{"paper_id":"3820adbe-2e74-453b-b5eb-55aa4aedb648","body_text":"Risk of hop viroids in citrus-based plant-strengthening products | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Risk of hop viroids in citrus-based plant-strengthening products Swati Jagani, Ute Born, Patrick Winterhagen, Gritta Schrader, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5942812/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Plant-based agricultural products, such as citrus peel-derived oils, are gaining traction as sustainable alternatives to synthetic pesticides. However, concerns remain about the potential transmission of viroids, particularly Cocadviroid rimocitri (formerly CBCVd), through these products. CBCVd poses significant risks to hop cultivation, causing severe economic losses due to its pathogenicity. This study evaluates the risk of viroid transmission, examining CBCVd, Hostuviroid impedihumuli (HSVd), and Pospiviroid exocortiscitri (CEVd) through orange oil using RNA extraction and RT-qPCR analysis. A detergent-based and a chaotropic RNA extraction protocol were tested, with the latter demonstrating superior performance in isolating RNA from orange oil-based formulations. Spiking experiments with CBCVd RNA confirmed consistent viroid detection in oil-RNA formulations. Notably, CBCVd and NAD were detectable in formulations with 90% RNA and 10% oil after seven days, suggesting RNA stability. However, viroids were undetectable in pure oil samples, indicating a low likelihood of integration during oil processing. Additionally, 32 orange peel samples were analyzed, revealing CBCVd in one and HSVd in seven fruit samples, but no viroid RNA or NAD was detected in the corresponding oils. These findings suggest that viroid transmission through orange oils is minimal. However, as orange oils are often formulated with water or surfactants, the hydrophilic nature of RNA may facilitate migration into aqueous phases, increasing transmission risk. Rigorous testing of raw materials and final products is recommended. This study establishes a critical framework for assessing viroid risks in citrus-based products for stringent phytosanitary controls. Horticulture citrus bark cracking viroid hop stunt viroid citrus exocortis viroid reserve transcription quantitative PCR Figures Figure 1 Introduction Germany is one of the world's leading hop producers, renowned for its high-quality bitter hops, which are predominantly used in beer production (Pavlovič et al., 2012, Šrédl et al., 2020). The excellent quality of German hops comes from the country's ideal growing conditions, good climate, rich soil, and long tradition of hop farming. These factors help Germany maintain its reputation for providing high-quality hops to the global brewing industry (Ruggeri et al., 2024). Despite its prominence, hop cultivation faces significant challenges from abiotic stressors such as drought, frost and excessive rainfall, which can cause stunted growth and root rot. Biotic stressors, like spider mites ( Tetranychus urticae ) and aphids ( Phorodon humuli ) (Lorenzana et al., 2013), can lead to leaf damage and facilitate fungal growth (EPPO, 1994). Pathogens like powdery mildew ( Podosphaera macularis ) and downy mildew ( Pseudoperonospora humuli ) are also widespread in hops, causing reduced growth, yield, and cone quality (Gent et al., 2009; Gargani et al., 2018; Weldon et al., 2021). All these stressors can adversely affect the chemical composition of hop cones, resulting in altered flavor profiles, reduced bitterness, and diminished aromatic qualities reducing their marketability. Among these biotic stressors are viroids, small, circular, single-stranded RNA pathogens that replicate autonomously within host cells without encoding proteins or a protective coat (Diener, 2003; Mishra et al., 2018; Adkar-Purushothama & Perreault, 2020). Currently, there are four viroids known to infect hops, Cocadviroid rimocitri (formerly citrus bark cracking viroid , CBCVd, synonym citrus viroid IV ; CVdIV) (Jakše et al., 2015), Cocadviroid latenshumuli (formerly hop latent viroid , HLVd) (Patzak et al., 2021), Hostuviroid impedihumuli (formerly hop stunt viroid , HSVd) (Marquez-Molins et al., 2021; Walker et al., 2021; new viroid nomenclature) and apple fruit crinkle viroid (AFCVd) (Sano et al., 2004). To combat these stressors and meet the growing global demand for hops, farmers are adopting various measures to protect their crops and maintain high yields. However, recent bans on synthetic chemical pesticides, driven by the European Green Deal and its Farm to Fork strategy (European Commission, 2020), based on increasing environmental concerns and consumer demand for sustainable products, have led to the exploration of alternative crop protection solutions. One promising outcome of this shift is the increased use of plant-based plant-strengthening agents. In Europe, several alternatives have already been developed, including seaweed extracts like Algifol® used as a plant growth stimulator (Neomed Pharma GmbH, Lübeck, Germany), neem-based products for aphid control, such as NeemAzal-T/S® (Trifolio-M GmbH, Lahnau, Germany), and orange peel oil-based products like Prev-Am® (Oro Agri International B.V., Groningen, Netherlands). Orange peel oil-based products can combine insecticidal, fungicidal, and acaricidal effects in one product. In particular, these oils are gaining attention due to their availability as a by-product of the juice industry, along with their straightforward extraction and processing, offering a sustainable, eco-friendly solution to pest and disease management (Andrade et al., 2023). They are rich in bioactive compounds, particularly the monoterpene family including limonene, citral, linalool, and geraniol, which provide strong insecticidal and antifungal effects (Moufida & Marzouk, 2003). For example they are known to disrupt the nervous systems and cell membranes of pests like aphids (Atanasova & Leather, 2018), making them efficient alternatives to synthetic pesticides. Several studies have demonstrated the efficiency of essential oils from Citrus aurantium and Citrus reticulata in controlling aphid populations in vitro. For example, Aphis illinoisensis (grapevine aphid) exhibited 100% mortality with C. aurantium oil, while C. reticulata oil resulted in 92.8% mortality after 48 hours (Alotaibi et al., 2022). This effect is primarily attributed to the high concentration of limonene, a compound known for its aphicidal properties (Sreepian et al., 2022; Alotaibi et al., 2022). Given the abundance of limonene in many citrus species, these plants show great potential as natural alternatives to synthetic insecticides, particularly for alternative pest management strategies. Additionally, their plant-based origin, cost-effectiveness, and rapid biodegradability ensure minimal residues, making them an ideal choice for organic farming systems. Prev-Am® , an example for a orange oil-based product, with insecticidal and anti-fungal effects, has been shown to effectively control aphids and whiteflies as well as pathogens like powdery and downy mildew (Biofa, 2025; Brunelli et al., 2018). It is also recommended for use on hops by the manufacturer for the control of the same diseases, demonstrating the widespread applicability of orange oil-based solutions in sustainable agriculture (Oro Agri International B.V., 2020). While citrus peel oils offer significant benefits as sustainable pest control agents, they also raise concerns about potential contamination with pathogens, particularly viroids, that are able to infect hop. Hereof, CBCVd is the most relevant viroid due to its severe pathogenicity. It was first detected in hops in Slovenia (2015) and later in Germany in 2019 (Julius Kühn-Institut, 2019). CBCVd causes severe stunting and bark cracking in hop plants, often leading to plant death within three to five years (Jakše et al., 2015; Julius Kühn-Institut 2019; Štajner et al., 2019). While CBCVd is the most relevant viroid in hop cultivation, HLVd is the most abundant in global hop production (Puchta et al., 1988). HLVd, while not causing visible symptoms in hops, reduces bitter acid and alters terpene content, thereby diminishing hop quality and altering the favorable aroma (Patzak et al., 2021; Štajner et al 2019). A third viroid, HSVd, originally identified in hops in Japan, causes a significant reduction in bitter acid content, leading to lower-quality hop cones and substantial economic losses in some cultivars (Hataya et al., 2017; Marquez-Molins et al., 2021). Besides hops, HSVd can also infect citrus plants, causing Cachexia, a disease that results in bark scaling, stunted growth, and reduced fruit quality, posing a significant threat to both hop and citrus cultivation worldwide (Levy & Hadidi, 1993). Lastly, despite primarily affecting citrus, where it causes bark cracking, stunted growth, and leaf yellowing, Pospiviroid exocortiscitri (formerly citrus exocortis viroid ; CEVd) has been experimentally shown to infect hops under greenhouse conditions (Hagemann et al., 2023a). Moreover, its ability to contribute to the formation of chimeric viroids, such as CBCVd (Puchta et al., 1991), highlights a potential indirect role in hop infection, particularly given the severe detrimental effects of CBCVd on hops (Jakše et al., 2015). Hagemann et al. demonstrated that viroids such as CBCVd, HSVd, and CEVd can be successfully extracted from citrus peels and used to infect hops (Hagemann et al., 2023a, 2023b). These findings suggest that oils derived from citrus peels could also carry viroids and potentially introduce them into clean hop fields when used as plant-strengthening agents. To identify this potential risk is the main objective of this study. However, extracting RNA from oil is challenging due to its lipophilic nature and high levels of secondary metabolites, which interfere with extraction and downstream applications. Even though extraction nucleic acids from oil have been successfully performed in the past (Busconi et al., 2003; Raieta et al., 2015), here we analyze the terpene-rich orange oil which is challenging. To further clarify the terminology, the International Organization for Standardization (ISO) defines \"essential oils\" as products obtained through steam distillation, dry distillation, or by mechanical processing of the citrus flavedo (Salvatore et al., 2022). However, some literature ambiguously applies the term to distilled oils alone. In this study, we used a laboratory-scale mechanical cold-pressing technique on orange flavedo to produce what we refer to as \"orange oil,\" aligning with industrial practices for cold pressing citrus peels. Up to now the potential for viroid transmission through this process was completely unknown. To address this, we formulated the following specific hypotheses: 1) A validated RNA extraction protocol tailored for orange oils can reliably detect viroids such as CBCVd, CEVd, and HSVd using RT-qPCR. 2) Viroids remain detectable in orange oil or orange oil formulations when subjected to spiking experiments, demonstrating their potential presence in plant-strengthening products. 3) Viroids are present and can persist in orange oils used for plant protection measures, indicating a potential risk of spreading viroids to crops. Initial insights from this study suggest that the risk of viroid transmission via orange oil products may be low. As the demand for eco-friendly plant-based products grows, ensuring their safety will be essential for protecting sensitive crops and maintaining sustainable practices. Materials and Methods 2.1 General methods 2.1.1 Plant sample preparation for reference and test material CBCVd infected hop: Hop plants of the cultivar ‘Herkules’ were grown at the greenhouse in Germany and inoculated using a mixture of CBCVd-positive total RNA and dimer structures introduced directly to plants via scalpel incisions in September 2021. In September 2022, the infection status of the plants was confirmed by RT-qPCP as discribed in the following paragraphs. Leaf samples of CBCVd-infected plants were sampled in liquid nitrogene and stored until needed at -80°C. Total RNA was extracted from leaves of CBCVd-infected hop plants using the Monarch® Total RNA Miniprep Kit (New England Biolabs, Ipswich, USA) according to the manufacturer’s instructions. After extraction, the RNA was diluted to a concentration of 50 ng/µL using 10 mM Tris buffer (pH 8.0) and used as reference for spiking experiments and positive control throughout the entire study. Different varieties of orange fruits were collected from various grocery stores and transported to the laboratory for processing. Oranges were chosen as souce material, since they they showed to be a more reliable source of oils (Online Ressoucre 1). Each fruit was sampled separately, by thinly peeling the flavedo using a sterile scalpel blade (Online Ressoucre 1). The individually sampled peels were stored at -80°C for further processing. 2.1.2 Detergent RNA extraction Samples were prepared by pooling the flavedo from two oranges to create a single sample. The pooled samples were kept frozen and ground with liquid nitrogen to ensure effective cell disruption. A total of 100 mg of the ground peel was used for RNA extraction using the Monarch® Total RNA Miniprep Kit (New England Biolabs, Ipswich, USA) according to the manufacturer’s instructions. The concentration of the extracted RNA was assessed using a NanoDrop™ 1000 spectrophotometer (ThermoFisher, Waltham, USA). 2.1.3 Chaotropic RNA extraction A 100 µL aliquot of the oil, cold-pressing described in the following, and RNA-oil mixture sample was used for RNA extraction with the NucleoZOL® RNA extraction kit (Macherey-Nagel, Düren, Germany) according to the manufacturer's guidelines. After extraction, the RNA was purified using NucleoSpin® RNA columns (Macherey-Nagel, Düren, Germany), which are designed for efficient RNA isolation. The RNA quality and concentration were assessed using a NanoDrop™ 1000 spectrophotometer (ThermoFisher, Waltham, USA). 2.1.4 Reverse transcription real-time quantitative PCR Two reverse transcription-duplex real-time quantitative PCRs (RT-qPCRs) were performed to detect viroids in various RNA or oil samples using the Bioline SensiFAST™ Probe No-ROX One-Step Kit (Bioline, London, UK) on a Rotor-Gene 6000 qPCR cycler (Qiagen, Hilden, Germany), following a modified version of the protocol described by Hagemann et al. (2023b). Each RNA or oil sample was analysed in two volumes, 0.2 µL and 1 µL, respectively. The first duplex RT-qPCR reaction used a FAM-labeled probe for CBCVd, along with the primers CVdIV_qPCR_F and CVdIV_qPCR_R, while NAD acted as internal control for plant RNA as detected using a HEX-labeled probe with the primers nad5_F and nad5_R. In the second duplex RT-qPCR reaction, CEVd was detected using a FAM-labeled probe with the primers CBCV_1 and CEVd_MH_F2, while HSVd was simultaneously detected using a HEX-labeled probe along with the primers HSVd_JK_F2 and HSVd_JK_R2, as detailed in Table 1 . The cycling parameters were: reverse transcription at 48°C for 30 min, followed by an initial step at 95°C for 10 min, then 40 cycles of denaturation at 95°C for 15 sec and a combined annealing extension at 60°C for 30 sec. Samples with Ct-values below 35 were classified as viroid-positive, above as viroid-free. Table 1 Primers and probes unsed in this study. Name Sequence Type Reference CVdIV_qPCR_F GGAACAGGAGCTCGTCTC Forward Seigner et al., (2020) CVdIV_qPCR_R GTCCCGCAGAGAAAT TCC Reverse Seigner et al., (2020) nad5_sense GATGCTTCTTGGGGCTTCTTGTT Forward Menzel et al., (2002) nad5_antisense CTCCAGTCACCAACATTGGCATAA Reverse Menzel et al., (2002) CEVd_MH_F2 CTGCAGGCAGGAAAAGAAAAA Forward Hagemann et al., (2023b) CBCV_1 CAAGAGTTGTATCCACCGGG Reverse This study HSVdF2_JK GACTTACCTGAGAAAGGAGCCC Forward Hagemann et al., (2023b) HSVdR2_JK ACAAAAAGCAGGTTGGAAGACG Reverse Hagemann et al., (2023b) nad5_probe AGGATCCGCATAGCCCTCGATTTATGTG-BHQ-1 HEX probe Menzel et al. (2002) CVdIV-qPCR_P CATCGCTGGCTCCACATCCG-BHQ1 FAM probe Seigner et al., (2020) HSVd HEX HEX-AGAGAGGGCCGCGGTGCTCT-BHQ-1 HEX probe Luigi and Faggioli., (2013) 2.2 Experimental procedures 2.2.1 Validation of RNA extraction from orange oil Compared to the white mesocarp (albedo), the flavedo showed to be a more reliable source for orange RNA (Online ressoucre 1). The flavedo was cut into small pieces and pressed using a cold press (Vevor, Shanghai, China). The resulting pulp was centrifuged at 25,000 rpm for 20 min to separate the oil from the aqueous phase and tissue debris (Fig. 1 a). Two replicates of orange oil (I and II) were generated for analysis. To assess viroid detection in oil, these samples were spiked with total RNA extracted from CBCVd-infected hop leaves as a positive control. Four RNA-to-oil ratios were prepared: 100% RNA (21°C), 90% RNA + 10% oil (R90/O10), 10% RNA + 90% oil (R10/O90), and 100% oil (O100, serving as a negative control with no added RNA). Additionally, a separate CBCVd RNA control, RNA (-80°C), was included as a positive reference to compare treated samples with fresh RNA not subjected to the experimental conditions. These samples were subjected to RNA extraction using the chaotropic RNA extraction after one hour, one day and one week incubation at ambient room temperature. The resulting RNA was used for the viroid stability study. 2.2.2 Evaluation of viroid stability in orange oil To investigate plant RNA and viroid stability and persistence in orange oil, the same sample setup from the validation of the RNA extraction experiment was used. These samples were tested using two methods as shown in Fig. 1 b. First, all samples were directly analysed by RT-qPCR for the detection of NAD and CBCVd without specific RNA extraction. Due to the immiscibility of phases, the lipophilic (upper) and aqueous (lower) phases were tested separately, with 0.2 µl and 1.0 µl of each phase used as templates. In parallel, the same set of samples underwent chaotropic RNA extraction, followed by RT-qPCR analysis for the same targets using the same template volumes. The results from both methods were then compared to assess differences in viroid detection. To extend the stability study, three 100% CBCVd RNA samples extracted using the chaotropic method were stored at ambient room temperature for three months and tested for CBCVd and NAD using RT-qPCR. 2.2.3 Simulation of orange oil extraction and viroid risk assessment fresh pressed oil analysis To investigate whether viroids detected in orange peel could also be found in the orange oil extracted from the same infected fruits, 32 orange samples were analysed. Initially, RNA was extracted with the detergent method and screened for the presence of NAD and three viroids, CBCVd, CEVd, and HSVd, using RT-qPCR. Fruits testing positive were subjected to oil extraction. The resulting orange oil was used directly as a template in RT-qPCR. The chaotropic method, though reliable for RNA extraction from oil, was reconsidered in this study for several reasons. The method required a minmum input volume of 100 µL, which was incompatible with the variable volumes of oil obtained. Additionally, to preserve the oil's composition and prevent alterations such as the evaporation of volatile terpenes and other components (Han et al., 2024), the study prioritized the direct analysis of fresh orange oil. Results 3.1 Validation of viroid extraction and detection in orange oil Oil extracted from oranges that tested negative in the pre-experiment was subjected to two analytical methods: the direct use of orange oil as template, and chaotropic RNA extraction. In Table 2 , samples directly used for analysis were separated into distinct phases due to immiscibility. NAD and CBCVd remained detectable for up to seven days in samples containing 100% RNA. In the 90% RNA sample, the upper oil-rich phase showed no detection of NAD or CBCVd up to one day, but both were detectable after one week in both replicates. The lower aqueous phase consistently showed detection of NAD and CBCVd across all time points. In contrast, samples containing 10% RNA were free of NAD and CBCVd in the upper oil-rich phase at all-time points, though sporadic detection was observed in the lower aqueous phase up to one day. The 100% oil control remained free of NAD and CBCVd throughout. Table 2: Direct use of the samples for RT-qPCR for NAD and CBCVd detection using spiked RNA-oil samples, tested in separate upper and lower phases, across three time points. The analysis was performed at two