{"paper_id":"3666b22b-8e4d-417f-91c3-b16c2a1a814d","body_text":"Isolation, identification and genome analysis of a new Escherichia coli phage XH12 and enhancement of antibacterial activity of its lysozyme by chimeric cationic peptides | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Isolation, identification and genome analysis of a new Escherichia coli phage XH12 and enhancement of antibacterial activity of its lysozyme by chimeric cationic peptides Xuhao Hou, Jiaqi Pu, Yu Li, Wenhai Xie, Limei zhang, Hongkuan Deng This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5333939/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 27 Mar, 2025 Read the published version in Archives of Virology → Version 1 posted 5 You are reading this latest preprint version Abstract Antibiotics are no longer adequate to address the threat of antibiotic resistance, especially Pseudomonas aeruginosa , Acinetobacter baumannii , Escherichia coli and other gram-negative pathogens, which pose a serious threat to human health worldwide. The antibiotic resistance pandemic requires the search for new antimicrobials as alternatives that are effective and less prone to resistance. Phages and its lysozyme become an attractive alternative to currently available antibiotics. However, gram-negative bacteria have outer membrane that acts as a strong barrier, so lysozymes are often used in combination with outer membrane permeator, or are modified to overcome the outer membrane barrier. To combat drug-resistant E. coli , in this study, we used multidrug-resistant E. coli eco-3 as host bacteria, a lytic phage XH12 was isolated from sewages, phage XH12 can lyse about 81% (30/37) of E. coli strains tested. The biological characteristics and genome of phage XH12 were analyzed, and we found that lysozyme Lys12 encoded by phage XH12 combined with ethylenediaminetetraacetic acid (EDTA) had antibacterial activity against E. coli . Two fusion lysozymes were obtained by fusing different amounts of cationic amino acid polypeptides with the C-terminal of Lys12. The fusion lysozymes could improve the antibacterial activity against E. coli from extracellular space. The study of phage XH12 and its lysozyme will provide basic information for further study of the treatment of multidrug-resistant E. coli infection. Multidrug-resistant E. coli Phages Biofilms Phage lysozyme Chimeric lysozyme Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction E. coli is a common and widely distributed opportunistic pathogen, which can cause gastrointestinal, urinary tract, arthritis, meningitis and septic infections in humans and many animals under certain condition [ 1 , 2 ]. E. coli biofilms help the bacteria survive in adverse environmental conditions, contributing to persistent infection and resistance to conventional antibiotics [ 3 , 4 ]. Due to the effectiveness and broad spectrum of antibiotics, antibiotics have become the main means of treating microbial infectious diseases, however, the abuse of antibiotics lead to the continuous emergence of drug-resistant E. coli , especially the emergence of carbapenem-resistant E. coli poses a serious threat to human health, traditional antibiotics are difficult to deal with the threat of drug-resistant E. coli to human health [ 5 ]. At present, the discovery of new antibiotics is increasingly difficult, and the development rate of new antibiotics is much slower than the emergence of drug-resistant bacteria [ 6 ]. Therefore, in addition to antibiotics, there is an urgent need for humans to seek more means to fight bacterial infections, such as phage therapy [ 7 ]. Phages are the organisms with the largest diversity and abundance in the biosphere of the earth [ 8 ]. Phages are predators in the ecosystem, natural enemies of pathogenic bacteria of animals and plants, and important members of microorganisms in the human body [ 9 ]. Phages play an important role in the type, quantity and distribution regulation of human flora, which is significant importance to human health [ 10 ]. The eradication of multidrug-resistant E. coli strains and biofilms by phages has been studied for many years, and good results have been achieved [ 11 ]. After phages infect bacteria, new phages particles synthesized in the bacteria must pass through the cell membrane and cell wall structure of the bacteria before they can be released to the outside of the bacteria. For cell membrane barriers, phages encode holins that punch holes in the cell membrane to destroy the bacterial cell membrane. For cell wall barriers, phages destroy the integrity of the cell wall by encoding lysozyme that binds to specific structures on the cell wall and hydrolyzes specific chemical bonds [ 12 ]. dsDNA phages rely primarily on holins and lysozyme to lyse bacteria, holins can form transmembrane pores on the cell membrane at a specific time point and change the permeability of the host cell membrane, and lysozyme can reach the cell wall through the pores formed by holins on the cell membrane and hydrolyze and destroy peptidoglycan. This causes the host bacteria to lyse and die under osmotic pressure, releasing their progeny phages [ 13 ]. Phage encoded lysozyme can selectively and quickly kill specific bacteria, the structure of phage lysozyme is similar, with a typical structure consisting of one or more N-terminal cell wall catalytic domains and a C-terminal cell wall binding domain [ 14 , 15 ]. The lysozyme of Gram-positive phages has been studied more, because the structural characteristics of most Gram-positive bacteria show that the structure of the cell wall adjacent to the cell membrane is the same as the structure of the outer surface of the bacterial cell wall. This provides a possibility for phage lysozyme to directly contact and hydrolyze cell wall peptidoglycan [ 16 , 17 ]. However, Gram-negative bacteria are not easily invaded by exogenous lysozyme due to their protective outer membrane. Therefore, usually with the help of membrane-destabilizing factors such as EDTA or malic acid to assist lysozyme to cross the outer membrane to reach the peptidoglycan [ 18 ]. It has been reported that natural phage lysozyme of Gram-negative bacteria have extracellular lytic activity, many researchers believe that hydrophobic peptides or polycationic peptides at the ends of lysozymes can help lysozyme to lyse Gram-negative bacteria from the