Student’s t-test was used for statistical analyses. Symbols for statistical significance levels: **P \\u0026lt; 0.01 and ***P \\u0026lt; 0.001 respectively.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2943175/v1/992ed0c4a94d800b4d1dbdca.png\"},{\"id\":38098816,\"identity\":\"c51447cb-5891-4975-ac8e-7c5adb48631d\",\"added_by\":\"auto\",\"created_at\":\"2023-06-06 14:18:42\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2931505,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAPT inhibition rescues Scribble plasma membrane localization and S-palmitoylation induced by estrogen. (A) Representative images of Scribble tested by immunocytofluorescence after treatment with estrogen or/and APT inhibitor Palmostatin B for 48H. Blue-DAPI, Green-Scribble. Scale bars: 20μm. (B) Western immunoblotting of protein fractions isolated from estrogen or/and APT inhibitor Palmostatin B treated cells after membranous and cytoplasmic protein fractionation. Na+-K+-ATPase and β-tubulin served as loading controls for fractionation and the molecular weight of relevant marker for each band was labelled. (C) The acyl-biotin exchange assay of protein extracts isolated from estrogen or/and APT inhibitor Palmostatin B treated cells (palmitoylation assay). Cells not treated with hydroxylamine (HA) served as negative controls and the molecular weight of relevant marker for each band was labelled. (D) Quantitative analysis of membranous Scribble, cytoplasmic Scribble and the expression level of palm-Scribble after estrogen or/and APT inhibitor Palmostatin B treatment. One-way ANOVA test followed by Tukey's multiple comparisons test was used for statistical analyses. Symbols for statistical significance levels: *P \\u0026lt; 0.05 and **P \\u0026lt; 0.01 respectively.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2943175/v1/b5612fbc39bf2d553ea8388b.png\"},{\"id\":38099798,\"identity\":\"e4203773-746e-4bd7-9413-8e545cea3384\",\"added_by\":\"auto\",\"created_at\":\"2023-06-06 14:26:42\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":14660089,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eExpression of APT1 and APT2 was verified in human specimens of adenomyosis. (A) Representative immunostaining images of APT1, APT2 and aromatase P450 with or without adenomyosis in human specimens. Scale bars: 50μm. (B) Quantitative analysis of APT1, APT2 and aromatase P450 with or without adenomyosis in human specimens. Two-tailed unpaired Student’s t-test was used for statistical analyses. Symbols for statistical significance levels: *P \\u0026lt; 0.05, ***P \\u0026lt; 0.001 and **** P \\u0026lt; 0.0001 respectively. (C) Correlation between APT1 and aromatase P450 in human specimens was analyzed by Pearson correlation test. (D) Correlation between APT2 and aromatase P450 in human specimens was analyzed by Pearson correlation test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2943175/v1/e92edd338a4ec2cdc7142250.png\"},{\"id\":42781491,\"identity\":\"22f517df-7860-498b-b382-f1c600384bcd\",\"added_by\":\"auto\",\"created_at\":\"2023-09-07 15:09:54\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3263741,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2943175/v1/17200fcc-4460-481b-9bcf-090f453ebb97.pdf\"},{\"id\":38097368,\"identity\":\"a83afc02-5524-4d93-8b32-3c98ec49e38a\",\"added_by\":\"auto\",\"created_at\":\"2023-06-06 14:10:42\",\"extension\":\"jpg\",\"order_by\":14,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1188410,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Graphicalabstract.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2943175/v1/f104d2762d2df0ca1f4ca9f4.jpg\"}],\"financialInterests\":\"\",\"formattedTitle\":\"Estrogen regulates Scribble localization in endometrial epithelial cells through acyl protein thioesterase (APT)-mediated S-palmitoylation in adenomyosis\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eAdenomyosis (ADE) is a common estrogen-dependent benign gynecological disease, which is characterized by the presence of ectopic endometrial tissue (endometrial glands and/or stroma) in the myometrium surrounded by hyperplastic and hypertrophic smooth muscle [1]. It\\u0026rsquo;s reported that ADE has detrimental effects on 20 to 35% of reproductive-aged women' quality of life and consumes substantial healthcare resources [2]. Due to the nonspecific symptoms and the lack of a specific and effective test method, its incidence is actually much higher than what is known at present and has a younger and rising trend in recent years.\\u003c/p\\u003e \\u003cp\\u003eDue to the unknown mechanisms, no drug is currently labeled for adenomyosis and there are no specific guidelines to follow for the best management [3]. Hysterectomy is currently considered the most effective treatment for adenomyosis, however, it is only applicable to older, nearly menopausal women with no fertility requirements [4]; drug treatment using suppressive hormone aiming for the hypothalamic-pituitary-ovarian (HPO) axis could induce regression of adenomyosis and improve the symptoms, but symptom recurrence after drug discontinuation, obvious side effects and pregnancy limitation becomes the principal drawbacks of these medical options [5].\\u003c/p\\u003e \\u003cp\\u003eSupraphysiologic estrogen production in the endometrium is widely considered to be closely related to the occurrence of adenomyosis [6]. In adenomyosis, abnormal production of local estrogen is thought to be the result of increased aromatase activity and decreased estrogen metabolism in the endometrium [7]. Researchers have found that estrogen can not only contribute to hyperplasia and epithelial mesenchymal transformation of endometrial glandular epithelium but also promote oxytocin-mediated uterine contractions, which could cause hyperperistalsis and tissue microtrauma in the junction zone and eventual activation of the tissue injury and repair (TIAR) mechanism [8, 9]. However, the underlying molecular mechanism is unclear. Our previous research has found that estrogen can disrupt the polarity of endometrial glandular epithelial cells through E3 ubiquitin ligase HECW1-mediated Scribble degradation. Also, Scribble was observed to be mislocated to cytoplasm in adenomyosis [10].\\u003c/p\\u003e \\u003cp\\u003eThe polarity protein Scribble, a member of the LAP family proteins, contains 16 LRRs at the N terminus, followed by two LAP-specific domains (LAPSD) and 4 PDZ domains, which is located at the basolateral membrane in endometrial epithelial cells of healthy women [11]. It plays an important role in establishing and maintaining apical-basal polarity, controlling tissue growth, differentiation and cell directed migration [12]. In breast cancer and liver cancer, genetically normal Scribble mislocated from cell-cell junctions to the cytoplasm, correlating with enhanced growth signaling and malignancy [13, 14]. In addition, Scribble intracellular localization changes can also cooperate with oncogenes (Ras or Myc) to promote tumorigenesis [15]. Despite the critical role for Scribble membrane localization, little is known about the role and molecular mechanism of Scribble re-localization in the development of adenomyosis.