replicates (I, II) at two volumes (a, b), with CBCVd and NAD detection indicated in red and non-detection in green. The results from direct use of the samples, while effective, are less practical for routine testing of commercial products due to their varied compositions, which often form multiple phases that complicate analysis. To address this, the chaotropic RNA extraction was applied to the same samples, to validate the findings and explore potential differences in detection outcomes. The results (Table 3 ) highlight, that all 100% RNA samples tested positive for NAD and CBCVd across all conditions. Whereas samples with 90% RNA showed positive results in both replicates at the one day and one week marks. In contrast, it was observed that NAD and CBCVd were detected only in replicate I at one day, with no detection in replicate II. For samples containing 10% RNA, both targets were detected up to one hour, but by the one day mark, NAD and CBCVd were only observed in replicate I, while replicate II showed no detection. Lastly, all 100% oil control samples were free of NAD and CBCVd, consistent with the direct use of oil results. Table 3: Chaotropic RNA extraction followed by RT-qPCR for NAD and CBCVd detection using RNA extracted from spiked oil samples across three time points. The analysis was performed at two replicates (I, II) at two volumes (a, b), with CBCVd and NAD detection indicated in red and non-detection in green. For the extended stability study, CBCVd and NAD remained detectable in all three 100% RNA control samples even after three months of storage at ambient temperature (data not shown). The average Ct-values were for CBCVd were 34.6 for 0.2 µL and 31.46 for 1 µL template volume, and 33.1 for 0.2 µL and 30.5 for 1 µL for NAD. 3.3 Simulation of orange oil extraction and viroid risk assessment To strengthen the study, we extended the testing with additional fruit and oil samples to assess whether the raw material and oil production processes impact viroid integrity. Among the 32 orange samples analysed, all peel RNA samples tested positive for NAD, one for CBCVd, none for CEVd, and seven for HSVd. However, none of the corresponding oil samples tested positive for NAD or any viroids. Table 4 Fresh oil pressing experiment where RNA was first extracted from 32 citrus peels using the detergent-based RNA extraction method and analysed by RT-qPCR for NAD, CBCVd, HSVd, and CEVd. For each sample, the corresponding orange oil was directly tested in the RT-qPCR setup for viroid detection. Peel RNA Oil Samples 32 32 NAD 32 0 CBCVd 1 0 CEVd 0 0 HSVd 7 0 Discussion In response to increasing restrictions on using synthetic pesticides under the European Green Deal and Farm to Fork strategies (European Commission, 2020), farmers and the agricultural sector are adopting plant-based strengthening products, such as orange peel oils, which have shown effectiveness as natural alternatives for managing pests and diseases in crops like hops (Brunelli et al., 2018; Oro Agri International, 2020). However, a recent study by Hagemann et al. (2023b) found that peel of tested citrus fruits contained the two most severe hop stunting viroids CBCVd in 5% and HSVd in 30% of tested fruits, respectively. In response to these challenges the current study analysed viroid contamination in terpene-rich matrices, such as orange oil, using different RNA extraction methods and subsequent RT-qPCR. This provides a framework for evaluating viroid-related risks in plant-derived agricultural products and ensuring the integrity of food authentication systems. Citrus oils, including orange oil, are chemically complex matrices, characterized by high concentrations of monoterpenes like limonene and secondary metabolites such as flavonoids and polyphenols (Njoroge et al., 2005). These compounds are known to interfere with RNA extraction (Sasi et al., 2023). Polyphenolic compounds in orange oil can also bind irreversibly with RNA to form strong, covalent-like interactions, creating inseparable complexes that further hinder RNA recovery and purification in citrus oils (Mattheus et al., 2003). In contrast, nucleic acids have been successfully extracted and analyzed from olive oil, for applications such as food authentication and traceability. Unlike terpene-rich orange oil, olive oil comprises over 98% triglycerides, resulting in a relatively simpler chemical composition (Boskou, 2006; Jimenez-Lopez et al., 2020). However, even with this simplicity, the lipid-rich nature of olive oil presents challenges for nucleic acid extraction (Birtić & Kranner, 2006). Studies employing CTAB-based extraction methods have successfully overcome these challenges, recovering nucleic acids from oils and providing valuable insights (Busconi et al., 2003; Raieta et al., 2015). Building on these findings, we aimed to isolate RNA from orange oil despite its enrichment with challenging secondary metabolites. Initially, we utilized detergent RNA extraction, which is phenol-free but still highly efficient for isolating RNA from non-fatty matrices like hop leaves and compost residues (Hagemann et al., 2023b; Hagemann et al., 2024). While effective for orange peel RNA extraction and baseline viroid detection, this method appeared less suitable for oil samples. In contrast, the chaotropic RNA extraction, which is based on the combination of guanidinium thiocyanate and phenol demonstrated superior performance for orange oil formulations, leveraging principles described by Chirgwin et al. (1979). Guanidinium thiocyanate denatures RNases rapidly, protecting RNA from degradation, while phenol enhances the disruption of hydrophobic compounds like terpenes and solubilizes secondary metabolites. Its one-phase system simplifies the process, reducing RNA loss and ensuring high-quality RNA recovery from lipid-rich matrices, making it a promising choice for commercial testing. Using this optimized protocol, we successfully extracted RNA from RNA-oil mixtures. For this study, we tested orange oil spiked with RNA extracts from viroid infected hop to create RNA-oil formulations. The result showed that RNA extraction after spiking of oil with RNA did lead to the consistent detection of both the viroid and also NAD as internal RNA control. This confirms our first hypothesis, which proposed that a specialized RNA extraction protocol would enable reliable viroid detection in artificially spiked orange oils via RT-qPCR. Using this protocol, RNA was successfully extracted from spiked orange oil formulations, consistently detecting both viroid RNA and NAD as an internal control, thereby confirming our hypothesis that a specialized RNA extraction method enables reliable viroid detection in orange oil via RT-qPCR. The results also set the foundation for our second hypothesis that viroids remain detectable in orange oil or orange oil formulations when subjected to spiking experiments. Using RNA-oil mixtures directly as a template for RT-qPCR and comparing them to RNA-extracted samples (Fig. 1 b), we confirmed that viroid RNA remains detectable in both cases, thereby validating the hypothesis (Tables 2 & 3 ). The direct use of RNA-oil formulations showed that the detection of CBCVd and NAD was consistent in both RNA 100% (-80 and + 21°C) controls (Table 2 ), also after incubation at room temperature for over three month (Data not shown). However, samples with varying RNA-oil concentrations, 90% RNA and 10% oil samples showed intriguing results; CBCVd was undetectable at one hour and one day but became detectable after one week in the lipophilic phase containing the orange oil. This may be attributed to the gradual diffusion of viroid RNA at the water-oil interface over time, eventually reaching detectable levels in the oil phase. Alternatively, the evaporation of volatile compounds in orange oil, as noted by Han et al., (2024), may alter oil's overall chemical composition, facilitating RNA dispersal or stabilization within the oil-rich phase. In contrast, 10% RNA samples exhibited sporadic CBCVd detection, likely due to the lower RNA concentration, which may result in levels near or below the RT-qPCR detection threshold. These findings highlight the complexity of viroid detection in lipophilic heterogeneous matrices but also demonstrate the capability of our methods to uncover viroid dynamics in such chemically complex systems. In 100% oil samples, NAD and viroids were undetectable irrespectively if used directly or after chaotropic RNA extraction. We hypothize that RNA, due to its hydrophilic nature, partitions into the aqueous and debris layers during centrifugation, which removes non-lipid components from the hydrophobic oil matrix. This observation highlights the physical and chemical limitations of RNA retention in oil, a key aspect explored in subsequent hypotheses regarding RNA persistence through oil extraction processes. The absence of RNA in pure oil suggests that nucleic acids are unlikely to integrate into the oil matrix during production. However, the presence of CBCVd and NAD following the chaotrophic RNA extraction of 100% RNA highlights the potential for viroid and plant RNA to maintain its integrity over extended periods (Table 3 ). NAD, despite its linear structure, remained detectable for up to seven days in samples with low oil concentrations, suggesting RNA stability under these conditions. Viroids, with their robust circular RNA conformation, are expected to exhibit even greater stability (Riesner et al., 1983). Supporting this, Hagemann et al. (2024) observed HLVd detectability in compost residues for over 15 days under controlled conditions (50°C, pH 5–7), further underscoring viroid resilience in challenging environments. A study by Hagemann et al. (2023b) highlighted the frequent detection of viroids in fruits imported into grocery stores from various global locations but did not investigate their persistence in oils. The potential reintroduction of viroids into agricultural systems through byproducts like orange peels remains a significant concern. These byproducts are often repurposed for processes such as oil manufacturing, which is commonly used in plant-strengthening products (Teigiserova et al., 2021). This observation led to the formulation of our third hypothesis, which is that viroid RNA can persist through industrial orange oil extraction processes, posing a potential risk of viroid transmission to sensitive crops like hops. However, our findings suggest otherwise, because despite all peel samples being NAD-positive and eight being viroid-positive, neither viroid RNA nor NAD was detected in the corresponding oils (Table 4 ). These results reinforce the conclusion that RNA, including viroid RNA, is unlikely to integrate into the oil matrix under the processing conditions tested, thereby mitigating the potential risk of RNA transmission through orange oil products. Global orange production exceeds 71 million tons annually (FAO), with a substantial 50–60% of the fruit, primarily the peels, discarded as waste (Manthey & Grohmann, 2001). These peels are often repurposed for the extraction of orange oils, primarily through methods like cold pressing or steam distillation. Cold pressing uses mechanical force to extract oil from the peel at low temperatures, preserving the natural components of the oil (Aydeniz-Guneser, 2020) whereas methods like steam distillation, are more heat-intensive processes, which involve passing steam through the peels to vaporize the volatile oil components, which are then condensed and collected (Sikdar et al., 2016). Hydrodistillation, although less commonly used for orange oil, involves boiling a water-peel mixture to release the oil (Tran et al., 2023). These different extraction methods, particularly the temperatures and pressures applied, impose distinct physical and chemical conditions that could influence the stability and detectability of viroids, should they be present. For instance, an optimized steam distillation method demonstrated optimal oil recovery from C. sinensis and C. reticulata peels when heated for 30 minutes at 50°C (Mercy et al., 2015). Similarly, a study by Tran et al., (2023) demonstrated that essential oil from C. sinensis was effectively extracted using a 3:1 water-to-raw material ratio by heating the mixture at 130°C for 60 minutes. Such high-temperature methods are particularly relevant in studies on viroid degradation. Hagemann et al. (2021) showed that treating fermentation residues at 70°C reduced HLVd concentrations by four decimal powers within a single day, while Matousek et al. (1995) observed a 70–90% decrease in HLVd concentrations in hop meristems after two weeks of heat treatment at 35°C. These studies underscore that the high-temperature conditions inherent in commonly used oil production methods may effectively minimize the risk of viroid persistence in oil-based products. Cold pressing, the most common method for essential oil extraction, preserves natural oil components by operating at low temperatures (Aydeniz-Guneser, 2020; Baser & Buchbauer, 2015). Industrial processes typically involve crushing fruit peels with water and using centrifugal force to separate oil at 40–50°C (JBT Operating Manual). In our study, a laboratory-scale cold-pressing method was used to simulate commercial conditions. The process was conducted at ambient temperature, which means that the conditions are even more in favour of viroid stability compared to commercial conditions making our approach rather conservative regarding risk assessment. The resulting orange oil was free of detectable RNA and viroid contamination, addressing a critical gap in viroid detection within complex fatty matrices and providing a practical framework for evaluating risks and developing safe plant-based products and bio-pesticides. Risk assessment Citrus-based agricultural products or orange oil have not been mentioned in the pest risk analysis (PRA) of CBCVd by Radišek and Benko-Beloglavec (2016). They along with Wilstermann et al., (2020) and EPPO (2021) evaluated the likelihood of entry, establishment, spread, and impact as well as management options to contain the spread and to control the viroid in Slovenia, Germany, and the EPPO region. The results of these PRAs in combination with the findings presented in this study can be used to identify the overall risk associated with the transmission of viroids through plant-based plant-strengthening agents and in particular to the risk posed by orange oil used for the treatment of hop. In accordance with these results, this risk appears to be low but not negligible. Results of our study indicate that neither viroid RNA nor NAD was detected in freshly pressed oil under the tested conditions (Table 4 ). Further, in an independent pioneer study we analysed three commercial citrus-oil based products, also not finding traces of viroids (Jagani et al., 2023). Additionally, we tested seven commercial products with the same methodology and in three repetitions, of which none showed a RT-qPCR signal for viroid or plant RNA (detailed data under disclosure). These results combined suggest that the presence of viroids in pure oil matrices is very low. Although the risk of viroid transmission through plant-based products appears to be low, CBCVd is known for its high stability and destructive impact on hops (Jakše et al., 2015), leading to significant economic losses for hop growers (Radišek and Benko-Beloglavec, 2016, Wilstermann et al., 2020, EPPO, 2021). Its ability to spread mechanically further increases the risk of transmission between orchards via shared machinery or tools (Barbosa et al., 2005; Seigner et al., 2020),underscoring the need for stringent biosecurity measures to mitigate the risk of viroid spread in agricultural systems. Therefore, it is essential to enhance phytosanitary checkpoints and implement stricter surveillance measures during critical stages of production and trade to prevent unintentional movement of viroid-contaminated materials. In agricultural applications, we are not aware of the use of undiluted pure oil. Further, our greenhouse trials show that pure oil is phytotoxic leading to necrosis of treated leaf or stem areas (data not shown). Therefore, orange oils used as plant strengthening agents are typically formulated with other components, such as water and surfactants or are recommended to be diluted before use (PREV-AM 2 l / ha in 500-1,000 l water / ha (Biofa, Münsingen Germany). To address the potential risks associated with viroid migration into aqueous phases during processing and to eliminate any residual uncertainty, we recommend individually testing all components of orange oil-based products, including newly developed formulations or updated batches, to ensure they are free from viroid contamination prior to use. Even better, producers could mitigate the risk by sourcing viroid-free raw materials for oil production, thereby providing the highest level of safeguarding and further minimizing the potential for viroid transmission. The combination of strengthened phytosanitary checkpoints and the initial findings highlighted in this study are critical to the manufacturing, testing, use, and distribution of plant-based plant-strengthening agents, as well as to protecting hop orchards and preventing the spread of viroids. Ensuring the safety of plant-based agricultural inputs is not only a precautionary measure but also a commitment to safeguarding global agricultural value chains and food security. This research fills a critical gap in viroid detection within complex fatty matrices, providing a practical framework for evaluating risks and developing safe plant-based products and bio-pesticides. Future studies should focus on increasing sample diversity and simulating industrial-scale processing conditions to enhance the robustness of these findings. In conclusion, this study successfully addressed its initial hypotheses, demonstrating the potential of the validated RNA extraction protocol for terpene-rich matrices. Outside the scope of viroid research, this protocol offers a wide range of additional applications, including the detection of diverse pathogens in essential oil-rich crops, the profiling of secondary metabolites in medicinal plants such as cannabis, and ensuring authenticity and safety in food and agricultural products. Additionally, this protocol facilitates detailed studies on viroid decay in complex fatty matrices, offering insights into pathogen stability and matrix interactions. The absence of viroids in fresh-pressed oils derived from viroid-positive fruit peels under the tested conditions highlights a low but not negligible risk of viroid transmission through citrus-based oils. These findings underscore the importance of stringent testing protocols and source material verification to ensure the safety of plant-based agricultural products. By establishing a robust framework for risk assessment, this study paves the way for developing safe, sustainable solutions in agriculture while protecting sensitive crops like hops from emerging pathogen threats. Declarations Data availability All data generated or analyzed during this study can be requested from the corresponding author. Acknowledgements The authors thank Elke Sprich for her assistance with fruit preparation and analytical work. Author information Authors and Affiliations University of Hohenheim, Production Systems of Horticultural Crops, Stuttgart, Germany Swati Jagani, Ute Born, Michael Helmut Hagemann State Education and Research Center of Viticulture and Horticulture, Institute for Plant Protection, Neustadt, Germany Patrick Winterhagen Federal Biological Research Centre for Agriculture and Forestry, Braunschweig, Germany Gritta Schrader Corresponding author Correspondence to Michael Helmut Hagemann ( [email protected] ) Contributions Swati Jagani: Conceptualization, Methodology, Investigation, Data Curation, Formal Analysis, Writing – Original Draft Preparation. Ute Born: Methodology, Investigation, Data Curation, Writing – Review & Editing. Gritta Schrader: Risk Assessment, Methodology, Validation, Compliance with EPPO Standards, Writing – Review & Editing. Patrick Winterhagen: Supervision, Project Administration, Writing – Review & Editing, Manuscript structure, Experimental Design Guidance. Michael Hagemann: Conceptualization, Project Administration, Formal Analysis, Supervision, Writing – Review & Editing. Conflict of interest The authors declare that they have no financial interests or personal relationships that could have influenced the work presented in this article. The work was self-funded. Ethical approval This work is not dealing with humans or animals. Informed consent All authors declare that they have no conflict of interest. References Adkar-Purushothama, C. R., & Perreault, J. P. (2020). Current overview on viroid–host interactions. Wiley Interdisciplinary Reviews : RNA, 11(2), 1–21. https://doi.org/10.1002/wrna.1570 Alotaibi, S. S., Darwish, H., Alzahrani, A. K., Alharthi, S., Alghamdi, A. S., Al-Barty, A. M., Helal, M., Maghrabi, A., Baazeem, A., Alamari, H. A., & Noureldeen, A. (2022). Environment-friendly control potential of two citrus essential oils against Aphis punicae and Aphis illinoisensis (Hemiptera: Aphididae) . Agronomy , 12(9). https://doi.org/10.3390/agronomy12092040 Andrade, M. A., Barbosa, C. H., Shah, M. A., Ahmad, N., Vilarinho, F., Khwaldia, K., Silva, A. S., & Ramos, F. (2023). Citrus by-products: valuable source of bioactive compounds for food applications. Antioxidants , 12(1), 1–20. https://doi.org/10.3390/antiox12010038 Atanasova, D., & Leather, S. R. (2018). Plant essential oils: the way forward for aphid control? Annals of Applied Biology , 173(2), 175–179. https://doi.org/10.1111/aab.12451 Aydeniz-Guneser, B. (2020). Cold pressed orange (Citrus sinensis) oil. Cold pressed oils, Academic Press (pp. 129–146). https://doi.org/10.1016/B978-0-12-818188-1.00012-8 Baser, K. H. C., & Buchbauer, G. (2020). Handbook of essential oils: science, technology and applications (3rd ed). CRC Press. Birtić, S., & Kranner, I. (2006). Isolation of high-quality RNA from polyphenol‐, polysaccharide‐and lipid‐rich seeds. Phytochemical Analysis: An International Journal of Plant Chemical and Biochemical Techniques , 17(3), 144–148. https://doi.org/10.1002/pca.903 Biofa (2025). Bekämpfung der Weißen Fliege im Fruchtgemüse und saugender Insekten im Zierpflanzenbau. https://biofa-profi.de/de/weisse-fliege/prev-am.html?file=files/content/Produkte/PREV-AM%C2%AE/Biofa_PREV_AM_Produktinformation_2019.pdf Accessed at 21.01.2025. Boskou, D. (2006). Olive Oil: Chemistry and Technology, Second Edition (2nd ed.). AOCS Publishing . https://doi.org/10.4324/9781003040217 Brunelli, A and Fabbri, M and Casagrandi, F and Paganelli, M and Collina, M. (2019). Pre- and post-infectional anti-odour and anti-peronosporic activity of an orange oil-based formulation, ATTI giornate fitopatologiche , 11(1), 1–14. Busconi, M., Foroni, C., Corradi, M., Bongiorni, C., Cattapan, F., & Fogher, C. (2003). DNA extraction from olive oil and its use in the identification of the production cultivar. Food chemistry , 83(1), 127–134. https://doi.org/10.1016/S0308-8146(03)00218-8 Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., & Rutter, W. J. (1979). Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry , 18(24), 5294–5299. https://doi.org/10.1021/bi00591a005 Diener, T. O. (2003). Discovering viroids - a personal perspective. Nature Reviews Microbiology , 1(1), 75–80. https://doi.org/10.1038/nrmicro736 EPPO (2021) Report of a pest risk analysis for Citrus bark cracking viroid. EPPO, Paris. https://gd.eppo.int/taxon/CBCVD0/documents Accessed at 21.01.2025. Gargani, E., Ferretti, L., Faggioli, F., Haegi, A., Luigi, M., Landi, S., Simoni, S., Benvenuti, C., Guidi, S., Simoncini, S., D’Errico, G., Amoriello, T., Ciccoritti, R., Roversi, P.F. and Carbone, K. (2017). A survey on pests and diseases of Italian Hop crops, Italus Hortus , 24(2), pp. 1–17. https://doi.org/10.26353/j.itahort/2017.2.117 Gent, D. H., & Ocamb, C. M. (2009). Predicting infection risk of hop by Pseudoperonspora humuli . Phytopathology , 99(10), 1190–1198. https://doi.org/10.1094/PHYTO-99-10-1190 Hagemann, M. H., Born, U., Sprich, E., Seigner, L., Oechsner, H., Hülsemann, B., Steinbrenner, J., Winterhagen, P., & Lehmair, E. (2021). Degradation of hop latent viroid during anaerobic digestion of infected hop harvest residues. European Journal of Plant Pathology , 161(3), 579–591. https://doi.org/10.1007/s10658-021-02344-2 Hagemann, M. H., Jagani, S., Sprich, E., & Born, U. (2023a). Citrus exocortis viroid infection in hops ( Humulus lupulus L.). In Deutschen Phytomedizinischen Gesellschaft e.V. (Ed.), 63. Deutsche Pflanzenschutztagung, 626–627). Göttingen: Julius Kühn-Institut. https://www.openagrar.de/servlets/MCRFileNodeServlet/openagrar_derivate_00055984/JKA_475_495.pdf Accessed at 21.01.2025. Hagemann, M. H., Treiber, C., Born, U., Schrader, G., Stampfl, J., Jakše, J., & Radišek, S. (2023b). Risk potential of international fruit trade for viroid spreading - case study on hop viroids in Europe. Journal of Plant Pathology , 105(4), 1335–1346. https://doi.org/10.1007/s42161-023-01449-3 Hagemann, M. H., Treiber, C., Sprich, E., Born, U., Lutz, K., Stampfl, J., & Radišek, S. (2024). Composting and fermentation: mitigating hop latent viroid infection risk in hop residues. European Journal of Plant Pathology , 1–16. https://doi.org/10.1007/s10658-024-02869-2 Han, L., Li, G., Wang, X., Yu, B., Zhang, T., & Cheng, Y. (2024). Characterization of volatile compounds from healthy and citrus black spot-infected Valencia orange juice and essential oil by using gas chromatography–mass spectrometry. Food Chemistry : X, 22(April). https://doi.org/10.1016/j.fochx.2024.101374 Hataya, T., Tsushima, T., & Sano, T. (2017). Hop stunt viroid. Viroids and satellites . (pp. 199–210), Academic Press . https://doi.org/10.1016/B978-0-12-801498-1.00019-X Jagani, S., Pasha, A., Born, U., Sprich, E., Ziebell, H., & Hagemann, M. H. (2023). Risk of hop viroids in citrus-based plant-strengthening products. Scientific-Technical Commission of the International Hop Growers' Convention Conference Proceedings , Ljubljana, Slovenia, 66–69. Jakše, J., Radišek, S., Pokorn, T., Matoušek, J., & Javornik, B. (2015). Deep-sequencing revealed Citrus bark cracking viroid (CBCVd) as a highly aggressive pathogen on hop. Plant Pathology , 64(4), 831–842. https://doi.org/10.1111/ppa.12325 Jimenez-Lopez, C., Carpena, M., Lourenço-Lopes, C., Gallardo-Gomez, M., Lorenzo, J. M., Barba, F. J., Prieto, M. A., & Simal-Gandara, J. (2020). Bioactive compounds and quality of extra virgin olive oil. Foods, 9(8), 1014. https://doi.org/10.3390/foods9081014 Julius Kühn Institut. (2019). First finding of Citrus bark cracking viroid (CBCVd) in Germany (Bavaria). Braunschweig, Germany. Levy, L., & Hadidi, A. (1993). Direct nucleotide sequence of PCR-amplified DNAs of the closely related Citrus Viroids IIa and IIb (Cachexia). International Organization of Citrus Virologists Conference Proceedings , (1957–2010), 12(12). https://doi.org/10.5070/c53k23180k Lorenzana, A., Hermoso-de-Mendoza, A., Seco, M. V., & Casquero, P. A. (2013). Population dynamics and integrated control of the damson-hop aphid Phorodon humuli (Schrank) on hops in Spain. Spanish Journal of Agricultural Research , 11(2), 505–517. https://doi.org/10.5424/sjar/2013112-2968 Luigi, M., & Faggioli, F. (2013). Development of a quantitative real-time RT-PCR (qRT-PCR) for the detection of hop stunt viroid . European Journal of Plant Pathology , 137 (2), 231–235. https://doi.org/10.1007/s10658-013-0243-2 Manthey, J. A., & Grohmann, K. (2001). Phenols in citrus peel by-products. Concentrations of hydroxycinnamates and polymethoxylated flavones in citrus peel molasses. Journal of Agricultural and Food Chemistry , 49(7), 3268–3273. https://doi.org/10.1021/jf010011r Marquez-Molins, J., Gomez, G., & Pallas, V. (2021). Hop stunt viroid: A polyphagous pathogenic RNA that has shed light on viroid–host interactions. Molecular Plant Pathology , 22(2), 153–162. https://doi.org/10.1111/mpp.13022 Mattheus, N., Ekramoddoullah, A. K., & Lee, S. P. (2003). Isolation of high-quality RNA from white spruce tissue using a three‐stage purification method and subsequent cloning of a transcript from the PR‐10 gene family. Phytochemical Analysis , 14(4), 209–215. https://doi.org/10.1002/pca.701 Matoušek, Jaroslav, Trněná, Ludmila, Svoboda, Petr, Oriniaková, Pavla and Lichtenstein, Conrad P., (1995) The gradual reduction of viroid levels in hop mericlones following heat therapy: a possible role for a nuclease degrading dsRNA\" Biological Chemistry , vol. 376 − 12, pp. 715–722. https://doi.org/10.1515/bchm3.1995.376.12.715 Menzel, W., Jelkmann, W., & Maiss, E. (2002). Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. Journal of Virological Methods , 99(1–2), 81–92. https://doi.org/10.1016/S0166-0934(01)00381-0 Mercy, N. P. J., Nithyalakshmi, B., & Aadhithiya, L. R. (2015). Extraction of orange oil by improved steam distillation and its characterization studies. International Journal of Engineering Technology, Management and Applied Sciences , 3(2), 1–8. Mishra, A. K., Kumar, A., Mishra, D., Nath, V. S., Jakše, J., Kocábek, T., Killi, U. K., Morina, F., & Matoušek, J. (2018). Genome-wide transcriptomic analysis reveals insights into the response to citrus bark cracking viroid (CBCVd) in hop ( Humulus lupulus L.). Viruses, 10(10), 1–19. https://doi.org/10.3390/v10100570 Moufida, S., & Marzouk, B. (2003). Biochemical characterization of blood orange, sweet orange, lemon, bergamot and bitter orange. Phytochemistry , 62(8), 1283–1289. https://doi.org/10.1016/S0031-9422(02)00631-3 Njoroge, S. M., Koaze, H., Karanja, P. N., & Sawamura, M. (2005). Essential oil constituents of three varieties of Kenyan sweet oranges ( Citrus sinensis ). Flavour and Fragrance Journal , 20(1), 80–85. https://doi.org/10.1002/ffj.1377 OEPP/EPPO (1994) EPPO Standard PP 2/1(1) Guideline on good plant protection practice: principles of good plant protection practice. Bulletin OEPP/EPPO Bulletin 24 , 233–240. Patzak, J., Henychová, A., Krofta, K., Svoboda, P., & Malířová, I. (2021). The influence of hop latent viroid (HLVd) infection on gene expression and secondary metabolite contents in hop ( Humulus lupulus L.) glandular trichomes. Plants , 10(11). https://doi.org/10.3390/plants10112297 Pavlovič, M., Turk, J., & Pavlovič, V. (2012). A review of the EU hop industry involvement within a beer brewing sector. Agricultura (Slovenia) , 9(1), 17–22. Puchta, H., Ramm, K., & Sänger, H. L. (1988). The molecular structure of hop latent viroid (HLV), a new viroid occuring worldwide in hops. Nucleic Acids Research , 16, 4197–4216. Puchta, H., Ramm, K., Luckinger, R., Hadas, R., Bar-Joseph, M., & Snger, H. L. (1991). Primary and secondary structure of citrus viroid IV (CVd IV), a new chimeric viroid present in dwarfed grapefruit in Israel. Nucleic Acids Research , 19(23), 6640. https://doi.org/10.1093/nar/19.23.6640 Radišek S & Benko-Beloglavec A (2016) Pest risk analysis for Citrus bark cracking viroid (CBCVd). Slovenian Institute of Hop Research and Brewing. Administration of the Republic of Slovenia for Food Safety, Veterinary Sector and Plant Protection . Available at https://gd.eppo.int/taxon/CBCVD0/documents Raieta, K., Muccillo, L., & Colantuoni, V. (2015). A novel reliable method of DNA extraction from olive oil suitable for molecular traceability. Food Chemistry , 172, 596–602. https://doi.org/10.1016/j.foodchem.2014.09.101 Riesner, D., Steger, G., Schumacher, J., Gross, H. J., Randles, J. W., & Sänger, H. L. (1983). Structure and function of viroids. Biophysics of structure and mechanism , 9, 145–170. https://doi.org/10.1007/BF00537813 Ruggeri, R., Rossini, F., Roberto, S. R., Sato, A. J., Loussert, P., Rutto, L. K., & Agehara, S. (2024). Development of hop cultivation in new growing areas: The state of the art and the way forward. European Journal of Agronomy , 127335. https://doi.org/10.1016/j.eja.2024.127335 Salvatore, M. M., Nicoletti, R., & Andolfi, A. (2022). Essential oils in citrus fruit ripening and postharvest quality. Horticulturae , 8(5). https://doi.org/10.3390/horticulturae8050396 Sano, T., Yoshida, H., Goshono, M., Monma, T., Kawasaki, H., & Ishizaki, K. (2004). Characterization of a new viroid strain from hops: Evidence for viroid speciation by isolation in different host species. Journal of General Plant Pathology , 70(3), 181–187. https://doi.org/10.1007/s10327-004-0105-z Sasi, S., Krishnan, S., Kodackattumannil, P., Shamisi, A. Al, Aldarmaki, M., Lekshmi, G., Kottackal, M., & Amiri, K. M. A. (2023). DNA-free high-quality RNA extraction from 39 difficult-to-extract plant species (representing seasonal tissues and tissue types) of 32 families, and its validation for downstream molecular applications. Plant Methods , 19(1), 113. https://doi.org/10.1186/s13007-023-01063-5 Seigner, L., Liebrecht, M., Keckel, L., Einberger, K., & Absmeier, C. (2020). Real-time RT-PCR detection of Citrus bark cracking viroid (CBCVd) in hops including an mRNA-based internal positive control. Journal of Plant Diseases and Protection , 127(6), 763–767. https://doi.org/10.1007/s41348-020-00317-x Sikdar, D. C., Menon, R., Duseja, K., Kumar, P., & Swami, P. (2016). Extraction of citrus oil from orange (Citrus sinensis) peels by steam distillation and its characterizations. International Journal of Technical Research and Applications , 4(3), 341–346. Šrédl, K., Prášilová, M., Svoboda, R., & Severová, L. (2020). Hop production in the Czech Republic and its international aspects. Heliyon , 6(7). 10.1016/j.heliyon.2020.e04371 Sreepian, A., Popruk, S., Nutalai, D., Phutthanu, C., & Sreepian, P. M. (2022). Antibacterial activities and synergistic interaction of citrus essential oils and limonene with gentamicin against clinically isolated methicillin-resistant Staphylococcus aureus . Scientific World Journal . https://doi.org/10.1155/2022/8418287 Štajner, N., Radišek, S., Mishra, A. K., Nath, V. S., Matoušek, J., & Jakše, J. (2019). Evaluation of disease severity and global transcriptome response induced by Citrus bark cracking viroid , Hop latent viroid , and their co-infection in hop (Humulus lupulus L.). International Journal of Molecular Sciences, 20(13). https://doi.org/10.3390/ijms20133154 Teigiserova, D. A., Tiruta-Barna, L., Ahmadi, A., Hamelin, L., & Thomsen, M. (2021). A step closer to circular bioeconomy for citrus peel waste: A review of yields and technologies for sustainable management of essential oils. Journal of Environmental Management , 111832. https://doi.org/10.1016/j.jenvman.2020.111832 Tran, K. N. T., Ngo, C. Q. T., Tran, B. L., To, P. M. N., Huynh, P. X., & Pham, T. V. (2023). Hydrodistillation of essential oil from peels of orange (Citrus sinensis) in the Mekong Delta, Vietnam: process optimization and chemical profiling. Food Research , 7(6), 272–277. https://doi.org/10.26656/fr.2017.7(6).816 Walker, P. J., Siddell, S. G., Lefkowitz, E. J., Mushegian, A. R., Adriaenssens, E. M., Alfenas-Zerbini, P., Davison, A. J., Dempsey, D. M., Dutilh, B. E., García, M. L., Harrach, B., Harrison, R. L., Hendrickson, R. C., Junglen, S., Knowles, N. J., Krupovic, M., Kuhn, J. H., Lambert, A. J., Łobocka, M., … Zerbini, F. M. (2021). Changes to virus taxonomy and to the International Code of Virus Classification and Nomenclature ratified by the International Committee on Taxonomy of Viruses (2021). Archives of Virology , 166(9), 2633–2648. https://doi.org/10.1007/s00705-021-05156-1 Weldon, W. A., Gent, D. H., & Gadoury, D. M. (2021). Management of hop powdery mildew in the context of recent advances in pathogen ecology and population genetics. Plant Health Progress , 22(4), 450–458. https://doi.org/10.1094/PHP-03-21-0065-SYN Wilstermann, A., Schrader, G., Pfeilstetter, E., Schäfer, B.C., & Ziebell, H. (2020). Express PRA for Citrusbark cracking viroid. Julius Kühn-Institute, Institute for national and international Plant Health . Available at https://pflanzengesundheit.julius-kuehn.de/citrus-bark-cracking-viroid.html Accessed at 21.01.2025. Additional Declarations The authors declare no competing interests. Supplementary Files JaganiOnlineRessource.docx Supplementary Files Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-5942812\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":409949520,\"identity\":\"a203148e-c83e-43f9-a185-159d805c8690\",\"order_by\":0,\"name\":\"Swati Jagani\",\"email\":\"\",\"orcid\":\"https://orcid.org/0009-0001-5247-3948\",\"institution\":\"University of Hohenheim\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Swati\",\"middleName\":\"\",\"lastName\":\"Jagani\",\"suffix\":\"\"},{\"id\":409949521,\"identity\":\"09d9bdb8-2a61-4f2e-be28-67de7291826c\",\"order_by\":1,\"name\":\"Ute Born\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Hohenheim\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ute\",\"middleName\":\"\",\"lastName\":\"Born\",\"suffix\":\"\"},{\"id\":409949522,\"identity\":\"0c8d5099-a96e-4824-b2e2-58d3bb8d9200\",\"order_by\":2,\"name\":\"Patrick Winterhagen\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0001-7835-8932\",\"institution\":\"State Education and Research Center of Viticulture and Horticulture\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Patrick\",\"middleName\":\"\",\"lastName\":\"Winterhagen\",\"suffix\":\"\"},{\"id\":409949523,\"identity\":\"eb720b2a-3c3c-4070-90c4-cc60f20e25a5\",\"order_by\":3,\"name\":\"Gritta Schrader\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0002-6713-2329\",\"institution\":\"Julius Kühn Institute\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Gritta\",\"middleName\":\"\",\"lastName\":\"Schrader\",\"suffix\":\"\"},{\"id\":409949524,\"identity\":\"0ea6dfeb-ec7a-4ed8-b8e8-69181ed8c0a1\",\"order_by\":4,\"name\":\"Michael Helmut Hagemann\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABTUlEQVRIie2RMWvCQBSAXwjEJeJ6IbX/oHASSFrIj/Eo6PJ0cengkEkX26wp9EcIhdDNkwO7SKXbDR20g1MGS6FYitKLtpQaaddC88Edj/fuu3fHA8jJ+YvoYKj9GOhnoqQW1wKoApiQ7irep5AvxQp+U2BXoRw2x7YKZJWjrj6fLs8IeIXb+0fZfmg6sjHk2o3fLNnnw+kMoRx+V1xheJXemMBJD1sOjuYtVzarXBvXWtbV3SllMTiXwY5iGqTYUQ/jWLPRECyWSMWqI1hfokuUwvo8o1irtVImSf0N14JdR0i5ppSBRG+ZKoOsYhcDpcj6SG+kl5MPRQUubLpk/uLaByNiUpnoduNCsGicpEqNRRId9TDiRDtdJmJuJW3/kE7qs2d8ESzsorPQOj4LI6w8vcZ+OcwOJkWNwKR7K2Rvdkth+kMxJycn5z/zDnIzgVE5cQKRAAAAAElFTkSuQmCC\",\"orcid\":\"https://orcid.org/0000-0002-8443-621X\",\"institution\":\"University of Hohenheim\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Michael\",\"middleName\":\"Helmut\",\"lastName\":\"Hagemann\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-02-01 16:51:43\",\"currentVersionCode\":1,\"declarations\":{\"humanSubjects\":false,\"vertebrateSubjects\":false,\"conflictsOfInterestStatement\":false,\"humanSubjectEthicalGuidelines\":false,\"humanSubjectConsent\":false,\"humanSubjectClinicalTrial\":false,\"humanSubjectCaseReport\":false,\"vertebrateSubjectEthicalGuidelines\":false},\"doi\":\"10.21203/rs.3.rs-5942812/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-5942812/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":75414829,\"identity\":\"dc41a95b-3264-4ccc-ba82-85ab50257df3\",\"added_by\":\"auto\",\"created_at\":\"2025-02-04 09:44:57\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1282762,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSchematics of the experimental procedure. (a) Method establishment, where RNA was extracted from orange peel using a detergent method, followed by viroid detection via RT-qPCR and oil pressing if viroids were absent. (b) Spiking experiments, where orange oil, orange oil spiked with RNA extract in two ratios (10:90 and 90:10), or pure RNA extract were analysed after one hour, one day, or one week. Samples were either directly subjected to RT-qPCR or processed for RNA extraction using the chaotropic method prior to RT-qPCR.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5942812/v1/1550dbad4c97659db7abc50d.png\"},{\"id\":75417427,\"identity\":\"3909aefd-1655-463e-99a3-3676af637d2b\",\"added_by\":\"auto\",\"created_at\":\"2025-02-04 10:09:10\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2054615,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5942812/v1/8d3218a4-abe6-4e59-8cb0-c3c0ee41835d.pdf\"},{\"id\":75414831,\"identity\":\"7a288ae6-3f25-47e5-9592-f8604fa43ae1\",\"added_by\":\"auto\",\"created_at\":\"2025-02-04 09:44:57\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":25504,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSupplementary Files\\u0026nbsp;\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"JaganiOnlineRessource.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5942812/v1/06f4ab4103ca3bf1136b0a4b.docx\"}],\"financialInterests\":\"The authors declare no competing interests.