{"paper_id":"37a82ff0-5420-47cc-8d4a-c8fe2c52c43b","body_text":"Study on the molecular mechanism of pod wall fiber formation using the bean pod fiber mutant (bfm) of Phaseolus vulgaris L | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Study on the molecular mechanism of pod wall fiber formation using the bean pod fiber mutant (bfm) of Phaseolus vulgaris L Kanhui Mo, Zhuang Sun, Guojun Feng, Dajun Liu, Taifeng Zhang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9156874/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Background and aims: Snap bean is a widely planted legume vegetable crop in the world, with tender pods as its edible organ. In the actual production process, excessive fiber content in bean pods can lead to a deterioration in their taste after cooking, seriously affecting their edible quality. In order to better study the mechanism of fiber formation in bean pod walls, we selected a bean pod fiber mutant ( bfm ) from the bean mutant library. Methods: Fiber content determination, cytological observation, transcriptome and metabolome analysis were performed on the pod walls of mutant bfm and its wild-type at different developmental stages. Key results: The results showed that the crude fiber content of the bfm pod wall tissue was significantly higher than that of the wild type during the mature commercial pod stage, and cellulose may be the main factor causing the increase in fiber content in the bean pod wall. During the mature commercial pod stage, the number of cells in the pod wall tissue of bfm increased significantly compared to the wild type, with an increase in phloem fibers and thicker cell walls. It is speculated that this situation led to changes in fiber content in the mutant bfm . The combined analysis of transcriptome and metabolome showed that differentially expressed genes and metabolites were enriched in metabolic pathways and secondary metabolite biosynthesis pathways. Metabolites such as glycine, L-glutamine, arabitol (D), and D-ribose were closely related to Phvul.007G077800 (CTL) and Phvul.003G089600 (KOR). Conclusions: These metabolites and genes mutually regulate and affect or promote precursor substances for cellulose synthesis, providing substrates and energy for cellulose synthesis, thereby promoting cellulose synthesis. This study provides theoretical research on the mechanism of fiber synthesis in bean pod walls, and also to provide some reference for bean breeding improvement and application practice. Phaseolus vulgaris L. mutant pod wall fiber transcriptome metabolome Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 1 INTRODUCTION Snap bean ( Phaseolus vulgaris L. ) has a delicious taste and rich nutrition, and is widely loved by people. The stitching and pod wall fiber content of bean pods are important traits that affect the quality of snap beans. Fiber in snap bean pod belongs to insoluble dietary fiber, namely crude fiber, which is one of the components of cell wall, mainly including cellulose, hemicellulose, lignin and other components. Cellulose is the most abundant component in plant cell walls, providing the mechanical strength required to resist swelling pressure, while also affecting the size, characteristics, and direction of cell growth and division, thus shaping the morphology of plants. The synthesis of cellulose is the most important biochemical process in plant cells, in which there is an important enzyme - cellulose synthase, including cellulose synthase (Ces) and cellulose like synthase (Csl). Current research indicates that a cellulose synthase gene family has evolved in higher plants, including multiple CesA genes, which are divided into PCW (primary cell wall) CesA group and SCW (secondary cell wall) CesA group. Ten CESA proteins have been identified in Arabidopsis, and CesA genes have also been identified in crops such as rice and bread wheat. In addition to cellulase, cellulase (Kor), sucrose synthase (SuSy), and other enzymes may also be involved in cellulose synthesis. Genes involved in starch and sucrose metabolism, as well as signal transduction, also play an important role in cellulose synthesis. Sucrose is the main form of carbohydrate transport in plants and an essential carbon source in the process of cellulose synthesis. Under the catalytic action of key enzymes such as sucrose synthase (SUS) and sucrose phosphate synthase (SPS), sucrose is broken down into glucose and fructose, which then participate in cellulose synthesis as precursor substances. Research has shown that the expression level of SUS genes is closely related to cellulose synthesis. The GhSUS2 gene in cotton exhibits high expression levels during the rapid fiber elongation stage, providing sufficient substrates for cellulose synthesis. In addition, UDP glucose (UDP Glc), as another important precursor for cellulose synthesis, is mainly synthesized through the breakdown of sucrose to produce glucose-1-phosphate (G1P), which is catalyzed by UDP glucose pyrophosphate (UGPase). In addition to UDP glucose, other sugar nucleotides such as GDP glucose and ADP glucose also participate in the synthesis of cell wall polysaccharides. These sugar nucleotides are catalyzed by enzymes such as Nucleotide Sugar Pyrophorase to provide substrates for the synthesis of cell wall polysaccharides.Plant chitinase (CTL), as a type of glycoside hydrolase, plays numerous regulatory roles in cell wall metabolism and plant disease resistance. (Wu et al. 2012 ). conducted in-depth phenotype analysis on the rice bc15 mutant and found that the gene mutation caused thinning of the thick walled cell wall and a significant decrease in cellulose content. Further research revealed that the mutant encodes a chitinase protein, BC15/OsCTL1, providing new clues for analyzing its possible molecular mechanisms in cellulose synthesis and cell wall remodeling pathways. In the study of bean fiber, (Parker et al. 2021 ). found in the anatomical analysis of developing pods that genetic changes leading to reduced cracking in dried bean pods may be related to changes in fiber composition or structure. The research results of (Rau et al. 2019 ). showed that in fiber free snap beans, the lignified wall fiber layer is usually absent. (Parker et al. 2021 ) observations under an electron microscope further confirmed this conclusion. At present, research on the fiber characteristics of snap bean pods only stays at the physiological level, and there is little research on the molecular mechanisms of pod fiber formation. This study screened a pod fiber mutant bfm from the mutant library. Exploring the reasons for the formation of fiber in the pod wall of snap beans through fiber content, cytological observation, and combined analysis of transcriptome and metabolome, providing basic materials for improving snap bean quality and breeding improvement. 2. MATERIALS AND METHODS 2.1 Materials The wild-type snap bean variety 'Jin Guan' is a high generation inbred line (from the Horticultural Team of Heilongjiang University, China). The bean pod fiber mutant ‘ bfm ’ is a stable genetic mutant strain obtained from dried seeds of 'Jinguan' through EMS mutagenesis treatment. There were no significant differences in plant height and branching between the mutant ‘ bfm ’ and the wild-type 'Jinguan', and the plant type development was basically consistent (Fig. 1 ). The bean pod hardness and brittleness of ‘ bfm ’ were both higher than those of 'Jinguan'. 2.2 Determination of Fiber Content in Pod Walls and Suture Tissues of Snap Bean The mutant ‘ bfm ’ and its wild-type 'Jin Guan' were planted in the greenhouse of the Horticultural Experimental Base at Hulan Campus of Heilongjiang University. Bean pods without diseases or pests and of uniform size were collected from ‘ bfm ’ and 'Jinguan' at 6, 10, 14, and 18 days after flowering, respectively. The pod walls and suture tissues of the besn pods were sampled separately, with three replicates set for each treatment. The treated pod walls and suture tissues were placed in an electric thermostatic oven set at 100°C for 30 minutes of blanching treatment, and then transferred to an 80°C electric thermostatic oven for continuous drying for 8–10 hours until constant weight for standby. The contents of crude fiber, cellulose, hemicellulose, and lignin were determined using an automatic fiber analyzer (ANKOM, USA). 2.3 Cytological Observation of Pod Wall Tissues Bean pods of ‘ bfm ’ and 'Jin Guan' at 6, 10, 14, and 18 days after flowering were collected as observation samples. A 2-cm section from the middle of each pod was taken, excluding the suture and seeds, with three biological replicates set. The sections were cut into approximately 0.5-cm segments and placed into vials containing FAA fixative. The tissues underwent a series of processing steps: fixation - dehydration - clearing - wax infiltration - embedding and sectioning - section spreading and mounting - staining - staining again - coverslipping - microscopic observation. 2.4 Transcriptome and Metabolome Sequencing Analysis The pod wall tissues of ‘ bfm ’ and 'Jinguan' at 6, 10, 14, and 18 days after flowering were used as experimental materials. Name the pod wall samples of mutant ‘ bfm ’ at 6, 10, 14, and 18 days after flowering as M1, M2, M3, and M4, respectively; The pod wall samples of wild-type 'Jin Guan' flowers at 6, 10, 14, and 18 days after flowering were named W1, W2, W3, and W4, respectively. For transcriptome analysis, three biological replicates were set with 0.5 g per replicate; for metabolome analysis, six biological replicates were set with 0.1 g per replicate. After sampling, the samples were quickly frozen in liquid nitrogen and then transferred to -80°C for storage.The samples were sent to Hangzhou Lianchuan Biotechnology Co., Ltd (Hangzhou, China) for sequencing. The pod wall samples of the wild-type 'Jinguan' at different developmental stages were named WT1, WT2, WT3, and WT4, respectively. The corresponding periods in the mutant ‘ bfm ’ pod wall samples are named M1, M2, M3, and M4. 2.5 Gene expression analysis by qRT-PCR The cDNA samples from the pod wall tissues of ‘ bfm ’ and 'Jinguan' at 6, 10, 14, and 18 days after flowering were obtained as described above, and specific primers for candidate genes were designed by Primer Premier 6.0 (Table 1 ). A MY17295272 fluorescence quantitative PCR instrument (Agilent Technologies Inc. CA., USA) was used for qPCR experiments. Actin was used as the internal reference gene, the 2 − ΔΔ CT method was used to calculate relative expression levels of genes (Wan et al. 2010 ), the least significant difference (LSD) test was used for single factor difference analysis, and GraphPad software ( https://www.graphpad.com/scientific-software/prism/ ) was used for mapping. The reaction system for qPCR was 10 µL of 2×Fast qPCR Mix, 0.4 µL of forward and reverse primer (10 µM), 2 µL of cDNA and 7.2 µL of DEPC-ddH 2 O. Thermal cycling included an initial denaturation at 95°C for 30 s, followed by 40 cycles at 95°C for 5 s and 60°C for 15 s. Three technical replicates and three biological replicates were performed. Table 1 Quantitative genes and primers for qRT-PCR Markers Forward (5’-3’) Reverse (5’-3’) Phvul.008G256800 ATGGAGATGGACACACAACCACATAAGA TTATTTGAAGGAAGCAACCAAAAGTGAATTACAGTC Phvul.002G048400 ATGATCGTGCTAAAATTCTCAAC CTTGAATGCACACACTCCTAG Phvul.004G019600 ATGGGGGGAGAGTGGTGGG TCATAGGAGTGAATGCGAAGCAA Phvul.010G083900 ATGGCGAATCCTCGATTTCCA TTAGATACCAAAATTGCATGCCTG Phvul.008G268900 ATGGCTTTAACTTTGTGTTACAT TCAAGAGATGTTGCATTCCGG Phvul.005G087400 ATGAATGCAGCTTCTTTGCACATAGCAA TTAGATTATATCACGAAGCTTGTGACAGAAAGCA Phvul.003G089600 ATGAGTATGTACGGTAGGGATCCGT TCATGGTTTCCATGGTGCAGGAGGT Phvul.007G077800 ATGGGCAAGAGCAAAAACTCTCGTG TCACACGCTTCCAATAATTGAAGCACT Actin GAAGTTCTCTTCCAACCATCC TTTCCTTGCTCATTCTGTCCG 3. RESULTS 3.1 Analysis of fiber content in pod wall and suture tissue of mutant and its wild type Determination of crude fiber, cellulose, hemicellulose, and lignin content in the pod walls and suture tissues of mutant ‘ bfm ’ and wild-type ‘Jin Guan’ at different developmental stages. The results showed that there was no significant difference in the content of various fiber components in the suture tissue of mutant ‘ bfm ’ compared to wild-type ‘Jin Guan’ (Fig. 2). While the crude fiber content of the mutant ‘ bfm ’ pod wall tissue gradually increased with pod development compared to the wild type, showing significant differences in pod wall tissue at 14 and 18 days after flowering (Fig. 3 ). The content of hemicellulose and lignin in pod wall tissue of ‘ bfm ’ pods is lower than that of wild-type ‘Jin Guan’ at all developmental stages of the pods. The content of cellulose in pod wall tissue of ‘ bfm ’ pods is not significantly different from that of ‘Jin Guan’ at 6–14 days after flowering, but is significantly higher than that of ‘Jin Guan’ at 18 days after flowering (commercial pod stage) (Fig. 3 ). Therefore, we speculate that the change in cellulose content of the pod wall is the main reason for the difference in fiber content between the pod fiber mutant ‘ bfm ’ and the ‘Jin Guan’ pod wall. Figure 2. Comparison of fiber content in suture tissues of ‘ bfm ’ and ‘Jin Guan’ pods *Significant difference (p < 0.05) 3.2 Cytological observation of pod wall tissue After observing the longitudinal sections of the pod wall tissues of mutant ‘ bfm ’ and wild-type 'Jin Guan' through paraffin sections (Fig. 4 ), it was found that cells of different sizes formed a circular structure, from the outside to the inside, consisting of palisade tissue, thin-walled cell layer, cork layer, thick walled cell layer, and thin-walled cell layer. As the pod wall develops, the thin-walled cell layer becomes lignified and thickened into thick walled cells with small or no intercellular gaps, while the innermost thin-walled cell layer is tightly arranged and the intercellular gaps are relatively tight. As the mutant ‘ bfm ’ pods grow and develop, the number of cells increases significantly compared to 'Jin Guan', the number of phloem fibers increases, the cell wall thickens, the intercellular space shortens, and the cell density decreases, resulting in highly fibrotic tissue. It is speculated that this situation is the cause of the change in ‘ bfm ’ fiber content. 