\\u003c/p\\u003e \\u003cp\\u003eProtein S-palmitoylation is a post-translational lipidation with a reversible thioester bond between a cysteine residue and 16-carbon fatty acid, palmitate, which is important in regulating trafficking and localization of many peripheral and integral membrane proteins [16]. S-palmitoylation is dynamically regulated by two opposite types of enzymes, protein S-acyl transferases (PATs) and acyl protein thioesterases (APTs). PATs mainly refer to zDHHC enzymes due to their predicted Zn\\u003csup\\u003e2+\\u003c/sup\\u003e-binding and conserved Asp-His-HisCys motif and work in catalyzing protein S-palmitoylation [17]. 23 zDHHC genes have been identified in human genome databases. De-palmitoylation is catalyzed by one or more HDFP-sensitive hydrolases, mainly referring to APT1 and APT2 [18]. PATs or APTs small molecule inhibitors such as 2-Bromopalmitate (2-BP), Palmostatin B can be used in the treatment of diseases by regulating the level of S-palmitoylation modification of proteins [19, 20]. Scribble has been identified as palmitoylated by zDHHC7 in MCF10A human epithelial cells and APT2 inhibition restores Scribble localization and S-palmitoylation in Snail-transformed breast epithelial cells [21, 22], suggesting that Scribble participates in an active S-palmitoylation cycle similar to that of palmitoylated Ras, where zDHHCs add and APTs remove S-palmitoyl groups from Scribble.\\u003c/p\\u003e \\u003cp\\u003eTherefore, we hypothesize that estrogen promotes cytoplasmic translocation though down-regulating Scribble S-palmitoylation in the development of adenomyosis and promoting Scribble localization restoration by regulating its S-palmitoylation may be a newly and effectively method for adenomyosis treatment.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cp\\u003eEthics statement\\u003c/p\\u003e\\n\\u003cp\\u003eThis study complied with the tenets of the Helsinki Declaration and the National Guidelines for Animal Use in Research (China). All experiments were performed under the guidelines of the National Research Council Guide for the Care and Use of Laboratory Animals and approved by the Medical Ethics Committee of the First Affiliated Hospital of Soochow University (Suzhou, China). All tissue samples were obtained after written, full and informed consent from recruited subjects.\\u003c/p\\u003e\\n\\u003cp\\u003ePatients and human tissue collection\\u003c/p\\u003e\\n\\u003cp\\u003eAfter informed written consent, totally 19 human endometrial samples from adenomyosis patients were collected at the First Affiliated Hospital of Soochow University (Suzhou, China), from June, 2021 to June, 2022. Their diagnoses were made by transvaginal ultrasound before surgery and histologically confirmed post-operatively. For controls, endometrial tissue samples were collected from 15 women who had undergone hysterectomy because of cervical intraepithelial neoplasia (CIN)-III, cervical carcinoma in situ or stage IA1 cervical cancer but free of endometriosis, adenomyosis and uterine fibroids. All the recruited women in both study and control groups had regular cycles and had not received any hormonal or anti-platelet treatment for at least 3 months prior to tissue collection. Two wedges of tissue from the lumen to the muscular myometrial layer that included superficial and basal endometrium as well as myometrium was taken from the detached uterus, then immediately fixed in 10% buffered formalin at room temperature for 48H and embedded in paraffin for hematoxylin and eosin (HE) or immunohistochemical staining. Information on uterine size, severity of dysmenorrhea, amount of menses, cycle length, reproductive history and age was also recorded (Table\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e).\\u003c/p\\u003e\\n\\u003cdiv class=\\\"gridtable\\\"\\u003e\\n \\u003ctable id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\n \\u003ccaption\\u003e\\n \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\n \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\n \\u003cp\\u003eCharacteristics of recruited patients with and without adenomyosis.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003c/caption\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eVariable name\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eControl group\\u003c/p\\u003e\\n \\u003cp\\u003en\\u0026thinsp;=\\u0026thinsp;15\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAdenomyosis group\\u003c/p\\u003e\\n \\u003cp\\u003en\\u0026thinsp;=\\u0026thinsp;19\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003ep-value\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAge (years)\\u003c/p\\u003e\\n \\u003cp\\u003eMean (\\u0026plusmn;\\u0026thinsp;S.D.)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e45.73\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;4.464\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e47.68\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;4.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e0.1195\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eLive births\\u003c/p\\u003e\\n \\u003cp\\u003eMedian (range)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1.5(0\\u0026ndash;3)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1(1\\u0026ndash;3)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e0.1900\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eMiscarriages\\u003c/p\\u003e\\n \\u003cp\\u003eMedian (range)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1.5(1\\u0026ndash;4)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1(0\\u0026ndash;3)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e0.2405\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCycle length (days)\\u003c/p\\u003e\\n \\u003cp\\u003eMedian (range)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e28(25\\u0026ndash;30)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e30(23\\u0026ndash;35)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e0.6689\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAmount of menses\\u003c/p\\u003e\\n \\u003cp\\u003eLight \\u0026amp; Moderate\\u003c/p\\u003e\\n \\u003cp\\u003eHeavy\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e14(93.33%)\\u003c/p\\u003e\\n \\u003cp\\u003e1(6.67%)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e9(47.37%)\\u003c/p\\u003e\\n \\u003cp\\u003e10(52.63%)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e0.0083\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eDysmenorrhea severity\\u003c/p\\u003e\\n \\u003cp\\u003eNone\\u003c/p\\u003e\\n \\u003cp\\u003eMild\\u003c/p\\u003e\\n \\u003cp\\u003eModerate\\u003c/p\\u003e\\n \\u003cp\\u003eSevere\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e13(86.67%)\\u003c/p\\u003e\\n \\u003cp\\u003e2(13.33%)\\u003c/p\\u003e\\n \\u003cp\\u003e0(0%)\\u003c/p\\u003e\\n \\u003cp\\u003e0(0%)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e2(10.53%)\\u003c/p\\u003e\\n \\u003cp\\u003e3(15.79%)\\u003c/p\\u003e\\n \\u003cp\\u003e4(21.05%)\\u003c/p\\u003e\\n \\u003cp\\u003e10(52.63%)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.0001\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eUterine size (in cm3)\\u003c/p\\u003e\\n \\u003cp\\u003eMean (\\u0026plusmn;\\u0026thinsp;S.D.)