\",\"formattedTitle\":\"\\u003cp\\u003e\\u003cstrong\\u003eRisk of hop viroids in citrus-based plant-strengthening products\\u003c/strong\\u003e\\u003c/p\\u003e\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eGermany is one of the world's leading hop producers, renowned for its high-quality bitter hops, which are predominantly used in beer production (Pavlovič et al., 2012, Šr\\u0026eacute;dl et al., 2020). The excellent quality of German hops comes from the country's ideal growing conditions, good climate, rich soil, and long tradition of hop farming. These factors help Germany maintain its reputation for providing high-quality hops to the global brewing industry (Ruggeri et al., 2024). Despite its prominence, hop cultivation faces significant challenges from abiotic stressors such as drought, frost and excessive rainfall, which can cause stunted growth and root rot. Biotic stressors, like spider mites (\\u003cem\\u003eTetranychus urticae\\u003c/em\\u003e) and aphids (\\u003cem\\u003ePhorodon humuli\\u003c/em\\u003e) (Lorenzana et al., 2013), can lead to leaf damage and facilitate fungal growth (EPPO, 1994). Pathogens like powdery mildew (\\u003cem\\u003ePodosphaera macularis\\u003c/em\\u003e) and downy mildew (\\u003cem\\u003ePseudoperonospora humuli\\u003c/em\\u003e) are also widespread in hops, causing reduced growth, yield, and cone quality (Gent et al., 2009; Gargani et al., 2018; Weldon et al., 2021). All these stressors can adversely affect the chemical composition of hop cones, resulting in altered flavor profiles, reduced bitterness, and diminished aromatic qualities reducing their marketability. Among these biotic stressors are viroids, small, circular, single-stranded RNA pathogens that replicate autonomously within host cells without encoding proteins or a protective coat (Diener, 2003; Mishra et al., 2018; Adkar-Purushothama \\u0026amp; Perreault, 2020). Currently, there are four viroids known to infect hops, \\u003cem\\u003eCocadviroid rimocitri\\u003c/em\\u003e (formerly \\u003cem\\u003ecitrus bark cracking viroid\\u003c/em\\u003e, CBCVd, synonym \\u003cem\\u003ecitrus viroid IV\\u003c/em\\u003e; CVdIV) (Jakše et al., 2015), \\u003cem\\u003eCocadviroid latenshumuli\\u003c/em\\u003e (formerly \\u003cem\\u003ehop latent viroid\\u003c/em\\u003e, HLVd) (Patzak et al., 2021), \\u003cem\\u003eHostuviroid impedihumuli\\u003c/em\\u003e (formerly \\u003cem\\u003ehop stunt viroid\\u003c/em\\u003e, HSVd) (Marquez-Molins et al., 2021; Walker et al., 2021; new viroid nomenclature) and \\u003cem\\u003eapple fruit crinkle\\u003c/em\\u003e viroid (AFCVd) (Sano et al., 2004).\\u003c/p\\u003e \\u003cp\\u003eTo combat these stressors and meet the growing global demand for hops, farmers are adopting various measures to protect their crops and maintain high yields. However, recent bans on synthetic chemical pesticides, driven by the European Green Deal and its Farm to Fork strategy (European Commission, 2020), based on increasing environmental concerns and consumer demand for sustainable products, have led to the exploration of alternative crop protection solutions. One promising outcome of this shift is the increased use of plant-based plant-strengthening agents. In Europe, several alternatives have already been developed, including seaweed extracts like \\u003cem\\u003eAlgifol\\u0026reg;\\u003c/em\\u003e used as a plant growth stimulator (Neomed Pharma GmbH, L\\u0026uuml;beck, Germany), neem-based products for aphid control, such as \\u003cem\\u003eNeemAzal-T/S\\u0026reg;\\u003c/em\\u003e (Trifolio-M GmbH, Lahnau, Germany), and orange peel oil-based products like \\u003cem\\u003ePrev-Am\\u0026reg;\\u003c/em\\u003e (Oro Agri International B.V., Groningen, Netherlands). Orange peel oil-based products can combine insecticidal, fungicidal, and acaricidal effects in one product.\\u003c/p\\u003e \\u003cp\\u003eIn particular, these oils are gaining attention due to their availability as a by-product of the juice industry, along with their straightforward extraction and processing, offering a sustainable, eco-friendly solution to pest and disease management (Andrade et al., 2023). They are rich in bioactive compounds, particularly the monoterpene family including limonene, citral, linalool, and geraniol, which provide strong insecticidal and antifungal effects (Moufida \\u0026amp; Marzouk, 2003). For example they are known to disrupt the nervous systems and cell membranes of pests like aphids (Atanasova \\u0026amp; Leather, 2018), making them efficient alternatives to synthetic pesticides. Several studies have demonstrated the efficiency of essential oils from \\u003cem\\u003eCitrus aurantium\\u003c/em\\u003e and \\u003cem\\u003eCitrus reticulata\\u003c/em\\u003e in controlling aphid populations in vitro. For example, \\u003cem\\u003eAphis illinoisensis\\u003c/em\\u003e (grapevine aphid) exhibited 100% mortality with \\u003cem\\u003eC. aurantium\\u003c/em\\u003e oil, while \\u003cem\\u003eC. reticulata\\u003c/em\\u003e oil resulted in 92.8% mortality after 48 hours (Alotaibi et al., 2022). This effect is primarily attributed to the high concentration of limonene, a compound known for its aphicidal properties (Sreepian et al., 2022; Alotaibi et al., 2022). Given the abundance of limonene in many citrus species, these plants show great potential as natural alternatives to synthetic insecticides, particularly for alternative pest management strategies. Additionally, their plant-based origin, cost-effectiveness, and rapid biodegradability ensure minimal residues, making them an ideal choice for organic farming systems. \\u003cem\\u003ePrev-Am\\u0026reg;\\u003c/em\\u003e, an example for a orange oil-based product, with insecticidal and anti-fungal effects, has been shown to effectively control aphids and whiteflies as well as pathogens like powdery and downy mildew (Biofa, 2025; Brunelli et al., 2018). It is also recommended for use on hops by the manufacturer for the control of the same diseases, demonstrating the widespread applicability of orange oil-based solutions in sustainable agriculture (Oro Agri International B.V., 2020).\\u003c/p\\u003e \\u003cp\\u003eWhile citrus peel oils offer significant benefits as sustainable pest control agents, they also raise concerns about potential contamination with pathogens, particularly viroids, that are able to infect hop. Hereof, CBCVd is the most relevant viroid due to its severe pathogenicity. It was first detected in hops in Slovenia (2015) and later in Germany in 2019 (Julius K\\u0026uuml;hn-Institut, 2019). CBCVd causes severe stunting and bark cracking in hop plants, often leading to plant death within three to five years (Jakše et al., 2015; Julius K\\u0026uuml;hn-Institut 2019; Štajner et al., 2019). While CBCVd is the most relevant viroid in hop cultivation, HLVd is the most abundant in global hop production (Puchta et al., 1988). HLVd, while not causing visible symptoms in hops, reduces bitter acid and alters terpene content, thereby diminishing hop quality and altering the favorable aroma (Patzak et al., 2021; Štajner et al 2019). A third viroid, HSVd, originally identified in hops in Japan, causes a significant reduction in bitter acid content, leading to lower-quality hop cones and substantial economic losses in some cultivars (Hataya et al., 2017; Marquez-Molins et al., 2021). Besides hops, HSVd can also infect citrus plants, causing Cachexia, a disease that results in bark scaling, stunted growth, and reduced fruit quality, posing a significant threat to both hop and citrus cultivation worldwide (Levy \\u0026amp; Hadidi, 1993). Lastly, despite primarily affecting citrus, where it causes bark cracking, stunted growth, and leaf yellowing, \\u003cem\\u003ePospiviroid exocortiscitri\\u003c/em\\u003e (formerly \\u003cem\\u003ecitrus exocortis viroid\\u003c/em\\u003e; CEVd) has been experimentally shown to infect hops under greenhouse conditions (Hagemann et al., 2023a). Moreover, its ability to contribute to the formation of chimeric viroids, such as CBCVd (Puchta et al., 1991), highlights a potential indirect role in hop infection, particularly given the severe detrimental effects of CBCVd on hops (Jakše et al., 2015).\\u003c/p\\u003e \\u003cp\\u003eHagemann et al. demonstrated that viroids such as CBCVd, HSVd, and CEVd can be successfully extracted from citrus peels and used to infect hops (Hagemann et al., 2023a, 2023b). These findings suggest that oils derived from citrus peels could also carry viroids and potentially introduce them into clean hop fields when used as plant-strengthening agents. To identify this potential risk is the main objective of this study. However, extracting RNA from oil is challenging due to its lipophilic nature and high levels of secondary metabolites, which interfere with extraction and downstream applications. Even though extraction nucleic acids from oil have been successfully performed in the past (Busconi et al., 2003; Raieta et al., 2015), here we analyze the terpene-rich orange oil which is challenging. To further clarify the terminology, the International Organization for Standardization (ISO) defines \\\"essential oils\\\" as products obtained through steam distillation, dry distillation, or by mechanical processing of the citrus flavedo (Salvatore et al., 2022). However, some literature ambiguously applies the term to distilled oils alone. In this study, we used a laboratory-scale mechanical cold-pressing technique on orange flavedo to produce what we refer to as \\\"orange oil,\\\" aligning with industrial practices for cold pressing citrus peels. Up to now the potential for viroid transmission through this process was completely unknown. To address this, we formulated the following specific hypotheses:\\u003c/p\\u003e \\u003cp\\u003e1) A validated RNA extraction protocol tailored for orange oils can reliably detect viroids such as CBCVd, CEVd, and HSVd using RT-qPCR.\\u003c/p\\u003e \\u003cp\\u003e2) Viroids remain detectable in orange oil or orange oil formulations when subjected to spiking experiments, demonstrating their potential presence in plant-strengthening products.\\u003c/p\\u003e \\u003cp\\u003e3) Viroids are present and can persist in orange oils used for plant protection measures, indicating a potential risk of spreading viroids to crops.\\u003c/p\\u003e \\u003cp\\u003eInitial insights from this study suggest that the risk of viroid transmission via orange oil products may be low. As the demand for eco-friendly plant-based products grows, ensuring their safety will be essential for protecting sensitive crops and maintaining sustainable practices.\\u003c/p\\u003e\"},{\"header\":\"Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003e2.1 General methods\\u003c/h2\\u003e\\n\\u003cdiv id=\\\"Sec4\\\" class=\\\"Section3\\\"\\u003e\\n\\u003ch2\\u003e2.1.1 Plant sample preparation for reference and test material\\u003c/h2\\u003e\\n\\u003cp\\u003eCBCVd infected hop: Hop plants of the cultivar \\u0026lsquo;Herkules\\u0026rsquo; were grown at the greenhouse in Germany and inoculated using a mixture of CBCVd-positive total RNA and dimer structures introduced directly to plants via scalpel incisions in September 2021. In September 2022, the infection status of the plants was confirmed by RT-qPCP as discribed in the following paragraphs. Leaf samples of CBCVd-infected plants were sampled in liquid nitrogene and stored until needed at -80\\u0026deg;C. Total RNA was extracted from leaves of CBCVd-infected hop plants using the Monarch\\u0026reg; Total RNA Miniprep Kit (New England Biolabs, Ipswich, USA) according to the manufacturer\\u0026rsquo;s instructions. After extraction, the RNA was diluted to a concentration of 50 ng/\\u0026micro;L using 10 mM Tris buffer (pH 8.0) and used as reference for spiking experiments and positive control throughout the entire study. Different varieties of orange fruits were collected from various grocery stores and transported to the laboratory for processing. Oranges were chosen as souce material, since they they showed to be a more reliable source of oils (Online Ressoucre 1). Each fruit was sampled separately, by thinly peeling the flavedo using a sterile scalpel blade (Online Ressoucre 1). The individually sampled peels were stored at -80\\u0026deg;C for further processing.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003c/div\\u003e\\n\\u003ch3\\u003e2.1.2 Detergent RNA extraction\\u003c/h3\\u003e\\n\\u003cp\\u003eSamples were prepared by pooling the flavedo from two oranges to create a single sample. The pooled samples were kept frozen and ground with liquid nitrogen to ensure effective cell disruption. A total of 100 mg of the ground peel was used for RNA extraction using the Monarch\\u0026reg; Total RNA Miniprep Kit (New England Biolabs, Ipswich, USA) according to the manufacturer\\u0026rsquo;s instructions. The concentration of the extracted RNA was assessed using a NanoDrop\\u0026trade; 1000 spectrophotometer (ThermoFisher, Waltham, USA).\\u003c/p\\u003e\\n\\u003ch3\\u003e2.1.3 Chaotropic RNA extraction\\u003c/h3\\u003e\\n\\u003cp\\u003eA 100 \\u0026micro;L aliquot of the oil, cold-pressing described in the following, and RNA-oil mixture sample was used for RNA extraction with the NucleoZOL\\u0026reg; RNA extraction kit (Macherey-Nagel, D\\u0026uuml;ren, Germany) according to the manufacturer's guidelines. After extraction, the RNA was purified using NucleoSpin\\u0026reg; RNA columns (Macherey-Nagel, D\\u0026uuml;ren, Germany), which are designed for efficient RNA isolation. The RNA quality and concentration were assessed using a NanoDrop\\u0026trade; 1000 spectrophotometer (ThermoFisher, Waltham, USA).\\u003c/p\\u003e\\n\\u003ch3\\u003e2.1.4 Reverse transcription real-time quantitative PCR\\u003c/h3\\u003e\\n\\u003cp\\u003eTwo reverse transcription-duplex real-time quantitative PCRs (RT-qPCRs) were performed to detect viroids in various RNA or oil samples using the Bioline SensiFAST\\u0026trade; Probe No-ROX One-Step Kit (Bioline, London, UK) on a Rotor-Gene 6000 qPCR cycler (Qiagen, Hilden, Germany), following a modified version of the protocol described by Hagemann et al. (2023b). Each RNA or oil sample was analysed in two volumes, 0.2 \\u0026micro;L and 1 \\u0026micro;L, respectively. The first duplex RT-qPCR reaction used a FAM-labeled probe for CBCVd, along with the primers CVdIV_qPCR_F and CVdIV_qPCR_R, while NAD acted as internal control for plant RNA as detected using a HEX-labeled probe with the primers nad5_F and nad5_R. In the second duplex RT-qPCR reaction, CEVd was detected using a FAM-labeled probe with the primers CBCV_1 and CEVd_MH_F2, while HSVd was simultaneously detected using a HEX-labeled probe along with the primers HSVd_JK_F2 and HSVd_JK_R2, as detailed in Table \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. The cycling parameters were: reverse transcription at 48\\u0026deg;C for 30 min, followed by an initial step at 95\\u0026deg;C for 10 min, then 40 cycles of denaturation at 95\\u0026deg;C for 15 sec and a combined annealing extension at 60\\u0026deg;C for 30 sec. Samples with Ct-values below 35 were classified as viroid-positive, above as viroid-free.\\u003c/p\\u003e\\n\\u003cdiv class=\\\"gridtable\\\"\\u003e\\n\\u003ctable id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\u003ccaption\\u003e\\n\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\n\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\n\\u003cp\\u003ePrimers and probes unsed in this study.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003c/caption\\u003e\\n\\u003cthead\\u003e\\n\\u003ctr\\u003e\\n\\u003cth align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eName\\u003c/p\\u003e\\n\\u003c/th\\u003e\\n\\u003cth align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eSequence\\u003c/p\\u003e\\n\\u003c/th\\u003e\\n\\u003cth align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eType\\u003c/p\\u003e\\n\\u003c/th\\u003e\\n\\u003cth align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eReference\\u003c/p\\u003e\\n\\u003c/th\\u003e\\n\\u003c/tr\\u003e\\n\\u003c/thead\\u003e\\n\\u003ctbody\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCVdIV_qPCR_F\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eGGAACAGGAGCTCGTCTC\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eForward\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eSeigner et al., (2020)\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCVdIV_qPCR_R\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eGTCCCGCAGAGAAAT TCC\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eReverse\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eSeigner et al., (2020)\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003enad5_sense\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eGATGCTTCTTGGGGCTTCTTGTT\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eForward\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eMenzel et al., (2002)\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003enad5_antisense\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eCTCCAGTCACCAACATTGGCATAA\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eReverse\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eMenzel et al., (2002)\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCEVd_MH_F2\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eCTGCAGGCAGGAAAAGAAAAA\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eForward\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eHagemann et al., (2023b)\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCBCV_1\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eCAAGAGTTGTATCCACCGGG\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eReverse\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eThis study\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eHSVdF2_JK\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eGACTTACCTGAGAAAGGAGCCC\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eForward\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eHagemann et al., (2023b)\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eHSVdR2_JK\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eACAAAAAGCAGGTTGGAAGACG\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eReverse\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eHagemann et al., (2023b)\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003enad5_probe\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eAGGATCCGCATAGCCCTCGATTTATGTG-BHQ-1\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eHEX probe\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eMenzel et al. (2002)\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCVdIV-qPCR_P\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eCATCGCTGGCTCCACATCCG-BHQ1\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eFAM probe\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eSeigner et al., (2020)\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003ctr\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eHSVd HEX\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eHEX-AGAGAGGGCCGCGGTGCTCT-BHQ-1\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eHEX probe\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003ctd align=\\\"left\\\"\\u003e\\n\\u003cp\\u003eLuigi and Faggioli., (2013)\\u003c/p\\u003e\\n\\u003c/td\\u003e\\n\\u003c/tr\\u003e\\n\\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003e2.2 Experimental procedures\\u003c/h2\\u003e\\n\\u003cdiv id=\\\"Sec9\\\" class=\\\"Section3\\\"\\u003e\\n\\u003ch2\\u003e2.2.1 Validation of RNA extraction from orange oil\\u003c/h2\\u003e\\n\\u003cp\\u003eCompared to the white mesocarp (albedo), the flavedo showed to be a more reliable source for orange RNA (Online ressoucre 1). The flavedo was cut into small pieces and pressed using a cold press (Vevor, Shanghai, China). The resulting pulp was centrifuged at 25,000 rpm for 20 min to separate the oil from the aqueous phase and tissue debris (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea). Two replicates of orange oil (I and II) were generated for analysis. To assess viroid detection in oil, these samples were spiked with total RNA extracted from CBCVd-infected hop leaves as a positive control. Four RNA-to-oil ratios were prepared: 100% RNA (21\\u0026deg;C), 90% RNA\\u0026thinsp;+\\u0026thinsp;10% oil (R90/O10), 10% RNA\\u0026thinsp;+\\u0026thinsp;90% oil (R10/O90), and 100% oil (O100, serving as a negative control with no added RNA). Additionally, a separate CBCVd RNA control, RNA (-80\\u0026deg;C), was included as a positive reference to compare treated samples with fresh RNA not subjected to the experimental conditions. These samples were subjected to RNA extraction using the chaotropic RNA extraction after one hour, one day and one week incubation at ambient room temperature. The resulting RNA was used for the viroid stability study.