3.3 Transcriptome analysis of pod wall tissue at different developmental stages between wild-type and mutant 3.3.1 Illumina Sequencing, DEG Analysis, Funtional Annotation and Classification In this study, we constructed 24 independent sequencing libraries. After Illumina sequencing, a total of 940164398 readings were generated (Supplementary Table 1). To ensure the accuracy of subsequent analysis, quality control analysis is performed on the raw data. Align clean reads to the reference genome of snap beans ( https://phytozome-next.jgi.doe.gov/ ). The comparison rate of each sample exceeds 94%, and the sequencing data quality is good, providing good data support for subsequent experimental research. Compare the sequencing data of the processing group (mutant ‘ bfm ’) and the control group (wild-type 'Jin Guan') at four different stages pairwise to analyze differentially expressed genes. The results showed that there were a total of 500 DEGs in W1 vs. M1, 5640 DEGs in W2 vs., 2713 DEGs in W3 vs. M3, 514 DEGs in W4 vs. M4. Through Veen plot analysis, we found that there were a total of 18 DEGs in the four periods of W1vsM1, W2vsM2, W3vsM3, and W4vsM4 (Supplementary Fig. 1). Perform GO and KEGG clustering analysis on DEGs in different comparison groups. According to the GO annotation results, it was found that differentially expressed genes were mainly enriched in molecular functions such as hydrolase, pectinase, oxidoreductase, transferase activity, cell wall tissue, and carbohydrate metabolism processes (Supplementary Table 2). This indicates that genes related to cellulose synthesis mainly regulate or affect cellulose synthesis by participating in processes such as cell wall, sugar metabolism, enzyme activity, and biosynthesis of plant secondary metabolites. According to the KEGG annotation results of four comparison groups, it was found that genes related to cellulose synthesis were significantly enriched in secondary metabolite biosynthesis, metabolic pathways, starch and sucrose metabolism, and plant hormone signal transduction, indicating that cellulose synthesis is related to these metabolic pathways (Supplementary Fig. 2). 3.3.2 Analysis of cellulose synthesis related genes Physiological data indicate that the difference in cellulose content between the pod fiber mutant ‘ bfm ’ and 'Jin Guan' gradually becomes significant with pod development. The cellulose content in the pod wall of ‘ bfm ’ after 18 days of flowering was significantly higher than that of 'Jin Guan'. We analyzed that this may be due to changes in the expression of certain genes during the development of pod wall tissue, which affects the biosynthesis of cellulose in the pod wall tissue. In order to clarify the relationship between changes in the content of cellulose synthesis intermediates and gene regulation expression during the growth and development of snap beans, we studied the expression changes of related genes in the cellulose synthesis pathway during different stages of pod development. Five genes encoding cellulose synthase were found in four periods (Table 2 ). The expression levels of four genes, Phvul.002G040200, Phvul.002G136300, Phvul.006G08400, and Phvul.007G081700, were higher in ‘ bfm ’ than in 'Jin Guan' as the pods developed. The overall trend of cumulative changes in cellulose content determined in the previous stage is consistent, indicating that changes in the expression of cellulose synthase related genes may be related to the ‘ bfm ’ mutation trait. Table 2 Cellulose synthase differentially expressed gene Gene_ID Pathway W1vsM1 log2(fc) W2vsM2 log2(fc) W3vsM3 log2(fc) W4vsM4 log2(fc) Description Phvul.006G058400 GO:0016760 0.02 2.39 0.42 2.36 Cellulose synthase-like protein E1 Phvul.007G081700 / -0.53 0.56 0.62 0.01 Cellulose synthase Phvul.009G242700 GO:0071555 GO:0030244 GO:0016760 0.33 -0.81 -1.98 -0.04 Cellulose synthase A Catalytic Subunit 7 (UDP-forming) Phvul.002G040200 GO:0071555 GO:0030244 GO:0016760 -0.18 0.01 1.08 0.28 Cellulose synthase-like protein D3 Phvul.002G136300 GO:0071555 GO:0016760 -0.9 2.11 1.18 1.14 Cellulose synthase (UDP-forming) Through KEGG enrichment analysis, 25 differentially expressed genes related to cellulose synthesis were screened for metabolic pathways, starch and sucrose metabolic pathways, secondary metabolite biosynthesis pathways (Table 3 ). Compared with the wild-type 'Jin Guan', the mutant ' bfm ' showed no significant changes in the expression levels of these 25 genes in the pod wall of 6–10 days after flowering, which is consistent with the physiological data measured earlier that showed no significant difference in crude fiber content during these two periods. 14 days after flowering, three genes, Phvul.003G089600, Phvul.007G077800, and Phvul.007G218400, were significantly upregulated in the mutant ' bfm '. Phvul.003G089600 and Phvul.007G077800 were significantly upregulated in the mutant ' bfm ' in the pod wall of 18 days after flowering. In summary, during the period of 14–18 days after flowering, which is the formation period of commercial pods in snap beans, two genes Phvul.003G089600 (KOR) and Phvul.007G077800 (CTL) consistently showed significant upregulation in the mutant ' bfm '. KOR and CTL are glycoside hydrolases that play important roles in cell wall synthesis metabolism and cellulose synthesis. Therefore, it is speculated that changes in the expression of these two genes affect or promote precursor substances for cellulose synthesis, leading to changes in cellulose content. Table 3 6 Analysis of expression levels of 25 genes Gene_ID Pathway W1vsM1 log2(fc) W2vsM2 log2(fc) W3vsM3 log2(fc) W4vsM4 log2(fc) Description Phvul.001G209600 pvu01100 1.11 1.90 -0.28 0.22 SUCROSE SYNTHASE 5 Phvul.009G114700 pvu01110 pvu01100 0.95 0.99 0.68 0.44 Sucrose transport protein SUC4 Phvul.003G089600 pvu01100 pvu00500 -0.02 -0.61 7.83 2.13 ENDOGLUCANASE 21 Phvul.006G0049001 / 8.56 -0.56 1.04 -0.10 Endoglucanase 7 Phvul.009G135900 / -0.16 11.42 -2.62 -0.25 Endoglucanase 25 Phvul.006G133700 / -0.16 -0.21 -0.06 -0.56 Endoglucanase 25 Phvul.007G218400 pvu01100 pvu00500 -0.89 0.21 2.65 0.93 Endoglucanase 1 Phvul.009G254400 pvu01100 pvu00520 0.60 0.81 -1.86 -0.79 Chitinase-like protein 2 Phvul.008G018100 / -0.02 -0.75 0.22 0.26 Chitinase-like protein 2 Phvul.007G077800 pvu01100 pvu00520 -4.22 6.55 3.56 12.55 Chitinase Phvul.011G167000 pvu01100 pvu00520 -0.47 -1.29 1.69 1.28 Chitinase3 Phvul.005G155800 pvu01100 pvu00520 -0.88 6.30 1.40 0.58 CHITINASE-RELATED Phvul.009G116700 pvu00520 2.12 5.46 -3.54 -0.94 BASIC ENDOCHITINASE B Phvul.003G158800 pvu01100 -0.70 11.10 0.11 -1.24 Chitinase Phvul.004G041300 pvu01110 -0.15 -1.34 1.70 0.50 COBRA-like protein Phvul.009G203100 pvu01110 pvu01100 -0.01 -1.61 0.49 -0.06 COBRA-like protein Phvul.008G029100 pvu01110 0.27 -0.98 0.44 -0.23 COBRA-like protein Phvul.008G029200 pvu01110 pvu01100 -0.14 0.65 1.07 -0.08 COBRA-like protein Phvul.002G075200 pvu01110 pvu01100 -1.13 3.05 -3.68 0.48 UDP-glycosyltransferase 74B1 Phvul.008G208400 pvu01100 -0.17 -0.27 0.96 -1.76 UDP-glycosyltransferase 92A1 Phvul.008G29100 pvu01100 -1.09 0.80 -2.11 -1.61 UDP-glycosyltransferase 82A1 Phvul.006G087300 pvu01110 pvu01100 0.18 0.42 1.37 -7.86 SUCROSE SYNTHASE 5 Phvul.004G142800 pvu01100 pvu00500 0.42 0.33 0.29 -2.32 SUCROSE SYNTHASE 5 Phvul.008G241300 pvu01100 pvu00500 0.00 0.06 0.23 -2.10 SUCROSE SYNTHASE 5 Phvul.009G250800 pvu01100 pvu00500 0.00 0.00 -1.36 -7.48 SUCROSE SYNTHASE 5 3.3.3 qRT-PCR validation To verify the accuracy of RNA-seq sequencing results, 6 DEGs were randomly selected Phvul.008G132200、Phvul.003G147700、Phvul.002G048400、Phvul.008G290300、Phvul.004G019600 and Phvul.005G155800 perform real-time fluorescence quantitative PCR validation. The qRT-PCR results showed that the expression levels of six genes showed the same trend as RNA-seq, indicating that RNA-seq sequencing data has good quality. 3.4 Metabolomic Analysis of Pod Wall Tissues at Different Developmental Stages between Wild-Type and Mutant 3.4.1 Principal component analysis To validate differences between samples, correlation analysis and principal component analysis (PCA) were performed on the collected samples from two varieties across four growth stages. Correlation analysis revealed that the two principal components (PC1 and PC2) accounted for 31.72% and 94.8% of the variance, respectively. PCA results indicated that samples within each group clustered closely, while samples from different groups showed clear. 3.4.2 differential metabolites analysis In this study, to identify significantly accumulated metabolites across different comparison groups, we screened for differential metabolites in four comparison sets: W1 vs M1, W2 vs M2, W3 vs M3, and W4 vs M4. A total of 1,030 differential metabolites were identified. Among the four comparison groups (W1 vs M1, W2 vs M2, W3 vs M3, W4 vs M4), 29 differentially expressed metabolites were common across all groups. Key differentially expressed metabolites included amino acids and their derivatives, phenolic acids, nucleotides and their derivatives, trehalose, D-glucose, α-glucose, D-arabinitol, D-ribose, quinic acid, quercetin, corticosterone, caffeic acid, flavonoids, quinones, lignan alkaloids, terpenoids, organic acids, and lipids. Changes in the content of these metabolites are presumed to have caused differences in cellulose content between ‘ bfm ’ and ‘Jin guang’. KEGG analysis indicated significant enrichment in metabolic pathways (ko01100), starch and sucrose metabolism (ko00500), and biosynthesis of plant secondary metabolites (ko011060) during the comparison of the four periods. 3.5 Integrated Analysis of Transcriptome and Metabolome To elucidate the correlation between cellulose-related differentially expressed genes and metabolites, KEGG pathway enrichment analysis was performed on the differentially expressed genes and metabolites identified across the four stages (W1vsM1, W2vsM2, W3vsM3, and W4vsM4). This revealed information about metabolic pathways jointly involved in both groups, with metabolic pathways and secondary metabolite biosynthesis pathways emerging as particularly significant pathways. 3.5.1Regulatory Network of Metabolic Pathways Metabolic pathways are crucial for plant growth and development, and they synergistically influence the synthesis of cellulose, the primary component of plant cell walls. Amino acids such as glycine and serine can indirectly affect cellulose synthesis by regulating cell wall structure and the expression of endoglucanases and chitinases. D-ribose can regulate the gene expression of these two enzymes through energy and sugar metabolism, thereby influencing cellulose synthesis. Although D-arabinose does not directly participate in cellulose synthesis, it can indirectly affect cellulose deposition by regulating carbon source allocation to support precursor formation, influencing related enzyme gene expression, or controlling hemicellulose and lignin synthesis. Within this metabolic pathway, metabolites associated with cellulose synthesis or its regulation were identified: 4-hydroxycinnamic acid, serine, glycine, L-glutamine, arabitol (D), D-ribose, etc. These metabolites were linked to differentially expressed genes Phvul.003G089600 (KOR) , Phvul.005G155800 (CHI4) , Phvul.007G077800 (CTL) , and Phvul.011G167000 (CHIT3). Except for 4-hydroxycinnamic acid, which exhibits negative regulation with other genes, the remaining metabolites all show positive regulation with these genes. 3.5.2 Regulatory Network of Secondary Metabolite Biosynthetic Pathways The biosynthetic pathways of secondary metabolites are crucial for cellulose synthesis. L-alanine may indirectly regulate sucrase gene expression and glycosyltransferase activity by influencing nitrogen metabolism and energy supply through its association with carbohydrate metabolism, while glycine may do so by participating in cell wall protein synthesis. The Flavonoid secondary metabolite delphinidin-3-glucoside indirectly influences cellulose synthesis by regulating enzyme gene expression through antioxidant effects, secondary metabolism control, and stress response modulation. In this pathway, metabolites associated with cellulose synthesis or its regulation—L-alanine, glycine, and apigenin-3-glucoside—exhibit positive correlations with genes Phvul.002G075200 (UGT74B1) and Phvul.006G087300 (SUS5). 3.5.3 Key Gene Screening Through integrated transcriptomic and metabolomic analysis, we identified eight differentially expressed metabolites in the metabolic pathways and secondary metabolic biosynthetic pathways, including 4-hydroxycinnamic acid, serine, glycine, L-glutamine, L-alanine, D-arabinitol, D-ribose, and Delphinidin 3-glucoside were associated with Phvul.003G089600 (KOR) , Phvul.005G155800 (CHI4), Phvul.007G077800 (CTL), Phvul.011G167000 (CHIT3), Phvul.002G075200 (UGT74B1) , and Phvul.006G087300 (SUS5). Among these, Phvul.003G089600 (KOR) and Phvul.007G077800 (CTL) showed significant correlations with other metabolites. Both genes exhibited consistently significant upregulation during the commercial pod stage (14–18 days after flowering). These genes encode endoglucanase (KOR) and chitinase (CTL), respectively. Both belong to the glycoside hydrolase family. While they do not directly synthesize sugars or cellulose, they degrade complex polysaccharides into reusable sugar units. These units are then converted into UDP-glucose (a precursor for cellulose synthesis) via glycolysis or gluconeogenesis, thereby indirectly influencing or promoting cellulose synthesis. Therefore, it is inferred that the genes Phvul.003G089600 (KOR) and Phvul.007G077800 (CTL) are associated with the phenotypic traits of the pod fiber mutant. 3.5.4 qRT-PCR Validation of Candidate Genes for Cellulose Synthesis To verify whether the differential expression patterns of the two genes Phvul.003G089600 (KOR) and Phvul.007G077800 (CTL) align with the cellulose content trend during ‘ bfm ’ growth and development, we performed real-time quantitative PCR analysis (Fig. 11 ). Results revealed significant differences in both genes during the 14–18 days post-flowering (commercial pod stage) period, consistent with the cellulose content trend observed during ‘ bfm ’ growth and development. This suggests an association with the phenotypic differences in the pod fiber mutant ‘ bfm ’. 