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e129.8\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;58.72\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e529.7\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;262.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u0026lt;\\u0026thinsp;0.0001\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cp\\u003ePreparation of drugs and animals\\u003c/p\\u003e\\n\\u003cp\\u003eUsing tamoxifen orally on Institute of Cancer Research (ICR) newborn mice is a classic method for establishment of experimental adenomyosis [23]. Tamoxifen was purchased from Fudan Forward Pharmaceutical Company (Shanghai, China). Pregnant ICR mice were purchased from Shanghai Laboratory Animal Corporation (Shanghai, China). Each dam and her pups were housed in the same cage under controlled conditions (12:12 light/dark cycle with lights on at 6:00 a.m.) and had access to chow and fresh water ad libitum.\\u003c/p\\u003e\\n\\u003cp\\u003eWe obtained 20 female neonatal mice from 6 pregnant ICR mice. They were randomly divided into two groups: the control group and the adenomyosis model (ADE) group. From day 1 to day 5 after birth, female neonatal mice in the ADE group received 1mg/kg tamoxifen suspended in a peanut oil/lecithin/condensed milk mixture (2:0.2:3, by volume) at a dose volume of 5\\u0026micro;l/g body weight. The control neonatal mice were fed similarly with the same amount of solvent, without tamoxifen. When the mice reached 3 weeks of age, they were weaned and separated from the dams. The uterine samples were harvested at 42 days of age. All the mice have normal estrus cycle.\\u003c/p\\u003e\\n\\u003cp\\u003eCell lines\\u003c/p\\u003e\\n\\u003cp\\u003eThe endometrial cancer cell line Ishikawa was purchased from the National Infrastructure of Cell Line Resource (China) and cultured in DMEM/F12 medium, supplemented with 10% fetal bovine serum (FBS).\\u003c/p\\u003e\\n\\u003cp\\u003eDrug intervention\\u003c/p\\u003e\\n\\u003cp\\u003eThe following drugs were used for cell interventions as indicated: 2-Bromopalmitate (21604; Sigma Aldrich, USA), Palmostatin B (178501; Sigma Aldrich, USA), 17\\u0026beta;-estrogen (E2758; Sigma Aldrich, USA), ICI182,780 (HY-13636; MedchemExpress, New Jersey, USA) and vehicles including ethanol and dimethyl sulfoxide (DMSO). Prior to E2 intervention, cells were cultured in phenol red-free medium supplemented with 10% charcoal-stripped FBS.\\u003c/p\\u003e\\n\\u003cp\\u003eReal-time polymerase chain reaction (RT-PCR)\\u003c/p\\u003e\\n\\u003cp\\u003eTotal RNA was isolated from endometrial tissues using DNA/RNA/Protein isolation kit (Tiangen, China) and 1\\u0026micro;g of the purified total RNA was reverse transcribed into cDNA with PrimeScript RT Master Mix kit (Takara, Japan), following the manufacturer\\u0026rsquo;s protocol. RT-PCR was performed with the CFX96 Real-time PCR Detection system (Bio-rad, USA) using the TB Green Premix Ex Taq II kit (Takara, Japan). The primers used in the experiment are shown in Table\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e. Relative expression of each gene was calculated using the delta\\u0026ndash;delta Ct method, with GAPDH as the endogenous control.\\u003c/p\\u003e\\n\\u003cdiv class=\\\"gridtable\\\"\\u003e\\n \\u003ctable id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e\\n \\u003ccaption\\u003e\\n \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e\\n \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\n \\u003cp\\u003ePrimer sequences.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003c/caption\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGene\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eSpecies\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eSense primer\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAntisense primer\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eACAGTGTTGCATCCGCTTTAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGTTGACAAAGAACTCCACGAAGA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTGATGCAGTCCAGGTATCTAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAGTGTCTTCTGTTGGCATTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCACTCGCATGAGAACTTAATTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCACAGGCAGGGTTTATGGT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGCAAGGGATGGTTTATACTGAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGGCAGAAGAAGGTAATGCAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCACCACCTCCACCTCCTATAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eACTCAAAATCAGGGCTGTCTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTAAACAGGTATTTACGTGGTCAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTGGTGACAGCCTTCTCTTACT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCCTTAAACTTGCCTGGTTTGT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGGAGACGCCAACTTCTCTTAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCTGGGCTGTGGCTCTACAT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGAGAATGGTTTTGTGGCTTTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGAGCAGGAATGGCAGTAATAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGGAGTCTGAGGGGATAGTGTT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC11\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGAAATACATTGCCTACGTGGTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTCATGAGTCTGACATTGGAGTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC12\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGCTTCAAGTCAGACAGATCCC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGTCCTTTTCTTCCCCTTCTTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC13\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCATCCGACAAGGACATTTACC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTTGAAACAATACTGCCAGGTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC14\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCTCTGTCTGGTCCATCGTTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGTCCTCATTTGTTGTCTGGTTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGGGTTTTCAGAGTGATTTTCA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGTGCTAATCCTCAGGCTAATG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC16\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCTCAGGCAAACAGAAGTTCCAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCAGCACTGGGCAAGGTAGGTA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC17\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eACCACTTACACCAAGGATGGA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTAATACAGCCACCCACATGAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC18\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGCCAGAGTGTAGAAAGCCATAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAGAGGGAGCATATCAGCGTAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC19\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTGGGTCAATAACTGCATCGGTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGAAGGGCAGGTGGGTTGTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC20\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTCCTCCTGGCTGTCAGTTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAGTCAGACTTCAGACTGTGCGT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC21\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCAGAGCCAAGTGAAGATCACC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCCCAGTACCCACTGCTACTACA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC22\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGAGCAGAGATTGGGAGGACTTTA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTGAGTGAAGGAATGAGTATGGGA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC23\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGGCAGTCTCAACAATCGCACAAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGCACACCAGTCCTCCTTCGCT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eZDHHC24\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCATGTGTCTCCAGCAGCTTACTGAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAGCATTGAGCCTGAGGTGTTGATG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGAPDH\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHuman\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGGGAAGGTGAAGGTCGGAGT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGGGGTCATTGATGGCAACA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cp\\u003eImmunohistochemistry (IHC)\\u003c/p\\u003e\\n\\u003cp\\u003eIHC staining was performed as previously described [24]. Primary antibodies used included Scribble (1:1000 dilution; HPA023557; Sigma Aldrich, USA), APT1 (1:100 dilution; 16055-1-AP; Proteintech, USA), APT2 (1:100 dilution; TA365341; Origene, USA) and aromatase P450 (1:50 dilution; SAB4500606; Sigma Aldrich, USA). Quantification of immunoreactivity was performed with Image Pro-Plus 6.0 software (Media Cybernetics, Inc.), as described previously.\\u003c/p\\u003e\\n\\u003cp\\u003eImmunofluorescence\\u003c/p\\u003e\\n\\u003cp\\u003eCell immunofluorescent staining was performed as previously described [25]. Primary antibodies against Scribble (1:1000 dilution; HPA023557; Sigma Aldrich, USA) was incubated with cells overnight at 4℃ followed by incubation with secondary fluorescent-tagged antibody (1:1000 dilution; anti-rabbit Alexa Fluor 488; Abcam, USA) for 1 h. Nuclei were stained with DAPI (Beyotime, China) for 5 min. Fluorescence was detected using laser scanning confocal microscopy (Leica) and inverted fluorescence microscope (Nikon).\\u003c/p\\u003e\\n\\u003cp\\u003eSodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting\\u003c/p\\u003e\\n\\u003cp\\u003eCell proteins were extracted and Mem-PER\\u0026trade; Plus kit (89842; Thermo Fisher Scientific, USA) was used for separating the membranous protein. Then SDS-PAGE and immunoblotting were carried out as previously described [26]. Primary antibodies used included anti-GAPDH (1:1000 dilution; ab181602; Abcam, USA), anti-tubulin (1:1000 dilution; 2146; Cell Signaling Technology, USA), anti-Na+-K+-APTase (1:1000 dilution; ab76020; Abcam, USA), LDHA (1:1000 dilution; 2012; Cell Signaling Technology, USA), Scribble (1:1000 dilution; 4475; Cell Signaling Technology, USA), ZDHHC7 (1:1000 dilution; ab138210; Abcam, USA), APT1 (1:5000 dilution; ab91606; Abcam, USA), APT2 (1:1000 dilution; ab151578; Abcam, USA).\\u003c/p\\u003e\\n\\u003cp\\u003eAcyl-biotin exchange palmitoylation assay\\u003c/p\\u003e\\n\\u003cp\\u003eBriefly, cells were lysed by lysis buffer (Beyotime, China) with protease inhibitor (B14001; Bimake, USA) and 50mM N-Ethylmaleimide (Sigma-Aldrich, USA). Endogenous Scribble is then purified by specific antibodies and beads. Purified Scribble protein were divided into two groups, and one treated with lysis buffer\\u0026thinsp;+\\u0026thinsp;1M hydroxylamine (467804; Sigma-Aldrich, USA) for 1 hour at room temperature. Finally, the beads were gently washed by lysis buffer pH 6.2 and incubated with lysis buffer pH 6.2\\u0026thinsp;+\\u0026thinsp;2\\u0026micro;M Biotin-BMCC (21900; Thermo Fisher Scientific, USA) for 1 hour at 4℃. Proteins were washed 3 times and proceeded for IB analysis.\\u003c/p\\u003e\\n\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e\\n \\u003cp\\u003eAll experiments were repeated at least three times in this study. Statistical differences were analyzed using Statistical Package for the Social Sciences (SPSS) software (19.0) (SPSS Inc., Chicago, IL, USA). The two-tailed unpaired Student\\u0026rsquo;s t-test, Mann-Whitney test, one-way ANOVA test followed by Tukey\\u0026apos;s multiple comparisons test, Pearson correlation test and Chi-Squared test were used for further analyses. P-values of 0.05 were considered statistically significant.\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e1. Mislocalization of polarity protein Scribble in eutopic endometrium of adenomyosis patients and tamoxifen-induced adenomyosis mice.\\u003c/p\\u003e\\n\\u003cp\\u003eThe characteristics of the recruited patients with adenomyosis and the control subjects are listed in Table \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. As shown in the table, the patients in different groups were comparable in age, live births, miscarriages and cycle length. However, patients with adenomyosis had significantly bigger uterine sizes, heavier menses and more severe dysmenorrhea.\\u003c/p\\u003e\\n\\u003cp\\u003eUsing IHC, the subcellular Scribble localization in endometrial biopsies of control and adenomyosis patients were investigated. As shown in the Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA, although Scribble was localized at the plasma membrane in eutopic endometrium of women without adenomyosis in 73% of all cases (11/15), partially translocation to cytoplasm of Scribble was detectable in 68% of adenomyosis cases (13/19).