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003c/div\\u003e\\n\\u003ch3\\u003e2.2.2 Evaluation of viroid stability in orange oil\\u003c/h3\\u003e\\n\\u003cp\\u003eTo investigate plant RNA and viroid stability and persistence in orange oil, the same sample setup from the validation of the RNA extraction experiment was used. These samples were tested using two methods as shown in Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb. First, all samples were directly analysed by RT-qPCR for the detection of NAD and CBCVd without specific RNA extraction. Due to the immiscibility of phases, the lipophilic (upper) and aqueous (lower) phases were tested separately, with 0.2 \\u0026micro;l and 1.0 \\u0026micro;l of each phase used as templates. In parallel, the same set of samples underwent chaotropic RNA extraction, followed by RT-qPCR analysis for the same targets using the same template volumes. The results from both methods were then compared to assess differences in viroid detection. To extend the stability study, three 100% CBCVd RNA samples extracted using the chaotropic method were stored at ambient room temperature for three months and tested for CBCVd and NAD using RT-qPCR.\\u003c/p\\u003e\\n\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003e2.2.3 Simulation of orange oil extraction and viroid risk assessment fresh pressed oil analysis\\u003c/h2\\u003e\\n\\u003cp\\u003eTo investigate whether viroids detected in orange peel could also be found in the orange oil extracted from the same infected fruits, 32 orange samples were analysed. Initially, RNA was extracted with the detergent method and screened for the presence of NAD and three viroids, CBCVd, CEVd, and HSVd, using RT-qPCR. Fruits testing positive were subjected to oil extraction. The resulting orange oil was used directly as a template in RT-qPCR.\\u003c/p\\u003e\\n\\u003cp\\u003eThe chaotropic method, though reliable for RNA extraction from oil, was reconsidered in this study for several reasons. The method required a minmum input volume of 100 \\u0026micro;L, which was incompatible with the variable volumes of oil obtained. Additionally, to preserve the oil's composition and prevent alterations such as the evaporation of volatile terpenes and other components (Han et al., 2024), the study prioritized the direct analysis of fresh orange oil.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec13\\\" class=\\\"Section3\\\"\\u003e\\n \\u003ch2\\u003e3.1 Validation of viroid extraction and detection in orange oil\\u003c/h2\\u003e\\n \\u003cp\\u003eOil extracted from oranges that tested negative in the pre-experiment was subjected to two analytical methods: the direct use of orange oil as template, and chaotropic RNA extraction. In Table \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, samples directly used for analysis were separated into distinct phases due to immiscibility. NAD and CBCVd remained detectable for up to seven days in samples containing 100% RNA. In the 90% RNA sample, the upper oil-rich phase showed no detection of NAD or CBCVd up to one day, but both were detectable after one week in both replicates. The lower aqueous phase consistently showed detection of NAD and CBCVd across all time points. In contrast, samples containing 10% RNA were free of NAD and CBCVd in the upper oil-rich phase at all-time points, though sporadic detection was observed in the lower aqueous phase up to one day. The 100% oil control remained free of NAD and CBCVd throughout.\\u003c/p\\u003e\\n \\u003cp\\u003eTable 2: Direct use of the samples for RT-qPCR for NAD and CBCVd detection using spiked RNA-oil samples, tested in separate upper and lower phases, across three time points. The analysis was performed at two replicates (I, II) at two volumes (a, b), with CBCVd and NAD detection indicated in red and non-detection in green.\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cimg src=\\\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAy8AAAETCAMAAAAI1Mn9AAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAJ5UExURQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPLy8vmbmefm5vdubOfl5fdvbQIBAfeamPLx8fmcmvdwbufk5AQCAvWZl/Lx8Pmdm/Lw8Pdxb+fj4+fj4v///wEBAfDw8AQEBO7u7pXXpmDEe+bm5mHEe+bm5WHEfJTWpfHy8ZbXp+Xm5WLEfOXm5GLEfQIDApPUo/Dy8ZfXp/Dx8ZfYp/Dx8JfYqGPFfeTl42PFfuPl42TFfgl8TbEAAAC1dFJOUwD/BzG3c6EBtnRy/sYNMLQCDLijM+jeHXD8vhBK+1C8TN0ZVuxY2esy3FfYyE4l1naPA579BIvKGrtLutsYNckmZKLL6iSmkA9jmnGNoD0bjL0On+linU9NfByXP0Cp2mW5NGF9jptIqyjFWZlVdVRbEeekqKeYWifHpVxvHjaWbip+ez5/d4BJUfqcF+2KZnrX1YFBgkIFH621s2cpiWj//////////////////////////wfWO2wlAAAACXBIWXMAABcRAAAXEQHKJvM/AAArIUlEQVR4Xu2diZ8c1Z3Yq1zTPUgtjVVC2BIM7kM1IwSoDWLMoEFCCCRbmkOgw0KALRlbQGwrJOwSB5K1d1dmbC/E3mziTUJOomzOzZ1s7nNz39n8Rfld71evuqp7qnumu6dHv+/no+7X9fpX1a1533nvVdX7TRCEhmGU4jOB+WIYZUFfDMMwDMMwDMMwDMMwdh7RVCUIqnQCpFKhp+q0VE040X274JvsrtGXCvfs3ivbJ5SZz+7aF+/Hb3P/gQfwG33u89MHD4UPPiT1jtmHw/AL++TF1hPX8dhhQ152AVpSsyXllMO4qZHUY345ecRz86AJFKIjYfORIGgdDRN42gHEjz4WhuhL0Hq8Fh6bbj9eS45N7i+C+PAXa+ET+wIU5snjQfzUQnj/l2D7zNPH+Q0eIMwQfcEGHy7mXeigWuBLgzbNTbAvDdCFfAFRms/Aj+XETvFlCXRhX+Jn0ZegdTJMDnDdBDILuqAvwcwD2K8Ep+ZryXPw7Q5WRu9LlIQbt/gCX+aSgi5n0mgU+9I+HYaLzweNWth8/gQO0aADSh45c2SCxmpLCxlfcGD2wr6gfV8tfPFAdBZt2vtsLTkwKV8ILEBfAuhZ8BmfjgenpsCd4NyXF8KvnNdn8gVHZfCGYcC+QMNJLiyGy2ROexlezcGmZhuGa1XYAr6sJOEqVU5BW4pwiIaDNHwTaNNehI3t7F4mgWJfoiPN51unobgGm0EV0KRRS5YuHqlPziSg0xdwpPlSdHbX9Ms1fA4vXQ6Clx+ZFF3UF3i+9FAQf/kI9jOzV2BQNvPAi5+feeDSQ+55ifqXg1ePDamTkf4F2n8FitR6ms12I0wi7FRgE/sSzrWaWBsllWAVHZEuh56ipNluLSZkkdvLRJD6IqAvoA0YUgnre31fwl3B2gT3L6BIcmCtdukyVBybpofWVyfn6zhfYAYDI7HZuSsLYMU1dOLawhPH4/1HnntKnsmXc599ZUi6pL4kkbT0KijShtaf8YUMgTfiA7SyBm/imriOb4IGFnt7mQgK+xcwBDbCV3kEvlzqy3UOmRAKfWmcrbMvMJ0Bc6LJ8yVYORTef/zVl8CK+197HUZhMJWhX3RPnuTnJ66DL7NfHJouHb5Au+d+BOj0Bd9C58M6fWFDsDrdy2RwT/nSfAkGzvdN0evdteRrr07QKWb1BWf8X7+wD2f8N3bBDAVe86kyecZ33qxJeRjkfNH2XugLTmBgBmO+bHM6fYHXL+yLX64da2D/gufL5r8xOd1L6gtO9d/45nRw8FBIp8hAHLoG457pnZVDw5rtF/gC/QtuyPtCD/Fq2Njh/Qs8wca1zvnLRPsCT8mB4IqbvwRQxO5mYkh9gdL9Xr8S718gb9wz1sPMRl4MgZwvMBuhfqTAFyh2mb9AA8OaSfOlEoZV+PLghH+9Es+PtY8m16mPqdQm0hc8f4zjLbleeQKvV4I0zZfWuL+ZOfvC0Ib4QwCnLTBbAWDGj9dX5In8ePCh+Fs4o3HPOPFfSIZ0gkyuV3otHQ1qxysN3IQNCjZVwZB2EzQCNZotfIUBs4fFJDw/BtW0cYJ8oXPi0MPk7oeJ8PoL9jTLYXIrCcPrIBQ8StgEILfB7JrO3g9z4Uj45tLZ8C0ox89eH9Iv4CEAtiAy43+Wxl0HT+LFF+DtL9bC3/ftaXkGXcLwCw16HIIw7n4Y6DLCxUUswcYIClNtbS2waXVuDrRqQ92ZJFydTcLlGCKX6boNdk8YsRjRK92Lsa05OEGzfcMYJ0sLx565MDndi2GMlSu1XYefkbJhGL2ZOTvJdysbhmEYxs4iNAyjHJaAbPwsDOea2nh5OBzazVvGvY35YhjlMV8Mozzmi2GUx3wxjPKYL8a4oFtHaSUC3mjMt0i3mri8Re9EDr+zQit7BiZaTsJwajY+3FqTPYbf+S7X3MaapfhwRLkA6ntxdQA+QdWRMHyh+HL6hr7EJ2qcVIBuOea9tE7SyhZ3E/Lmc/HN3IZPuH9p7+9/VvYY7vkuf15Xs3sBt166HLRu0hPUXIWPU/zpN/YlfgO/1TfhGHjnMS5nCVrz7/De5F7kcE8FDzM4M6+fDcM3rl/+A2/QZ8c9/kE+gqs5iDcxhw++G5x6rIZPWPULtfAXe356vKXYUfKuYsrTtx1pLYowrffwVmqgIUvfqKqBaWySTdw6Hd8Ok+/GQbxypPmMLJbBO/+h9fo18QnXsHdXuSHDWwf1BYLhCCRM6w89z1uWapdkv1B1bLp9Okw2c29+/L1a8of3BvHBI82XKE3Z9MzjtfAd2KPWnG2+DyqxHitr3I7BnIF9gegPaixM64+8T5996dAlXt9CVa/sO/dBLdnEIvz49YXkj14O4l+62vx+67Fa8oPpmT01WnQZ//IhqvmVq81f3S95/4KDa5InE9TZwJdmG1dUNlvBbMmmxHn6tiMx/vbHTxffYkugy+Glb9T5wNeDbyobBkCWXwLR6WfwFa7JxKVmqIhXQ5vwxR25p3FTvsT4Kx7XQsay3h66HEm9h50Pry3eRC4+WnlJn27m8ZdoRRmUaLF/pgbX/7+G5VvuS23Kl/h1+Faf+zwUfkj6QY/jVkRi5wOmuJx8A6GrLYOZPZ+HF5/7/jT0HSE8Yc0PpOb70J1gTRC8+pocaWNfuBVhK8PixmzjPH3xrYsgDPQozpcIXvLATHzBgdnAi9kqmFOJudPyfKnvhZERD5HYkTV+GZ3BbXeOJHc25curH0LTgh7F+QItV3YnvtBayuL9lwCGWtiXIHeeSX2BQZdXA5JcgT4HPu0MrQO4dTZZhy+1CV9++CEM6KBLEV9mHpBxGVSxL5wJhrb0z8F0Af+rL6W+PPhQAIOwH7ma16avLdCrmQu06dWryY9vbuALIr4gko0PGloSnUmqQbwOTQ6AaUD7RhiuxjQT2KbGgCZoSD12vlTPuG/mfIH6QT88zke8JZbsy+zpcPGRjhp2KAgu4IF21+p757q251K+7MUJ0KW9zpe1bxyl/gY/AvsiuV8GAjon2gfDvvzkdO3FA5hzyasRh4IL2L2sLFy6/Cgm0OCqDsr5chlnQJfOiy9PfeNkDbsbrBJfMBOMLKHsF5yQpKsr2Ze3P6i9+Nw01vxa+rGhg8GJy7dewuMcfPjBdw9/tMH8BUl90Wx8jTCZvZjUY16uj2OYKFlsRbRlm9oC/zGgCc7HquJL60QL9KZe0/Nl0AEZtFoZdBHgC7H8fGcNVV0PWvibGFTaNb258RhosoRz/b3sS+vZZ6A/oQmL58vAAzLQwMsKC77Ql3oLpkrZGqqSHH8wFHtn3ybHY6DJEs71z5Mvrf2vQXfyCh3N82XQAVk2FHyhL3Xt29TJyHCMiKcWQJ9T38LuBVT60fENx2NI6otms4CHSlCtQvOqYDWMYapQiuucxY/eu/0gTebgf2aZfalU0A+a8Q/FF+hfTq2F4ZudvmB2jPreD/E4lCdj074Ej0IzfusW+bK7Mg1+0Ix/KL5A/3IKxl5v7uvwBTPOXLp8EXP8QemV6c37EhwGYT6+g76sVPZBG+cZ/zB8gf7ljz21EH7lSx2+BLMfhQ++S18Ki6BOf75oNj56oOYlvsADUdnuvtC5Y3bkBuXnID+GNR6jrTBAyozHcGPyyAX8DFvkC507ZkfeewQ9IT+GNR7jjc9kx2PYqyQHvoqfYat8oXPHKEn85QPToAm38SGNx3jjM9nxGG786Q++SkPCQXzRbHziC3U4c9jkoKHxRHnb+wIDSvYFvgOBl2CcL7Bt4Pk+dCVuvg+ILzj22lWlk8oe0LxP0Gx/q3wJXq6xLzg0Q/B4zhdov132XwKcx2uw+IJjr3emMzXAykJYpxx/W+ZL8DPos8AXHJkhlADG+SKJxgYC5vFpwj7xBYdlTxyXGb4C8/9Lv04bBvFFs/E5X+IVmEAvt+k9fClj+/tCkuMTfgP53OKL624GAoZdaAiAB/L6F0y35GpkksEJAClmC+YvyBpfdVnDmQv8/scX4gu07k2cT4Zhl3ROcCS/f5nO1MAjGMKnlGGmvhXzF+SpBfTlKbS+NV+jAZn4wpnF6U39g30TnSgO4j9+3u9f9vFZZamBR9gqr2Huv6n5C/kSub9NoS1tG/vSlsuUcR0UidfZb+htVmN3vRK+BH2twYhOh8kS7H7uMZitoBKP0F+KeXM6W4Os1cSQtRqdbs6O15QSvrTlMmV8or43iO+cIHugt3lzr7teCaOzzVyvnHm8ljTAukcfo3NizQP418hg/uLV/AbPY67UxBDMk4mX/HmC3kkZX859mS9Txm/Uz8e3TmDLxc7mSSjI9UoYnmEvMyAze2qYsC8+/EU6J/a556bP7anB/CVbg++8tuByLV879OC7eM3fH68VEoEv5AJIIdn4xBf8tQzMn6GRTD2OL7QkT982BNPuydWWWzH8DsCvQE9hfR0fgU3eDxPPwmA1nMeduPthkinwBGvugxfzu93uIydOfLuWLJ2+JZfmO9nYlzVwjdWDX/L4ez+8Tmd6YeD/YxmabfZ+mPgn98Ge5mEvMAIjkv1LfEitIWbEG7rw33j8zvP8qpMSvsDcWwZb8Q/fvwnHgPEdJdq/dH6L7oeJf/JZOMbNXZdxbEYk+6/T/3b8NteQo/Cl/oTrxeJfPvTTYx+ss8jdESfot7HLxofX/VAYqaPy7HwY3mjjpsn5e0jbnRL9y+RRpn/ZqbTltNjAk2SjF+bLzkLu723Lbb7GFmO+7CyiBNPXx3Mb/wVlYxDMlx1GNAUzmWT1lLw0thbzxTDKY74YRnnMF8Moj/liGOUxXwyjPOaLYZTHfDHGS7wyP9ANyAPEQUhmlVhZ4oPu5rLSvnghfQFxfd65jBEb3EBVSPxLv4HpXpCyvnghfQFx/d64HP+K3F3ZJxDnry6bQCh/QOE9xlxTzd+wTxXfoVrZ4khrrkNcZ4uk2sL7ivGG46IQ3l6hR9kk+DVrNY0TX7i28AfDVV6I4O3QX9QFUM0xroG4Dl+4tuhQlGOMIjpqqWJPUdyK1rwCcZ2+UG3hLcxcc2VBQwS61/KV3fjY8ceNqeYLXANxHY3/YEGEwFUQ0tHuKfnYr+2mx2ygX3Pl0E874vhvaQNTs7KlO5h4DFdgStGVR0ur2e2gXFPJL3ChisI42IiJ9TA7RSXni1QUwTW7j3SG8PaiOL8mjRNfCiOE1slsiIO3w2PuNl7exo+7j3T2L0URjEZ0NnGqaN0siION5/khWDmb619aN3mFcZ7WPNakIQ7eDo+SDizlFG3jx5WrnZ0Fby/k1GNYdfBqZz8B2991j1n8mnxcaxF/I7frvA6xF5R4bI4c4RxkXB4xcb3bvZ9cU+ALVRTGcc0Jjsv5AhUd/1kOrsk3Yt5eFOfX5H0pihA6Qxyyw2fzgbyNH/O+wPbCX8SupsAXqiiMi9/AGnwo8gUquiyQ5Jq8L/EbL8B2fswS76caesz7Atu7jQG5Kt/u4ynczo9Z/JqCOF4Ilq4Z64aXeGycOci43bfxD/53fAbny8XlMFnnTYznS0dcxpcPc3HUJHFJ2CKvnlRcI8aQH3v/odKIC+L8Goi7XaO4rC9FR8qFOGSHZAUF8lJIgLfx4+4jX+uMo3aPS8Je1AiGayTCd4MquPZcNi7jy9dvLyR/Ekodvpz7AEJoXWaK8+Xr3+MQh+8LxekC/qwvP8c4KDlYClwSlkYIzpeff+9Q8pt+iGcFBfIqy46ag1f/1OuHfvqbUHKIL/KUZhlrviw9Dm/h0XzzDCYf42KrwYnIqAm2cT1ZcmFx+GtjqIm3mtU4SrCZe4gv8BHi9cwChNSXzjjfF4nzmxY2ydbR6t7oiL8ZkEZcW94b36l5ddKIC+K8Goh7C+NemM76whGdK5c7QxyyQ7SidfKFvdFZraNt8uji0jZJ7R4iLkOE11IBNmL3wluX4zsLfh1VcNzNFy7PXE3rfF8WPr4c31qA9pz1RUK8lgqIL4c+Pg8h3ip9z5dT8y+cn3lA6zK+YNyrh9y6SICkkAivbSPiy6FrD3WEpFaceuz+h2Z+QesyvjyMcQ//4p+WOtiu/QsOrtIsY+EcbAJh3BZZiEyPsiaZnqKk2W4twi7Aogrlkxku0u4xuVPHaFB8Ie2r9AEF35dsnO8Ljceqsg6fkFYMIbgW2EcaMQ2S1rwQacQct2vai/NqvLgOXzIRQjbE+9XOO2RfIPBZnV7QNnnk8diVo14c+5KJYKgGIyDOj+AKjru5a58f5/tCg6unjr6W8+WdfbjqmDcJ4ouEcJ4+JOMLxO2vu2lJxhcaj107mnYl4ss7x70IQXyhcdW1o9qJZH154ng8VXcTmYwvFPfxyT+TxpEvpz7hYUomyxjljXBbRJJOXyAcWlsF3lmB/YzKFyCa4iWhKb4vDf9cWOoLkInL+dKoZVImYZODkPs40X6K34j9EGnEBXF+TRrXOX+J7qv18mWplp5Ekx2SFRRIafMR3saP7MvSQnpmi9o9MONFMFzDvvgRXKFxf9aLy/mydOiV6dz8BUO6+4IhsplNkUeI+2xNp/F5X2Yf9lMmYePGiIUHe/gy+3B6Lsy3AgL/3AJn6Afyvsx+5MXJkuM5fMHL3V2WMXzQLV18YUPQFfGFW+Xw4HbfXly82Kt/6eZLR1wZX9qnFz+sD+ALxvXqX/K+ZCMEP6SbLxzYjy/tx/0Ihmt6+3Lu8cWv9epfCnw59wGG9O8LxH39jR79S96Xc3v8CKGMLxD48zd69C8dvmB3gp0M/JrKZBnLGrCdfGk1V6HQw5fMWbLUl864nC+Zs2TUJFtHV/OjJL8R8yMjjbggzqvx4jrGY29uMB4rOBRa0ToJgb3GY/zIULvviGDYCPaFHwWq4Libb/Yej+Fj53gMQnqNx/iR8Xw5Nf+kP7rK+3LQO0tGUnRECL4v/Mh4Vpx67Mkv9RyPZeLQF+xksBXJLMbTQreIJFohW8bjSwN06D1/8etSXzrjcr5U/eZKTbIBbbSnL2tenTTigjivxovL+LJUdKRciEN2iFYsgQ49fbnimUHtfunsgQ3mL34dVUjcNzNxOV+eAjGyvixdhZCe8xfOpkR4vsyCDr3nLydSM0iK2QcyEYLvSyYktWL2gR9M956/nHB1sJ3mLzjsokaFLwDRoh7rFpGk0xeoB1/wnSPyha47NuCgc0k9kj+LxPAVyblwNY7X6fM50uuVnXHe9UqJ80/nUkWjtiuYO1J/JHsoDqm9uTe+44fwdhc37cV5NcGjFHcU4pwvtH0JIh7tPBJ0BV6INwnn7XQpcWkhE8jXHfnx0YWCOIk42/mlXMTlbARX0PXKpYV39j169tKBNjQiqkmvVz566MnL8S2Y7qe+0PXKpUPZEIKvSx6mkJPpdN+/Xjn78BP7Dl+99E2J869XHn74yfPxqye9M8e0HSKOexECX688/PBXMCSd7sv1SHqc/ehHxw8/cOk5dyjveuXhj77yUPzqzXS6T9crYawPLR3PGrssYzBAq4BDoILbgn3I7GFWhYtcxvNj7SbsYjS+0LnsRrAaLraryRnZSEhNMLsYZs9qU4XcD5ONS2tgClIcdz14OVx8vpp8QzYSfDMKhJyGEGi1Du8mFYirLT6/llAC1Y4ainsL48QXrp2miCMSIUhV8BMXIng7PJYNpBq5Hwbjavk4jHjx/Y5D8f0wEuH1Lpn7YZ5eePH9K0d+XeK8+2Eg7vFa+DHGOV/kfhgI+TaEyG8Gwt0pQyFez5O5H+ZnGHf2z3Ocfz/MvuDtD7Jxcj/Mzw69+BeechGCu1UGQ655XU/mfpi/SIF/Cbquzprg7T0LmTi+HwbaPXiBPYlkGQMVVuRcl2zBvmcZk19ypwMti8tBhNdfInq1CEV/om1sgPiys9D+5R5CRlzGcDFfdgjmy0gwX3YI5stIMF92BjjVldNixhAxXwyjPOaLYZTHfDGM8pgvhlEe88UwymO+GEZ5zBfDKI/5YhjlMV8Mozzmy6SBtxU7et9ZTCn6SlDifS5J4NQsHv8evpHAfJk0Gs120KLcY7O4DKY7nKJvY0q9L8Y/9I9JaCoBLpuRrfce5suk0QBJ2BcqdqVsir5y7yNf+Ljmy05jx89fxBdaZJlEZzCfnSTpC9pTtBiM1xpitr7k8CJsmF3ElWIAvw8HVZyrj9+3oTHsCzzSsn/YJS9sdEeLYMPFM+mn2LGYL5OI+gKziWT2YlKPXZK+KKkEq1TJN/iDDlV4dzIHZuHiS/c+2C65+sotBMj0LxSKfZs7Wlz/JMY/+a+pAncs5ssk4vsCbb5ahVbv0vbVsfOAxux8oVwy9RhCcKG+e5+s3e/Pl3T+Iva5o0UJDNGiVd07x+xEzJdJJOML/qKHDUQF/2JFD1/0fdLoYVNpX4BkikZ6mibDHQ1rYRime+eYnYj5MonkfJH2i7SnYE7RzRd93wC+uLd5vujRUBhv687FfJlEcr7ABp41xKtho3f/wu/bGl/SowVzSdiMNFXgjsV8mURyvkBz5lnDBvMXfd/W+KLzl3V8R3JRUwXuWMyXSQR+kTe5YYov+IxJ+trYrGFWDtugWc8edr5QGlhs4fI+uojCm/h9G1HoC23Eo7Waq3FcJXc4VeCOxXyZPKCZIjj0gXYrwkiSvjNJuDqb4NUReBdn62uegIdPMAbfyO/D7ZKrj96He+gF3w9Dgy0vVI/WXp9dxD/BpKkCdyzmi2GUx3wxjPKYL4ZRHvPFMMpjvhhGecyXiYJOUxmGsTGfMV8MozTgywTx6ad/uRu9quQ5T4+gu3f/Sje61/zW3b8qpRw9qv7aX5dj5vgbn/5NKeXoVdW1ZrDP91t/Swo5fvtu16q/Hf4dOWiOv/v3pJDj7386SNVv/wM5Zo5/eHegqq41/+juP5aWOBmYL4r5opgv3TBfFPNFMV+6Yb4o5ouy/X2Jnu7jFvv46S27+ct8UcwXZeS+yM2W4fwKaFCVeyDpJkhXotsvlbkpNeBMEibr9KY23x0ZBBW+6ThemYc9zrXWg+g7c7ihAzoo3qqfHmdDzBfFfFHG0L9ETbyVfpXa7alluksfXi+LJlXZIDQW9eb6SrMdYFIKXD4zF8yBKXG9GvGf8l+chV2sY2irmfVNaISr9KzH2RDzRTFflDH40kJf8Fc+ttwokYa8yuthohuf+Eu2/NZfxTB+ANXAlaC1GAVVzOoiXUYDn4vT92EmGEKOszHmi2K+KGPzJaiwL8t1Ti8h7bhaafjpJire4KkSzgUtTFjRok4GhmJxvRLNgzJuCBffgnfDRn6VwfcFRm8XVynBRVrCwR4M8U6tLkaLfEzzRTFflDH2L9SPRKvS0bAvrROtVjN1BDsRBd44dRtnLTQGCxoQTztpNbM9CvY+OXxfqmGy3Ab9MIuTK1VW43az2a6HyRyO9ADzRTFflHH5Ei1yNxKtwmts/+xLBaqq6YCMzXDEn/Asn08J6ImBzgR7FX9A58iMx/gdVfDClaIT4Aj2eLiRMV8U80UZiy94fmz1FL0AX6AtQ6slX+Ib8NhIZ/zODACVmuNcyR2+NDrOeGmFT4EvqIcr3cZDUOpA8yWP+aKMqX+J69Iu0Rdo4c0W+UJmeOmQM77gXCbCVMvc62g3EnUkHC/rC77PlW67XZgvBZgvyrjGY26WQr7AL/jme9Bw4zq1dD4TgPhNn+cyeMFF5/u0Hec1GUF6+hIvQ5RYAo+udMvFmC8FmC/K2Ob70FOgMOwLKIINN7rBDmEnQmivAMR1NIzOFleh5J0K0AFZvIKNXTseH/UTD8HvwL240sUkmYXKM+ZLEeaLMgZfIm66DfpDEg3JhYSTfHcmGDoMuUifOT9WgekFvyVK5tLuBZhLFmdhNxH2UexBngadNZ6bx36kEtbbEARFLdGfxcBUZ+ZLHvNFGbkvIANAAypooPM0M8HNNyI8D4BNnc4HSJv3r7/Q/TBnqBS5+2GE9nIid9jgAdI+yWd2CnbLN9dUkgsJ2eqV8PoLZgakjg4xXxTzRRlD/9IPXe5u6UWJP8+XjtgKx26M+aKYL8o296X0H7FUyhhmvhRgvigT7AtMLrq26CLaU0X3J3ew6uZHXimH+aKYL8q29yVo97f+ZWO7aAZFc5y0VID5opgvyvb3ZVyYL4r5opgv3TBfFPNFMV+68enouDs6fuefyDGHjhxwFPzT8J/JQYeOHHEkWP/SBetfFOtfHDYek0Ie80UxXxzmixTymC+K+eIwX6SQx3xRzBeH+SKFPOaLYr44BvWlbL6+LUzVR5gvivmijNwXvj+5v3x98XLINxFD+Mo8X5pflXuVN0rVR9BB8cYay9dnvggT07/0na8Pe472It1HFt9I+AaW1QrsAkolUvURlq+PMV8cE+OLy6dEHUmZfH0RbnBLLfm5hcvM4KFMqj4is36/FOaLYr4oY/Ml6DNfHy/a7/SlTKo+wvfF8vUVYb4o27N/oX6kdL4+TGRJz9zweTxWKlUf4fti+fqKMF+UbehL3/n6qtLepeHzfL9Uqj7C90XehqktXMny9ZkvKdvNFzw/1ke+PkRSx3gNHymVqo8o8MXy9WUwX5Tt17/0la8PIJGIjC+lUvURBb7gm13J8vWZLynbzxd44J6hZL6+VfUg44vMfZSNfbF8fXLMHOaLsg19gQbcR74+1CVex6ad9QUEkQFZj1R9hOXrY8wXx8T40n++vlUapUmDz/hSKlUfYfn6CPPFMSG+0K0pdG6sdL6+dYyQxBRVKGiTRsqk6iMsXx9ivjgmpn/ph/7y9ZVNVpYO27oP4MyXFPNF2ea+9JWvr7Rc5ksB5osywb70ka+vVKo+wvL1FWC+KJPsS+l8fWVS9RE0g6KJTloqwHxRzBdl+/syLswXxXxRzJdumC+K+aKYL92QBG2jQPKzjQLL17c55IgjYdJ8+efd6FUlz3l6BN29+y+68S//lRRy/Ou7/0ZKOXpU/c6/lWPm+Hef/nsp5ehV1bVmsM/3u/9BCjn+493/JKUc/9n6l/Fjvijmi2K+dMN8UcwXxXzphvmimC/KdvQlXewyTswXxXxRRu4L32+pt0gGc3K/Y9DWv3nMt/VTYrEEbyqmMl9WTN/UF3RQvFGgr/xj8oPPY74o5otjaP2Ln38saDTbfBNXqzkXSKaJCroRJXUQo13Hu+4165j3pj4ZJP+Y/ODzmC+K+eIYmi8uPwzeyE9ZkuI6qFOFf7zchYZjLpOFSyPDq17SN/WLLpuhdc9lMF8U80UZmy8BrTrmBcTQwXB6sQr2HTgcE00AFoebu/emfvF9KZt/TH7wecwXxXxxDL1/4fkE+gKPnDkJl9TTcCxNZNFq4jZu7t6b+sX3pWz+MfnB5zFfFPPFMVxfJP8YL9WH/kXF4eFYmiiJx23c3NM39Y3vi6x6waX6rlSYf0x+8HnMF8V8cQzRFzw/xvnHwIY5mNQ3W6kKdHZsFL5smH9MfvB5zBfFfHEMtX/RvBLxcpiswAyeh1rYfOXsmGu3PG7j5p6+qW8KfEHvXKkw/5j84POYL4r54hiqL/DgOhBortBodSrPFyu5V0G2eL7fT/4x+cHnMV8U88UxXF+gAVP+MaBNFrhTxZqDjH2KOZuyNPfBzycPkn9MfvB5zBfFfHEMzZdM/rHg1Mo8LaGPkjnqOWg4BjQSvJAvfybJ+eLeNAAD5B+TH3we80UxXxxD8gVGWjSxxrYaNqMmntAlIrrVJb137NRqmlhMs47xmwai//xj8oPPY74o5otjaP3L+OFRWLaUw3xRzBfFfJFSDvNFMV+Ue9KXkvnH5Aefx3xRzBfHjvWFZlB0+iAtFWC+KOaLck/2L6UwXxTzRTFfumG+KOaLYr50QxJOjQLJNzUKLP/Y5pAjjgTzpQvy/zMKzJfNIUccCZPmi3TBeSwfrGL5YB02HpP/ojzmi2K+OMwX+S/KY74o5ovDfJH/ojzmi2K+OMbny3bJ1yf/RXnMF8V8cQzJF74/ebT5+tJ7ovvAfFHMF2UM/cs48vU1Ek7X1wfmi2K+KGPwxeVTwiXAo8rX55Yj94H5opgvyth8CUaar8/3pT2F68YwS00F0ylXMAsZHKwzYZ/5opgvyhj7F2ykmiFpyPn6PF9wTAfDvIh6NX54GkZ+uYR95otivijj8mXE+fo8X6p4RDwuywkP0Rn4ULmEfeaLYr4oY/EFz1aNNl9f6guP6VALLMHeK8EZEpTwEvaZL4r5ooypfxl1vr7UFynhJKhajxvrMCBbh0M13PHMlzzmizKu8diI8/U5Xz6M3NkG2AkcdzWqJLPr8Fo7LfMlj/mijG2+P9p8fRIfvxyLEFV43Wq+dyOOkttoSpRL2Ge+KOaLMgZfxpGvr0HxMc716UIonwKrQqfiRoa5hH3mi2K+KCP3BUZaNK+mFjqifH18TASP214MQz4oTVoq3JHlEvaZL4r5ooyhf5kQzBfFfFHMl26YL4r5opgv3TBfFPNFMV+6Yb4o5otivnTDfFHMF8V86Yb5opgvivnSDUk4NQok39QosPxjm0OOOBLMly7I/88oMF82hxxxJEyaL5IIOI/lT1a2Sf7k/yIHzfFf/5sUcvz3T/+HlHL8z0//l5Ry/O7/lmPm+D93/6+UcvSo+r3/J4Ucv2e+dMN8UcwXh/kihTzmi2K+OMwXKeQxXxTzxVHel+2Sr0/+i/KYL4r54hiSL+5eYZevryAVXz5fX0FSv76gg+J9x7jsWO5H3gjzRTFflDH0L5l8fUWp+HL5+oqS+vVJI+SEffGyrKPcEPNFMV+UMfjC6yvhVz633NzSyVy+PlqG3JHUr1/cguRgtexYz3xRzBdlbL5wvj6AW7K3ND+Xr2+O3gkdzODr9zO+wEjv4moYwlAvLeXS9ZkvKeaLMsb+RYzgltwrX98t8qWRSerXL74v1RAXdVbCqlfKpeszX1LMF2Vcvki+PoBbcppaLJ+v71Y+qV/f+L5IRibMbOFKUS5dn/mSYr4oY/EFz49xvj6g05d8vr65fFK/vinwBfVwpdv4kTLp+syXFPNFGVP/kqZhkZbcM19fPqlf3xT4gt650m13OPOlAPNFGdd4LM3Xxy15g3x90KahZW/BfD9ehmCxBB5diadIgPlSgPmijG2+r/n6pCW7U8XF+fo6kvr1j/OTds+W4M5c6WIuXZ/5kmK+KGPwJZuvz/nSM19fZ1K/AWjQWeO5eRrRhZiyDwd3Wsql6zNfUswXZeS+0K0pmq+v1ZmKryhfX6szqd9AzE7BkaYouJJckBts0lJnuj7zJcV8UcbQv4wfHoVlSznMF8V8UcwXKeUwXxTzRbknfVkNaTaUKeUwXxTzRbkHfaEZFJ1VSEsFmC+K+aLck/1LKcwXxXxRzJdumC+K+aKYL92QhFOjQPJNjQLLP7Y55IgjwXzpgvz/jALzZXPIEUfCDhqPSTbdPL3yJ0t0ngHHYz3yE49uPNYjf/JWj8d65E+28djYMV8U80UxX7phvijmi2K+dMN8UcwXZTv6MgH5+qRN5DFfHOaLshlf+P7k0ebrS++J7gPzRTFflDH0L+PI19dIOF1fH5gvivmijMEXl09JlgB3rK9EhcCMLc7X55Yj94H5opgvyth8CUaar8/3pT2F68YwS00F0ylXMAsZHKwzYZ/5opgvyhj7FzGCm/KQ8/V5vuCYDoZ5EXVY/PA0jPxyCfvMF8V8Ucbly4jz9Xm+VHFnEeyS5YSH6Ax8qFzCPvNFMV+UsfiCZ6tGm68v9YXHdKgFlmDvleAMCUp4CfvMF8V8UcbUv4w6X1/qi5RwElStx411GJCtw6Ea7njmSx7zRRnXeGzE+fqcLx9G7mwD7AR2uRpVktl1eK2dlvmSx3xRxjbfH22+PjlI/HIsQlThdav53o04Sm6jKVEuYZ/5opgvyhh8GUe+vgYdJMa5Pl0I5VNgVehU3Mgwl7DPfFHMF2XkvsBIi+bV1EKhbY4iXx8fE8HjthfDkPdHk5YKd2S5hH3mi2K+KGPoXyYE80UxXxTzpRvmi2K+KOZLN8wXxXxRzJdumC+K+aKYL90wXxTzRTFfumG+KOaLYr50QxJOjQLJNzUKLP/Y5pAjjoQd1L9IIc9AQQP2L4P8/t7y/qVrzWCfr1f/YvlgtzPmi2K+KOZLN8wXxXxRzJdumC+K+aKYL90wXxTzRTFfumG+KOaLMhZf/FR8BQn7BkvK1wu6QRnvO8Zlx3I/8kaYL4r5oozDF1qBIqn4ChL2DZyUrxeNkBP2xcuyjnJDzBfFfFHG4IsunZSMSh0LLAdfRNkLtyA5WHXrazbCfFHMF2X0vmRS8aE43JR1bf7gi/R74fsCI8CLq2EI48G0lEvXZ76kmC/K6H3JpOJDc7gpay6+wZPy9cL3pRries1KWPVKuXR95kuK+aKM3pdMajFONYFNWXOLDZ5krBe+L5KRCTNbuFKUS9dnvqSYL8o97Avq4Uq3aXW/n67PfEkxX5RxjsdkJsNNWXPxDZ6UrxcFvqCSrnTbfSbzpQDzRRnHfN91HeOY78fLsF+xBB5diVOaA+ZLAeaLMnpfnCaaik+a8nDPJ7t8mpQOkC3B47jSxVy6PvMlxXxRxuAL/DrHy/eSik990Vx8Ayfl60mDzhrPzdNgL8SUfTju01IuXZ/5kmK+KOPwxUvFB3Qk7PMLW8rsFBxoivZbSS7IH8RMS53p+syXFPNFGYsv44ZHYdlSDvNFMV8U80VKOcwXxXxR7klfVkPKXp4p5TBfFPNFuQd9oZv76RRDWirAfFHMF+We7F9KYb4o5osyYl/g97lhGGX4jPliGKUBXwzDKEcQ/H9VvgtuPPaBRgAAAABJRU5ErkJggg==\\\"\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003eThe results from direct use of the samples, while effective, are less practical for routine testing of commercial products due to their varied compositions, which often form multiple phases that complicate analysis. To address this, the chaotropic RNA extraction was applied to the same samples, to validate the findings and explore potential differences in detection outcomes. The results (Table \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e) highlight, that all 100% RNA samples tested positive for NAD and CBCVd across all conditions. Whereas samples with 90% RNA showed positive results in both replicates at the one day and one week marks. In contrast, it was observed that NAD and CBCVd were detected only in replicate I at one day, with no detection in replicate II. For samples containing 10% RNA, both targets were detected up to one hour, but by the one day mark, NAD and CBCVd were only observed in replicate I, while replicate II showed no detection. Lastly, all 100% oil control samples were free of NAD and CBCVd, consistent with the direct use of oil results.