4 DISCUSSION The causes of plant tissue fibrosis vary across different crops. Previous studies have shown that quality deterioration in fruits such as pears (Cai et al. 2010 ) and citrus (Wu et al. 2014 ; Liu et al. 2022 ) is closely linked to increased lignin synthesis and deposition. Similarly, post-harvest fibrosis in asparagus (Hennion et al. 1992 ) and bamboo shoots (Luo et al. 2008 )is primarily attributed to elevated lignin content. However, fiber composition analysis of the mutant bfm and the wild-type ‘Golden Crown’ in this study revealed no significant differences in hemicellulose or lignin content between the two. Conversely, the cellulose content in bfm was significantly higher than that in the wild-type during the marketable pod stage, and this change was consistent with an increase in crude fiber content. This result indicates that the fibrillation phenotype in the fiber wall mutant of common bean is not dominated by lignin but rather caused by abnormal accumulation of cellulose content, consistent with the findings of (Murgia et al. 2017 ) research. The reason for this discrepancy may be closely related to the specificity of the study material. As a crop whose edible organ is the tender pod, common bean is more sensitive to the impact of cellulose content on texture, and its fibrillation regulatory mechanism may be more inclined toward regulating cellulose metabolism. Furthermore, transcriptomic analysis revealed that differentially expressed genes were predominantly enriched in metabolic pathways related to cellulose synthesis, starch and sucrose metabolism, rather than the phenylpropanoid pathway critical for lignin synthesis. This molecular evidence further substantiates the pivotal role of cellulose in the bfm mutant phenotype. Through transcriptomic and metabolomic analysis, this study identified two core regulatory genes— Phvul.003G089600 (KOR) and Phvul.007G077800 (CTL) . Both genes exhibited sustained significant upregulation during the commercial pod formation stage (14–18 days after flowering) and encode glycoside hydrolase family proteins. Previous studies have confirmed that the endo-β-1,4-glucanase encoded by the KOR gene is an essential protein for cellulose biosynthesis and cell wall assembly. It promotes cellulose polymer synthesis and recycling by cleaving glucan primers. (Mølhøj et al. 2001 ) research using Arabidopsis revealed KOR gene involvement in cell wall assembly throughout the entire plant. (von Schaewen et al. 2015 ) research revealed that KOR genes play a central role in maintaining cellulose biosynthesis in both primary and secondary cell walls. Chitinase-like proteins encoded by CTL genes play crucial roles in plant cell wall structural organization and cellulose deposition. Their homologs in cotton and Arabidopsis have been confirmed to participate in secondary cell wall cellulose synthesis (Kwon et al. 2005 ). demonstrated that chitinases may contribute to cell wall structural organization and potentially function in Arabidopsis (A. thaliana) active defense systems. For instance, (Zhang et al. 2004 ). reported that two homologous cotton chitinase-like proteins (GhCTL1 and GhCTL2) are preferentially expressed during secondary cell wall deposition in cotton fiber cells and are responsible for cellulose biosynthesis during primary and secondary cell wall formation in Arabidopsis vascular tissues. (Aktar Hossain et al. 2010 ). demonstrated that AtCTL2 is essential for proper cell wall biosynthesis in Arabidopsis seedlings using a mutant of the chitinase-like protein-encoding gene AtCTL2. In this study, the abnormal upregulation of these two genes may synergistically regulate the production and conversion of cellulose synthesis precursors through changes in the levels of metabolites such as glycine and D-ribose. This ultimately leads to abnormal accumulation of pod wall cellulose, acting as a key molecular switch driving the fibrillation phenotype. 5 CONCLUSIONS This study demonstrates that the fiber mutant ‘ bfm ’ in common bean pods exhibits significantly higher fiber content than the wild type during the commercial maturity stage. Cellulose appears to be the primary factor contributing to pod wall thickening. Integrated transcriptomic and metabolomic analyses reveal that differentially expressed genes and metabolites are predominantly enriched in metabolic pathways and secondary metabolite biosynthesis pathways. These include amino acids and their derivatives, arabitol (D), D-ribose, apigenin 3-glucoside, and carbohydrates, closely associated with Phvul.007G077800 (CTL) and Phvul.003G089600 (KOR) . These metabolites and genes indirectly influence or regulate precursors involved in cellulose synthesis, providing essential substrates and energy to promote cellulose formation. Additionally, we investigated the key CTL and KOR genes within the cellulose synthesis regulatory network, briefly elucidating their crucial roles and establishing a theoretical foundation for future studies on the regulation of pod wall cellulose synthesis in Phaseolus vulgaris. In summary, this study confirms that the high cellulose content trait in the bean pod fiber mutant ‘ bfm ’ is not regulated by a single gene or metabolite, but rather results from the synergistic action of a complex regulatory network. These findings provide key candidate genes and metabolic markers for molecular breeding of this fiber bean pod variety. Declarations ETHICS APPROVAL AND CONSENT TO PARTICIPATE Ethical approval was not required as the study used only secondary data from publicly available, de-identified sources. CONSENT FOR PUBLICATION All authors have read and agreed to the submission and publication of this paper.The content of the paper represents original research results, with no plagiarism, no fabrication, and no duplicate submission.There is no infringement of others' intellectual property rights, no confidential content, and no conflicts of interest.All authors agree to submit this paper to BMC Plant Biology for publication and to comply with the relevant publication regulations of the journal. FUNDING This work was supported by the Heilongjiang Provincial Undergraduate Universitis’ “Support Program for Outstanding Young Facully in Basic Research” “Cloning and Functional Validation of the Candidate Gene pv-bfm , a Mutation Gene Encoding Sanp Bean Pod Fiber”(grant number YQJH2024198), the Basic Research Fund of the Provincial Department of Education, “Localization, Cloning, and Functional Analysis of Major Genes Regulating Fiber Coutent in Snap Bean Pod Walls”(grant number 2024-KYYWF-0110), and the Heilongjiang Provincial Natural Science Foundation Project \"Construction of the Regulatory Network of Phaseolus vulgaris Lectin and Breeding of New Varieties\", (grant number YQ2024C046). Author Contribution Kanhui Mo: Writing-Original Draft, Writing-Review & Editing, Visualization.Zhuang Sun: Investigation, Date Curation.Guojun Feng, Zhishan Yan: Resources, Supervision.Dajun Liu, Taifeng Zhang: Resources, Software.Xiaoxu Yang*, Chang Liu*( corresponding author ): Project administration. Acknowledgement We thank all the researchers, colleagues and mentors who have participated in this work, and thank them for their support and assistance. Data Availability The raw RNA-seq data generated in this study have been submitted to the NCBI Gene Expression Omnibus (GEO) database under submission ID 2251963@orcid. The submission is currently under review by GEO, and the official accession number will be provided once the review is completed. All data will be made publicly available upon publication. References Wu B, Zhang B, Dai Y, Zhang L, Shang-Guan K, Peng Y, Zhou Y, Zhu Z. Brittle culm15 encodes a membrane-associated chitinase-like protein required for cellulose biosynthesis in rice. Plant Physiol. 2012;159(4):1440–52. Parker TA, Lo S, Gepts P. Pod shattering in grain legumes: emerging genetic and environment-related patterns. Plant Cell. 2021;33(2):179–99. 10.1093/plcell/koaa025 . Rau D, Murgia ML, Rodriguez M, Bitocchi E, Bellucci E, Fois D, Albani D, Nanni L, Gioia T, Santo D, et al. Genomic dissection of pod shattering in common bean: mutations at non-orthologous loci at the basis of convergent phenotypic evolution under domestication of leguminous species. Plant J. 2019;97(4):693–714. 10.1111/tpj.14155 . Wan H, Zhao Z, Qian C, Sui Y, Malik AA, Chen J. Selection of appropriate reference genes for gene expression studies by quantitative real-time polymerase chain reaction in cucumber. Anal Biochem. 2010;399(2):257–61. Cai Y, Li G, Nie J, Lin Y, Nie F, Zhang J, Xu Y. Study of the structure and biosynthetic pathway of lignin in stone cells of pear. Sci Hort. 2010;125(3):374–9. 10.1016/j.scienta.2010.04.029 . Wu J-L, Pan T-F, Guo Z-X, Pan D-M. Specific Lignin Accumulation in Granulated Juice Sacs of Citrus maxima . J Agric Food Chem. 2014;62(50):12082–9. 10.1021/jf5041349 . Liu X, Zhang H, Zhang W, Xu W, Li S, Chen X, Chen H. Genome-wide bioinformatics analysis of Cellulose Synthase gene family in common bean (Phaseolus vulgaris L.) and the expression in the pod development. BMC Genomic Data. 2022;23(1). 10.1186/s12863-022-01026-0 . Hennion S, Anthony Little CH, Hartmann C. Activities of enzymes involved in lignification during the postharvest storage of etiolated asparagus spears. Physiol Plant. 1992;86(3):474–8. 10.1111/j.1399-3054.1992.tb01346.x . Luo Z, Xu X, Yan B. Accumulation of lignin and involvement of enzymes in bamboo shoot during storage. Eur Food Res Technol. 2008;226(4):635–40. 10.1007/s00217-007-0595-y . Murgia ML, Attene G, Rodriguez M, Bitocchi E, Bellucci E, Fois D, Nanni L, Gioia T, Albani DM, Papa R. A comprehensive phenotypic investigation of the pod-shattering syndrome in common bean. Front Plant Sci. 2017;8:251. Mølhøj M, Jørgensen B, Ulvskov P, Borkhardt B. Two Arabidopsis thaliana genes, KOR2 and KOR3, which encode membrane-anchored endo-1,4-β-D-glucanases, are differentially expressed in developing leaf trichomes and their support cells. Plant Mol Biol. 2001;46(3):263–75. 10.1023/A:1010688726755 . von Schaewen A, Rips S, Jeong IS, Koiwa H. Arabidopsis thaliana KORRIGAN1 protein: N-glycan modification, localization, and function in cellulose biosynthesis and osmotic stress responses. Plant Signal Behav. 2015;10(5):e1024397. 10.1080/15592324.2015.1024397 . Kwon H-K, Yokoyama R, Nishitani K. A Proteomic Approach to Apoplastic Proteins Involved in Cell Wall Regeneration in Protoplasts of Arabidopsis Suspension-cultured Cells. Plant Cell Physiol. 2005;46(6):843–57. 10.1093/pcp/pci089 . Zhang D, Hrmova M, Wan C-H, Wu C, Balzen J, Cai W, Wang J, Densmore LD, Fincher GB, Zhang H, et al. Members of a New Group of Chitinase-Like Genes are Expressed Preferentially in Cotton Cells with Secondary Walls. Plant Mol Biol. 2004;54(3):353–72. 10.1023/B:PLAN.0000036369.55253.dd . Aktar Hossain M, Noh H-N, Kim K-I, Koh E-J, Wi S-G, Bae H-J, Lee H, Hong S-W. Mutation of the chitinase-like protein-encoding AtCTL2 gene enhances lignin accumulation in dark-grown Arabidopsis seedlings. J Plant Physiol. 2010;167(8):650–8. 10.1016/j.jplph.2009.12.001 . Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 16 May, 2026 Reviewers agreed at journal 10 Apr, 2026 Reviews received at journal 08 Apr, 2026 Reviewers agreed at journal 08 Apr, 2026 Reviewers invited by journal 07 Apr, 2026 Editor invited by journal 06 Apr, 2026 Editor assigned by journal 02 Apr, 2026 Submission checks completed at journal 02 Apr, 2026 First submitted to journal 02 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-9156874\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":621032122,\"identity\":\"c179cd0d-b864-48c5-b7fb-2847096fc2ee\",\"order_by\":0,\"name\":\"Kanhui Mo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Heilongjiang University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Kanhui\",\"middleName\":\"\",\"lastName\":\"Mo\",\"suffix\":\"\"},{\"id\":621032124,\"identity\":\"fa520480-a6b1-4414-9c5c-db72c360da3b\",\"order_by\":1,\"name\":\"Zhuang Sun\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Heilongjiang University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zhuang\",\"middleName\":\"\",\"lastName\":\"Sun\",\"suffix\":\"\"},{\"id\":621032126,\"identity\":\"20331f5e-92bd-478e-b9c1-52559038bb14\",\"order_by\":2,\"name\":\"Guojun Feng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Heilongjiang University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Guojun\",\"middleName\":\"\",\"lastName\":\"Feng\",\"suffix\":\"\"},{\"id\":621032128,\"identity\":\"013584d0-e441-422a-977b-ae81c70d0297\",\"order_by\":3,\"name\":\"Dajun Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Heilongjiang University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dajun\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":621032129,\"identity\":\"e6363f00-0f86-4800-a968-8136e0b4f0f0\",\"order_by\":4,\"name\":\"Taifeng Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Heilongjiang University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Taifeng\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":621032130,\"identity\":\"e96b0463-fb69-445e-986a-8d60bed27e74\",\"order_by\":5,\"name\":\"Zhishan Yan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Heilongjiang University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zhishan\",\"middleName\":\"\",\"lastName\":\"Yan\",\"suffix\":\"\"},{\"id\":621032131,\"identity\":\"06ba528b-8d0d-4363-ac95-4f6920dba005\",\"order_by\":6,\"name\":\"Xiaoxu Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Heilongjiang University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaoxu\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":621032132,\"identity\":\"a62a9fd5-6c7d-4155-8114-c05669b91309\",\"order_by\":7,\"name\":\"Chang Liu\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxklEQVRIiWNgGAWjYBACPgY2BoaECgk5fmbmgw+I0sIG0vLhjI2xZDtbsgHRWhhntqUlbjjPYyZAnBb2Y2nSvG2HEzcfZjBjYKixiSashSftmDTPucPG2w4zpD1gOJaW20BQiwR7mzRP2WFZoJbjBowNh4nVwnaYcXMzY5sEkVrYjknOaEtT3MDMzEakFp60ZAtQIEscZmM2SCDGL/zsxwxvgKOy//zHBx9qbAhrAQIWCTgzgQjlIMD8gUiFo2AUjIJRMFIBAM6ZOvBUrjvsAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Heilongjiang University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Chang\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2026-03-18 08:53:11\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-9156874/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-9156874/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":107018724,\"identity\":\"9b0923d1-0b13-4db1-a85a-1c176fc505c0\",\"added_by\":\"auto\",\"created_at\":\"2026-04-15 20:38:55\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":611355,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePhotos of mutant ‘\\u003cem\\u003ebfm\\u003c/em\\u003e’ and its wild-type 'Jin Guan' plants. A is the wild-type 'Jinguan', B is the mutant ‘\\u003cem\\u003ebfm\\u003c/em\\u003e’.