\\u003c/p\\u003e\\n\\u003cp\\u003eIn order to find out whether the subcellular Scribble localization in mouse has the similar change to that found in the human endometrium. Tamoxifen was used to induce adenomyosis in newborn ICR mice. The complete absence of any ectopic endometrium in the myometrium is considered as successful establishment of adenomyosis mouse model. At day 42, all mice in the tamoxifen-induced group showed endometrial invasion into the myometrium, while no ectopic endometrium was observed in the myometrium of the control group. Compared with mice in the control group (9/10), mislocalization of Scribble was observed in 60% of adenomyosis cases (6/10). (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB)\\u003c/p\\u003e\\n\\u003cp\\u003e2. S-palmitoylation of Scribble regulates its membrane localization in endometrial epithelial cells\\u003c/p\\u003e\\n\\u003cp\\u003eSince Scribble requires S-palmitoylation for membrane recruitment in MDCK, we explored if defects in Scribble S-palmitoylation might provide a potential mechanism for mislocalization in endometrial epithelial cells.\\u003c/p\\u003e\\n\\u003cp\\u003eAfter treating Ishikawa cells with different concentrations (25\\u0026micro;M, 50\\u0026micro;M or 75\\u0026micro;M) of the general palmitoylation inhibitor 2-BP for 48H, the expression of membranous and cytoplasmic Scribble was detected by immunofluorescence and cytoplasmic enrichment has been seen following different concentrations of 2-BP (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). Then we separated the membranous and cytoplasmic protein by Mem-PER\\u003csup\\u003e\\u0026trade;\\u003c/sup\\u003e Plus kit and found membranous Scribble was decreased significantly and cytoplasmic Scribble was increased significantly after 25\\u0026micro;M 2-BP treatment (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB\\u0026amp;\\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD), compared with the control group. Meanwhile, the reduced level of palm-Scribble caused by 25\\u0026micro;M 2-BP was further verified by western blot. (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC-D)\\u003c/p\\u003e\\n\\u003cp\\u003e3. Estrogen regulates Scribble localization and S-palmitoylation in endometrial epithelial cells.\\u003c/p\\u003e\\n\\u003cp\\u003eSupraphysiologic estrogen production in the endometrium is considered to be the culprit of adenomyosis. Therefore, we treated Ishikawa cells with 10\\u003csup\\u003e-6\\u003c/sup\\u003eM estrogen or/and estrogen receptor inhibitor ICI182,780 for 48H and the result demonstrated that estrogen contributed to Scribble mislocalization which can be recovered by estrogen receptor inhibitor ICI182,780 (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). A significantly decrease in membranous Scribble and a significantly increase in cytoplasmic Scribble was further verified by western blot (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB\\u0026amp;\\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). Moreover, the expression level of palm-Scribble was dramatically decreased with estrogen treatment compared with the control group. (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC-D)\\u003c/p\\u003e\\n\\u003cp\\u003e4. Screening and verification of PATs or APTs induced by estrogen.\\u003c/p\\u003e\\n\\u003cp\\u003eWe hypothesized that estrogen may perturb the Scribble S-palmitoylation cycle equilibrium by disrupting normal PATs or APTs expression. To explore this question, total RNA was isolated from control and estrogen-treated cells for RT-PCR of all 23 zDHHCs. Surprisingly, estrogen treatment did not affect the mRNA level of any zDHHCs. (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA)\\u003c/p\\u003e\\n\\u003cp\\u003eBoth APT1 and APT2 are annotated as protein de-palmitoylases and are widely expressed and active across nearly all tissues. Then, we detected the effect of estrogen on the protein level of APT1, APT2 and zDHHC7 which has been reported to have a regulatory effect on Scribble palmitoylation in MDCK and found the expression levels of both APT1 and APT2 were increased significantly, while the expression of zDHHC7 had no dramatically change, compared with control group (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB-C), suggesting their possible role in the regulation of Scribble S-palmitoylation caused by estrogen.\\u003c/p\\u003e\\n\\u003cp\\u003e5. APT inhibition rescues Scribble plasma membrane localization and S-palmitoylation induced by estrogen.\\u003c/p\\u003e\\n\\u003cp\\u003eWe next explored if inhibiting de-palmitoylation might restore Scribble membrane localization and its S-palmitoylation cycle balance. Ishikawa cells were treated with 10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;6\\u003c/sup\\u003eM estrogen or/and the APT inhibitor Palmostatin B (25\\u0026micro;M) for 48H. The result demonstrated that when Palmostatin B was added in, estrogen did not have a significant effect on Scribble plasma membrane localization and its S-palmitoylation any more (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e), which suggested the important role of APTs in estrogen-induced Scribble cytoplasmic translocation and reduction of Scribble S-palmitoylation.\\u003c/p\\u003e\\n\\u003cp\\u003e6. Expression of APT1 and APT2 was verified in human specimens of adenomyosis patients.\\u003c/p\\u003e\\n\\u003cp\\u003eFinally, we verified the expression of APT1 and APT2 in adenomyosis patients and their correlation with estrogen production. We revealed that APT1 and APT2 staining was mainly seen in endometrial epithelial cells and mostly localized in the cytoplasm and cytomembrane, while aromatase P450, a key enzyme for estrogen synthesis was seen both in epithelial and stromal cells and was mostly localized in the cytoplasm and nucleus (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA).\\u003c/p\\u003e\\n\\u003cp\\u003eCompared with control endometrium, the expression of aromatase P450, APT1 and APT2 in the eutopic endometrium of patients with adenomyosis was all increased significantly (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eB). Furthermore, a positive correlation was found not only between APT1 and aromatase P450 but also between APT2 and aromatase P450 (Pearson\\u0026rsquo;s r\\u0026thinsp;=\\u0026thinsp;0.3475/P\\u0026thinsp;=\\u0026thinsp;0.0440 and r\\u0026thinsp;=\\u0026thinsp;0.4763/P\\u0026thinsp;=\\u0026thinsp;0.0044 respectively; Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eC-D).\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eADE is an often-overlooked heterogeneous gynecologic condition that causes infertility, pelvic pain, abnormal uterine bleeding and dysmenorrhea. It is generally recognized that supraphysiologic estrogen production in the eutopic endometrium plays an important role in the pathophysiology of adenomyosis, however little is known about its effects on the direction of gland epithelial cell growth that is related to cell polarity. In our previous research, the subcellular localization of Scribble has been found to be partially translocated to cytoplasm, suggesting its possible involvement in the development of adenomyosis.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we first verified the subcellular localization of Scribble in adenomyosis patients and tamoxifen-induced adenomyosis mice. Scribble translocation from the basolateral membrane to the cytoplasm was easily to be seen in women with adenomyosis (68% vs 27%). At day 42, when all the mice in the tamoxifen-treated group successfully formed lesions of adenomyosis and the similar change of Scribble localization was also found in adenomyosis model mice (60% vs 10%).