\\u003c/p\\u003e\\n \\u003cp\\u003eTable 3: Chaotropic RNA extraction followed by RT-qPCR for NAD and CBCVd detection using RNA extracted from spiked oil samples across three time points. The analysis was performed at two replicates (I, II) at two volumes (a, b), with CBCVd and NAD detection indicated in red and non-detection in green.\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cimg src=\\\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAycAAADuCAMAAAAUeIh6AAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAJDUExURQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPLy8vmbmefm5vdubOfl5fdvbQEBAfiamPmcmufk5PdwbgMCAvWZl+fl5Pmcm/dxb+fj4////+bl5QMDA+Tj45bXppXXpubm5pbXp+bm5WHEfGDEe+Xm5WLEfAEDApPUpJfXp2PFfeTl5OTl42PFfuPl42TFfmHEe5TWpfT/jNwAAACqdFJOUwD/BzG3c6HdtnQBoP7Gcg0wtAIY2aMz6L0QcfxK+3YDGUzsjQxYZFfYyE5J69Yknv2MvMVjxLrqG2LD3h1NS6K4UBzKJT0/2w6fVulbmj5/Gqg1pcmKD098KaZa1aqO2r6ZnZBUra67Mq8nm6lZBNx+Jrk0l1FwHuekrKerx311exG1NmGPnItA+omYy3eAgShI7W9uXF0q//////////////////////8HRPLlLgAAAAlwSFlzAAAXEQAAFxEByibzPwAAI+BJREFUeF7tnYt/HEd9wHezurtYusjCVmxFkpu71UomiYgl2Y1CgxUnOtexHdsJxHmQNg5OU6d5YBLApKUQnnFpoQ0FWqpSWvp+Qmnpu7T90/p7ze7s7tzeSzqvTr/v58Pd3M7O7Yr8vjczu7M/e56vKEoht3nqiaJ0Aj1RFEVRFEVRFEVRFEW5hQRjFXit0qWKWlCj9ypXjRjB7fvGPW+iTn+if8fkftk+Cky9b98B7+A0/m13HjqMf9/MXd7sHL7mmD/i+z9zt3zYMTiiMLYKgd1qDSnnaIYLkRRvLdHitPwtDTBkCd6Xis57FxMdfb/voyde4x7fv3f8vmU/PMRVu57o6Afq/s8c8Lz7QZQ77/aiYyv4BkasOnUAUXbeEy8I/TCQcnuiNXe8BRiM1W6+YRgsHQ/FEzhfvwnvTd9fK4fD28uJn4W/lDyJHqiDJ16w7tce5Lrdzgd/bhl6CPAEDXjoQ+PYseCbN3sSN+YYmidd/OK28SRaw6gsTX9CXuwJTzxvo57yBAdgD+PnUWBjjj2JTnHHAh3KIzAOO/Wo8w8svyeNzc4jtuHS1pNg0/c3W7QhPA2VMGeBv9yvLIZru3Ngn/Vksk4dSuv2uj/98+ONMzCarj0IvczMY7z/bsJ4YqYkPPCaP8s2nDvvh49jtRTIE3jZWVvEE4yfE5sSVNEF35+et2MKPVkKfe43WmNQfZEDDUKtInMAOxTjrxoycGynJ0FYa7VqIWzCQSKcOM7t4cQvna7VnsAGu46sJxsrOEPZWNk3PlGHQusMTViCJ3ehJoknU4f98MPjBz/yFA68jt1L2y6v3Pn07Bz0L5fnuMD9yfwHyJ0dw/QnMFOvQBmjDLqJZhPnHElMQdyFizA5xvBqwk48JeGolL7GDsX4q4aN7YmAnsBHOPMqltOeVL3qiPQn4Am8T9RnHoOehScsMA47UY6JY4/EnnBPMlupzPmPPMHDrvkjYM7U4Zm7NpICeHJw+pkd1cTyxIqfWqOxWWtZ29iFKu2K4QYhBkJIVNJmdygOmzb9CZ9NBeVOe3IrXN4e3P3JieU18QS2h4eiZ3flj0DiCfQVDz330UPBYf/O53nYNTsHXcvU4fDDk6aAnhz6hR3WxOEJxBiNVTLbYC8KNG8pdHniDsVh094T2OzwBPfZnTg8oQtewe3H4w0Pn2ziLruOxBOcyf/iC3fDWygdBvQwxCNnTaF5xL9S91903FrZTiBmMp7A8KrQE2gzdtzliSMUh02hJ3he9smNlCd8vSv6WP3eCm/ADmVsl869Yk9wJo/XupJ7jMdWYLiFhaumAH3OS/ugxc5e84KYyXjCTiDZbRRoOMtvOvsTRygOmzaewEc4G8f8ZGQ8aZzB7gQ+mPkJdSi0x+7D8uTgdB0FgQl9MhLD0i89QdOSuHCVLh3vIBAzGU+gKPGTbDOeQKBBsbzzEzivl7EvzN6Pb/p4kQHPGXs82GvXewI2/DJOPvh+fOtaffMV+AC2HFoST6IHdusteug9fuVpKR9bQS2iU8vceeBILHz8wNTF8bhA17uiUyt8sXinQE9wMGUFNwRZrRVdCqyYot/nRg27E6wNIP4gxHD/YAnqcHsSirfMEzhXBC/HIfb6LrpojX8nnO3miRBPH07R909Sw10HWILgRWAq+Kc2aMY+Wd98FTqV1/hDdVd2JzjUAkz/cZ4EmX3AzD+iyyv+FVQiujyHBdCEJyk0QNspOKIq2DX4mxBL9AvbgsJYy46p6PXFxZADDaJxswU1F+B3m26pYHTSJEBCMfVVyq1jY3fO4hVlaGws79u/Oy8KK8rwmKzPvKHdiaIUA9P7F1QTRVEURSkRvqIoxdymnihKJzQf5I5S90d/Fn3E/7iUFKU/1BNF6Yx6oiidUU8UpTPqiTIUcIUyrUOmpZqy9riC6y0BXr3p+8dn+fNAtC6Evj82H13CBweYEFeBpuqC61Rxkpfqcu6JYBlOrI0OXXkSXcNjvQIlXPYraYUmr/GyLLMS+Ph2ZHpsfQzO9dTG/k884Z2V7w1PvZmpewWTtOAqfW9yBbO1YOXUOpxYm2W4XXkSvQXHCz8Jfxs+iUj56jxv9hovmzcPJ95R2YZ0F/d/Cs71rZP7n33QfG146jn5ryB1jz17iJJM+p8+4N044vsPfQbrp96u+7/a4U/Bxb2Gkq3vbdXk4ZHWkxK1vLCfSpt4uvNd5ejrQMXHNDLRAgV/4yl0YREChxbcY91+L1qFumjC9znlRPRrmxJhIMpAnsCfBvqRdK3Pync2rpM4WMJzoUyPsqF/wO0X8O+oY/A37sEHVI5C4NBjKuCEqYvAIc5jFP365qv4TqIM5AnE6JW6/9CjWPjoq/x/SuMKiYOlz9X9Z8bvO49pVWhD/9yY8196GhfbQ/AfvKPuP3Lg3GGz1N6qi66uyDPC0etPiUYgSkdPai15VCvAVCndQnkgdxjqUbADiT4vvQZILR0L1sHp8pkPBKhAT0B6FYxX/IUHQ2AjOgFv++K6BoQ0ydN4ysQtbBrQE+pR8FBxxoeNOF8dncs4ysg/7f0DmvCTjZPX4ZvkCUjYiE6AJu/EdZj2i+Rp3HNIzh82DegJ9Sgz0IFEX5BeY2POdCxY98w4Pq740IdoQ9+ACvzk740znxmPTtHjjbCNlEjqroBD769jd+J5B48bN2FTR0+SaMNil3AeyB0m+vwiBBE+JGY8gWGRaCGe4JbBHgfDKOSHyBvX4KvFk2Ydt1p1D8B7pc4dSjN2Yxs8eXYRgggfbDeewHBLDiqeDJ7pMcmp2ngr8YQTT0B3YdeBNdShbEwYN7bBky+8MUcjrtgTGBeJFuIJbhFz+oRMo/+XDo59yHiC2VpgZDX1tgywqA4HXC9+ET7MnzWn34UnSM+/ysPJAwl6wA86HMl4EozRaAsxnsAOg3UolmgwP7H6ExAARlpGA6wDbXAEFD3J3cnSsr9QG9yT/Tjf2TduPAluh78R7ZBzgRLsMFiHAqMpE+owP7H6E9iaqQNtQuhJos++QqdwYt1fuD64J4/NwoThnQPGk6kvbbIdUCeezM4N2KHAaOpOOZtnH7T6E9xo1z1K2oRfhr/xIzz2+8rh+lfP9OyJnesRk4riyB2fj+VwWoQJwSLVmdHKDoJ64MS6aTypYPoKjmrjCYzEBpqh4GDK/kPYE5ifXIhydeJNsED/907Wa09AXzC4JzRhP2k8mWxCt8Xdh/EERmIDzVBwMGUnlGBPYH7y2n6q42GXwN5MrZIakyu1B4+ubIMnNGF/Zr94Mnty0gy8jCcwEhtohoL/BoSVcIU9gfnJuzDcw4FWKhkLezN1k87+xpGHPnPuSMd5PGJ5kuR6hJDEpKINiMi1aNGnycuCX4Wf+CZG53D6E/IhPM2eNJ5sNGqiheWJ9DD94fIECPE6Ws4THo2t0vFoyEUvVJWjB0/wmOHFz5Mnjc8+AV/KWlieSA/THy5P8G/E62g5T3g0dpOOR0MueuG6LD14gj6Ev/EsedL4yKON6TrP5C1PpIfpD4cn+CfuwwPmPJn/Go7DfpPSsELlnR/vfdyV5Hqkn+7qWgSVVdwDfscpl2oAfczwPKHEKZs3yZMmnAL0L3TkHexPMEjhj6/kPcHA3df4GAU0DML2bZMndKDNm/S1GxMw3DMZh3auP8GxFU3uc56gRO888VsU0DAIewf32AZPvMaVuv/1VfrajYm7sX+hPBE715/g1/H8PecJWvSNBz9FF72m3q5/4+7ePUlyPVKoAFAJIUOZhTGfKnwOgyF6gseni17Qm4EQcGT6YHkSDxn7AWORR3KMeEJTEapL/beDDmXtUoU2bacn+GVyzXkVDg5e0AfLk4HmJxj6dqiLJzQVydbB0WAm/9v8N26nJ97Ueb7o5Xk34eDgBX2wPBlofoKhb+YggHiCaby/TJMVqw6ADuXF36mQOn16Ah8k1yPbAoeUcRcEKU4WkOYwPYnVQGH48Fgnngx8vQv+TLm8RIgn+At/MlvHm2ULhPZ2jbsAowYKQ6AfxpOBr3dlLgSIJ9iV3Ds+KelWY3CzbAFPtmvcBRg1UBgC/TCeDHy9C7oOud6FiCfYk/B0Xq53CbhdtoAn/Yy7klyPxhMvmoUApfvTPHEBhuoJnAl5UqHTgdNCMcQTzCU2SHcCX4TBSKXWJf6InkDHAW+ZOgDm2CIGKbJtnkAokyeTlPoBr0TBu3gCgTpQdwJfRBN3LLU+gd/LnkDHAW+ZOgDMETFIkW3zxJtdIU9m0X28wIViiCcwXxnw/gl2GnxP8f7P3208mT/CV7ZSdciNI6aHAUX68IQ6j4wnASbqIkSPc43heBLfhodZkhdd4lPEm/SL8J+QrhC31iSl2ACgGTBrjxbpp4Dvx+Nd8oVUXXwDPp4pyPWu1MjfoktP4tvwE+BJ9Inr1Fnh4d+A4KH78ZLpcSDQDJi1R0dvx6Px/fgW9BuYaSKpi2/Ao0WEXO9Kz2ASuvQkvg1/bO1p+PE7g7fm6Sb94wfkfvz9b9W/Ljfo+wbVgGl7dO5L70FHQvfj8d93fAnFoDo49rkvxTfg0R9Crnf53+jcnTXj5R9WrkfjCf5yA+ESFfGq8EUUq7rjd+RxlMdjKuhY6CxoioSsvUxvtPKK9hiI+TH4pmlaKWZGluHYfK6OmIj7j2i1Hm48dbOdpt15gpeE5SLws/ux/8BP0J0Aay/TG6682oa/8b7b4dumaaVYsr5rg0/RqiPOVk3/Ed2sh817VvleSp7uPMFLwnIR+AuPYf+Bnzjn48zLdFkK/sZmfPT++eb74Nuu4Eqxq/K14SnzLzpyHbgiXK2aU48uz/3uvZ9bMD8N7REReK4c53qk2QCKghecCOhBogX4PxR+zTkPJO6vtKHL/mRX02V/skeQJL0Dzpf3GurJHqNRo6lIEA5hRjJCqCd7jCDEfyghWhrwutJeQz3Za8yPwVQlvCDXnpTuUE8UpTPqiaJ0Rj1RlM6oJ4rSGfVEUTqjnihKZ9QTRemMeqIMkWi2l2xJafprC614LX0fRLPLpm0PnkQ3lmmpeT/01xZa8Vr6PohurJu2PXgSfWsdHzPpi+hb559ps7K/AGjFa+n7IPp2/213Alr92yaWua7qqOcad1u7rn1b+ZCB6k5Cq5wnFVxie5JfZVMMre6VOqtt7AnXczkL103U6XGsFPa3Zuq4ajxum4t4qmnjAdc5W+Ea23sr9Jo9Im/EpCmptrEnVNPGA66bWMnX05rhZybpNVNHVY8c4Lez5ukRixu8g3xKw3VtW316Ev+pecrgZYHZIWEjv52dy9WbleT+8cVuFwA3Q2utcOpDzzRqvEzZBddh2oosXONua9e1b+umcR0flqo4oppr+DWLXTdZz3nSphUTt8rFmP2tGRpnaCO/TdbzRkANPxnlgOvat3K2lY2NK/g2u5LzBGviJetZGlfw8azZlbxHjWms4dcMB6dn8PF1fpudyxshOzg5+H6su+FqRTXwivm70shGfrtxJOtJ8sRTVwuC8akT81gjPYESP+PYF4VR2yHW3W3tOvUkD9epJ7IhoZMn+PgJhFPQVapeygMpXQjnhNT+xK5TT/KMlif4OFY+qjLYeSC3JSckRy0+/pV/7svE+iLUpittF7Jt7br2bdsckaKy4r+Rb2VFbbQKY/wXMFIZu26y/sYCpbzOeZJtxWRbJdjfmmkLUYtlfnO2pbBuc0Tx5HmodbWStjexLRQY3hh78vzqiv9VKGU9iW7CXAQrUhhPHpdWCbYnmbYZT6htyiauiS7DjOOlVAVgPPnOKqXftrA9ybTNePJ72BZPwZB4IivnOecjTGprq3G42HkgAdiTyxXcDZoFMHjbbEHv4vvhiU15NrILOGqrtRYcL2udifULWJkaE9ouZNvade3btjkiRaVpZf/82VE7UXsT4ix5LN6um6y/hpUPj+c8ybZisq0S7G/NtIWohY3y5mxLYT1x/VW7lcB1ppX9o8k1/HoW267Ej8XzxtiT116FOT20zXpy9vp7UPFO5pfYePIutkolVbE9OXb9ufHZOcrphWQ8wbZzqbZccxVa3ZhLJecCjCfvvgeVqYxEtidXz/z++I0j8WPxGU+uQtsjdnIJ9gQzMvDKecn5iJsrIA/FUioPJNSgGpxLgj8EYa3VquFV2CpsBYWyEdgOitpoDV6CMDs9MrGOvVw1NSa0XMi1terat213RIpKHndNxAkjECtqo2vwEiwnGtkRzeMubJvxJNeKiVvB9onl4iPGKkDUQpW88QhqYvkQ1xEU1tED8BKsZ3OlcMhzq7PL9lPhXJO0nUraclXsCbf95HjGk+gteJk6/3Amau1x1zFoJZsByxNuezhum/EER1DH1u1EeFQTnVq7C1qlk3NRrJMn2OrqukkYgVieRGNrX/Sm3o7bZjzBcVeqLQoBmFsNJufjQRKgKkrwNskDaTaSDfgBvgJCDlNJwksYgCfZCGwHxzOcxGy+jR3rTXo12C5k29p17du2OSLFJnvSjGcaiBW1QDRr/7sndh17gm3z85PoxnIuD1fcCrZvpGYp9rdm2kLU4kZ+44jfiOcMiIQ1tyrwxNUqaWv9uyey0fZkY+6ZrCdA9C1oVeAJtpLNgN2fcNu4y3B4Mn/Enm/IDnibJJPEjmI99iTTyupPoO23z9eLPJn/mjVLQU/whgOHD0QJ9Q/hafEEf4wzeSBznrAYFdy3L0+ihXD2dGF/0t6TbFu7rn3bNkekqOzkSbQaTp4u7E9cnkSry6lWTNwKY6itJ9y2V0+oVWF/0t6T6OZy5WJhf+LyhFoV9iftPYlurtttu/Qkury+72Jhf9LeE2pb2J/kPcEXjHqMe2aRPKHYj7dJHkiXJ1Ds25Muxl1NPI0Yy4Uuxl2Otl2Mu5odRkGFnkDb3sddGwOMuzb6GndtrPc/7tpY72fctXG+/3HX/Pl+xl3zh/sfd6XakicQNPgKmPshsDnuT8w2caONJ7RXP55QiopiTzDTXYLlQq6tVde+bbsjUmzK/IRi0WBFbbAMU+MO8xMoZjzJtWLiVrC90xEL5ycUxwYK62AdWxV6cjbfil+nsG2H+QkUM55MnYcpfIf5CXY7MZYnU4exbfH85BpuMVDN1GGYwneYn6RbJZ5MvY1ti+cn13CLwJ5AdFD0m/A/BxN78sRSwuSBzHkCXwEh1/f8BGc+0YJfnU8/gs+xvuivtbxKqkuwXci1terat213RIrNxfram9AqlYMxFbVr+6PVunXEpI7bTmLHkPOEWj284Tri0bhVgvWt2bYQtVAlb0frM9jW7k44rIP1tcdcR6SQP7oy8yq2MueIcA29Tq3PPBbdTB0x8QTbjs9Cd5L3ZObp6ObKwxtv2l8rnpybm3mPWyWkPKG2dzalbcoTbpvqTownM3dFl+fiVgLbcO7Ii8+N3zhvdydpT2a+aLdNeXLua7m2fD+edIGownfK+YifzfUusw3iy68Gs/AJQo/KS1gVgDN4vQu/pjdPaEVVk7LmtdbgEDZS583D+aWTWHCNu22qrm3bgiNCf+BoVccaWd+1tOy/0LoWviF19kosaPuU77+GyUljT7jeOwGt3oRWqf+gXDfu3WdaxdjfOp5uK406tL0300qQOmhVz7ai1VuyvuvEOrR9YPl5OSJv5PVd0PYeaIupUGNPZH3XB9f9r74atxLM2i9s9a4kUGVS67s+eB7avrX8OHdhqfVdB7xvfi7bVtZ3QauXklaCWftFrd7LtTLru75y2H/pvVPL3+G2qfVd0PaOun/VbstzD+ggILop/vEW3PQijbvirI+yjfNAXoL98deaajG28Aca759AY+hk/E0oY5DubZL+ZHRJ+pO9C3qC4zClP9STvYF6Mhjqyd5APRkM9WRvgBOP9JUipRfUE0XpjHqiKJ1RTxSlM+qJonRGPVGUzqgnitIZ9URROqOeKEpn1BNF6Yx6MlrgCl/Dnl/ku42oJ6NFs9bCJfW0sL6jJ5QBsjt62HUkUU9GiybIwZ5QsRDOANkVPew6mqgno4d40okeMkBuS7LIXY16MnoknuBDjZXFEB9XlByQntca8/3pi1zn+8fhf7Ob+HRvkvaR94SZjskFybvuaVPUk9HD6k8qvn/pdA0/JTkgK/TUO035IfSrvl9t1aAIrdgEs6eVC1KSTOxh1JPRI+1JlTL5xDkgMY0KbIW5Cwc/lukhLmhF6SKsPeMcEuqJejJ6pD3hAI9zQC6BAYWexHuqJxbqyeiR9oSvesU5IKF6DCYl7T2J91RPLNST0cPtiTz1G12gfFhFnsie6omFejJ6uDyRSMe8kB3nJ7xnQz2xUE9Gj2byb87FnoAKIeaAxH8/KFiirehAsATDrLQnZk+7P+FdsXavop6MGhDnCN0MgfiORZEckBV/swW7XJAMkIuwQ+0avLyMzWhX2RP6kCQXZJxKcq+inihKZ9QTRemMeqIonVFPFKUz6omidEY9UZTOqCcjhK8oSjG3iSy3gO/+QXu+W1BZVFdYubX1h+0pqixs+L2tP5JSnu/7fyzHdrC1JQUH39v6Eyk5KKosOpvCUy1s+IOtP5VSnj/z/1yO7aD4VAv+xr/Y+ksp5fnB1l/JsR38dUFlUV2Hhn8jQTt8+g539UQ9kWM7UE8M6ol6Isd2oJ4Y1BP1RI7tQD0xqCfqiRzbQdk8iRZ4pWTXBJfSSyLVE/VESg5K6YksFvanaXUvLvnlJcC4WdKpVGn1fEJrDLOwMC35d+N50TB9R2AW6UeL07iOuHHJ8ypjLdxiUE/UEyk5KGl/EtTAA4hytmIxlCdRGtfkiRR88p1LTKOW9CZBCD3FItVX16LoZfymtYpXwae+WpuY1ejgBfripnkOjFBP1BMpOSipJw30BB/a5fCvyqON0QXzhOPx9KOJdvdSQQco9WMTZcHMq40ae9KoiV6YvCXdSj1RT3atJxWxYeFJ7lmMJ41rp2vc1TDBtNW7VNCFaA0MIxuiNfgqGXeZ7/Ma+IRXupl6op5IyUGpPYEJCfcnC0GVntw1nlQwy10y0pLuQYAx2bxXWUg6pXh4FXcnnncJt5FCBvVEPZGSgzJ7EqyZn/+FAJSBsngSvR7A7D6J8VS8U+dxfJ7eqTn1L0QQpmYkab/UE/VESg5K6wle77p0kD+BJ7ilYjxpghYNyqPK4PTDZpEvi+U8acYZXISkSj1RT3alJ1WI6vjXHjzBXqIpnlRxyIXJgwURguQCEyoL0YK/iekgaXMy7lJP1JPR8ySZdZMnEOXhafKE8q8AsUZpT+gqVwWGZUXzE0Y9sVBPdqkn8TSePYHYD8cw5Kk7gdo4yEUIgb3AWydraJI9eanG5jHqiYV6sks9gdca3zJnT+Q2SuMa9w9Jd5Oex7MneBclvn9iiG9PRifoO5KuRj1RT3ahJwHfHoGhFi5HiV7nUI/WIK7pBjsCwy+zVoVuLRrwX3Pw5tEO8CdqpRxqhuEi7BqMkS56XdhGPdltnvD6Luwtqr4fBhWadmAFdCU4CaEPuOzLXBsO7BuGXmCv7wpnLYU87+ACTG5CyQqZaqaeqCdSclDS/qRXsssiu6Nit1JP1BMpORgRTxq1ZLlw1+g6yBTqyeh74jXGMo+TdGZR19WnUE/2gCf6nJZBPVFPdhL1RD2RkgP1xKCeqCdScqCeGL47dLaGzvf9v5XS6PJ3/t9LaZTR/kTQ/kT7Eynl0XFXjHqinkgpj3oSo56oJ1LKo57EqCfqiZTyqCcx6ol6IqU8A3jSy33G7C1GQj1RT6TkoJSe8HrhPvJBLobxWuD5C7x6K04JWZAKklBP1BMpOShpf9JfPkhaas9tKtOyFH/hUhQt4BL9glSQhHqinkjJQUk9MY+2y4O/3eWDjF4HEeZD04aaUEI7fClKBUmoJ+qJlByU25Pe8kEGF7HcdHtSlAqSUE/UEyk5KLUncSKJXvJBUr5tQJ59l3FXYSpIQj1RT6TkoMye9JcPsiptxBOZxxemgiTUE/VESg5K6wnOyPvJBxlsymY7lwqOxjKe2CmJCPVEPZGSgxL3Jz3ng0Swq2HUkzzqyQh6YiXo6i4fJLIUy5P2pDAVJKGeqCdSclBmT+JpPHsC3nTMBwkTfEPaE5j3J1WIepJFPdmlnsBrj/kgl5bwkwzO0p4UpYIk1BP1REoOSupJf/kgMSEeQPXRy7V0h1GQCpJQT9QTKTkopSe8vgt7i57yQYomNFiza4X2qSAJ9UQ9kZKDkvYnvdJzPshUKkhCPVFPpORgRDzpNR+kroPMo56Mvic95oPMpIIk1BP1REoORsUTfU7LoJ6oJzuJeqKeSMmBemJQT9QTKTlQTwySpHGISGq/IaL5IEcF9WQnUU9GBR13CWUbd/3DD9vyo61/lFKeH/c/7vqnf27LT7b+RUp5/lXHXTuKeqKeSMmBemJQT9QTKTlQTwzqiXoiJQe72ROzwH57UE/UEyk5KKUnvF7Y5IMEWpu+T+mErPSOntdcgM+z0771b8SbLJCp/bpDPVFPpOSgpP1JOh9kEC56rTUqV9ei+AGUahME2mxB/aY8gxVngUzt1x3qiXoiJQcl9USe5OUkXfxMFSVVaaIQQUhLuRoXIpN0JUm+Io8p2vt1iXqinkjJQbk94Ud7JU0EKkBZt+RZRDvZXcU8kyWe2Pt1iXqinkjJQak9kUQS4kklDEw3gzJEr8NHkwwiTmPHntj7dYt6op5IyUGZPTH5IBv8sHw1DBJjoPb1KEnK1ahJz8Jq2Pt1i3qinkjJQWk9wetdJh9klTKfbtYadvzDsEs9caCe7LH+xMoHuRT6myegV5H4Rxnw5kmSNDj5VxtsT3TclUE9GUFPrARdCOZJteYdnGPYdBg6P4lRT/aaJ0k+SIAmKRHdRKHrWJQUMk7yGGevZzWs/bpGPVFPpOSgzJ7Aq+SDxDvylIc+vi/Ca1b0/kke9WQPeZLOB+kdnA15rgJdRNTCbqLJHUkQbp72vNN0Vx4xWSDj/bpHPVFPpOSglJ5k8kHCx7F53A5EC7SaK/7nG2h917RZ35VkgZT9ekA9UU+k5KCk/cktQD1RT6TkQD0xqCfqiZQcqCcG9UQ9kZID9cSgnqgnUnKgnhjUE/VESg7UE4N6op5IyYF6YpDkc0NEUpYNEc1zNyqoJzuJejIq6LhL0HFX3+Ouf5NjO/hx4am2r/vhT7b+XUp5frL1H3JsB/9ZUPlfW/8tJQc/3fofKeX5qXpiUE/UEynlUU9i1BP1REp51JMY9UQ9kVKe3jzRfJAu1JM940kuH6Q7z2M+H6Q7b2R3qCfqiZQclLQ/SeeDbJPnMZcPsk3eyO5QT9QTKTkoqSfmAff4wV/Hc4q5fJD8nG8ub2SXqCfqiZQclNuTJJOEeFKYD9LKsqL5IJ2oJyPpiZVIgj0x3Qx+yOeDTLJ22ft1i3qinkjJQZk9MfkgEQ55O39dPh+kO29kt6gn6omUHJTWE7zeZfJBAnlPHPkgnXkju0U9UU+k5KDE/YmVDzLjCX5w5oN05I3sGvVEPZGSgzKPu+x8kBzy1ryjTT5IbJXKG9k16ol6IiUHZfbEzgfJId85HyS0hF00H6Qb9WQUPYHXOB+kdA0d80Fm80Z2j3qinkjJQUk9yeSDzOd5dOeDzOeN7B71RD2RkoNSepLJB4m+ABT1RfkgHXkje0A9UU+k5KCk/cktQD1RT6TkQD0xqCfqiZQcqCcG9UQ9kZID9cSgnqgnUnKgnhjUE/VESg7UE4N6op5IyYF6YpDkc0NEUpYNEc1zNyqoJzuJejIq3EpPpBt1UVTZd8OtLelGXRRVbm39r5Qc/Kig8vv+/8mxHfyoYGxVVNdh3FUwfCqqLGyo4y71RFBP1BMp5VFPYtQT9URKedSTGPVEPZFSHvUkRj1RT6SUx/IknejRlRCy95SPhagn6omUHJTVk3SiR2dCyN5TPhainqgnUnJQUk/yDypmH2js55HFQtQT9URKDkrqSTrRIyKeJIke+0j5WIh6op5IyUE5PXEkUmFPkkQq/aRUKUQ9UU+k5KCcnmQT2AEsRJLArp9UdoWoJ+qJlByoJwb1RD2RkoNyepJL9JjxBD4kJXzbBtQT9URKDnR+YlBP1BMpOSinJ45EjyxEkuixn5SPhagn6omUHJTUE71/op6oJ1LKE3sCAqQSPeYTQlql7UE9UU+k5KCsnqQSPeLwK5MQMlXaFtQT9URKDkrrydBRT9QTKTlQTwzqiXoiJQfqiUE9UU+k5EA9Magn6omUHKgnBvVEPZGSA/XEoJ6oJ1JyUEJP8BKwoigF3KaeKEpHwBNFUYrxvP8HEIpUaFgffDQAAAAASUVORK5CYII=\\\"\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cp\\u003eFor the extended stability study, CBCVd and NAD remained detectable in all three 100% RNA control samples even after three months of storage at ambient temperature (data not shown). The average Ct-values were for CBCVd were 34.6 for 0.2 \\u0026micro;L and 31.46 for 1 \\u0026micro;L template volume, and 33.1 for 0.2 \\u0026micro;L and 30.5 for 1 \\u0026micro;L for NAD.\\u003c/p\\u003e\\n\\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.3 Simulation of orange oil extraction and viroid risk assessment\\u003c/h2\\u003e\\n \\u003cp\\u003eTo strengthen the study, we extended the testing with additional fruit and oil samples to assess whether the raw material and oil production processes impact viroid integrity. Among the 32 orange samples analysed, all peel RNA samples tested positive for NAD, one for CBCVd, none for CEVd, and seven for HSVd. However, none of the corresponding oil samples tested positive for NAD or any viroids.\\u003c/p\\u003e\\n \\u003cdiv class=\\\"gridtable\\\"\\u003e\\n \\u003cdiv class=\\\"colspec\\\" align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/div\\u003e\\n \\u003cdiv class=\\\"colspec\\\" align=\\\"char\\\"\\u003e\\u0026nbsp;\\u003c/div\\u003e\\n \\u003cdiv class=\\\"colspec\\\" align=\\\"char\\\"\\u003e\\u0026nbsp;\\u003c/div\\u003e\\n \\u003ctable id=\\\"Tab4\\\" border=\\\"1\\\"\\u003e\\n \\u003ccaption\\u003e\\n \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 4\\u003c/div\\u003e\\n \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\n \\u003cp\\u003eFresh oil pressing experiment where RNA was first extracted from 32 citrus peels using the detergent-based RNA extraction method and analysed by RT-qPCR for NAD, CBCVd, HSVd, and CEVd. For each sample, the corresponding orange oil was directly tested in the RT-qPCR setup for viroid detection.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003c/caption\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003ePeel RNA\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eOil\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eSamples\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e32\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e32\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNAD\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e32\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eCBCVd\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eCEVd\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eHSVd\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n \\u003c/div\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e\\u003cbr\\u003e\\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eIn response to increasing restrictions on using synthetic pesticides under the European Green Deal and Farm to Fork strategies (European Commission, 2020), farmers and the agricultural sector are adopting plant-based strengthening products, such as orange peel oils, which have shown effectiveness as natural alternatives for managing pests and diseases in crops like hops (Brunelli et al., 2018; Oro Agri International, 2020). However, a recent study by Hagemann et al. (2023b) found that peel of tested citrus fruits contained the two most severe hop stunting viroids CBCVd in 5% and HSVd in 30% of tested fruits, respectively. In response to these challenges the current study analysed viroid contamination in terpene-rich matrices, such as orange oil, using different RNA extraction methods and subsequent RT-qPCR. This provides a framework for evaluating viroid-related risks in plant-derived agricultural products and ensuring the integrity of food authentication systems.\\u003c/p\\u003e\\n\\u003cp\\u003eCitrus oils, including orange oil, are chemically complex matrices, characterized by high concentrations of monoterpenes like limonene and secondary metabolites such as flavonoids and polyphenols (Njoroge et al., 2005). These compounds are known to interfere with RNA extraction (Sasi et al., 2023). Polyphenolic compounds in orange oil can also bind irreversibly with RNA to form strong, covalent-like interactions, creating inseparable complexes that further hinder RNA recovery and purification in citrus oils (Mattheus et al., 2003). In contrast, nucleic acids have been successfully extracted and analyzed from olive oil, for applications such as food authentication and traceability. Unlike terpene-rich orange oil, olive oil comprises over 98% triglycerides, resulting in a relatively simpler chemical composition (Boskou, 2006; Jimenez-Lopez et al., 2020). However, even with this simplicity, the lipid-rich nature of olive oil presents challenges for nucleic acid extraction (Birtić \\u0026amp; Kranner, 2006). Studies employing CTAB-based extraction methods have successfully overcome these challenges, recovering nucleic acids from oils and providing valuable insights (Busconi et al., 2003; Raieta et al., 2015). Building on these findings, we aimed to isolate RNA from orange oil despite its enrichment with challenging secondary metabolites.\\u003c/p\\u003e\\n\\u003cp\\u003eInitially, we utilized detergent RNA extraction, which is phenol-free but still highly efficient for isolating RNA from non-fatty matrices like hop leaves and compost residues (Hagemann et al., 2023b; Hagemann et al., 2024). While effective for orange peel RNA extraction and baseline viroid detection, this method appeared less suitable for oil samples. In contrast, the chaotropic RNA extraction, which is based on the combination of guanidinium thiocyanate and phenol demonstrated superior performance for orange oil formulations, leveraging principles described by Chirgwin et al. (1979). Guanidinium thiocyanate denatures RNases rapidly, protecting RNA from degradation, while phenol enhances the disruption of hydrophobic compounds like terpenes and solubilizes secondary metabolites. Its one-phase system simplifies the process, reducing RNA loss and ensuring high-quality RNA recovery from lipid-rich matrices, making it a promising choice for commercial testing. Using this optimized protocol, we successfully extracted RNA from RNA-oil mixtures. For this study, we tested orange oil spiked with RNA extracts from viroid infected hop to create RNA-oil formulations. The result showed that RNA extraction after spiking of oil with RNA did lead to the consistent detection of both the viroid and also NAD as internal RNA control. This confirms our first hypothesis, which proposed that a specialized RNA extraction protocol would enable reliable viroid detection in artificially spiked orange oils via RT-qPCR. Using this protocol, RNA was successfully extracted from spiked orange oil formulations, consistently detecting both viroid RNA and NAD as an internal control, thereby confirming our hypothesis that a specialized RNA extraction method enables reliable viroid detection in orange oil via RT-qPCR.\\u003c/p\\u003e\\n\\u003cp\\u003eThe results also set the foundation for our second hypothesis that viroids remain detectable in orange oil or orange oil formulations when subjected to spiking experiments. Using RNA-oil mixtures directly as a template for RT-qPCR and comparing them to RNA-extracted samples (Fig.