outside, the effects of C-terminal positive ion and hydrophobic amino acids have also been proved [ 19 – 21 ]. In this study, we isolated a lytic E. coli phage from sewage, name it XH12. The biological characteristics of phage XH12 were analyzed, the antibacterial activity of the lysozyme Lys12 encoded by the phage XH12 was analyzed. In order to improve the antibacterial activity of lys12, we fused 5 cationic amino acid polypeptides (KRKRK) and 10 cationic amino acid polypeptides (KRKRKRKRKR) to the C-terminus of lys12 to obtain two fusion lysozymes (5aa, 10aa). The bactericidal effects of those lysozymes on E. coli were tested in vitro. Our results showed that fusion lysozymes (5aa, 10aa) have antibacterial activity against E. coli from the outside, we hope this study can provide a reference for the development of lysozyme against Gram-negative bacteria to prevent and treat multidrug-resistant E. coli infection. Materials and methods Bacterial strains and culture conditions All E. coli strains (Table 1 ) were laboratory-preserved multidrug-resistant E. coli . All strains were cultured in Luria-Bertani (LB) at 37°C. Phage isolation, propagation, and purification We first centrifuged the sewages sample at 8000 g for 10 minutes, and then filtered the clarified supernatant through a 0.22 µm filter to remove residual bacteria. 10 ml of filtered sample was added to 90 ml of sterile broth medium in a 250 ml culture flask, 100 µl host E. coli (Table 1 ) was added into culture flask. Mixed liquor was incubated under 37℃ for 12 h, 10 ml of the enrichment culture was added into a 50 ml sterile centrifuge tube and centrifuged at 8,000 g for 10 min. Supernatant was filtered through a 0.22 µm filter, 100 µl host E. coli was coated on LB solid plate, 2 µl of undiluted supernatant was dropped on the plate to form plaques. A single plaque was selected and cultured with 1 ml host E. coli eco-3 at 37℃ for 6 h, culture solution was filtered through a 0.22 µm filter. 100 µL 10-fold serially diluted phages and 100 µL host E. coli eco-3 was mixed with LB soft agar, and poured onto LB plates, single plaque was continually isolated on the plate and purified several times in succession and purified phages were collected and stored at 4℃. Transmission electron microscopy (TEM) NaCl was added into phage solution until the final concentration was 1 mol/L, phage solution was centrifuged at 12,000 g for 5 min, we retained the supernatant. PEG 8000 was added into the supernatant until its mass volume fraction reached 10%. Phage solution was placed in a 4℃ overnight to settle, phage solution was centrifuged at 10000 g for 5 minutes. The supernatant was abandoned, and re-suspended with 5 mL SM buffer and stored at 4℃. We dropped 10 µL of phages solution on the copper mesh and added 5 µL 2% phosphotungstic acid to the copper mesh, the morphology of phage was observed by transmission electron microscopy (HT7700, Japan) at 80 kV. Host ranges of phage XH12 We mixed 200 µL of bacterial cultures (Table 1 ) with 5 ml of LB soft agar, and poured the mixtures onto LB plate. 2.5 µL of 10-fold serially diluted phages in 0.95% saline were spotted onto LB soft agar and incubated at 37°C for 12 h. E. coli eco-3 was used as efficiency of plating (EOP) reference for phage XH12. The ratio of plaque forming units (pfu) of XH12 from each tested strains to the pfu from the reference strain as each susceptible strain EOP. Phage titers below 10 5 pfu/ml were considered that phages had no lytic ability to the tested strain. One‑step growth curve A one-step growth curve was generated as described previously [ 22 ]. Phage XH12 was mixed with E. coli eco-3 at a multiplicity of infection (MOI) of 1, and allowed to incubate for 5 min at 37°C. Then, the mixture was centrifuged at 8000 g for 5 min, 10 ml of preheated LB liquid medium at 37℃ was used to resuspend the bacteria. We incubated the mixture in a 37℃ shaker, at the same time, time t 0 = 0 was started, samples were collected every 20 min for 120 min continuously, the titer of phage XH12 was determined after centrifugation at 10,000 g for 5 min. The experiment was repeated three times. Stability determination of phage XH12 The thermal stability was determined by incubating phages at 10°C intervals of temperature from 40°C to 90°C for 1 h, phages were taken at 10-minute intervals for a total of 60 minutes and the titer of phage XH12 was determined. For pH stability test, phage XH12 titer was measured after phages were incubated at room temperature by mixing with equal volume of pH buffer solutions at different pH values ranging from 2 to 13 for 1 h. The experiment was repeated three times. Effect of phage XH12 on E. coli biofilms 2 ml LB broth and 100 µL of E. coli eco-3 (10 8 cfu/ml) suspensions were added into 96-well plate, the biofilms was formed after incubation at 37℃ for 48 h. We discarded the planktonic cells and washed three times with PBS, 100 µL phages (10 8 pfu/mL) was added into 96-well plate as experimental group, and 100 µL PBS was added into 96-well plate as control group. 96-well plate was cultured in a constant temperature incubator at 37℃ for 4 h, 8 h, 12 h, and 24 h respectively. We discarded the planktonic cells and washed three times with PBS, 200 µL methanol was added into each well, after 30 minutes, the methanol was discarded. We added 200 µL 1% crystal violet dye solution to each well, dyed it for 30 min, lightly washed it with 200 µL PBS for three times, and dried it at room temperature. Finally, 200 µL 33% glacial acetic acid was added into each well, optical density at 600 nm was measured after dissolution for 15 min. The biofilms reduction rate was determined by calculating the ratio of the biomass reduction of the biofilms to the control biofilms. Extraction and analysis of phage genome Phage solution was added into 50 ml centrifuge tube, added 1% chloroform by volume, centrifuged at 12,000 g for 6 min. 1/4 volume of PEG/NaCl was added into phage solution, centrifuged at 12,000 g for 20 min, supernatant was abandoned and used 2 ml PBS to re-suspension precipitation. Added 20 µl 10% SDS and incubated in a water bath at 68℃ for 15 min. Added equal volume phenol: chloroform: isoamyl alcohol = 25:24:1 into liquor and centrifuged at 12,000 g for 5 min, retained the supernatant, phage genome was purified from the supernatant by DNA purification column. Phage XH12 genome