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9156874/v1/144390210624de2277938529.png\"},{\"id\":107018754,\"identity\":\"56c6b2bc-2a2a-48f5-b662-d4617f161cb2\",\"added_by\":\"auto\",\"created_at\":\"2026-04-15 20:39:06\",\"extension\":\"jpeg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":137659,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eComparison of fiber content in suture tissues of ‘\\u003cem\\u003ebfm\\u003c/em\\u003e’ and ‘Jin Guan’ pods\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9156874/v1/46dbdc831dca35de1157a85a.jpeg\"},{\"id\":107018807,\"identity\":\"c9a2504f-0115-46b2-bd11-775e0430e136\",\"added_by\":\"auto\",\"created_at\":\"2026-04-15 20:39:15\",\"extension\":\"jpeg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":63711,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eComparison of fiber content in pod wall of ‘\\u003cem\\u003ebfm\\u003c/em\\u003e’ \\u0026nbsp;and ‘Jin Guan’ pods\\u003c/p\\u003e\\n\\u003cp\\u003e*Significant difference (p\\u0026lt;0.05)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9156874/v1/6065e6111e8de752690197d9.jpeg\"},{\"id\":107018753,\"identity\":\"177eab86-b709-42c9-8bdd-292d432be098\",\"added_by\":\"auto\",\"created_at\":\"2026-04-15 20:39:06\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":918289,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eObservation of longitudinal sections of pod wall tissues of the mutant '\\u003cem\\u003ebfm\\u003c/em\\u003e' and the wild-type 'Jin Guan' using paraffin sections\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9156874/v1/b584413df863b1deaa0589e4.png\"},{\"id\":107018755,\"identity\":\"60a36d86-c2e7-4c0b-9d11-511849f0d324\",\"added_by\":\"auto\",\"created_at\":\"2026-04-15 20:39:06\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":205253,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCorrelation Analysis and Principal Component Analysis\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9156874/v1/1a0b7a911bff021c2a5b7e87.png\"},{\"id\":107018737,\"identity\":\"7c06a774-fd29-4332-8e3d-85035c13759b\",\"added_by\":\"auto\",\"created_at\":\"2026-04-15 20:38:58\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":109581,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHeatmap of Metabolites Differing Across Four Periods in Fiber Mutant ‘\\u003cem\\u003ebfm\\u003c/em\\u003e’ and Golden Crown\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9156874/v1/095f59caa56fbf553bd62ef6.png\"},{\"id\":107018756,\"identity\":\"ca5b6538-0a18-45ba-8115-06dd97276c66\",\"added_by\":\"auto\",\"created_at\":\"2026-04-15 20:39:07\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":336372,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eKEGG enrichment analysis (P ≤ 0.05) of differential metabolites in the four time points of the fiber mutant ‘\\u003cem\\u003ebfm\\u003c/em\\u003e’ and ‘jin guan’. Note: A: KEGG pathways significantly enriched for W1 vs. M1 differential metabolites; B: KEGG pathways significantly enriched for W2 vs. M2 differential metabolites; C: KEGG pathways significantly enriched for W3 vs. M3 differential metabolites; D: KEGG pathways significantly enriched for W4 vs. M4 differential metabolites.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9156874/v1/2b64000285812c9394d806e6.png\"},{\"id\":107018725,\"identity\":\"5d2de6f4-aa21-4ee9-9915-775a944abe41\",\"added_by\":\"auto\",\"created_at\":\"2026-04-15 20:38:55\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":102969,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eVeen Diagram of Differentially Expressed Genes and Metabolites Note: A: W1 vs. M1 period; B: W2 vs. M2 period; C: W3 vs. M3 period; D: W4 vs. M4 period\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9156874/v1/41200be46061cfb43032c87e.png\"},{\"id\":107018751,\"identity\":\"214c64ff-a695-412c-8145-8e88a30bff1a\",\"added_by\":\"auto\",\"created_at\":\"2026-04-15 20:39:04\",\"extension\":\"png\",\"order_by\":9,\"title\":\"Figure 9\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":56180,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCorrelation Network Diagram of Differentially Expressed Genes and Metabolites (ko01100)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage9.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9156874/v1/3f90f6205274f4be7fdf7f89.png\"},{\"id\":107018760,\"identity\":\"1f273f53-64f2-422c-9080-175694979827\",\"added_by\":\"auto\",\"created_at\":\"2026-04-15 20:39:09\",\"extension\":\"png\",\"order_by\":10,\"title\":\"Figure 10\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":31042,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCorrelation Network Diagram of Differentially Expressed Genes and Metabolites (ko01110)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage10.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9156874/v1/84a8e0e224d7e134a3f21af2.png\"},{\"id\":107018821,\"identity\":\"ead4ef07-aab1-4027-942e-7c6d9fa27719\",\"added_by\":\"auto\",\"created_at\":\"2026-04-15 20:39:16\",\"extension\":\"png\",\"order_by\":11,\"title\":\"Figure 11\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":74145,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eqRT-PCR validation of cellulose synthesis candidate genes. Note: Different letters indicate significant differences between groups (t-test, p\\u0026lt;0.05).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage11.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9156874/v1/c8cbee2b93139b9c7787cd88.png\"},{\"id\":107480814,\"identity\":\"b3072fe5-4878-47fa-8e4e-1231442873ca\",\"added_by\":\"auto\",\"created_at\":\"2026-04-22 02:13:43\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3389834,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9156874/v1/9c87fde2-e2e4-4615-9b02-30768a838917.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Study on the molecular mechanism of pod wall fiber formation using the bean pod fiber mutant (bfm) of Phaseolus vulgaris L\",\"fulltext\":[{\"header\":\"1 INTRODUCTION\",\"content\":\"\\u003cp\\u003eSnap bean (\\u003cem\\u003ePhaseolus vulgaris L.\\u003c/em\\u003e) has a delicious taste and rich nutrition, and is widely loved by people. The stitching and pod wall fiber content of bean pods are important traits that affect the quality of snap beans. Fiber in snap bean pod belongs to insoluble dietary fiber, namely crude fiber, which is one of the components of cell wall, mainly including cellulose, hemicellulose, lignin and other components.\\u003c/p\\u003e \\u003cp\\u003eCellulose is the most abundant component in plant cell walls, providing the mechanical strength required to resist swelling pressure, while also affecting the size, characteristics, and direction of cell growth and division, thus shaping the morphology of plants. The synthesis of cellulose is the most important biochemical process in plant cells, in which there is an important enzyme - cellulose synthase, including cellulose synthase (Ces) and cellulose like synthase (Csl). Current research indicates that a cellulose synthase gene family has evolved in higher plants, including multiple \\u003cem\\u003eCesA\\u003c/em\\u003e genes, which are divided into PCW (primary cell wall) CesA group and SCW (secondary cell wall) CesA group. Ten CESA proteins have been identified in Arabidopsis, and \\u003cem\\u003eCesA\\u003c/em\\u003e genes have also been identified in crops such as rice and bread wheat. In addition to cellulase, cellulase (Kor), sucrose synthase (SuSy), and other enzymes may also be involved in cellulose synthesis. Genes involved in starch and sucrose metabolism, as well as signal transduction, also play an important role in cellulose synthesis. Sucrose is the main form of carbohydrate transport in plants and an essential carbon source in the process of cellulose synthesis. Under the catalytic action of key enzymes such as sucrose synthase (SUS) and sucrose phosphate synthase (SPS), sucrose is broken down into glucose and fructose, which then participate in cellulose synthesis as precursor substances. Research has shown that the expression level of \\u003cem\\u003eSUS\\u003c/em\\u003e genes is closely related to cellulose synthesis. The \\u003cem\\u003eGhSUS2\\u003c/em\\u003e gene in cotton exhibits high expression levels during the rapid fiber elongation stage, providing sufficient substrates for cellulose synthesis. In addition, UDP glucose (UDP Glc), as another important precursor for cellulose synthesis, is mainly synthesized through the breakdown of sucrose to produce glucose-1-phosphate (G1P), which is catalyzed by UDP glucose pyrophosphate (UGPase). In addition to UDP glucose, other sugar nucleotides such as GDP glucose and ADP glucose also participate in the synthesis of cell wall polysaccharides. These sugar nucleotides are catalyzed by enzymes such as Nucleotide Sugar Pyrophorase to provide substrates for the synthesis of cell wall polysaccharides.Plant chitinase (CTL), as a type of glycoside hydrolase, plays numerous regulatory roles in cell wall metabolism and plant disease resistance. (Wu et al. \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e). conducted in-depth phenotype analysis on the rice bc15 mutant and found that the gene mutation caused thinning of the thick walled cell wall and a significant decrease in cellulose content. Further research revealed that the mutant encodes a chitinase protein, BC15/OsCTL1, providing new clues for analyzing its possible molecular mechanisms in cellulose synthesis and cell wall remodeling pathways.\\u003c/p\\u003e \\u003cp\\u003eIn the study of bean fiber, (Parker et al. \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). found in the anatomical analysis of developing pods that genetic changes leading to reduced cracking in dried bean pods may be related to changes in fiber composition or structure. The research results of (Rau et al. \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). showed that in fiber free snap beans, the lignified wall fiber layer is usually absent. (Parker et al. \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e) observations under an electron microscope further confirmed this conclusion. At present, research on the fiber characteristics of snap bean pods only stays at the physiological level, and there is little research on the molecular mechanisms of pod fiber formation. This study screened a pod fiber mutant \\u003cem\\u003ebfm\\u003c/em\\u003e from the mutant library. Exploring the reasons for the formation of fiber in the pod wall of snap beans through fiber content, cytological observation, and combined analysis of transcriptome and metabolome, providing basic materials for improving snap bean quality and breeding improvement.\\u003c/p\\u003e\"},{\"header\":\"2. MATERIALS AND METHODS\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1 Materials\\u003c/h2\\u003e \\u003cp\\u003eThe wild-type snap bean variety 'Jin Guan' is a high generation inbred line (from the Horticultural Team of Heilongjiang University, China). The bean pod fiber mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; is a stable genetic mutant strain obtained from dried seeds of 'Jinguan' through EMS mutagenesis treatment. There were no significant differences in plant height and branching between the mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; and the wild-type 'Jinguan', and the plant type development was basically consistent (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). The bean pod hardness and brittleness of \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; were both higher than those of 'Jinguan'.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2 Determination of Fiber Content in Pod Walls and Suture Tissues of Snap Bean\\u003c/h2\\u003e \\u003cp\\u003eThe mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; and its wild-type 'Jin Guan' were planted in the greenhouse of the Horticultural Experimental Base at Hulan Campus of Heilongjiang University. Bean pods without diseases or pests and of uniform size were collected from \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; and 'Jinguan' at 6, 10, 14, and 18 days after flowering, respectively. The pod walls and suture tissues of the besn pods were sampled separately, with three replicates set for each treatment. The treated pod walls and suture tissues were placed in an electric thermostatic oven set at 100\\u0026deg;C for 30 minutes of blanching treatment, and then transferred to an 80\\u0026deg;C electric thermostatic oven for continuous drying for 8\\u0026ndash;10 hours until constant weight for standby. The contents of crude fiber, cellulose, hemicellulose, and lignin were determined using an automatic fiber analyzer (ANKOM, USA).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 Cytological Observation of Pod Wall Tissues\\u003c/h2\\u003e \\u003cp\\u003eBean pods of \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; and 'Jin Guan' at 6, 10, 14, and 18 days after flowering were collected as observation samples. A 2-cm section from the middle of each pod was taken, excluding the suture and seeds, with three biological replicates set. The sections were cut into approximately 0.5-cm segments and placed into vials containing FAA fixative. The tissues underwent a series of processing steps: fixation - dehydration - clearing - wax infiltration - embedding and sectioning - section spreading and mounting - staining - staining again - coverslipping - microscopic observation.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4 Transcriptome and Metabolome Sequencing Analysis\\u003c/h2\\u003e \\u003cp\\u003eThe pod wall tissues of \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; and 'Jinguan' at 6, 10, 14, and 18 days after flowering were used as experimental materials. Name the pod wall samples of mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; at 6, 10, 14, and 18 days after flowering as M1, M2, M3, and M4, respectively; The pod wall samples of wild-type 'Jin Guan' flowers at 6, 10, 14, and 18 days after flowering were named W1, W2, W3, and W4, respectively. For transcriptome analysis, three biological replicates were set with 0.5 g per replicate; for metabolome analysis, six biological replicates were set with 0.1 g per replicate. After sampling, the samples were quickly frozen in liquid nitrogen and then transferred to -80\\u0026deg;C for storage.The samples were sent to Hangzhou Lianchuan Biotechnology Co., Ltd (Hangzhou, China) for sequencing. The pod wall samples of the wild-type 'Jinguan' at different developmental stages were named WT1, WT2, WT3, and WT4, respectively. The corresponding periods in the mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; pod wall samples are named M1, M2, M3, and M4.