\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb), we confirmed that viroid RNA remains detectable in both cases, thereby validating the hypothesis (Tables\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e \\u0026amp; \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). The direct use of RNA-oil formulations showed that the detection of CBCVd and NAD was consistent in both RNA 100% (-80 and +\\u0026thinsp;21\\u0026deg;C) controls (Table\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e), also after incubation at room temperature for over three month (Data not shown). However, samples with varying RNA-oil concentrations, 90% RNA and 10% oil samples showed intriguing results; CBCVd was undetectable at one hour and one day but became detectable after one week in the lipophilic phase containing the orange oil. This may be attributed to the gradual diffusion of viroid RNA at the water-oil interface over time, eventually reaching detectable levels in the oil phase. Alternatively, the evaporation of volatile compounds in orange oil, as noted by Han et al., (2024), may alter oil's overall chemical composition, facilitating RNA dispersal or stabilization within the oil-rich phase. In contrast, 10% RNA samples exhibited sporadic CBCVd detection, likely due to the lower RNA concentration, which may result in levels near or below the RT-qPCR detection threshold. These findings highlight the complexity of viroid detection in lipophilic heterogeneous matrices but also demonstrate the capability of our methods to uncover viroid dynamics in such chemically complex systems.\\u003c/p\\u003e\\n\\u003cp\\u003eIn 100% oil samples, NAD and viroids were undetectable irrespectively if used directly or after chaotropic RNA extraction. We hypothize that RNA, due to its hydrophilic nature, partitions into the aqueous and debris layers during centrifugation, which removes non-lipid components from the hydrophobic oil matrix. This observation highlights the physical and chemical limitations of RNA retention in oil, a key aspect explored in subsequent hypotheses regarding RNA persistence through oil extraction processes. The absence of RNA in pure oil suggests that nucleic acids are unlikely to integrate into the oil matrix during production. However, the presence of CBCVd and NAD following the chaotrophic RNA extraction of 100% RNA highlights the potential for viroid and plant RNA to maintain its integrity over extended periods (Table\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). NAD, despite its linear structure, remained detectable for up to seven days in samples with low oil concentrations, suggesting RNA stability under these conditions. Viroids, with their robust circular RNA conformation, are expected to exhibit even greater stability (Riesner et al., 1983). Supporting this, Hagemann et al. (2024) observed HLVd detectability in compost residues for over 15 days under controlled conditions (50\\u0026deg;C, pH 5\\u0026ndash;7), further underscoring viroid resilience in challenging environments.\\u003c/p\\u003e\\n\\u003cp\\u003eA study by Hagemann et al. (2023b) highlighted the frequent detection of viroids in fruits imported into grocery stores from various global locations but did not investigate their persistence in oils. The potential reintroduction of viroids into agricultural systems through byproducts like orange peels remains a significant concern. These byproducts are often repurposed for processes such as oil manufacturing, which is commonly used in plant-strengthening products (Teigiserova et al., 2021). This observation led to the formulation of our third hypothesis, which is that viroid RNA can persist through industrial orange oil extraction processes, posing a potential risk of viroid transmission to sensitive crops like hops. However, our findings suggest otherwise, because despite all peel samples being NAD-positive and eight being viroid-positive, neither viroid RNA nor NAD was detected in the corresponding oils (Table\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). These results reinforce the conclusion that RNA, including viroid RNA, is unlikely to integrate into the oil matrix under the processing conditions tested, thereby mitigating the potential risk of RNA transmission through orange oil products. Global orange production exceeds 71\\u0026nbsp;million tons annually (FAO), with a substantial 50\\u0026ndash;60% of the fruit, primarily the peels, discarded as waste (Manthey \\u0026amp; Grohmann, 2001). These peels are often repurposed for the extraction of orange oils, primarily through methods like cold pressing or steam distillation. Cold pressing uses mechanical force to extract oil from the peel at low temperatures, preserving the natural components of the oil (Aydeniz-Guneser, 2020) whereas methods like steam distillation, are more heat-intensive processes, which involve passing steam through the peels to vaporize the volatile oil components, which are then condensed and collected (Sikdar et al., 2016). Hydrodistillation, although less commonly used for orange oil, involves boiling a water-peel mixture to release the oil (Tran et al., 2023). These different extraction methods, particularly the temperatures and pressures applied, impose distinct physical and chemical conditions that could influence the stability and detectability of viroids, should they be present. For instance, an optimized steam distillation method demonstrated optimal oil recovery from \\u003cem\\u003eC. sinensis\\u003c/em\\u003e and \\u003cem\\u003eC. reticulata\\u003c/em\\u003e peels when heated for 30 minutes at 50\\u0026deg;C (Mercy et al., 2015). Similarly, a study by Tran et al., (2023) demonstrated that essential oil from \\u003cem\\u003eC. sinensis\\u003c/em\\u003e was effectively extracted using a 3:1 water-to-raw material ratio by heating the mixture at 130\\u0026deg;C for 60 minutes. Such high-temperature methods are particularly relevant in studies on viroid degradation. Hagemann et al. (2021) showed that treating fermentation residues at 70\\u0026deg;C reduced HLVd concentrations by four decimal powers within a single day, while Matousek et al. (1995) observed a 70\\u0026ndash;90% decrease in HLVd concentrations in hop meristems after two weeks of heat treatment at 35\\u0026deg;C. These studies underscore that the high-temperature conditions inherent in commonly used oil production methods may effectively minimize the risk of viroid persistence in oil-based products. Cold pressing, the most common method for essential oil extraction, preserves natural oil components by operating at low temperatures (Aydeniz-Guneser, 2020; Baser \\u0026amp; Buchbauer, 2015). Industrial processes typically involve crushing fruit peels with water and using centrifugal force to separate oil at 40\\u0026ndash;50\\u0026deg;C (JBT Operating Manual). In our study, a laboratory-scale cold-pressing method was used to simulate commercial conditions. The process was conducted at ambient temperature, which means that the conditions are even more in favour of viroid stability compared to commercial conditions making our approach rather conservative regarding risk assessment. The resulting orange oil was free of detectable RNA and viroid contamination, addressing a critical gap in viroid detection within complex fatty matrices and providing a practical framework for evaluating risks and developing safe plant-based products and bio-pesticides.\\u003c/p\\u003e\\n\\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e\\n\\u003ch2\\u003eRisk assessment\\u003c/h2\\u003e\\n\\u003cp\\u003eCitrus-based agricultural products or orange oil have not been mentioned in the pest risk analysis (PRA) of CBCVd by Radi\\u0026scaron;ek and Benko-Beloglavec (2016). They along with Wilstermann et al., (2020) and EPPO (2021) evaluated the likelihood of entry, establishment, spread, and impact as well as management options to contain the spread and to control the viroid in Slovenia, Germany, and the EPPO region. The results of these PRAs in combination with the findings presented in this study can be used to identify the overall risk associated with the transmission of viroids through plant-based plant-strengthening agents and in particular to the risk posed by orange oil used for the treatment of hop. In accordance with these results, this risk appears to be low but not negligible.\\u003c/p\\u003e\\n\\u003cp\\u003eResults of our study indicate that neither viroid RNA nor NAD was detected in freshly pressed oil under the tested conditions (Table\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). Further, in an independent pioneer study we analysed three commercial citrus-oil based products, also not finding traces of viroids (Jagani et al., 2023). Additionally, we tested seven commercial products with the same methodology and in three repetitions, of which none showed a RT-qPCR signal for viroid or plant RNA (detailed data under disclosure). These results combined suggest that the presence of viroids in pure oil matrices is very low. Although the risk of viroid transmission through plant-based products appears to be low, CBCVd is known for its high stability and destructive impact on hops (Jak\\u0026scaron;e et al., 2015), leading to significant economic losses for hop growers (Radi\\u0026scaron;ek and Benko-Beloglavec, 2016, Wilstermann et al., 2020, EPPO, 2021). Its ability to spread mechanically further increases the risk of transmission between orchards via shared machinery or tools (Barbosa et al., 2005; Seigner et al., 2020),underscoring the need for stringent biosecurity measures to mitigate the risk of viroid spread in agricultural systems. Therefore, it is essential to enhance phytosanitary checkpoints and implement stricter surveillance measures during critical stages of production and trade to prevent unintentional movement of viroid-contaminated materials.\\u003c/p\\u003e\\n\\u003cp\\u003eIn agricultural applications, we are not aware of the use of undiluted pure oil. Further, our greenhouse trials show that pure oil is phytotoxic leading to necrosis of treated leaf or stem areas (data not shown). Therefore, orange oils used as plant strengthening agents are typically formulated with other components, such as water and surfactants or are recommended to be diluted before use (PREV-AM 2 l / ha in 500-1,000 l water / ha (Biofa, M\\u0026uuml;nsingen Germany). To address the potential risks associated with viroid migration into aqueous phases during processing and to eliminate any residual uncertainty, we recommend individually testing all components of orange oil-based products, including newly developed formulations or updated batches, to ensure they are free from viroid contamination prior to use. Even better, producers could mitigate the risk by sourcing viroid-free raw materials for oil production, thereby providing the highest level of safeguarding and further minimizing the potential for viroid transmission. The combination of strengthened phytosanitary checkpoints and the initial findings highlighted in this study are critical to the manufacturing, testing, use, and distribution of plant-based plant-strengthening agents, as well as to protecting hop orchards and preventing the spread of viroids. Ensuring the safety of plant-based agricultural inputs is not only a precautionary measure but also a commitment to safeguarding global agricultural value chains and food security. This research fills a critical gap in viroid detection within complex fatty matrices, providing a practical framework for evaluating risks and developing safe plant-based products and bio-pesticides. Future studies should focus on increasing sample diversity and simulating industrial-scale processing conditions to enhance the robustness of these findings.\\u003c/p\\u003e\\n\\u003cp\\u003eIn conclusion, this study successfully addressed its initial hypotheses, demonstrating the potential of the validated RNA extraction protocol for terpene-rich matrices. Outside the scope of viroid research, this protocol offers a wide range of additional applications, including the detection of diverse pathogens in essential oil-rich crops, the profiling of secondary metabolites in medicinal plants such as cannabis, and ensuring authenticity and safety in food and agricultural products. Additionally, this protocol facilitates detailed studies on viroid decay in complex fatty matrices, offering insights into pathogen stability and matrix interactions. The absence of viroids in fresh-pressed oils derived from viroid-positive fruit peels under the tested conditions highlights a low but not negligible risk of viroid transmission through citrus-based oils. These findings underscore the importance of stringent testing protocols and source material verification to ensure the safety of plant-based agricultural products. By establishing a robust framework for risk assessment, this study paves the way for developing safe, sustainable solutions in agriculture while protecting sensitive crops like hops from emerging pathogen threats.\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch3\\u003e\\u003cstrong\\u003eData availability\\u003c/strong\\u003e\\u003c/h3\\u003e\\n\\u003cp\\u003eAll data generated or analyzed during this study can be requested from the corresponding author.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors thank Elke Sprich for her assistance with fruit preparation and analytical work.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor information\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors and Affiliations\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eUniversity of Hohenheim, Production Systems of Horticultural Crops, Stuttgart, Germany\\u003c/p\\u003e\\n\\u003cp\\u003eSwati Jagani, Ute Born, Michael Helmut Hagemann\\u003c/p\\u003e\\n\\u003cp\\u003eState Education and Research Center of Viticulture and Horticulture, Institute for Plant Protection, Neustadt, Germany\\u003c/p\\u003e\\n\\u003cp\\u003ePatrick Winterhagen\\u003c/p\\u003e\\n\\u003cp\\u003eFederal Biological Research Centre for Agriculture and Forestry, Braunschweig, Germany\\u003c/p\\u003e\\n\\u003cp\\u003eGritta Schrader\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCorresponding author\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCorrespondence to \\u003cstrong\\u003eMichael Helmut Hagemann (\\u003c/strong\\u003e\\u003cstrong\\u003emichael.hagemann@uni-hohenheim.de\\u003c/strong\\u003e\\u003cstrong\\u003e)\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eContributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eSwati Jagani: Conceptualization, Methodology, Investigation, Data Curation, Formal Analysis, Writing \\u0026ndash; Original Draft Preparation. Ute Born: Methodology, Investigation, Data Curation, Writing \\u0026ndash; Review \\u0026amp; Editing. Gritta Schrader: Risk Assessment, Methodology, Validation, Compliance with EPPO Standards, Writing \\u0026ndash; Review \\u0026amp; Editing. Patrick Winterhagen: Supervision, Project Administration, Writing \\u0026ndash; Review \\u0026amp; Editing, Manuscript structure, Experimental Design Guidance. Michael Hagemann: Conceptualization, Project Administration, Formal Analysis, Supervision, Writing \\u0026ndash; Review \\u0026amp; Editing.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no financial interests or personal relationships that could have influenced the work presented in this article. The work was self-funded.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthical approval\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work is not dealing with humans or animals.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eInformed consent\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors declare that they have no conflict of interest.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003e Adkar-Purushothama, C. R., \\u0026amp; Perreault, J. P. (2020). Current overview on viroid\\u0026ndash;host interactions. \\u003cem\\u003eWiley Interdisciplinary Reviews\\u003c/em\\u003e: RNA, 11(2), 1\\u0026ndash;21. https://doi.org/10.1002/wrna.1570\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Alotaibi, S. S., Darwish, H., Alzahrani, A. K., Alharthi, S., Alghamdi, A. S., Al-Barty, A. M., Helal, M., Maghrabi, A., Baazeem, A., Alamari, H. A., \\u0026amp; Noureldeen, A. (2022). Environment-friendly control potential of two citrus essential oils against \\u003cem\\u003eAphis punicae\\u003c/em\\u003e and \\u003cem\\u003eAphis illinoisensis (Hemiptera: Aphididae)\\u003c/em\\u003e. \\u003cem\\u003eAgronomy\\u003c/em\\u003e, 12(9). https://doi.org/10.3390/agronomy12092040\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Andrade, M. A., Barbosa, C. H., Shah, M. A., Ahmad, N., Vilarinho, F., Khwaldia, K., Silva, A. S., \\u0026amp; Ramos, F. (2023). Citrus by-products: valuable source of bioactive compounds for food applications. \\u003cem\\u003eAntioxidants\\u003c/em\\u003e, 12(1), 1\\u0026ndash;20. https://doi.org/10.3390/antiox12010038\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Atanasova, D., \\u0026amp; Leather, S. R. (2018). Plant essential oils: the way forward for aphid control? \\u003cem\\u003eAnnals of Applied Biology\\u003c/em\\u003e, 173(2), 175\\u0026ndash;179. https://doi.org/10.1111/aab.12451 Aydeniz-Guneser, B. (2020). Cold pressed orange \\u003cem\\u003e(Citrus sinensis)\\u003c/em\\u003e oil. Cold pressed oils, \\u003cem\\u003eAcademic Press\\u003c/em\\u003e (pp. 129\\u0026ndash;146). https://doi.org/10.1016/B978-0-12-818188-1.00012-8\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Baser, K. H. C., \\u0026amp; Buchbauer, G. (2020). Handbook of essential oils: science, technology and applications (3rd ed). \\u003cem\\u003eCRC Press.\\u003c/em\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Birtić, S., \\u0026amp; Kranner, I. (2006). Isolation of high-quality RNA from polyphenol‐, polysaccharide‐and lipid‐rich seeds. \\u003cem\\u003ePhytochemical Analysis: An International Journal of Plant Chemical and Biochemical Techniques\\u003c/em\\u003e, 17(3), 144\\u0026ndash;148. https://doi.org/10.1002/pca.903\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Biofa (2025). Bek\\u0026auml;mpfung der Wei\\u0026szlig;en Fliege im Fruchtgem\\u0026uuml;se und saugender Insekten im Zierpflanzenbau. https://biofa-profi.de/de/weisse-fliege/prev-am.html?file=files/content/Produkte/PREV-AM%C2%AE/Biofa_PREV_AM_Produktinformation_2019.pdf Accessed at 21.01.2025.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Boskou, D. (2006). Olive Oil: Chemistry and Technology, Second Edition (2nd ed.). \\u003cem\\u003eAOCS Publishing\\u003c/em\\u003e. https://doi.org/10.4324/9781003040217\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Brunelli, A and Fabbri, M and Casagrandi, F and Paganelli, M and Collina, M. (2019). Pre- and post-infectional anti-odour and anti-peronosporic activity of an orange oil-based formulation, \\u003cem\\u003eATTI giornate fitopatologiche\\u003c/em\\u003e, 11(1), 1\\u0026ndash;14.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Busconi, M., Foroni, C., Corradi, M., Bongiorni, C., Cattapan, F., \\u0026amp; Fogher, C. (2003). DNA extraction from olive oil and its use in the identification of the production cultivar. \\u003cem\\u003eFood chemistry\\u003c/em\\u003e, 83(1), 127\\u0026ndash;134. https://doi.org/10.1016/S0308-8146(03)00218-8\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., \\u0026amp; Rutter, W. J. (1979). Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. \\u003cem\\u003eBiochemistry\\u003c/em\\u003e, 18(24), 5294\\u0026ndash;5299. https://doi.org/10.1021/bi00591a005\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Diener, T. O. (2003). Discovering viroids - a personal perspective. \\u003cem\\u003eNature Reviews Microbiology\\u003c/em\\u003e, 1(1), 75\\u0026ndash;80. https://doi.org/10.1038/nrmicro736\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e EPPO (2021) Report of a pest risk analysis for Citrus bark cracking viroid. EPPO, Paris. https://gd.eppo.int/taxon/CBCVD0/documents Accessed at 21.01.2025.