sequencing was completed by Sangon Biotech (Shanghai) company. The annotation of ORF was carried out with the NCBI online tool BLASTp ( http://blast.ncbi.nlm.nih.gov/ ), we used tRNAscan-SE server ( http://lowelab.ucsc.edu/tRNAscan-SE/ ) to make tRNA predictions. Phage XH12 phylogenetic tree was constructed by MEGA 7.0 software based on large subunits of terminal enzymes (ORF192), we drew whole genome map with CGView server ( http://cgview.ca ). Online prediction server ( https://cge.cbs.dtu.dk/services/ResFinder/ and https://cge.cbs.dtu.dk/services/VirulenceFinder/ ) were used to predict antibiotic resistance genes and virulence factors. The full genome sequence of phage XH12 has been deposited into the GenBank database with accession number PQ327946. We predicted a lysozyme gene (ORF142), named Lys12. We used I-TASSER ( https://seq2fun.dcmb.med.umich.edu/I-TASSER/ ) to predict the three-dimensional structure of the lysozyme protein. We used HDOCK Server ( http://hdock.phys.hust.edu.cn/ ) to simulate the binding of lysozyme protein to peptidoglycans. Cloning, expression, and purification of Lys12 and fusion lysozyme. Phage XH12 genome was used as template to amplify the coding sequence of Lys12, Lys-5aa and Lys-10aa. All PCR products were prepared with specific primer sets (Table 1 ). Lys12, Lys-5aa and Lys-10aa was cloned into the pET -28a (+) vector between BamHI and XhoI sites to construct recombinant plasmid pET -Lys12, pET -5aa and pET -10aa. Plasmid was transformed into E. coli BL21 (DE3) competent cells, single clone was selected and cultured bacterial solution until OD 600 is 0.5, isopropyl β-Dthiogalactoside (IPTG) was added into bacterial solution with the final concentration of 0.7 mmol/L, bacterial solution was further incubated at 18℃ for 16 h. Bacterial solution was broken by ultrasound, we retained the supernatant after centrifugation. Then, His tag present at the N-terminus of target protein was used to purify all proteins using High Affinity Ni-NTA Resin. 20 mM imidazole was used to wash the impure proteins, 300 mM imidazole was used to elute the target proteins. we used Ultrafiltration tube to concentrate the samples and remove the high concentration of imidazole and changed the buffer to PBS. Table 1 Primers, phage, bacterial strains, and plasmids used in this study Name Characteristics source Lys12-F 5´-CG GGATCC ATGAATATATTTGAAATGCTT-3´ ( BamHI ) This study Lys12-R 5´-CCG CTCGAG TCATATATACGCTTTCCA-3´ (Xho Ⅰ ) This study 5aa-F 5´-GCG GGATCC ATGAATATATTTGAAATGCTTCGTAATGACGAAGGT − 3´ ( BamHI ) This study 5aa-R 5´- GCG CTCGAG TCATTTGCGTTTGCGTTTTATATACGCTTTCCAA − 3´ (Xho Ⅰ ) This study 10aa-F 5´-GCG GGATCC ATGAATATATTTGAAATGCTTCGTAATGACGAAGGTCTTAG − 3´ ( BamHI ) This study 10aa-R 5´-GCG CTCGAG TCAGCGTTTGCGTTTGCGTTTGCGTTTGCGTTTTATATACGCT-3´ (Xho Ⅰ ) This study pET -28a (+) Expression vector ( kanamycin resistant) TaKaRa tech pET -Lys12 Recombinant vector( kanamycin resistant) This study pET -5aa Recombinant vector( kanamycin resistant) This study pET -10aa Recombinant vector( kanamycin resistant) This study DH5α E. coli Amplification host for plasmid TaKaRa Bitech BL21 E. coli Expression host for recombinant plasmid TaKaRa tech XH12 Escherichia coli phage This study Lys12 The protein expressed by pET-Lys12 recombinant vector This study 5aa The protein expressed by pET-5aa recombinant vector This study 10aa The protein expressed by pET-10aa recombinant vector This study E. coli Eco-3 One of the host bacteria of phage XH12 This study The underlined base sequences indicate restriction enzyme sites for XhoⅠ and BamHI . Antibacterial activity of Lys12 To determine the most appropriate EDTA pretreatment concentration, a single colony of the target strain ( E. coli eco-3) was cultured in LB liquid medium at 37℃ with shaking at 180 rpm until the OD 600 of the cell culture was in the range of 0.6. Then the cells were washed twice and diluted to 10 6 cfu/ml with LB broth. EDTA with the final concentration of 5 mM ,10 mM, 25 mM and 50 mM were added into bacterial suspension, the OD 600 value was measured at one-hour intervals for 5 h. EDTA with a final concentration of 5 mM was incubated with 10 8 cfu/ml E. coli eco-3 for 15 min, cells were washed twice and adjusted to 10 8 cfu/ml with LB broth. Purified Lys12 was diluted to 400 µg/ml with PBS, 100 µL bacterial suspension and 100 µL Lys12 were mixed as experimental group, 100 µL bacterial suspension and100 µL PBS were mixed as control group, 100 µL without EDTA pretreatment E. coli eco-3 (10 8 cfu/ml) and 100 µL Lys12 were mixed to determine lys12 antibacterial activity, all mixtures were incubated at 37℃ for 5 h. The OD 600 absorbance value was measured at 1 h intervals for 5 h, the samples were diluted and coated on LB agar plate at 0 h and 5 h respectively for the count of viable colonies. All experiments were repeated three times. Antimicrobial activity assay of fusion lysozyme A single colony of the target strain ( E. coli eco-3) was cultured in LB liquid medium at 37℃ with shaking at 180 rpm until the OD 600 of the cell culture was in the range of 0.6. Then the cells were washed twice and adjusted to 10 8 cfu/ml with LB broth. To compare the antimicrobial activity of Lys12 and fusion lysozyme, purified Lys12, 5aa, 10aa were diluted to 400 µg/ml with PBS, 100 µL bacterial suspension and 100 µL each of Lys12 and two fusion lysozymes (5aa, 10aa) were mixed as experimental group, bacterial suspensions and 100 µL of PBS were mixed as control group. After incubated at 37℃ for 5h, the number of live colonies was measured by colony forming unit methods. All experiments were repeated three times. Statistical analysis All data were expressed as the mean ± standard deviation (SD) and were analyzed using GraphPad Prism 8.0 software. Results Phage isolation and morphology Phage XH12 was isolated from sewage using E. coli eco-3 as host bacteria, after purification, phage XH12 with a diameter of 2 mm was produced on a double-layer plate (Fig. 1 A). Transmission electron microscopy (TEM) images showed that the XH12 had a typical icosahedral head structure and a retractable tail, with a head diameter of about 110 nm and a tail length of about 130 nm, which was consistent with the characteristics of Myoviridae , we named it as phage XH12, XH12 for short. Host range and EOP investigation The host range of phage XH12 was determined using 40 strains (Table 2 ), and the EOP of XH12 was determined using E. coli eco-3 as indicator bacteria. The EOP values of phage XH12 against different strains are listed in Table 2 . The higher the EOP value, the stronger the lytic activity of phage XH12 against the strain. In summary, phage XH12 can lyse 81% (30/37) of multidrug-resistant E. coli strains, but has no antibacterial activity against Salmonella typhimurium , Pseudomonas aeruginosa , and Staphylococcus aureus . These results indicated that phage XH12 had high host specificity, broad spectrum and strong lytic activity. Table 2 Host range of phage XH12. No. Strain source EOP No. Strain source EOP 1 E. coli Eco-1 clinical 0.856 21 E. coli Eco-21 clinical 0.956 2 E. coli Eco-2 clinical 0.893 22 E. coli Eco-22 clinical - 3 E. coli Eco-3 clinical 1.000 23 E. coli Eco-23 clinical - 4 E. coli Eco-4 clinical 0.932 24 E. coli Eco-24 clinical - 5 E. coli Eco-5 clinical 1.023 25 E. coli Eco-25 clinical 0.974 6 E. coli Eco-6 clinical 0.963 26 E. coli Eco-26 clinical 0.687 7 E. coli Eco-7 clinical 0.942 27 E. coli Eco-27 clinical 0.874 8 E. coli Eco-8 clinical 0.836 28 E. coli Eco-28 clinical / 9 E. coli Eco-9 clinical 0.971 29 E. coli Eco-29 clinical 0.684 10 E. coli Eco-10 clinical 0.896 30 E. coli Eco-30 clinical / 11 E. coli Eco-11 clinical 0.876 31 E. coli Eco-31 clinical 0.896 12 E. coli Eco-12 clinical 0.763 32 E. coli Eco-32 clinical 0.757 13 E. coli Eco-13 clinical 0.857 33 E. coli Eco-33 clinical 0.963 14 E. coli Eco-14 clinical 0.863 34 E. coli Eco-34 clinical / 15 E. coli Eco-15 clinical 0.914 35 P. aeruginosa ATCC27853 clinical - 16 E. coli Eco-16 clinical - 36 S. typhimurium ATCC14028 clinical - 17 E. coli Eco-17 clinical 0.871 37 E. coli ATCC25922 clinical 0.968 18 E. coli Eco-18 clinical 0.842 38 E. coli DH5α clinical 0.986 19 E. coli Eco-19 clinical 0.963 39 E. coli BL21 clinical 0.971 20 E. coli Eco-20 clinical 0.971 40 S. aureus ATCC25923 clinical - The ratio of pfu produced by phage XH12 in sensitive strains to that produced by indicator strain E. coli Eco-3 was measured by EOP. “-” indicates that phage XH12 does not form plaque on the agar plate. “/” indicates a phage titer lower than 10 5 pfu/ml. Biological characteristics of phage XH12 The one-step growth curve of phage XH12 showed that the incubation period of phage XH12 was about 20 min and the outbreak period was about 40 min (Fig. 2 A). The stability test of phage XH12 showed that the titer of phage XH12 did not change much in the pH range of 4–10, and it could maintain stability, however, phage XH12 cannot survive in strong acid or alkali environments (Fig. 2 B). In the temperature range of 40–60℃, the titer of XH12 remained basically unchanged, but the titer of XH12 decreased significantly in high temperature environment (Fig. 2 C). Reduction of E. coli biofilms by phage XH12 To test the clear multidrug-resistant E. coli biofilms activity of phage XH12, 48-hour biofilms produced by E. coli eco-3 was established on 96-well plate. Biofilms biomass was measured by OD 600 after phage treatment for 0, 4, 12 and 24 h. Compared with the control group, biofilms biomass decreased significantly during the first 4 hours of treatment with phage XH12. After 4 h, biofilms regeneration occurred, but biofilms biomass measured at 24 h was still lower than control group (Fig. 3 ). The results showed that phage XH12 has strong clear ability on multidrug-resistant E. coli eco-3 biofilms, and the highest reduction rate of biofilms was 79.2%. Analysis of the phage XH12 genome Phage XH12 is a double-stranded DNA molecule consisting of 170,505 bp with a GC content of 37.58%.275 putative open reading frames (ORFs) were predicted, three tRNA genes were found. In phage XH12 genome, 107 genes with gene length greater than 500 bp, 107 genes with gene length greater than 1000 bp, the longest gene length was 3876 bp, the smallest gene length was 74 bp, the total length of coding genes was 159435 bp. We predicted one lysozyme gene (ORF142), the length of the lysozyme gene sequence was 489 bp and the predicted lysozyme protein size was 23 kDa. We predicted major functional genes included amino acid transport and metabolism, nucleotide transport and metabolism, coenzyme transport and metabolism, translation, ribosome structure and biogenesis, post-translational modification, protein turnover rate, replication, recombination and repair, cell wall/membrane/envelope biogenesis, concomitant proteins, and general function prediction, the genome circle was mapped (Fig. 4 ). The large subunit sequence of the terminal enzyme (ORF192) was selected to construct homologous evolutionary tree. Phylogenetic analysis showed that phage XH12 was closely related to Escherichia phage HXO1 (Fig. 5 ). Purification of Lys12 and simulated lys12 docking with peptidoglycan The predicted lyase protein encoded by phage XH12 was named Lys12, predicted Lys12 was analyzed by SDS-PAGE, molecular weight of Lys12 was about 23 kDa, which was consistent with the predicted size (Fig. 6 ). Purified Lys12 concentration measured by NanoDrop Ultra Micro spectrophotometer was about 3.7 mg/ml. Then, we used I-TASSER to predict the three-dimensional structure of Lys12 and found the presence of a distinct pocket of active centers. We used HDOCK Server to simulate the binding of Lys12 and peptidoglycan and found that both long and short chain peptidoglycan can bind to the active center pocket of Lys12. Antibacterial activity of Lys12 Pretreatment of host E. coli Eco-3 with a final concentration of 5 mM EDTA was the most appropriate (Fig. 7 A). Vitro antibacterial activities of Lys12 under the help of EDTA against E. coli Eco-3 were determined, when E. coli Eco-3 was pretreated with 5 mM EDTA, after added Lys12 with a final concentration of 200 µg/ml, OD 600 values of E. coli Eco-3 was found to obviously decrease. After 5 h, the OD 600 values of control remained stable at approximately 0.83, the OD 600 value of experimental group was less than 0.45. There was a significant difference in the OD 600 value compared with control group. However, when E. coli Eco-3 was not pretreated used EDTA, added Lys12 with a final concentration of 200 µg/ml, the OD 600 values of E. coli Eco-3 remained stable at approximately 0.82 (Fig. 7 B). Meanwhile, the bacterial cell number showed an obvious decrease after treatment with Lys12, and control group remained stable after 5 h (Fig. 7 C). Experimental results showed that Lys12 in the absence of EDTA pretreated showed no antibacterial activity, after E. coli Eco-3 was pretreated by 5mM EDTA, Lys12 had significant antibacterial activity. Results of expression purification of fusion lysozyme and antibacterial activity We fused different amounts of positively charged amino acids at the C-terminus of Lys12. 