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5 Gene expression analysis by qRT-PCR\\u003c/h2\\u003e \\u003cp\\u003eThe cDNA samples from the pod wall tissues of \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; and 'Jinguan' at 6, 10, 14, and 18 days after flowering were obtained as described above, and specific primers for candidate genes were designed by Primer Premier 6.0 (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). A MY17295272 fluorescence quantitative PCR instrument (Agilent Technologies Inc. CA., USA) was used for qPCR experiments. Actin was used as the internal reference gene, the 2\\u003csup\\u003e\\u0026minus; ΔΔ CT\\u003c/sup\\u003e method was used to calculate relative expression levels of genes (Wan et al. \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e), the least significant difference (LSD) test was used for single factor difference analysis, and GraphPad software (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.graphpad.com/scientific-software/prism/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.graphpad.com/scientific-software/prism/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) was used for mapping. The reaction system for qPCR was 10 \\u0026micro;L of 2\\u0026times;Fast qPCR Mix, 0.4 \\u0026micro;L of forward and reverse primer (10 \\u0026micro;M), 2 \\u0026micro;L of cDNA and 7.2 \\u0026micro;L of DEPC-ddH\\u003csub\\u003e2\\u003c/sub\\u003eO. Thermal cycling included an initial denaturation at 95\\u0026deg;C for 30 s, followed by 40 cycles at 95\\u0026deg;C for 5 s and 60\\u0026deg;C for 15 s. Three technical replicates and three biological replicates were performed.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eQuantitative genes and primers for qRT-PCR\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMarkers\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward (5\\u0026rsquo;-3\\u0026rsquo;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eReverse (5\\u0026rsquo;-3\\u0026rsquo;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.008G256800\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATGGAGATGGACACACAACCACATAAGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTTATTTGAAGGAAGCAACCAAAAGTGAATTACAGTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.002G048400\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATGATCGTGCTAAAATTCTCAAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCTTGAATGCACACACTCCTAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.004G019600\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATGGGGGGAGAGTGGTGGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTCATAGGAGTGAATGCGAAGCAA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.010G083900\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATGGCGAATCCTCGATTTCCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTTAGATACCAAAATTGCATGCCTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.008G268900\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATGGCTTTAACTTTGTGTTACAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTCAAGAGATGTTGCATTCCGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.005G087400\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATGAATGCAGCTTCTTTGCACATAGCAA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTTAGATTATATCACGAAGCTTGTGACAGAAAGCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.003G089600\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATGAGTATGTACGGTAGGGATCCGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTCATGGTTTCCATGGTGCAGGAGGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.007G077800\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATGGGCAAGAGCAAAAACTCTCGTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTCACACGCTTCCAATAATTGAAGCACT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eActin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGAAGTTCTCTTCCAACCATCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTTTCCTTGCTCATTCTGTCCG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. RESULTS\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003e3.1 Analysis of fiber content in pod wall and suture tissue of mutant and its wild type\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eDetermination of crude fiber, cellulose, hemicellulose, and lignin content in the pod walls and suture tissues of mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; and wild-type \\u0026lsquo;Jin Guan\\u0026rsquo; at different developmental stages. The results showed that there was no significant difference in the content of various fiber components in the suture tissue of mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; compared to wild-type \\u0026lsquo;Jin Guan\\u0026rsquo; (Fig.\\u0026nbsp;2). While the crude fiber content of the mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; pod wall tissue gradually increased with pod development compared to the wild type, showing significant differences in pod wall tissue at 14 and 18 days after flowering (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). The content of hemicellulose and lignin in pod wall tissue of \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; pods is lower than that of wild-type \\u0026lsquo;Jin Guan\\u0026rsquo; at all developmental stages of the pods. The content of cellulose in pod wall tissue of \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; pods is not significantly different from that of \\u0026lsquo;Jin Guan\\u0026rsquo; at 6\\u0026ndash;14 days after flowering, but is significantly higher than that of \\u0026lsquo;Jin Guan\\u0026rsquo; at 18 days after flowering (commercial pod stage) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). Therefore, we speculate that the change in cellulose content of the pod wall is the main reason for the difference in fiber content between the pod fiber mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; and the \\u0026lsquo;Jin Guan\\u0026rsquo; pod wall.\\u003c/p\\u003e \\u003cp\\u003eFigure\\u0026nbsp;2. Comparison of fiber content in suture tissues of \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; and \\u0026lsquo;Jin Guan\\u0026rsquo; pods\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e*Significant difference (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05)\\u003c/p\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.2 Cytological observation of pod wall tissue\\u003c/h2\\u003e \\u003cp\\u003eAfter observing the longitudinal sections of the pod wall tissues of mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; and wild-type 'Jin Guan' through paraffin sections (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e), it was found that cells of different sizes formed a circular structure, from the outside to the inside, consisting of palisade tissue, thin-walled cell layer, cork layer, thick walled cell layer, and thin-walled cell layer. As the pod wall develops, the thin-walled cell layer becomes lignified and thickened into thick walled cells with small or no intercellular gaps, while the innermost thin-walled cell layer is tightly arranged and the intercellular gaps are relatively tight. As the mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; pods grow and develop, the number of cells increases significantly compared to 'Jin Guan', the number of phloem fibers increases, the cell wall thickens, the intercellular space shortens, and the cell density decreases, resulting in highly fibrotic tissue. It is speculated that this situation is the cause of the change in \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; fiber content.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.3 Transcriptome analysis of pod wall tissue at different developmental stages between wild-type and mutant\\u003c/h2\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e3.3.1 Illumina Sequencing, DEG Analysis, Funtional Annotation and Classification\\u003c/h2\\u003e \\u003cp\\u003eIn this study, we constructed 24 independent sequencing libraries. After Illumina sequencing, a total of 940164398 readings were generated (Supplementary Table\\u0026nbsp;1). To ensure the accuracy of subsequent analysis, quality control analysis is performed on the raw data. Align clean reads to the reference genome of snap beans (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://phytozome-next.jgi.doe.gov/\\u003c/span\\u003e\\u003cspan address=\\\"https://phytozome-next.jgi.doe.gov/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e ). The comparison rate of each sample exceeds 94%, and the sequencing data quality is good, providing good data support for subsequent experimental research.\\u003c/p\\u003e \\u003cp\\u003eCompare the sequencing data of the processing group (mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo;) and the control group (wild-type 'Jin Guan') at four different stages pairwise to analyze differentially expressed genes. The results showed that there were a total of 500 DEGs in W1 vs. M1, 5640 DEGs in W2 vs., 2713 DEGs in W3 vs. M3, 514 DEGs in W4 vs. M4. Through Veen plot analysis, we found that there were a total of 18 DEGs in the four periods of W1vsM1, W2vsM2, W3vsM3, and W4vsM4 (Supplementary Fig.\\u0026nbsp;1).\\u003c/p\\u003e \\u003cp\\u003ePerform GO and KEGG clustering analysis on DEGs in different comparison groups. According to the GO annotation results, it was found that differentially expressed genes were mainly enriched in molecular functions such as hydrolase, pectinase, oxidoreductase, transferase activity, cell wall tissue, and carbohydrate metabolism processes (Supplementary Table\\u0026nbsp;2). This indicates that genes related to cellulose synthesis mainly regulate or affect cellulose synthesis by participating in processes such as cell wall, sugar metabolism, enzyme activity, and biosynthesis of plant secondary metabolites. According to the KEGG annotation results of four comparison groups, it was found that genes related to cellulose synthesis were significantly enriched in secondary metabolite biosynthesis, metabolic pathways, starch and sucrose metabolism, and plant hormone signal transduction, indicating that cellulose synthesis is related to these metabolic pathways (Supplementary Fig.\\u0026nbsp;2).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e3.3.2 Analysis of cellulose synthesis related genes\\u003c/h2\\u003e \\u003cp\\u003ePhysiological data indicate that the difference in cellulose content between the pod fiber mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; and 'Jin Guan' gradually becomes significant with pod development. The cellulose content in the pod wall of \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; after 18 days of flowering was significantly higher than that of 'Jin Guan'. We analyzed that this may be due to changes in the expression of certain genes during the development of pod wall tissue, which affects the biosynthesis of cellulose in the pod wall tissue. In order to clarify the relationship between changes in the content of cellulose synthesis intermediates and gene regulation expression during the growth and development of snap beans, we studied the expression changes of related genes in the cellulose synthesis pathway during different stages of pod development. Five genes encoding cellulose synthase were found in four periods (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). The expression levels of four genes, Phvul.002G040200, Phvul.002G136300, Phvul.006G08400, and Phvul.007G081700, were higher in \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; than in 'Jin Guan' as the pods developed. The overall trend of cumulative changes in cellulose content determined in the previous stage is consistent, indicating that changes in the expression of cellulose synthase related genes may be related to the \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; mutation trait.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eCellulose synthase differentially expressed gene\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"7\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGene_ID\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ePathway\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eW1vsM1\\u003c/p\\u003e \\u003cp\\u003elog2(fc)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eW2vsM2\\u003c/p\\u003e \\u003cp\\u003elog2(fc)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eW3vsM3\\u003c/p\\u003e \\u003cp\\u003elog2(fc)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eW4vsM4\\u003c/p\\u003e \\u003cp\\u003elog2(fc)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eDescription\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.006G058400\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGO:0016760\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.02\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e2.39\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.42\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e2.36\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eCellulose synthase-like protein E1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.007G081700\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e/\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.53\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.56\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.62\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.01\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eCellulose synthase\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.009G242700\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGO:0071555\\u003c/p\\u003e \\u003cp\\u003eGO:0030244\\u003c/p\\u003e \\u003cp\\u003eGO:0016760\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.33\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-0.81\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-1.98\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-0.04\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eCellulose synthase A Catalytic Subunit 7 (UDP-forming)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.002G040200\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGO:0071555\\u003c/p\\u003e \\u003cp\\u003eGO:0030244\\u003c/p\\u003e \\u003cp\\u003eGO:0016760\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.18\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.01\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1.08\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.28\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eCellulose synthase-like protein D3\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.002G136300\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGO:0071555\\u003c/p\\u003e \\u003cp\\u003eGO:0016760\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e2.11\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1.18\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e1.14\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eCellulose synthase (UDP-forming)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eThrough KEGG enrichment analysis, 25 differentially expressed genes related to cellulose synthesis were screened for metabolic pathways, starch and sucrose metabolic pathways, secondary metabolite biosynthesis pathways (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). Compared with the wild-type 'Jin Guan', the mutant '\\u003cem\\u003ebfm\\u003c/em\\u003e' showed no significant changes in the expression levels of these 25 genes in the pod wall of 6\\u0026ndash;10 days after flowering, which is consistent with the physiological data measured earlier that showed no significant difference in crude fiber content during these two periods. 