\\u003c/p\\u003e \\u003cp\\u003eAs an important part of the Scribble polarity complex, Scribble contributes to multiple physiological processes. In epithelial tumors, Scribble is often considered as a tumor suppressor. Downregulation of Scribble was observed in endometrial cancer [27], non-small cell lung cancer [28] and prostate cancer [29] which was closely related to positive lymph node metastasis, chemotherapy resistance and poor prognosis. Knockdown of Scribble has been verified to accelerate the migration and invasion of tumor cells in vitro. Furthermore, Scribble localization is also necessary for polarized cells. Scribble localizes to the basolateral membrane, yet is mislocalized to the cytosol in most epithelial cancers, correlating with disrupted cell polarity, enhanced growth signaling, and transformation [30]. Despite the critical role for Scribble membrane localization, little is known about how Scribble re-localizes to the cytosol in adenomyosis.\\u003c/p\\u003e \\u003cp\\u003eSince it\\u0026rsquo;s reported that Scribble requires S-palmitoylation for membrane recruitment, we then explored if defects in Scribble S-palmitoylation might provide a potential mechanism for mislocalization in adenomyosis. Further in vitro investigation was conducted in Ishikawa cell lines and found Scribble re-localizes from the membrane to the cytosol along with decreased expression of palm-Scribble after treating with 2-Bromopalmitate, the general palmitoylation inhibitor by inhibiting the function of PATs, indicating that the S-palmitoylation cycle may be also involved in the translocation process of Scribble in adenomyosis.\\u003c/p\\u003e \\u003cp\\u003eIn view of the importance of estrogen in the pathogenesis of adenomyosis, we tried to illustrate the effect of estrogen on the subcellular localization and S-palmitoylation of Scribble in endometrial epithelial cells. Our study found that high concentration of estrogen could not only reduce the expression of palm-Scribble in glandular epithelial cells but also changed its intracellular localization which was consistent with what we found in mice and patients with adenomyosis, suggesting that estrogen functionally targets the S-palmitoylation machinery, which cooperates in disrupting cell polarity and the displacement of Scribble from the plasma membrane.\\u003c/p\\u003e \\u003cp\\u003eIn order to screen the PAT that may contribute to the perturbation of Scribble S-palmitoylation cycle equilibrium induced by estrogen, total RNA was isolated from control and estrogen treated cells for RT-PCR of all 23 zDHHC PATs. Surprisingly, all zDHHC mRNAs had no significantly change after high concentration of estrogen exposure. Although zDHHC7 was recently reported to participate in Scribble plasma membrane localization, we found neither mRNA levels nor protein levels of zDHHC7 were changed significantly followed estrogen treatment, suggesting estrogen either attenuates zDHHC7 activity or bypasses zDHHC7-dependent Scribble S-palmitoylation. APT1 and APT2 are annotated as protein de-palmitoylases and are targets of several classes of covalent serine hydrolase inhibitors, including β-lactones [31], triazole ureas [32] and N-hydroxyhydantoin carbamates [33]. In the following experiment, estrogen has been found to lead to a 1.5-fold increase of APT1 and a 2-fold or greater increase of APT2 at their protein levels, potentially shifting the balance of the S-palmitoylation cycle.\\u003c/p\\u003e \\u003cp\\u003eGiven the observed dynamic S-palmitoylation of Scribble in endometrial epithelial cells, we hypothesized that de-palmitoylase inhibition might enhance Scribble S-palmitoylation levels and restore plasma membrane localization in estrogen treated cells. The β-lactone inhibitor Palmostatin B is the most widely used APT inhibitor, and is primarily selective for both APT1 and APT2 at low micromolar concentrations [34]. Treatment with Palmostatin B reportedly blocks the Ras S-palmitoylation cycle, restoring epithelial-like features to HRasG12V-transformed MDCK cells [31]. Research highlighted a central role for MC1R palmitoylation in protecting against melanoma found inhibition of de-palmitoylation by Palmostatin B might be a potential clinical prevention strategy for melanoma [19]. In our study, Palmostatin B treatment promoted Scribble membrane re-localization and increase Scribble S-palmitoylation levels in estrogen treated cells, without having significant effects on Scribble localization in control cells, limiting the response to the estrogen-induced cells. Overall, we found that Scribble is regulated by an APT-dependent S-palmitoylation cycle, which is necessary for efficient membrane localization.\\u003c/p\\u003e \\u003cp\\u003eFinally, we verified the expression of APT1, APT2 and aromatase P450 in human specimens and found that they all increased significantly in eutopic endometrium of humans with adenomyosis. Furthermore, positive correlations between APT1 or APT2 and aromatase P450 have been found using Pearson\\u0026rsquo;s correlation test.\\u003c/p\\u003e \\u003cp\\u003eOur study has two limitations. First, all ADE patients enrolled in our study were diffuse type, whether our conclusion can be extended to focal ADE remains to be demonstrated. Second, although reestablishment of cellular polarity is to our knowledge not possible, specific downstream effector mechanisms may represent promising therapeutic target structures for a subgroup of patients with distinct alterations of cell polarity factors. Therefore, future researches may be focused on biologic behavior and downstream effector mechanisms via mutated Scribble with enforced cytoplasmic enrichment.\\u003c/p\\u003e \\u003cp\\u003eIn summary, we demonstrated that estrogen-induced Scribble mislocalization in endometrial epithelial cells through APT-mediated S-palmitoylation might be one of the key mechanisms in the development of adenomyosis, which may provide a new understanding of the pathogenesis of adenomyosis.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe are grateful to the women who participated in this study and Shanghai Key Laboratory of Female Reproductive Endocrine Related Disease, Fudan University (Shanghai, China) for providing experimental platform. Graphical abstract was created with BioRender.com\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics Approval\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAppropriate ethical approvals were obtained for the study.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent to Participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eInformed consent was obtained from the study participants.