5aa means that Lys12 fused with a peptide containing 5 cationic amino acids at the C-terminus (KRKRK), 10aa means that Lys12 fused with a peptide containing 10 cationic amino acids at the C-terminus (KRKRKRKRKR) (Fig. 8 A). we used XH12 genome as template, obtained the genes encoding 5aa, 10aa by fusion PCR, then cloned those genes into the PET -28a vector and transformed them into E. coli BL21(DE3) for expression. We finally obtained purified fusion lysozyme proteins by Genscript Ni-NTA affinity chromatography and used SDS-PAGE to analysis Lys12, 5aa and 10aa (Fig. 8 B). For explore the effects of the C-terminal cationic amino acids on the antibacterial activity of Lys12, we added Lys12 or fusion lysozyme 5aa,10aa into E. coli Eco-3 (10 8 cfu/ml) at a final concentration of 200 µg/ml and incubated for 5 h at 37℃, the number of viable colonies were measured by colony forming unit. The experimental results showed that bactericidal activity levels were 10aa>5aa>Lys12, the antibacterial activity of the fusion lysozyme increased with increasing C-terminal positive charge (Fig. 8 C). Discussion E. coli is widely found in nature, especially in the intestines and skins of humans and animals [ 23 ]. Due to the abuse of antibiotics, multidrug-resistant E. coli has emerged widely [ 24 ]. Especially the urinary tract infection caused by multidrug-resistant E. coli is a serious threat to human health [ 25 ]. The successful discovery and widespread use of small molecule antibiotics limited the development and innovation of phage therapy. However, it is now clear that relying on small molecule antibiotics is not a long-term solution [ 26 ]. Phages have many advantages such as host specificity, non-toxicity to animals, and the absence of residual effects, so phages are expected to become an alternative treatment plan for antibiotics [ 27 ]. This work has already begun, with researchers and clinicians using phages screening pipelines to identify natural phages for use in patients to overcome drug-resistant E. coli infections [ 28 , 29 ]. However, the high host specificity of phages seriously hinders the popularization and application of phages [ 30 ]. To overcome the narrow host spectrum of phages, the most common method is to develop cocktail preparations [ 31 , 32 ]. Therefore, subsequent studies can combine phage XH12 with other phages with a wide host spectrum to make up cocktail to expand the lytic spectrum. Although the effectiveness of antibiotics has declined due to bacterial resistance, it does not mean that the main position of antibiotics against drug-resistant bacteria has been shaken, and it is a good choice to use antibiotics and phages in combination against drug-resistant bacteria [ 33 – 35 ]. Given the increasing problem of antibiotic resistance worldwide, there is an urgent need to adopt globally coordinated phage therapy, standardize phage treatment protocols, and develop shared resources, such as through the establishment of phage libraries to optimize the production of clinical-grade phages, and extend these resources to low-and middle-income countries to alleviate the pressure on antibiotic resistance and reduce healthcare costs. Although phages are unlikely to completely replace antibiotics, in the long run, phage-based therapies could relatively reduce the threat of antibiotic resistance to human health. At present, the use of phage gene encoding products against bacterial infection has a good application prospect [ 36 ]. In the process of replication, each phage will express a variety of substances that can inhibit or even kill the host bacteria. Among them, phage lysozyme has entered the application stage [ 37 ]. Lysozymes have been considered potential agents for treating clinical bacterial infections [ 38 ]. Gram-negative bacteria often have a lipopolysaccharide layer outside the cell wall, this prevents lysozymes from interacting with peptidoglycans, so lysozymes maybe more promising for the infection of Gram-positive bacteria without an outer membrane structure. For lysozymes that act on Gram-negative bacteria, physical or chemical methods can be used to improve lysozyme function. Such as high static pressure, EDTA, weak organic acids and citric acid can enhance the ability of lysozyme to penetrate the outer membrane of Gram-negative [ 39 ]. Lysozyme chimeric cationic polypeptides or antimicrobial peptides can effectively lyse Gram-negative bacteria, the charge number and hydrophilicity of antimicrobial peptides had great influence on chimeric lysozyme activity [ 40 ]. On account of the phospholipid bilayer of the outer membrane of the cell wall mostly carries a negative charge, therefore, increasing the amount of positive charge carried can enhance lysozyme to bind the outer membrane and cross the Gram-negative bacteria outer membrane [ 41 ]. In our study, Lys12 combined with ethylenediaminetetraacetic acid (EDTA) had antibacterial activity against multidrug-resistant E. coli Eco-3. We fused 5 cationic amino acid polypeptides (KRKRK) and 10 cationic amino acid polypeptides (KRKRKRKRKR) to the C-terminus of Lys12 to obtain two fusion lysozymes (5aa, 10aa) and improved the antibacterial activity of Lys12 against multidrug-resistant E. coli Eco-3 from extracellular space. Usually E. coli do not exist in isolation, preferring to aggregate to form biofilms [ 42 ]. After E. coli aggregation, E. coli generate exopolysaccharides, proteins, nucleic acids, and lipids Constitute extracellular polymeric substances (EPS), which enhancing the E. coli stability of surface adhesion. After bacteria proliferate, quorum sensing (QS) is generated and formed mature E. coli biofilms [ 43 ]. Biofilms enhance bacteria tolerant for bactericidal substances, especially to antibiotics have a great resistance [ 44 , 45 ]. It is difficult to effectively remove multidrug-resistant E. coli biofilms by using antibiotics alone, however, we noted the effectiveness of phage XH12 against multidrug-resistant E. coli