14 days after flowering, three genes, Phvul.003G089600, Phvul.007G077800, and Phvul.007G218400, were significantly upregulated in the mutant '\\u003cem\\u003ebfm\\u003c/em\\u003e'. Phvul.003G089600 and Phvul.007G077800 were significantly upregulated in the mutant '\\u003cem\\u003ebfm\\u003c/em\\u003e' in the pod wall of 18 days after flowering. In summary, during the period of 14\\u0026ndash;18 days after flowering, which is the formation period of commercial pods in snap beans, two genes \\u003cem\\u003ePhvul.003G089600 (KOR)\\u003c/em\\u003e and \\u003cem\\u003ePhvul.007G077800 (CTL)\\u003c/em\\u003e consistently showed significant upregulation in the mutant '\\u003cem\\u003ebfm\\u003c/em\\u003e'. KOR and CTL are glycoside hydrolases that play important roles in cell wall synthesis metabolism and cellulose synthesis. Therefore, it is speculated that changes in the expression of these two genes affect or promote precursor substances for cellulose synthesis, leading to changes in cellulose content.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003e6 Analysis of expression levels of 25 genes\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"7\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGene_ID\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ePathway\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eW1vsM1\\u003c/p\\u003e \\u003cp\\u003elog2(fc)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eW2vsM2\\u003c/p\\u003e \\u003cp\\u003elog2(fc)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eW3vsM3\\u003c/p\\u003e \\u003cp\\u003elog2(fc)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eW4vsM4\\u003c/p\\u003e \\u003cp\\u003elog2(fc)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eDescription\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.001G209600\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1.11\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e1.90\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-0.28\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.22\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eSUCROSE SYNTHASE 5\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.009G114700\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01110\\u003c/p\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.95\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.99\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.68\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.44\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eSucrose transport protein SUC4\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.003G089600\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003cp\\u003epvu00500\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.02\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-0.61\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e7.83\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e2.13\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eENDOGLUCANASE 21\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.006G0049001\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e/\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e8.56\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-0.56\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1.04\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-0.10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eEndoglucanase 7\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.009G135900\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e/\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.16\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e11.42\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-2.62\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-0.25\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eEndoglucanase 25\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.006G133700\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e/\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.16\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-0.21\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-0.06\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-0.56\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eEndoglucanase 25\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.007G218400\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003cp\\u003epvu00500\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.89\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.21\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e2.65\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.93\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eEndoglucanase 1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.009G254400\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003cp\\u003epvu00520\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.60\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.81\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-1.86\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-0.79\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eChitinase-like protein 2\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.008G018100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e/\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.02\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-0.75\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.22\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.26\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eChitinase-like protein 2\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.007G077800\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003cp\\u003epvu00520\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-4.22\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e6.55\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e3.56\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e12.55\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eChitinase\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.011G167000\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003cp\\u003epvu00520\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.47\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-1.29\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1.69\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e1.28\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eChitinase3\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.005G155800\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003cp\\u003epvu00520\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.88\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e6.30\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1.40\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.58\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eCHITINASE-RELATED\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.009G116700\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu00520\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e2.12\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e5.46\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-3.54\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-0.94\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eBASIC ENDOCHITINASE B\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.003G158800\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.70\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e11.10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.11\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-1.24\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eChitinase\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.004G041300\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01110\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.15\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-1.34\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1.70\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.50\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eCOBRA-like protein\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.009G203100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01110\\u003c/p\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.01\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-1.61\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.49\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-0.06\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eCOBRA-like protein\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.008G029100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01110\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.27\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-0.98\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.44\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-0.23\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eCOBRA-like protein\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.008G029200\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01110\\u003c/p\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.14\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.65\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1.07\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-0.08\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eCOBRA-like protein\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.002G075200\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01110\\u003c/p\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-1.13\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e3.05\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-3.68\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e0.48\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eUDP-glycosyltransferase 74B1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.008G208400\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.17\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-0.27\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.96\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-1.76\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eUDP-glycosyltransferase 92A1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.008G29100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-1.09\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.80\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-2.11\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-1.61\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eUDP-glycosyltransferase 82A1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.006G087300\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01110\\u003c/p\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.18\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.42\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1.37\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-7.86\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eSUCROSE SYNTHASE 5\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.004G142800\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003cp\\u003epvu00500\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.42\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.33\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.29\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-2.32\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eSUCROSE SYNTHASE 5\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.008G241300\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003cp\\u003epvu00500\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.00\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.06\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.23\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-2.10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eSUCROSE SYNTHASE 5\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePhvul.009G250800\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epvu01100\\u003c/p\\u003e \\u003cp\\u003epvu00500\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.00\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.00\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-1.36\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-7.48\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eSUCROSE SYNTHASE 5\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e3.3.3 qRT-PCR validation\\u003c/h2\\u003e \\u003cp\\u003eTo verify the accuracy of RNA-seq sequencing results, 6 DEGs were randomly selected Phvul.008G132200、Phvul.003G147700、Phvul.002G048400、Phvul.008G290300、Phvul.004G019600 and Phvul.005G155800 perform real-time fluorescence quantitative PCR validation. The qRT-PCR results showed that the expression levels of six genes showed the same trend as RNA-seq, indicating that RNA-seq sequencing data has good quality.