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis manuscript has not been published or presented elsewhere and is not under consideration by another journal. All study participants provided informed consent and approved it for publication.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflicts of interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors declare that there are no competing financial interests associated with this work.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and material\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets used or analyzed during the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCode availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by funding from the National Natural Science Foundation of China (No. 82001523) and Gusu Health Talent Project (No. GSWS2021004).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors\\u0026apos; contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eZ.J. performed the lab experiments and wrote the manuscript. J.W. designed the study and edited the manuscript. Y.C. supervised the research project and gave final approval. All authors reviewed the manuscript.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eBulun SE, Yildiz S, Adli M, Wei JJ. Adenomyosis pathogenesis: insights from next-generation sequencing. \\u003cem\\u003eHum Reprod Update\\u003c/em\\u003e 2021; 27(6):1086-1097.\\u003c/li\\u003e\\n\\u003cli\\u003eUpson K, Missmer SA. Epidemiology of Adenomyosis. \\u003cem\\u003eSemin Reprod Med\\u003c/em\\u003e 2020; 38(2-03):89-107.\\u003c/li\\u003e\\n\\u003cli\\u003eSharara FI, Kheil MH, Feki A, Rahman S, Klebanoff JS, Ayoubi JM, Moawad GN. \\u003cem\\u003eCurrent and Prospective Treatment of Adenomyosis\\u003c/em\\u003e J Clin Med. 2021; 10:15.\\u003c/li\\u003e\\n\\u003cli\\u003eOsada H. Uterine adenomyosis and adenomyoma: the surgical approach. \\u003cem\\u003eFertil Steril\\u003c/em\\u003e 2018; 109(3):406-417.\\u003c/li\\u003e\\n\\u003cli\\u003eFan Y, Zhu S, Liang X. Conservative surgical and drug therapies for adenomyosis \\u003cem\\u003eMedicine. Reprod Biol\\u003c/em\\u003e 2022; 22(3):100664.\\u003c/li\\u003e\\n\\u003cli\\u003eRižner TL. The Important Roles of Steroid Sulfatase and Sulfotransferases in Gynecological Diseases. \\u003cem\\u003eFront Pharmacol\\u003c/em\\u003e 2016; \\u003cstrong\\u003e7\\u003c/strong\\u003e:30.\\u003c/li\\u003e\\n\\u003cli\\u003eArtymuk N, Zotova O, Gulyaeva L. Adenomyosis: genetics of estrogen metabolism. \\u003cem\\u003eHorm Mol Biol Clin I\\u003c/em\\u003e 2019; 37:2.\\u003c/li\\u003e\\n\\u003cli\\u003eLeyendecker G, Wildt L. A new concept of endometriosis and adenomyosis: tissue injury and repair (TIAR). \\u003cem\\u003eHorm Mol Biol Clin I\\u003c/em\\u003e 2011; 5(2):125-142.\\u003c/li\\u003e\\n\\u003cli\\u003eChen YJ, Li HY, Huang CH, Twu NF, Yen MS, Wang PH, Chou TY, Liu YN, Chao KC, Yang MH. Oestrogen-induced epithelial-mesenchymal transition of endometrial epithelial cells contributes to the development of adenomyosis. \\u003cem\\u003eJ Pathol\\u003c/em\\u003e 2010; 222(3):261-270.\\u003c/li\\u003e\\n\\u003cli\\u003eJin Z, Liu H, Xu C. Estrogen degrades Scribble in endometrial epithelial cells through E3 ubiquitin ligase HECW1 in the development of diffuse adenomyosis. \\u003cem\\u003eBiol Reprod\\u003c/em\\u003e 2020; 102(2):376-387.\\u003c/li\\u003e\\n\\u003cli\\u003eBuckley CE, St JD. Apical-basal polarity and the control of epithelial form and function. \\u003cem\\u003eNat Rev Mol Cell Bio\\u003c/em\\u003e 2022; 23(8):559-577.\\u003c/li\\u003e\\n\\u003cli\\u003eBonello TT, Peifer M. Scribble: A master scaffold in polarity, adhesion, synaptogenesis, and proliferation. \\u003cem\\u003eJ Cell Biol\\u003c/em\\u003e 2019; 218(3):742-756.\\u003c/li\\u003e\\n\\u003cli\\u003eWan S, Meyer AS, Weiler S, Rupp C, T\\u0026oacute;th M, Sticht C, Singer S, Thomann S, Roessler S, Schorpp-Kistner M,\\u003cem\\u003e \\u003c/em\\u003eSchmitt J, Gretz N, et al. Cytoplasmic localization of the cell polarity factor scribble supports liver tumor formation and tumor cell invasiveness. \\u003cem\\u003eHepatology\\u003c/em\\u003e 2018 ;67(5):1842-1856.\\u003c/li\\u003e\\n\\u003cli\\u003eFeigin ME, Akshinthala SD, Araki K, Rosenberg AZ, Muthuswamy LB, Martin B, Lehmann BD, Berman HK, Pietenpol JA, Cardiff RD,\\u003cem\\u003e \\u003c/em\\u003eMuthuswamy SK. Mislocalization of the cell polarity protein scribble promotes mammary tumorigenesis and is associated with basal breast cancer. \\u003cem\\u003eCancer Res\\u003c/em\\u003e 2014; 74(11):3180-3194.\\u003c/li\\u003e\\n\\u003cli\\u003eElsum IA, Humbert PO. Localization, not important in all tumor-suppressing properties: a lesson learnt from scribble. \\u003cem\\u003eCells Tissues Organs\\u003c/em\\u003e 2013 ;198(1):1-11.\\u003c/li\\u003e\\n\\u003cli\\u003eBlaskovic S, Blanc M, van der Goot FG. What does S-palmitoylation do to membrane proteins? \\u003cem\\u003eFEBS J \\u003c/em\\u003e2013; 280(12):2766-2774.\\u003c/li\\u003e\\n\\u003cli\\u003eDe I, Sadhukhan S. Emerging Roles of DHHC-mediated Protein S-palmitoylation in Physiological and Pathophysiological Context. \\u003cem\\u003eEur J Cell Biol\\u003c/em\\u003e 2018; 97(5):319-338.\\u003c/li\\u003e\\n\\u003cli\\u003eWon SJ, Cheung SKM, Martin BR. Protein depalmitoylases. \\u003cem\\u003eCrit Rev Biochem Mol\\u003c/em\\u003e 2018; 53(1):83-98.\\u003c/li\\u003e\\n\\u003cli\\u003eChen S, Zhu B, Yin C, Liu W, Han C, Chen B, Liu T, Li X, Chen X, Li C, Hu L, Zhou J, et al. Palmitoylation-dependent activation of MC1R prevents melanomagenesis. \\u003cem\\u003eNature\\u003c/em\\u003e 2017; 549(7672):399-403.\\u003c/li\\u003e\\n\\u003cli\\u003eBatista CM, Kessler RL, Eger I, Soares MJ. Treatment of Trypanosoma cruzi with 2-bromopalmitate alters morphology, endocytosis, differentiation and infectivity. \\u003cem\\u003eBMC Cell Biol\\u003c/em\\u003e 2018; 19(1):19.\\u003c/li\\u003e\\n\\u003cli\\u003eHernandez JL, Davda D, Cheung SKM, Majmudar JD, Won SJ, Gang M, Pasupuleti SC, Choi AI, Bartkowiak CM, Martin BR. APT2 Inhibition Restores Scribble Localization and S-Palmitoylation in Snail-Transformed Cells. \\u003cem\\u003eCell Chem Biol\\u003c/em\\u003e 2017; 24(1):87-97.\\u003c/li\\u003e\\n\\u003cli\\u003eChen B, Zheng B, DeRan M, Jarugumilli GK, Fu J, Brooks YS, Wu X. ZDHHC7-mediated S-palmitoylation of Scribble regulates cell polarity. \\u003cem\\u003eNat Chem Biol\\u003c/em\\u003e 2016; 12(9):686-693.\\u003c/li\\u003e\\n\\u003cli\\u003eMarquardt RM, Jeong JW, Fazleabas AT. Animal Models of Adenomyosis. \\u003cem\\u003eSemin Reprod Med\\u003c/em\\u003e 2020; 38(2-03):168-178.\\u003c/li\\u003e\\n\\u003cli\\u003ePeng Y, Liu X, Jin Z, Liu H, Xu C. Scribble downregulation in adenomyosis compromises endometrial stromal decidualization by decreasing FOXO1 expression. \\u003cem\\u003eHum Reprod\\u003c/em\\u003e 2021; 37(1):93-108.