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Gargani, E., Ferretti, L., Faggioli, F., Haegi, A., Luigi, M., Landi, S., Simoni, S., Benvenuti, C., Guidi, S., Simoncini, S., D\\u0026rsquo;Errico, G., Amoriello, T., Ciccoritti, R., Roversi, P.F. and Carbone, K. (2017). A survey on pests and diseases of Italian Hop crops, \\u003cem\\u003eItalus Hortus\\u003c/em\\u003e, 24(2), pp. 1\\u0026ndash;17. https://doi.org/10.26353/j.itahort/2017.2.117\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Gent, D. H., \\u0026amp; Ocamb, C. M. (2009). Predicting infection risk of hop by \\u003cem\\u003ePseudoperonspora humuli\\u003c/em\\u003e. \\u003cem\\u003ePhytopathology\\u003c/em\\u003e, 99(10), 1190\\u0026ndash;1198. https://doi.org/10.1094/PHYTO-99-10-1190\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Hagemann, M. H., Born, U., Sprich, E., Seigner, L., Oechsner, H., H\\u0026uuml;lsemann, B., Steinbrenner, J., Winterhagen, P., \\u0026amp; Lehmair, E. (2021). Degradation of \\u003cem\\u003ehop latent viroid\\u003c/em\\u003e during anaerobic digestion of infected hop harvest residues. \\u003cem\\u003eEuropean Journal of Plant Pathology\\u003c/em\\u003e, 161(3), 579\\u0026ndash;591. https://doi.org/10.1007/s10658-021-02344-2\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Hagemann, M. H., Jagani, S., Sprich, E., \\u0026amp; Born, U. (2023a). Citrus exocortis viroid infection in hops (\\u003cem\\u003eHumulus lupulus\\u003c/em\\u003e L.). In Deutschen Phytomedizinischen Gesellschaft e.V. (Ed.), 63. Deutsche Pflanzenschutztagung, 626\\u0026ndash;627). G\\u0026ouml;ttingen: Julius K\\u0026uuml;hn-Institut. https://www.openagrar.de/servlets/MCRFileNodeServlet/openagrar_derivate_00055984/JKA_475_495.pdf Accessed at 21.01.2025.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Hagemann, M. H., Treiber, C., Born, U., Schrader, G., Stampfl, J., Jakše, J., \\u0026amp; Radišek, S. (2023b). Risk potential of international fruit trade for viroid spreading - case study on hop viroids in Europe. \\u003cem\\u003eJournal of Plant Pathology\\u003c/em\\u003e, 105(4), 1335\\u0026ndash;1346. https://doi.org/10.1007/s42161-023-01449-3\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Hagemann, M. H., Treiber, C., Sprich, E., Born, U., Lutz, K., Stampfl, J., \\u0026amp; Radišek, S. (2024). Composting and fermentation: mitigating \\u003cem\\u003ehop latent viroid\\u003c/em\\u003e infection risk in hop residues. \\u003cem\\u003eEuropean Journal of Plant Pathology\\u003c/em\\u003e, 1\\u0026ndash;16. https://doi.org/10.1007/s10658-024-02869-2\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Han, L., Li, G., Wang, X., Yu, B., Zhang, T., \\u0026amp; Cheng, Y. (2024). Characterization of volatile compounds from healthy and citrus black spot-infected Valencia orange juice and essential oil by using gas chromatography\\u0026ndash;mass spectrometry. \\u003cem\\u003eFood Chemistry\\u003c/em\\u003e: X, 22(April). https://doi.org/10.1016/j.fochx.2024.101374\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Hataya, T., Tsushima, T., \\u0026amp; Sano, T. (2017). Hop stunt viroid. \\u003cem\\u003eViroids and satellites\\u003c/em\\u003e. (pp. 199\\u0026ndash;210), \\u003cem\\u003eAcademic Press\\u003c/em\\u003e. https://doi.org/10.1016/B978-0-12-801498-1.00019-X\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Jagani, S., Pasha, A., Born, U., Sprich, E., Ziebell, H., \\u0026amp; Hagemann, M. H. (2023). Risk of hop viroids in citrus-based plant-strengthening products. Scientific-Technical Commission of the \\u003cem\\u003eInternational Hop Growers' Convention Conference Proceedings\\u003c/em\\u003e, Ljubljana, Slovenia, 66\\u0026ndash;69.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Jakše, J., Radišek, S., Pokorn, T., Matoušek, J., \\u0026amp; Javornik, B. (2015). Deep-sequencing revealed \\u003cem\\u003eCitrus bark cracking viroid\\u003c/em\\u003e (CBCVd) as a highly aggressive pathogen on hop. \\u003cem\\u003ePlant Pathology\\u003c/em\\u003e, 64(4), 831\\u0026ndash;842. https://doi.org/10.1111/ppa.12325\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Jimenez-Lopez, C., Carpena, M., Louren\\u0026ccedil;o-Lopes, C., Gallardo-Gomez, M., Lorenzo, J. M., Barba, F. J., Prieto, M. A., \\u0026amp; Simal-Gandara, J. (2020). Bioactive compounds and quality of extra virgin olive oil. Foods, 9(8), 1014. https://doi.org/10.3390/foods9081014\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Julius K\\u0026uuml;hn Institut. (2019). First finding of \\u003cem\\u003eCitrus bark cracking viroid\\u003c/em\\u003e (CBCVd) in Germany (Bavaria). Braunschweig, Germany.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Levy, L., \\u0026amp; Hadidi, A. (1993). Direct nucleotide sequence of PCR-amplified DNAs of the closely related \\u003cem\\u003eCitrus Viroids IIa\\u003c/em\\u003e and \\u003cem\\u003eIIb\\u003c/em\\u003e (Cachexia). \\u003cem\\u003eInternational Organization of Citrus Virologists Conference Proceedings\\u003c/em\\u003e, (1957\\u0026ndash;2010), 12(12). https://doi.org/10.5070/c53k23180k\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Lorenzana, A., Hermoso-de-Mendoza, A., Seco, M. V., \\u0026amp; Casquero, P. A. (2013). Population dynamics and integrated control of the damson-hop aphid \\u003cem\\u003ePhorodon humuli\\u003c/em\\u003e (Schrank) on hops in Spain. \\u003cem\\u003eSpanish Journal of Agricultural Research\\u003c/em\\u003e, 11(2), 505\\u0026ndash;517. https://doi.org/10.5424/sjar/2013112-2968\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Luigi, M., \\u0026amp; Faggioli, F. (2013). Development of a quantitative real-time RT-PCR (qRT-PCR) for the detection of \\u003cem\\u003ehop stunt viroid\\u003c/em\\u003e. \\u003cem\\u003eEuropean Journal of Plant Pathology\\u003c/em\\u003e, \\u003cem\\u003e137\\u003c/em\\u003e(2), 231\\u0026ndash;235. https://doi.org/10.1007/s10658-013-0243-2\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Manthey, J. A., \\u0026amp; Grohmann, K. (2001). Phenols in citrus peel by-products. Concentrations of hydroxycinnamates and polymethoxylated flavones in citrus peel molasses. \\u003cem\\u003eJournal of Agricultural and Food Chemistry\\u003c/em\\u003e, 49(7), 3268\\u0026ndash;3273. https://doi.org/10.1021/jf010011r\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Marquez-Molins, J., Gomez, G., \\u0026amp; Pallas, V. (2021). Hop stunt viroid: A polyphagous pathogenic RNA that has shed light on viroid\\u0026ndash;host interactions. \\u003cem\\u003eMolecular Plant Pathology\\u003c/em\\u003e, 22(2), 153\\u0026ndash;162. https://doi.org/10.1111/mpp.13022\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Mattheus, N., Ekramoddoullah, A. K., \\u0026amp; Lee, S. P. (2003). Isolation of high-quality RNA from white spruce tissue using a three‐stage purification method and subsequent cloning of a transcript from the PR‐10 gene family. \\u003cem\\u003ePhytochemical Analysis\\u003c/em\\u003e, 14(4), 209\\u0026ndash;215. https://doi.org/10.1002/pca.701\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Matoušek, Jaroslav, Trněn\\u0026aacute;, Ludmila, Svoboda, Petr, Oriniakov\\u0026aacute;, Pavla and Lichtenstein, Conrad P., (1995) The gradual reduction of viroid levels in hop mericlones following heat therapy: a possible role for a nuclease degrading dsRNA\\\" \\u003cem\\u003eBiological Chemistry\\u003c/em\\u003e, vol. 376\\u0026thinsp;\\u0026minus;\\u0026thinsp;12, pp. 715\\u0026ndash;722. https://doi.org/10.1515/bchm3.1995.376.12.715\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Menzel, W., Jelkmann, W., \\u0026amp; Maiss, E. (2002). Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. \\u003cem\\u003eJournal of Virological Methods\\u003c/em\\u003e, 99(1\\u0026ndash;2), 81\\u0026ndash;92. https://doi.org/10.1016/S0166-0934(01)00381-0\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Mercy, N. P. J., Nithyalakshmi, B., \\u0026amp; Aadhithiya, L. R. (2015). Extraction of orange oil by improved steam distillation and its characterization studies. \\u003cem\\u003eInternational Journal of Engineering Technology, Management and Applied Sciences\\u003c/em\\u003e, 3(2), 1\\u0026ndash;8.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Mishra, A. K., Kumar, A., Mishra, D., Nath, V. S., Jakše, J., Koc\\u0026aacute;bek, T., Killi, U. K., Morina, F., \\u0026amp; Matoušek, J. (2018). Genome-wide transcriptomic analysis reveals insights into the response to \\u003cem\\u003ecitrus bark cracking viroid\\u003c/em\\u003e (CBCVd) in hop (\\u003cem\\u003eHumulus lupulus\\u003c/em\\u003e L.). Viruses, 10(10), 1\\u0026ndash;19. https://doi.org/10.3390/v10100570\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Moufida, S., \\u0026amp; Marzouk, B. (2003). Biochemical characterization of blood orange, sweet orange, lemon, bergamot and bitter orange. \\u003cem\\u003ePhytochemistry\\u003c/em\\u003e, 62(8), 1283\\u0026ndash;1289. https://doi.org/10.1016/S0031-9422(02)00631-3\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Njoroge, S. M., Koaze, H., Karanja, P. N., \\u0026amp; Sawamura, M. (2005). Essential oil constituents of three varieties of Kenyan sweet oranges (\\u003cem\\u003eCitrus sinensis\\u003c/em\\u003e). \\u003cem\\u003eFlavour and Fragrance Journal\\u003c/em\\u003e, 20(1), 80\\u0026ndash;85. https://doi.org/10.1002/ffj.1377\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e OEPP/EPPO (1994) EPPO Standard PP 2/1(1) Guideline on good plant protection practice: principles of good plant protection practice. \\u003cem\\u003eBulletin OEPP/EPPO Bulletin\\u003c/em\\u003e \\u003cb\\u003e24\\u003c/b\\u003e, 233\\u0026ndash;240.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Patzak, J., Henychov\\u0026aacute;, A., Krofta, K., Svoboda, P., \\u0026amp; Mal\\u0026iacute;řov\\u0026aacute;, I. (2021). The influence of \\u003cem\\u003ehop latent viroid\\u003c/em\\u003e (HLVd) infection on gene expression and secondary metabolite contents in hop (\\u003cem\\u003eHumulus lupulus\\u003c/em\\u003e L.) glandular trichomes. \\u003cem\\u003ePlants\\u003c/em\\u003e, 10(11). https://doi.org/10.3390/plants10112297\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Pavlovič, M., Turk, J., \\u0026amp; Pavlovič, V. (2012). A review of the EU hop industry involvement within a beer brewing sector. \\u003cem\\u003eAgricultura (Slovenia)\\u003c/em\\u003e, 9(1), 17\\u0026ndash;22.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Puchta, H., Ramm, K., \\u0026amp; S\\u0026auml;nger, H. L. (1988). The molecular structure of \\u003cem\\u003ehop latent viroid\\u003c/em\\u003e (HLV), a new viroid occuring worldwide in hops. \\u003cem\\u003eNucleic Acids Research\\u003c/em\\u003e, 16, 4197\\u0026ndash;4216.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Puchta, H., Ramm, K., Luckinger, R., Hadas, R., Bar-Joseph, M., \\u0026amp; Snger, H. L. (1991). Primary and secondary structure of \\u003cem\\u003ecitrus viroid IV\\u003c/em\\u003e (CVd IV), a new chimeric viroid present in dwarfed grapefruit in Israel. \\u003cem\\u003eNucleic Acids Research\\u003c/em\\u003e, 19(23), 6640. https://doi.org/10.1093/nar/19.23.6640\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Radišek S \\u0026amp; Benko-Beloglavec A (2016) Pest risk analysis for \\u003cem\\u003eCitrus bark cracking viroid\\u003c/em\\u003e (CBCVd). Slovenian Institute of Hop Research and Brewing. \\u003cem\\u003eAdministration of the Republic of Slovenia for Food Safety, Veterinary Sector and Plant Protection\\u003c/em\\u003e. Available at https://gd.eppo.int/taxon/CBCVD0/documents\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Raieta, K., Muccillo, L., \\u0026amp; Colantuoni, V. (2015). A novel reliable method of DNA extraction from olive oil suitable for molecular traceability. \\u003cem\\u003eFood Chemistry\\u003c/em\\u003e, 172, 596\\u0026ndash;602. https://doi.org/10.1016/j.foodchem.2014.09.101\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Riesner, D., Steger, G., Schumacher, J., Gross, H. J., Randles, J. W., \\u0026amp; S\\u0026auml;nger, H. L. (1983). Structure and function of viroids. \\u003cem\\u003eBiophysics of structure and mechanism\\u003c/em\\u003e, 9, 145\\u0026ndash;170. https://doi.org/10.1007/BF00537813\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Ruggeri, R., Rossini, F., Roberto, S. R., Sato, A. J., Loussert, P., Rutto, L. K., \\u0026amp; Agehara, S. (2024). Development of hop cultivation in new growing areas: The state of the art and the way forward. \\u003cem\\u003eEuropean Journal of Agronomy\\u003c/em\\u003e, 127335. https://doi.org/10.1016/j.eja.2024.127335\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Salvatore, M. M., Nicoletti, R., \\u0026amp; Andolfi, A. (2022). Essential oils in citrus fruit ripening and postharvest quality. \\u003cem\\u003eHorticulturae\\u003c/em\\u003e, 8(5). https://doi.org/10.3390/horticulturae8050396\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Sano, T., Yoshida, H., Goshono, M., Monma, T., Kawasaki, H., \\u0026amp; Ishizaki, K. (2004). Characterization of a new viroid strain from hops: Evidence for viroid speciation by isolation in different host species. \\u003cem\\u003eJournal of General Plant Pathology\\u003c/em\\u003e, 70(3), 181\\u0026ndash;187. https://doi.org/10.1007/s10327-004-0105-z\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Sasi, S., Krishnan, S., Kodackattumannil, P., Shamisi, A. Al, Aldarmaki, M., Lekshmi, G., Kottackal, M., \\u0026amp; Amiri, K. M. A. (2023). DNA-free high-quality RNA extraction from 39 difficult-to-extract plant species (representing seasonal tissues and tissue types) of 32 families, and its validation for downstream molecular applications. \\u003cem\\u003ePlant Methods\\u003c/em\\u003e, 19(1), 113. https://doi.org/10.1186/s13007-023-01063-5\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Seigner, L., Liebrecht, M., Keckel, L., Einberger, K., \\u0026amp; Absmeier, C. (2020). Real-time RT-PCR detection of \\u003cem\\u003eCitrus bark cracking viroid\\u003c/em\\u003e (CBCVd) in hops including an mRNA-based internal positive control. \\u003cem\\u003eJournal of Plant Diseases and Protection\\u003c/em\\u003e, 127(6), 763\\u0026ndash;767. https://doi.org/10.1007/s41348-020-00317-x\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Sikdar, D. C., Menon, R., Duseja, K., Kumar, P., \\u0026amp; Swami, P. (2016). Extraction of citrus oil from orange \\u003cem\\u003e(Citrus sinensis)\\u003c/em\\u003e peels by steam distillation and its characterizations. \\u003cem\\u003eInternational Journal of Technical Research and Applications\\u003c/em\\u003e, 4(3), 341\\u0026ndash;346.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Šr\\u0026eacute;dl, K., Pr\\u0026aacute;šilov\\u0026aacute;, M., Svoboda, R., \\u0026amp; Severov\\u0026aacute;, L. (2020). Hop production in the Czech Republic and its international aspects. \\u003cem\\u003eHeliyon\\u003c/em\\u003e, 6(7). 10.1016/j.heliyon.2020.e04371\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Sreepian, A., Popruk, S., Nutalai, D., Phutthanu, C., \\u0026amp; Sreepian, P. M. (2022). Antibacterial activities and synergistic interaction of citrus essential oils and limonene with gentamicin against clinically isolated methicillin-resistant \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e. \\u003cem\\u003eScientific World Journal\\u003c/em\\u003e. https://doi.org/10.1155/2022/8418287\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Štajner, N., Radišek, S., Mishra, A. K., Nath, V. S., Matoušek, J., \\u0026amp; Jakše, J. (2019). Evaluation of disease severity and global transcriptome response induced by \\u003cem\\u003eCitrus bark cracking viroid\\u003c/em\\u003e, \\u003cem\\u003eHop latent viroid\\u003c/em\\u003e, and their co-infection in hop \\u003cem\\u003e(Humulus lupulus\\u003c/em\\u003e L.). International Journal of Molecular Sciences, 20(13). https://doi.org/10.3390/ijms20133154\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Teigiserova, D. A., Tiruta-Barna, L., Ahmadi, A., Hamelin, L., \\u0026amp; Thomsen, M. (2021). A step closer to circular bioeconomy for citrus peel waste: A review of yields and technologies for sustainable management of essential oils. \\u003cem\\u003eJournal of Environmental Management\\u003c/em\\u003e, 111832. https://doi.org/10.1016/j.jenvman.2020.111832\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Tran, K. N. T., Ngo, C. Q. T., Tran, B. L., To, P. M. N., Huynh, P. X., \\u0026amp; Pham, T. V. (2023). Hydrodistillation of essential oil from peels of orange \\u003cem\\u003e(Citrus sinensis)\\u003c/em\\u003e in the Mekong Delta, Vietnam: process optimization and chemical profiling. \\u003cem\\u003eFood Research\\u003c/em\\u003e, 7(6), 272\\u0026ndash;277. https://doi.org/10.26656/fr.2017.7(6).816\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Walker, P. J., Siddell, S. G., Lefkowitz, E. J., Mushegian, A. R., Adriaenssens, E. M., Alfenas-Zerbini, P., Davison, A. J., Dempsey, D. M., Dutilh, B. E., Garc\\u0026iacute;a, M. L., Harrach, B., Harrison, R. L., Hendrickson, R. C., Junglen, S., Knowles, N. J., Krupovic, M., Kuhn, J. H., Lambert, A. J., Łobocka, M., \\u0026hellip; Zerbini, F. M. (2021). Changes to virus taxonomy and to the International Code of Virus Classification and Nomenclature ratified by the International Committee on Taxonomy of Viruses (2021). \\u003cem\\u003eArchives of Virology\\u003c/em\\u003e, 166(9), 2633\\u0026ndash;2648. https://doi.org/10.1007/s00705-021-05156-1\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Weldon, W. A., Gent, D. H., \\u0026amp; Gadoury, D. M. (2021). Management of hop powdery mildew in the context of recent advances in pathogen ecology and population genetics. \\u003cem\\u003ePlant Health Progress\\u003c/em\\u003e, 22(4), 450\\u0026ndash;458. https://doi.org/10.1094/PHP-03-21-0065-SYN\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003e Wilstermann, A., Schrader, G., Pfeilstetter, E., Sch\\u0026auml;fer, B.C., \\u0026amp; Ziebell, H. (2020). Express PRA for Citrusbark cracking viroid. \\u003cem\\u003eJulius K\\u0026uuml;hn-Institute, Institute for national and international Plant Health\\u003c/em\\u003e. Available at https://pflanzengesundheit.julius-kuehn.de/citrus-bark-cracking-viroid.html Accessed at 21.01.2025.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"University of Hohenheim\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"citrus bark cracking viroid, hop stunt viroid, citrus exocortis viroid, reserve transcription quantitative PCR\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-5942812/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-5942812/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003ePlant-based agricultural products, such as citrus peel-derived oils, are gaining traction as sustainable alternatives to synthetic pesticides. However, concerns remain about the potential transmission of viroids, particularly Cocadviroid rimocitri (formerly CBCVd), through these products. CBCVd poses significant risks to hop cultivation, causing severe economic losses due to its pathogenicity. This study evaluates the risk of viroid transmission, examining CBCVd, Hostuviroid impedihumuli (HSVd), and Pospiviroid exocortiscitri (CEVd) through orange oil using RNA extraction and RT-qPCR analysis.\\u003c/p\\u003e \\u003cp\\u003eA detergent-based and a chaotropic RNA extraction protocol were tested, with the latter demonstrating superior performance in isolating RNA from orange oil-based formulations. Spiking experiments with CBCVd RNA confirmed consistent viroid detection in oil-RNA formulations. Notably, CBCVd and NAD were detectable in formulations with 90% RNA and 10% oil after seven days, suggesting RNA stability. However, viroids were undetectable in pure oil samples, indicating a low likelihood of integration during oil processing.\\u003c/p\\u003e \\u003cp\\u003eAdditionally, 32 orange peel samples were analyzed, revealing CBCVd in one and HSVd in seven fruit samples, but no viroid RNA or NAD was detected in the corresponding oils. These findings suggest that viroid transmission through orange oils is minimal. However, as orange oils are often formulated with water or surfactants, the hydrophilic nature of RNA may facilitate migration into aqueous phases, increasing transmission risk. Rigorous testing of raw materials and final products is recommended. This study establishes a critical framework for assessing viroid risks in citrus-based products for stringent phytosanitary controls.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Risk of hop viroids in citrus-based plant-strengthening products\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-02-04 09:44:52\",\"doi\":\"10.21203/rs.3.rs-5942812/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":1}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"28118664-be7b-4426-b004-5032267c3f77\",\"owner\":[],\"postedDate\":\"February 4th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":43713199,\"name\":\"Horticulture\"}],\"tags\":[],\"updatedAt\":\"2025-02-04T09:44:52+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-02-04 09:44:52\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-5942812\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-5942812\",\"identity\":\"rs-5942812\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}