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.4 Metabolomic Analysis of Pod Wall Tissues at Different Developmental Stages between Wild-Type and Mutant\\u003c/h2\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e3.4.1 Principal component analysis\\u003c/h2\\u003e \\u003cp\\u003eTo validate differences between samples, correlation analysis and principal component analysis (PCA) were performed on the collected samples from two varieties across four growth stages. Correlation analysis revealed that the two principal components (PC1 and PC2) accounted for 31.72% and 94.8% of the variance, respectively. PCA results indicated that samples within each group clustered closely, while samples from different groups showed clear.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e3.4.2 differential metabolites analysis\\u003c/h2\\u003e \\u003cp\\u003eIn this study, to identify significantly accumulated metabolites across different comparison groups, we screened for differential metabolites in four comparison sets: W1 vs M1, W2 vs M2, W3 vs M3, and W4 vs M4. A total of 1,030 differential metabolites were identified. Among the four comparison groups (W1 vs M1, W2 vs M2, W3 vs M3, W4 vs M4), 29 differentially expressed metabolites were common across all groups. Key differentially expressed metabolites included amino acids and their derivatives, phenolic acids, nucleotides and their derivatives, trehalose, D-glucose, α-glucose, D-arabinitol, D-ribose, quinic acid, quercetin, corticosterone, caffeic acid, flavonoids, quinones, lignan alkaloids, terpenoids, organic acids, and lipids. Changes in the content of these metabolites are presumed to have caused differences in cellulose content between \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; and \\u0026lsquo;Jin guang\\u0026rsquo;. KEGG analysis indicated significant enrichment in metabolic pathways (ko01100), starch and sucrose metabolism (ko00500), and biosynthesis of plant secondary metabolites (ko011060) during the comparison of the four periods.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.5 Integrated Analysis of Transcriptome and Metabolome\\u003c/h2\\u003e \\u003cp\\u003eTo elucidate the correlation between cellulose-related differentially expressed genes and metabolites, KEGG pathway enrichment analysis was performed on the differentially expressed genes and metabolites identified across the four stages (W1vsM1, W2vsM2, W3vsM3, and W4vsM4). This revealed information about metabolic pathways jointly involved in both groups, with metabolic pathways and secondary metabolite biosynthesis pathways emerging as particularly significant pathways.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e3.5.1Regulatory Network of Metabolic Pathways\\u003c/h2\\u003e \\u003cp\\u003eMetabolic pathways are crucial for plant growth and development, and they synergistically influence the synthesis of cellulose, the primary component of plant cell walls. Amino acids such as glycine and serine can indirectly affect cellulose synthesis by regulating cell wall structure and the expression of endoglucanases and chitinases. D-ribose can regulate the gene expression of these two enzymes through energy and sugar metabolism, thereby influencing cellulose synthesis. Although D-arabinose does not directly participate in cellulose synthesis, it can indirectly affect cellulose deposition by regulating carbon source allocation to support precursor formation, influencing related enzyme gene expression, or controlling hemicellulose and lignin synthesis.\\u003c/p\\u003e \\u003cp\\u003eWithin this metabolic pathway, metabolites associated with cellulose synthesis or its regulation were identified: 4-hydroxycinnamic acid, serine, glycine, L-glutamine, arabitol (D), D-ribose, etc. These metabolites were linked to differentially expressed genes \\u003cem\\u003ePhvul.003G089600 (KOR)\\u003c/em\\u003e, \\u003cem\\u003ePhvul.005G155800 (CHI4)\\u003c/em\\u003e, \\u003cem\\u003ePhvul.007G077800 (CTL)\\u003c/em\\u003e, and \\u003cem\\u003ePhvul.011G167000 (CHIT3).\\u003c/em\\u003e Except for 4-hydroxycinnamic acid, which exhibits negative regulation with other genes, the remaining metabolites all show positive regulation with these genes.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e3.5.2 Regulatory Network of Secondary Metabolite Biosynthetic Pathways\\u003c/h2\\u003e \\u003cp\\u003eThe biosynthetic pathways of secondary metabolites are crucial for cellulose synthesis. L-alanine may indirectly regulate sucrase gene expression and glycosyltransferase activity by influencing nitrogen metabolism and energy supply through its association with carbohydrate metabolism, while glycine may do so by participating in cell wall protein synthesis. The Flavonoid secondary metabolite delphinidin-3-glucoside indirectly influences cellulose synthesis by regulating enzyme gene expression through antioxidant effects, secondary metabolism control, and stress response modulation.\\u003c/p\\u003e \\u003cp\\u003eIn this pathway, metabolites associated with cellulose synthesis or its regulation\\u0026mdash;L-alanine, glycine, and apigenin-3-glucoside\\u0026mdash;exhibit positive correlations with genes Phvul.002G075200 (UGT74B1) and Phvul.006G087300 (SUS5).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e3.5.3 Key Gene Screening\\u003c/h2\\u003e \\u003cp\\u003eThrough integrated transcriptomic and metabolomic analysis, we identified eight differentially expressed metabolites in the metabolic pathways and secondary metabolic biosynthetic pathways, including 4-hydroxycinnamic acid, serine, glycine, L-glutamine, L-alanine, D-arabinitol, D-ribose, and Delphinidin 3-glucoside were associated with \\u003cem\\u003ePhvul.003G089600 (KOR)\\u003c/em\\u003e, \\u003cem\\u003ePhvul.005G155800 (CHI4), Phvul.007G077800 (CTL), Phvul.011G167000 (CHIT3), Phvul.002G075200 (UGT74B1)\\u003c/em\\u003e, and \\u003cem\\u003ePhvul.006G087300 (SUS5).\\u003c/em\\u003e Among these, \\u003cem\\u003ePhvul.003G089600 (KOR)\\u003c/em\\u003e and \\u003cem\\u003ePhvul.007G077800 (CTL)\\u003c/em\\u003e showed significant correlations with other metabolites. Both genes exhibited consistently significant upregulation during the commercial pod stage (14\\u0026ndash;18 days after flowering). These genes encode endoglucanase (KOR) and chitinase (CTL), respectively. Both belong to the glycoside hydrolase family. While they do not directly synthesize sugars or cellulose, they degrade complex polysaccharides into reusable sugar units. These units are then converted into UDP-glucose (a precursor for cellulose synthesis) via glycolysis or gluconeogenesis, thereby indirectly influencing or promoting cellulose synthesis. Therefore, it is inferred that the genes \\u003cem\\u003ePhvul.003G089600 (KOR)\\u003c/em\\u003e and \\u003cem\\u003ePhvul.007G077800 (CTL)\\u003c/em\\u003e are associated with the phenotypic traits of the pod fiber mutant.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e3.5.4 qRT-PCR Validation of Candidate Genes for Cellulose Synthesis\\u003c/h2\\u003e \\u003cp\\u003eTo verify whether the differential expression patterns of the two genes \\u003cem\\u003ePhvul.003G089600 (KOR)\\u003c/em\\u003e and \\u003cem\\u003ePhvul.007G077800 (CTL)\\u003c/em\\u003e align with the cellulose content trend during \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; growth and development, we performed real-time quantitative PCR analysis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig10\\\" class=\\\"InternalRef\\\"\\u003e11\\u003c/span\\u003e). Results revealed significant differences in both genes during the 14\\u0026ndash;18 days post-flowering (commercial pod stage) period, consistent with the cellulose content trend observed during \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; growth and development. This suggests an association with the phenotypic differences in the pod fiber mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo;.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e\"},{\"header\":\"4 DISCUSSION\",\"content\":\"\\u003cp\\u003eThe causes of plant tissue fibrosis vary across different crops. Previous studies have shown that quality deterioration in fruits such as pears (Cai et al. \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e) and citrus (Wu et al. \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e; Liu et al. \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e) is closely linked to increased lignin synthesis and deposition. Similarly, post-harvest fibrosis in asparagus (Hennion et al. \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e1992\\u003c/span\\u003e) and bamboo shoots (Luo et al. \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e)is primarily attributed to elevated lignin content. However, fiber composition analysis of the mutant \\u003cem\\u003ebfm\\u003c/em\\u003e and the wild-type \\u0026lsquo;Golden Crown\\u0026rsquo; in this study revealed no significant differences in hemicellulose or lignin content between the two. Conversely, the cellulose content in \\u003cem\\u003ebfm\\u003c/em\\u003e was significantly higher than that in the wild-type during the marketable pod stage, and this change was consistent with an increase in crude fiber content. This result indicates that the fibrillation phenotype in the fiber wall mutant of common bean is not dominated by lignin but rather caused by abnormal accumulation of cellulose content, consistent with the findings of (Murgia et al. \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e) research. The reason for this discrepancy may be closely related to the specificity of the study material. As a crop whose edible organ is the tender pod, common bean is more sensitive to the impact of cellulose content on texture, and its fibrillation regulatory mechanism may be more inclined toward regulating cellulose metabolism. Furthermore, transcriptomic analysis revealed that differentially expressed genes were predominantly enriched in metabolic pathways related to cellulose synthesis, starch and sucrose metabolism, rather than the phenylpropanoid pathway critical for lignin synthesis. This molecular evidence further substantiates the pivotal role of cellulose in the \\u003cem\\u003ebfm\\u003c/em\\u003e mutant phenotype.\\u003c/p\\u003e \\u003cp\\u003eThrough transcriptomic and metabolomic analysis, this study identified two core regulatory genes\\u0026mdash;\\u003cem\\u003ePhvul.003G089600 (KOR)\\u003c/em\\u003e and \\u003cem\\u003ePhvul.007G077800 (CTL)\\u003c/em\\u003e. Both genes exhibited sustained significant upregulation during the commercial pod formation stage (14\\u0026ndash;18 days after flowering) and encode glycoside hydrolase family proteins. Previous studies have confirmed that the endo-β-1,4-glucanase encoded by the \\u003cem\\u003eKOR\\u003c/em\\u003e gene is an essential protein for cellulose biosynthesis and cell wall assembly. It promotes cellulose polymer synthesis and recycling by cleaving glucan primers. (M\\u0026oslash;lh\\u0026oslash;j et al. \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e2001\\u003c/span\\u003e) research using Arabidopsis revealed \\u003cem\\u003eKOR\\u003c/em\\u003e gene involvement in cell wall assembly throughout the entire plant. (von Schaewen et al. \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e) research revealed that \\u003cem\\u003eKOR\\u003c/em\\u003e genes play a central role in maintaining cellulose biosynthesis in both primary and secondary cell walls. Chitinase-like proteins encoded by \\u003cem\\u003eCTL\\u003c/em\\u003e genes play crucial roles in plant cell wall structural organization and cellulose deposition. Their homologs in cotton and Arabidopsis have been confirmed to participate in secondary cell wall cellulose synthesis (Kwon et al. \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e). demonstrated that chitinases may contribute to cell wall structural organization and potentially function in Arabidopsis (A. thaliana) active defense systems. For instance, (Zhang et al. \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2004\\u003c/span\\u003e). reported that two homologous cotton chitinase-like proteins (GhCTL1 and GhCTL2) are preferentially expressed during secondary cell wall deposition in cotton fiber cells and are responsible for cellulose biosynthesis during primary and secondary cell wall formation in Arabidopsis vascular tissues. (Aktar Hossain et al. \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). demonstrated that AtCTL2 is essential for proper cell wall biosynthesis in Arabidopsis seedlings using a mutant of the chitinase-like protein-encoding gene AtCTL2.\\u003c/p\\u003e \\u003cp\\u003eIn this study, the abnormal upregulation of these two genes may synergistically regulate the production and conversion of cellulose synthesis precursors through changes in the levels of metabolites such as glycine and D-ribose. This ultimately leads to abnormal accumulation of pod wall cellulose, acting as a key molecular switch driving the fibrillation phenotype.\\u003c/p\\u003e\"},{\"header\":\"5 CONCLUSIONS\",\"content\":\"\\u003cp\\u003eThis study demonstrates that the fiber mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; in common bean pods exhibits significantly higher fiber content than the wild type during the commercial maturity stage. Cellulose appears to be the primary factor contributing to pod wall thickening. Integrated transcriptomic and metabolomic analyses reveal that differentially expressed genes and metabolites are predominantly enriched in metabolic pathways and secondary metabolite biosynthesis pathways. These include amino acids and their derivatives, arabitol (D), D-ribose, apigenin 3-glucoside, and carbohydrates, closely associated with \\u003cem\\u003ePhvul.007G077800 (CTL)\\u003c/em\\u003e and \\u003cem\\u003ePhvul.003G089600 (KOR)\\u003c/em\\u003e. These metabolites and genes indirectly influence or regulate precursors involved in cellulose synthesis, providing essential substrates and energy to promote cellulose formation. Additionally, we investigated the key \\u003cem\\u003eCTL\\u003c/em\\u003e and \\u003cem\\u003eKOR\\u003c/em\\u003e genes within the cellulose synthesis regulatory network, briefly elucidating their crucial roles and establishing a theoretical foundation for future studies on the regulation of pod wall cellulose synthesis in Phaseolus vulgaris.