biofilms, therefore, combining antibiotics with phages to remove biofilms maybe a wise choice [ 46 , 47 ]. We hope that our results can provide basic information for research on the application of phages and its lysozyme in the treatment of multidrug-resistant E. coli and biofilm-associated infections. Declarations Author contributions Xuhao Hou contributed to the study conceptualization, study design, and drafting of the manuscript. Yu Li, Jiaqi Pu and Wenhai Xie contributed to data collection, statistical analysis, and revising of the manuscript. Limei Zhang and Hongkuan Deng supervised this study, funding acquisition and conceptualization. All authors approved the final manuscript as submitted and agreed to be accountable for all aspects of the work. Conflict of interest : The authors declare that they have no conflict of interest. Acknowledgments We thank the staff of the large instrument platform of Shandong University of technology for their assistance with TEM. Funding This work was supported by grants from the financial support from the Shandong Provincial Natural Science Foundation (ZR2020MC184 and No. ZR2020MC074) and Shandong Medical and Health Science and Technology Development Plan Project (202203060106). References Kaper JB, Nataro JP, Mobley HLT (2004) Pathogenic Escherichia coli . Nat Rev Microbiol 2:123–140 Huang J, Lv C, Li M, Rahman T, Chang Y-F, Guo X, Song Z, Zhao Y, Li Q, Ni P (2024) Carbapenem-resistant Escherichia coli exhibit diverse spatiotemporal epidemiological characteristics across the globe. Commun Biology 7:51 Flemming H-C, Wingender J, Szewzyk U, Steinberg P, Rice SA, Kjelleberg S (2016) Biofilms: an emergent form of bacterial life. Nat Rev Microbiol 14:563–575 Otto M (2013) Staphylococcal Infections: Mechanisms of Biofilm Maturation and Detachment as Critical Determinants of Pathogenicity. Annu Rev Med 64:175–188 Wang X, Li Q, Kang J, Yin D, Li X, Wang S, Guo Q, Song Y, Wang J, Duan JJI, Resistance D (2022) Mortality risk factors and prognostic analysis of patients with multi-drug resistant enterobacterales infection.3225–3237 Tacconelli E, Carrara E, Savoldi A, Harbarth S, Mendelson M, Monnet DL, Pulcini C, Kahlmeter G, Kluytmans J, Carmeli YJTL (2018) Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. 18:318–327 Strathdee SA, Hatfull GF, Mutalik VK, Schooley RTJC (2023) Phage therapy: From biological mechanisms to future directions. 186:17–31 Al-Shayeb B, Sachdeva R, Chen L-X, Ward F, Munk P, Devoto A, Castelle CJ, Olm MR, Bouma-Gregson K, Amano YJN (2020) Clades of huge phages from across Earth’s ecosystems. 578:425–431 Salmond GPC, Fineran PC (2015) A century of the phage: past, present and future. Nat Rev Microbiol 13:777–786 Breitbart M, Rohwer FJT (2005) Here a virus, there a virus. everywhere same virus? 13:278–284 Pallavali RR, Degati VL, Narala VR, Velpula KK, Yenugu S, Durbaka VRPJT, Applications R (2021) Lytic bacteriophages against bacterial biofilms formed by multidrug-resistant Pseudomonas aeruginosa , Escherichia coli , Klebsiella pneumoniae , and Staphylococcus aureus isolated from burn wounds. 2:120–130 Lai WCB, Chen X, Ho MKY, Xia J, Leung SSY (2020) Bacteriophage-derived endolysins to target gram-negative bacteria. Int J Pharm 589:119833 Young R (2014) Phage lysis: three steps, three choices, one outcome. J Microbiol 52:243–258 Ferraboschi P, Ciceri S, Grisenti P (2021) Applications of lysozyme, an innate immune defense factor, as an alternative antibiotic. Antibiotics 10:1534 Jarábková V, Tišáková L, Godány A (2015) Phage endolysin: a way to understand a binding function of C-terminal domains a mini review. Nova Biotechnol Chim 14:117–134 Fischetti VA (2010) Bacteriophage endolysins: a novel anti-infective to control Gram-positive pathogens. Int J Med Microbiol 300:357–362 Raz A, Serrano A, Lawson C, Thaker M, Alston T, Bournazos S, Ravetch JV, Fischetti VA (2017) Lysibodies are IgG Fc fusions with lysin binding domains targeting Staphylococcus aureus wall carbohydrates for effective phagocytosis. Proceedings of the National Academy of Sciences 114:4781–4786 Ghose C, Euler CW (2020) Gram-negative bacterial lysins. Antibiotics 9:74 Morita M, Tanji Y, Orito Y, Mizoguchi K, Soejima A, Unno H (2001) Functional analysis of antibacterial activity of Bacillus amyloliquefaciens phage endolysin against Gram-negative bacteria. FEBS Lett 500:56–59 Briers Y, Walmagh M, Van Puyenbroeck V, Cornelissen A, Cenens W, Aertsen A, Oliveira H, Azeredo J, Verween G, Pirnay J-P (2014) Engineered endolysin-based Artilysins to combat multidrug-resistant gram-negative pathogens. MBio 5:10–1128 Ma Q, Guo Z, Gao C, Zhu R, Wang S, Yu L, Qin W, Xia X, Gu J, Yan G (2017) Enhancement of the direct antimicrobial activity of Lysep3 against Escherichia coli by inserting cationic peptides into its C terminus. Antonie Van Leeuwenhoek 110:347–355 Yang Z, Liu X, Shi Y, Yin S, Shen W, Chen J, Chen Y, Chen Y, You B, Gong Y, Luo X, Zhang C, Yuan Z, Peng Y (2019) Characterization and genome annotation of a newly detected bacteriophage infecting multidrug-resistant Acinetobacter baumannii . Arch Virol 164:1527–1533 Puvača N, de Llanos Frutos R (2021) Antimicrobial resistance in Escherichia coli strains isolated from humans and pet animals. Antibiotics 10:69 Peng Z, Wang X, Huang J, Li B (2024) Pathogenic Escherichia coli . Molecular Medical Microbiology. Elsevier, pp 1065–1096 Mazzariol A, Bazaj A, Cornaglia G (2017) Multi-drug-resistant Gram-negative bacteria causing urinary tract infections: a review. J Chemother 29:2–9 Brives C, Pourraz J (2020) Phage therapy as a potential solution in the fight against AMR: obstacles and possible futures. Palgrave Commun 6:1–11 Gordillo Altamirano FL, Barr JJ (2019) Phage therapy in the postantibiotic era. Clin Microbiol Rev 32:10–1128 Rahmani R, Zarrini G, Sheikhzadeh F, Aghamohammadzadeh N (2015) Effective phages as green antimicrobial agents against antibiotic-resistant hospital Escherichia coli . Jundishapur J Microbiol 8 De Miguel T, Rama JLR, Sieiro C, Sánchez S, Villa TG (2020) Bacteriophages and lysins as possible alternatives to treat antibiotic-resistant urinary tract infections. Antibiotics 9:466 Chung KM, Liau XL, Tang SS (2023) Bacteriophages and Their Host Range in Multidrug-Resistant Bacterial Disease Treatment. Pharmaceuticals 16:1467 Ross A, Ward S, Hyman P (2016) More is better: selecting for broad host range bacteriophages. Front