\\u003c/li\\u003e\\n\\u003cli\\u003ePeng Y, Jin Z, Liu H, Xu C. Impaired decidualization of human endometrial stromal cells from women with adenomyosis. \\u003cem\\u003eBiol Reprod\\u003c/em\\u003e 2021; 104(5):1034-1044.\\u003c/li\\u003e\\n\\u003cli\\u003eJin Z, Wu X, Liu H, Xu C. Celecoxib, a selective COX-2 inhibitor, markedly reduced the severity of tamoxifen-induced adenomyosis in a murine model. \\u003cem\\u003eExp Ther Med\\u003c/em\\u003e 2020; 19(5):3289-3299.\\u003c/li\\u003e\\n\\u003cli\\u003eOuyang Z, Zhan W, Dan L. hScrib, a human homolog of Drosophila neoplastic tumor suppressor, is involved in the progress of endometrial cancer. \\u003cem\\u003eOncol Res\\u003c/em\\u003e 2010; 18(11-12):593-599.\\u003c/li\\u003e\\n\\u003cli\\u003eWang N, Song L, Xu Y, Zhang L, Wu Y, Guo J, Ji W, Li L, Zhao J, Zhang X, Zhan L,\\u003cem\\u003e \\u003c/em\\u003eet al. Loss of Scribble confers cisplatin resistance during NSCLC chemotherapy via Nox2/ROS and Nrf2/PD-L1 signaling. \\u003cem\\u003eEbiomedicine\\u003c/em\\u003e 2019; 47:65-77.\\u003c/li\\u003e\\n\\u003cli\\u003ePearson HB, Perez-Mancera PA, Dow LE, Ryan A, Tennstedt P, Bogani D, Elsum I, Greenfield A, Tuveson DA, Simon R, Humbert PO. SCRIB expression is deregulated in human prostate cancer, and its deficiency in mice promotes prostate neoplasia. \\u003cem\\u003eJ Clin Invest\\u003c/em\\u003e 2011; 121(11):4257-4267.\\u003c/li\\u003e\\n\\u003cli\\u003eEllenbroek SI, Iden S, Collard JG. Cell polarity proteins and cancer. \\u003cem\\u003eSemin Cancer Biol\\u003c/em\\u003e 2012; 22(3):208-215.\\u003c/li\\u003e\\n\\u003cli\\u003eDekker FJ, Rocks O, Vartak N, Menninger S, Hedberg C, Balamurugan R, Wetzel S, Renner S, Gerauer M, Sch\\u0026ouml;lermann B, Rusch M, Kramer JW, et al. Small-molecule inhibition of APT1 affects Ras localization and signaling. \\u003cem\\u003eNat Chem Biol\\u003c/em\\u003e 2010; 6(6):449-456.\\u003c/li\\u003e\\n\\u003cli\\u003eAdibekian A, Martin BR, Wang C, Hsu KL, Bachovchin DA, Niessen S, Hoover H, Cravatt BF. Click-generated triazole ureas as ultrapotent in vivo-active serine hydrolase inhibitors. \\u003cem\\u003eNat Chem Biol\\u003c/em\\u003e 2011; 7(7):469-478.\\u003c/li\\u003e\\n\\u003cli\\u003eCognetta AR, Niphakis MJ, Lee HC, Martini ML, Hulce JJ, Cravatt BF. Selective N-Hydroxyhydantoin Carbamate Inhibitors of Mammalian Serine Hydrolases. \\u003cem\\u003eChem Biol\\u003c/em\\u003e 2015; 22(7):928-937.\\u003c/li\\u003e\\n\\u003cli\\u003eMain A, Fuller W. Protein S-Palmitoylation: advances and challenges in studying a therapeutically important lipid modification. \\u003cem\\u003eFEBS J\\u003c/em\\u003e 2022; 289(4):861-882.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":true,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"reproductive-sciences\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"resc\",\"sideBox\":\"Learn more about [Reproductive Sciences](https://rd.springer.com/journal/43032)\",\"snPcode\":\"43032\",\"submissionUrl\":\"https://www.editorialmanager.com/resc/default2.aspx\",\"title\":\"Reproductive Sciences\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"Adenomyosis, Estrogen, Scribble, S-palmitoylation, Endometrial epithelial cells\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-2943175/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-2943175/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eDespite its prevalence and the severity of symptoms, little is known about the pathogenesis and etiology of adenomyosis. In our previous study, Scribble localization has been found to be partially translocated to cytoplasm, however, its regulatory mechanism is known. In consideration of the important role of supraphysiologic estrogen production in the endometrium in the development of adenomyosis, we analyzed the effect and mechanism of estrogen on Scribble localization in vivo and in vitro. Firstly, we found Scribble translocation from the basolateral membrane to the cytoplasm was easily to be seen in women and mice with adenomyosis (68% vs 27%, 60% vs 10% separately). After treatment with the S-palmitoylation inhibitor 2-Bromopalmitate for 48H, cytoplasmic enrichment of Scribble and the reduced level of palm-Scribble was observed by immunofluorescence, Western blot and acyl-biotin exchange palmitoylation assay. High estrogen exposure could not only induce partially cytoplasmic translocation of Scribble but also decrease the expression level of palm-Scribble, which can be recovered by estrogen receptor inhibitor ICI182,780. Based on following experiments, we found that estrogen regulated Scribble localization by APT through S-palmitoylation of Scribble protein. At last, IHC was performed to verify the expression of APT1 and APT2 in human clinical tissue specimens and found that they were all increased dramatically. Furthermore, positive correlations were found between APT1 or APT2 and aromatase P450. Therefore, our research may provide a new understanding of the pathogenesis of adenomyosis.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Estrogen regulates Scribble localization in endometrial epithelial cells through acyl protein thioesterase (APT)-mediated S-palmitoylation in adenomyosis\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2023-06-06 14:10:37\",\"doi\":\"10.21203/rs.3.rs-2943175/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"reviewerAgreed\",\"content\":\"\",\"date\":\"2023-06-03T02:52:34+00:00\",\"index\":0,\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2023-06-02T18:16:45+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2023-05-24T04:36:50+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Reproductive Sciences\",\"date\":\"2023-05-17T11:36:37+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"reproductive-sciences\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"resc\",\"sideBox\":\"Learn more about [Reproductive Sciences](https://rd.springer.com/journal/43032)\",\"snPcode\":\"43032\",\"submissionUrl\":\"https://www.editorialmanager.com/resc/default2.aspx\",\"title\":\"Reproductive Sciences\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"a8ebe0ea-7aa0-4704-a1b4-904b25b56802\",\"owner\":[],\"postedDate\":\"June 6th, 2023\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2023-09-07T15:09:37+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-2943175\",\"link\":\"https://doi.org/10.1007/s43032-023-01319-4\",\"journal\":{\"identity\":\"reproductive-sciences\",\"isVorOnly\":false,\"title\":\"Reproductive Sciences\"},\"publishedOn\":\"2023-08-21 15:02:05\",\"publishedOnDateReadable\":\"August 21st, 2023\"},\"versionCreatedAt\":\"2023-06-06 14:10:37\",\"video\":\"\",\"vorDoi\":\"10.1007/s43032-023-01319-4\",\"vorDoiUrl\":\"https://doi.org/10.1007/s43032-023-01319-4\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-2943175\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-2943175\",\"identity\":\"rs-2943175\",\"version\":[\"v1\"]},\"buildId\":\"B-jG_2CBjPDmsCi4Wdhf-\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC0","license_restricted":false}