\\u003c/p\\u003e \\u003cp\\u003eIn summary, this study confirms that the high cellulose content trait in the bean pod fiber mutant \\u0026lsquo;\\u003cem\\u003ebfm\\u003c/em\\u003e\\u0026rsquo; is not regulated by a single gene or metabolite, but rather results from the synergistic action of a complex regulatory network. These findings provide key candidate genes and metabolic markers for molecular breeding of this fiber bean pod variety.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e \\u003cstrong\\u003eETHICS APPROVAL AND CONSENT TO PARTICIPATE\\u003c/strong\\u003e \\u003cp\\u003eEthical approval was not required as the study used only secondary data from publicly available, de-identified sources.\\u003c/p\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cstrong\\u003eCONSENT FOR PUBLICATION\\u003c/strong\\u003e \\u003cp\\u003eAll authors have read and agreed to the submission and publication of this paper.The content of the paper represents original research results, with no plagiarism, no fabrication, and no duplicate submission.There is no infringement of others' intellectual property rights, no confidential content, and no conflicts of interest.All authors agree to submit this paper to \\u003cem\\u003eBMC Plant Biology\\u003c/em\\u003e for publication and to comply with the relevant publication regulations of the journal.\\u003c/p\\u003e \\u003c/p\\u003e\\u003ch2\\u003eFUNDING\\u003c/h2\\u003e \\u003cp\\u003eThis work was supported by the Heilongjiang Provincial Undergraduate Universitis\\u0026rsquo; \\u0026ldquo;Support Program for Outstanding Young Facully in Basic Research\\u0026rdquo; \\u0026ldquo;Cloning and Functional Validation of the Candidate Gene \\u003cem\\u003epv-bfm\\u003c/em\\u003e, a Mutation Gene Encoding Sanp Bean Pod Fiber\\u0026rdquo;(grant number YQJH2024198), the Basic Research Fund of the Provincial Department of Education, \\u0026ldquo;Localization, Cloning, and Functional Analysis of Major Genes Regulating Fiber Coutent in Snap Bean Pod Walls\\u0026rdquo;(grant number 2024-KYYWF-0110), and the Heilongjiang Provincial Natural Science Foundation Project \\\"Construction of the Regulatory Network of Phaseolus vulgaris Lectin and Breeding of New Varieties\\\", (grant number YQ2024C046).\\u003c/p\\u003e\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eKanhui Mo: Writing-Original Draft, Writing-Review \\u0026amp; Editing, Visualization.Zhuang Sun: Investigation, Date Curation.Guojun Feng, Zhishan Yan: Resources, Supervision.Dajun Liu, Taifeng Zhang: Resources, Software.Xiaoxu Yang*, Chang Liu*( corresponding author ): Project administration.\\u003c/p\\u003e\\u003ch2\\u003eAcknowledgement\\u003c/h2\\u003e\\u003cp\\u003eWe thank all the researchers, colleagues and mentors who have participated in this work, and thank them for their support and assistance.\\u003c/p\\u003e\\u003ch2\\u003eData Availability\\u003c/h2\\u003e\\u003cp\\u003eThe raw RNA-seq data generated in this study have been submitted to the NCBI Gene Expression Omnibus (GEO) database under submission ID 2251963@orcid. The submission is currently under review by GEO, and the official accession number will be provided once the review is completed. All data will be made publicly available upon publication.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eWu B, Zhang B, Dai Y, Zhang L, Shang-Guan K, Peng Y, Zhou Y, Zhu Z. Brittle culm15 encodes a membrane-associated chitinase-like protein required for cellulose biosynthesis in rice. Plant Physiol. 2012;159(4):1440\\u0026ndash;52.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eParker TA, Lo S, Gepts P. Pod shattering in grain legumes: emerging genetic and environment-related patterns. Plant Cell. 2021;33(2):179\\u0026ndash;99. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/plcell/koaa025\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/plcell/koaa025\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRau D, Murgia ML, Rodriguez M, Bitocchi E, Bellucci E, Fois D, Albani D, Nanni L, Gioia T, Santo D, et al. Genomic dissection of pod shattering in common bean: mutations at non-orthologous loci at the basis of convergent phenotypic evolution under domestication of leguminous species. Plant J. 2019;97(4):693\\u0026ndash;714. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/tpj.14155\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/tpj.14155\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWan H, Zhao Z, Qian C, Sui Y, Malik AA, Chen J. Selection of appropriate reference genes for gene expression studies by quantitative real-time polymerase chain reaction in cucumber. Anal Biochem. 2010;399(2):257\\u0026ndash;61.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCai Y, Li G, Nie J, Lin Y, Nie F, Zhang J, Xu Y. Study of the structure and biosynthetic pathway of lignin in stone cells of pear. Sci Hort. 2010;125(3):374\\u0026ndash;9. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.scienta.2010.04.029\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.scienta.2010.04.029\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu J-L, Pan T-F, Guo Z-X, Pan D-M. Specific Lignin Accumulation in Granulated Juice Sacs of \\u003cem\\u003eCitrus maxima\\u003c/em\\u003e. J Agric Food Chem. 2014;62(50):12082\\u0026ndash;9. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1021/jf5041349\\u003c/span\\u003e\\u003cspan address=\\\"10.1021/jf5041349\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu X, Zhang H, Zhang W, Xu W, Li S, Chen X, Chen H. Genome-wide bioinformatics analysis of Cellulose Synthase gene family in common bean (Phaseolus vulgaris L.) and the expression in the pod development. BMC Genomic Data. 2022;23(1). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s12863-022-01026-0\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s12863-022-01026-0\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHennion S, Anthony Little CH, Hartmann C. Activities of enzymes involved in lignification during the postharvest storage of etiolated asparagus spears. Physiol Plant. 1992;86(3):474\\u0026ndash;8. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/j.1399-3054.1992.tb01346.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1399-3054.1992.tb01346.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLuo Z, Xu X, Yan B. Accumulation of lignin and involvement of enzymes in bamboo shoot during storage. Eur Food Res Technol. 2008;226(4):635\\u0026ndash;40. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00217-007-0595-y\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00217-007-0595-y\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMurgia ML, Attene G, Rodriguez M, Bitocchi E, Bellucci E, Fois D, Nanni L, Gioia T, Albani DM, Papa R. A comprehensive phenotypic investigation of the pod-shattering syndrome in common bean. Front Plant Sci. 2017;8:251.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eM\\u0026oslash;lh\\u0026oslash;j M, J\\u0026oslash;rgensen B, Ulvskov P, Borkhardt B. Two Arabidopsis thaliana genes, KOR2 and KOR3, which encode membrane-anchored endo-1,4-β-D-glucanases, are differentially expressed in developing leaf trichomes and their support cells. Plant Mol Biol. 2001;46(3):263\\u0026ndash;75. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1023/A:1010688726755\\u003c/span\\u003e\\u003cspan address=\\\"10.1023/A:1010688726755\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003evon Schaewen A, Rips S, Jeong IS, Koiwa H. Arabidopsis thaliana KORRIGAN1 protein: N-glycan modification, localization, and function in cellulose biosynthesis and osmotic stress responses. Plant Signal Behav. 2015;10(5):e1024397. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1080/15592324.2015.1024397\\u003c/span\\u003e\\u003cspan address=\\\"10.1080/15592324.2015.1024397\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKwon H-K, Yokoyama R, Nishitani K. A Proteomic Approach to Apoplastic Proteins Involved in Cell Wall Regeneration in Protoplasts of Arabidopsis Suspension-cultured Cells. Plant Cell Physiol. 2005;46(6):843\\u0026ndash;57. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/pcp/pci089\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/pcp/pci089\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang D, Hrmova M, Wan C-H, Wu C, Balzen J, Cai W, Wang J, Densmore LD, Fincher GB, Zhang H, et al. Members of a New Group of Chitinase-Like Genes are Expressed Preferentially in Cotton Cells with Secondary Walls. Plant Mol Biol. 2004;54(3):353\\u0026ndash;72. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1023/B:PLAN.0000036369.55253.dd\\u003c/span\\u003e\\u003cspan address=\\\"10.1023/B:PLAN.0000036369.55253.dd\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAktar Hossain M, Noh H-N, Kim K-I, Koh E-J, Wi S-G, Bae H-J, Lee H, Hong S-W. Mutation of the chitinase-like protein-encoding \\u003cem\\u003eAtCTL2\\u003c/em\\u003e gene enhances lignin accumulation in dark-grown \\u003cem\\u003eArabidopsis\\u003c/em\\u003e seedlings. J Plant Physiol. 2010;167(8):650\\u0026ndash;8. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.jplph.2009.12.001\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jplph.2009.12.001\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"bmc-plant-biology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"pbio\",\"sideBox\":\"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/pbio/default.aspx\",\"title\":\"BMC Plant Biology\",\"twitterHandle\":\"BMC_series\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC Series\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Phaseolus vulgaris L., mutant, pod wall fiber, transcriptome, metabolome\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-9156874/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-9156874/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cstrong\\u003eBackground and aims: \\u003c/strong\\u003eSnap bean is a widely planted legume vegetable crop in the world, with tender pods as its edible organ. In the actual production process, excessive fiber content in bean pods can lead to a deterioration in their taste after cooking, seriously affecting their edible quality. In order to better study the mechanism of fiber formation in bean pod walls, we selected a bean pod fiber mutant (\\u003cem\\u003ebfm\\u003c/em\\u003e) from the bean mutant library.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMethods: \\u003c/strong\\u003eFiber content determination, cytological observation, transcriptome and metabolome analysis were performed on the pod walls of mutant \\u003cem\\u003ebfm\\u003c/em\\u003e and its wild-type at different developmental stages.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eKey results: \\u003c/strong\\u003eThe results showed that the crude fiber content of the \\u003cem\\u003ebfm\\u003c/em\\u003e pod wall tissue was significantly higher than that of the wild type during the mature commercial pod stage, and cellulose may be the main factor causing the increase in fiber content in the bean pod wall. During the mature commercial pod stage, the number of cells in the pod wall tissue of \\u003cem\\u003ebfm\\u003c/em\\u003e increased significantly compared to the wild type, with an increase in phloem fibers and thicker cell walls. It is speculated that this situation led to changes in fiber content in the mutant \\u003cem\\u003ebfm\\u003c/em\\u003e. The combined analysis of transcriptome and metabolome showed that differentially expressed genes and metabolites were enriched in metabolic pathways and secondary metabolite biosynthesis pathways. Metabolites such as glycine, L-glutamine, arabitol (D), and D-ribose were closely related to \\u003cem\\u003ePhvul.007G077800 (CTL)\\u003c/em\\u003e and \\u003cem\\u003ePhvul.003G089600 (KOR).\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConclusions: \\u003c/strong\\u003eThese metabolites and genes mutually regulate and affect or promote precursor substances for cellulose synthesis, providing substrates and energy for cellulose synthesis, thereby promoting cellulose synthesis. This study provides theoretical research on the mechanism of fiber synthesis in bean pod walls, and also to provide some reference for bean breeding improvement and application practice.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Study on the molecular mechanism of pod wall fiber formation using the bean pod fiber mutant (bfm) of Phaseolus vulgaris L\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-04-15 20:38:18\",\"doi\":\"10.21203/rs.3.rs-9156874/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"reviewerAgreed\",\"content\":\"245954344031459996164830671166486148303\",\"date\":\"2026-05-16T16:49:19+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"265851354459949683020854908436443830551\",\"date\":\"2026-04-10T13:56:01+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-04-09T01:00:40+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"52169356712811946678442872915786123717\",\"date\":\"2026-04-08T08:03:03+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2026-04-08T00:51:14+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvited\",\"content\":\"\",\"date\":\"2026-04-06T06:50:36+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2026-04-02T17:31:38+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2026-04-02T07:52:45+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"BMC Plant Biology\",\"date\":\"2026-04-02T07:29:56+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"bmc-plant-biology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"pbio\",\"sideBox\":\"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/pbio/default.aspx\",\"title\":\"BMC Plant Biology\",\"twitterHandle\":\"BMC_series\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC Series\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"a569032e-318a-4f58-9bbb-7d5dd5539655\",\"owner\":[],\"postedDate\":\"April 15th, 2026\",\"published\":true,\"recentEditorialEvents\":[{\"type\":\"reviewerAgreed\",\"content\":\"245954344031459996164830671166486148303\",\"date\":\"2026-05-16T16:49:19+00:00\",\"index\":42,\"fulltext\":\"\"}],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-04-15T20:38:19+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-04-15 20:38:18\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-9156874\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-9156874\",\"identity\":\"rs-9156874\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}