Microbiol 7:1352 Kunisch F, Campobasso C, Wagemans J, Yildirim S, Chan BK, Schaudinn C, Lavigne R, Turner PE, Raschke MJ, Trampuz A (2024) Targeting Pseudomonas aeruginosa biofilm with an evolutionary trained bacteriophage cocktail exploiting phage resistance trade-offs. Nat Commun 15:8572 Martin JK, Sheehan JP, Bratton BP, Moore GM, Mateus A, Li SH-J, Kim H, Rabinowitz JD, Typas A, Savitski MM (2020) A dual-mechanism antibiotic kills gram-negative bacteria and avoids drug resistance. Cell 181:1518–1532 Taati Moghadam M, Amirmozafari N, Shariati A, Hallajzadeh M, Mirkalantari S, Khoshbayan A, Masjedian Jazi F (2020) How phages overcome the challenges of drug resistant bacteria in clinical infections. Infect Drug Resist :45–61 Malik S, Nehra K, Rana JS (2021) Bacteriophage cocktail and phage antibiotic synergism as promising alternatives to conventional antibiotics for the control of multi-drug-resistant uropathogenic Escherichia coli . Virus Res 302:198496 Lin J, Du F, Long M, Li P (2022) Limitations of phage therapy and corresponding optimization strategies: a review. Molecules 27:1857 Strathdee SA, Hatfull GF, Mutalik VK, Schooley RT (2023) Phage therapy: From biological mechanisms to future directions. Cell 186:17–31 Oliveira H, Thiagarajan V, Walmagh M, Sillankorva S, Lavigne R, Neves-Petersen MT, Kluskens LD, Azeredo J (2014) A thermostable Salmonella phage endolysin, Lys68, with broad bactericidal properties against gram-negative pathogens in presence of weak acids. PLoS ONE 9:e108376 Schmelcher M, Donovan DM, Loessner MJ (2012) Bacteriophage endolysins as novel antimicrobials. Future Microbiol 7:1147–1171 Varotsou C, Premetis GE, Labrou NE (2023) Characterization and engineering studies of a new endolysin from the Propionibacterium acnes bacteriophage PAC1 for the development of a broad-spectrum artilysin with altered specificity. Int J Mol Sci 24:8523 Yan G, Yang R, Fan K, Dong H, Gao C, Wang S, Yu L, Cheng Z, Lei L (2019) External lysis of Escherichia coli by a bacteriophage endolysin modified with hydrophobic amino acids. Amb Express 9:1–7 Dang H, Lovell CR (2016) Microbial Surface Colonization and Biofilm Development in Marine Environments. Microbiol Mol Biol Rev 80:91–138 Liu S, Lu H, Zhang S, Shi Y, Chen Q (2022) Phages against pathogenic bacterial biofilms and biofilm-based infections: a review. Pharmaceutics 14:427 Niveditha S, Pramodhini S, Umadevi S, Kumar S, Stephen S (2012) The isolation and the biofilm formation of uropathogens in the patients with catheter associated urinary tract infections (UTIs). J Clin Diagn research: JCDR 6:1478 Almalki MA, Varghese R (2020) Prevalence of catheter associated biofilm producing bacteria and their antibiotic sensitivity pattern. J King Saud University-Science 32:1427–1433 Comeau AM, Tétart F, Trojet SN, Prère M-F, Krisch HM (2007) Phage-antibiotic synergy (PAS): β-lactam and quinolone antibiotics stimulate virulent phage growth. PLoS ONE 2:e799 Coulter LB, McLean RJC, Rohde RE, Aron GM (2014) Effect of bacteriophage infection in combination with tobramycin on the emergence of resistance in Escherichia coli and Pseudomonas aeruginosa biofilms. Viruses 6:3778–3786 Supplementary Files phageXH12genomeannotation.txt Cite Share Download PDF Status: Published Journal Publication published 27 Mar, 2025 Read the published version in Archives of Virology → Version 1 posted Reviewers agreed at journal 03 Dec, 2024 Reviewers invited by journal 14 Nov, 2024 Editor assigned by journal 12 Nov, 2024 First submitted to journal 11 Nov, 2024 Editorial decision: Minor Revision 29 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-5333939\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":378278795,\"identity\":\"d2e8b2b6-d88d-4e5c-b1ac-22ceb5a33f02\",\"order_by\":0,\"name\":\"Xuhao Hou\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong University of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xuhao\",\"middleName\":\"\",\"lastName\":\"Hou\",\"suffix\":\"\"},{\"id\":378278796,\"identity\":\"023769a3-efa2-489d-8dbe-0333e2d61e8e\",\"order_by\":1,\"name\":\"Jiaqi Pu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong University of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jiaqi\",\"middleName\":\"\",\"lastName\":\"Pu\",\"suffix\":\"\"},{\"id\":378278797,\"identity\":\"32c7a1a6-1751-4398-b868-b6eb35b8ba1f\",\"order_by\":2,\"name\":\"Yu Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Shandong University of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yu\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":378278798,\"identity\":\"cee29d70-e622-403c-a6a1-693af17b8c0c\",\"order_by\":3,\"name\":\"Wenhai Xie\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Westlake University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Wenhai\",\"middleName\":\"\",\"lastName\":\"Xie\",\"suffix\":\"\"},{\"id\":378278799,\"identity\":\"fbaedee2-d678-4be9-a06d-5fbc990bd223\",\"order_by\":4,\"name\":\"Limei zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Zibo Central Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Limei\",\"middleName\":\"\",\"lastName\":\"zhang\",\"suffix\":\"\"},{\"id\":378278800,\"identity\":\"4e74173b-722f-4d81-9b3a-0cc605aebc06\",\"order_by\":5,\"name\":\"Hongkuan Deng\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7ElEQVRIiWNgGAWjYBACAyBmbACxDgDxByBmYydFC+MMkBZmUrQw84AYhLSYs/cefjmzzS6P73jv4dc2v7bJ8zEzMH74mINbi2XPuTTLjW3JxZJnzqVZ5/bdNmxjZmCWnLkNj8Nu5JgZPmxjTtwAZBjn9txmBGphY+YlrKU+ccP9N2bGlj237YnRYvxwY9thoC08xo8ZftxOJKzlzBkzxhnnjifOPJNjxtjbcDu5jZmxGb9fjvcYf+wpq07sO37G+MOPP7dt57c3H/zwEY8WIGCTgDMY20A0JJ7wAeYPCMYfQopHwSgYBaNgJAIAKrlaHaHtEWoAAAAASUVORK5CYII=\",\"orcid\":\"https://orcid.org/0009-0002-1815-0237\",\"institution\":\"Shandong University of Technology\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Hongkuan\",\"middleName\":\"\",\"lastName\":\"Deng\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-10-25 17:19:03\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-5333939/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-5333939/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1007/s00705-025-06274-w\",\"type\":\"published\",\"date\":\"2025-03-27T15:57:15+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":70380717,\"identity\":\"46534bd9-1404-4a67-a06e-bb304cf98d00\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 15:56:02\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":341747,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eMorphology of phage XH12. (A) Phage XH12 form bright plaque on a double plate. (B)TEM image of phage XH12 with a head diameter of about 110 nm and a tail length of about 130 nm.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5333939/v1/5698262cc4ad0d6eb75801ba.png\"},{\"id\":70381187,\"identity\":\"21d63aa3-8556-428b-bd5a-e76725397223\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 16:04:02\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":120960,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eOne-step growth curve and stability test of phage XH12. (A) One-step growth curve of phage XH12. The incubation period of phage XH12 was about 20 min and the outbreak period was about 40 min. (B) The stability of phage XH12 was determined in different acid-base environments. Phage XH12 was relatively stable within the pH range of 4-10. (C) The stability of phage XH12 was determined in different temperature. The phage XH12 maintained a high titer at 40-70℃, and the titer dropped significantly at 80℃ or 90℃. The data are expressed as the mean ± SD (n = 3).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5333939/v1/738cf5d59d9329e1c26e4639.png\"},{\"id\":70380714,\"identity\":\"e91ad731-b111-46dd-897f-2028e609fd4f\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 15:56:02\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":14200,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eReduction of \\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3 biofilms by phage XH12. Phage XH12 with titer 10\\u003csup\\u003e8\\u003c/sup\\u003e reduced biofilms biomass produced by \\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3 on 96-well plates at 4, 8, 12 and 24 h. Data are expressed as the mean ± SD (n = 3). **, \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5333939/v1/900cdeac3a11df707525a790.png\"},{\"id\":70380720,\"identity\":\"e793b47b-328d-4494-a2f6-dc5bfae22b8f\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 15:56:03\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":424535,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eGenome map of phage XH12. Different functional proteins are represented by different colors and mainly contain amino acid transport and metabolism, nucleotide transport and metabolism, coenzyme transport and metabolism, translation, ribosome structure and biogenesis, post-translational modification, protein turnover rate, replication, recombination and repair, cell wall/membrane/envelope biogenesis, concomitant proteins, and general function prediction.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5333939/v1/cf7d7e40e1a091acfa1fd66c.png\"},{\"id\":70380716,\"identity\":\"1559c466-603e-4fb9-8c63-770aa145c051\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 15:56:02\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":8289,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePhylogenetic analysis of phage XH12. Phylogenetic trees were constructed based on phage terminate large subunit amino acid sequences (ORF192) using MEGA7 software, showing the relationships between phage XH12 and other known phages. GenBank numbers of these phages are shown in brackets.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5333939/v1/1fbe2b4b5c563ccad342b7e7.png\"},{\"id\":70380725,\"identity\":\"d07951ed-c8bb-4110-b69b-0c2cd9c55432\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 15:56:03\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":327191,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePurified Lys12 analysis and binding simulation of Lys12 and peptidoglycan. (A) Lys12, the purified recombinant lysozyme protein (23 kDa), purified by Ni-affinity chromatography; M, protein marker (14.4-116 kDa). (B) Prediction of three-dimensional structure of Lys12, there is a distinct pocket of enzyme activity. (C) Simulation of Lys12 binding to short chain peptidoglycan. (D) Simulation of lys12 binding to long chain peptidoglycan.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5333939/v1/3abcff899940c5fef74eb868.png\"},{\"id\":70380722,\"identity\":\"90d2c2c2-264d-4003-a94c-6df0a1a01c13\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 15:56:03\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":105656,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAntibacterial activity of Lys12. (A) Effects of different concentrations of EDTA on \\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3 growth. (B) The antibacterial activity of Lys12 against\\u003cem\\u003e E. \\u003c/em\\u003ecoli Eco-3 at a final concentration of 200 μg/ml was examined each hour for 5 h. (C) The antibacterial activity was shown as the cfu at 0 h and 5 h. Data are expressed as the mean ± SD (n = 3). ***, \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.001\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5333939/v1/118b53cbb2c2661739de43de.png\"},{\"id\":70381189,\"identity\":\"f39a1239-0124-4833-88f7-c44ea21fea71\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 16:04:04\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":162518,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAntibacterial activity of the fusion lysozyme. (A) Schematic diagram of Lys12 and two C-terminal cationic peptides fused lysozymes. The pI of the C-terminal region is shown at the right side of each protein. (B) SDS-PAGE results for production of Lys12 and two fusion lysozyme proteins. Lane 1 is a protein marker (14–97 kDa); Lane 2 is Lys12 (23 kDa); Lane 3 is 5aa (24.5 kDa); Lane 4 is 10aa (25.4 kDa). (C) The antibacterial activity of Lys12, 5aa and 10aa were detected by count of viable colonies. The bacterial survival numbers of Lys12 and two fusion lysozyme proteins treated \\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3 were: Control, 5.6×10\\u003csup\\u003e7\\u003c/sup\\u003e cfu/ml; Lys12, 5.1×10\\u003csup\\u003e7\\u003c/sup\\u003e cfu/ml; 5aa, 1.3×10\\u003csup\\u003e7\\u003c/sup\\u003e cfu/ml; 10aa, 4.1×10\\u003csup\\u003e6\\u003c/sup\\u003e cfu/ml. The bacterial cell number showed a significant difference between Lys12, 5aa and 10aa. Data are expressed as the mean ± SD (n = 3). *, \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.1, **, \\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5333939/v1/f1933d2be3acf6eda540038c.png\"},{\"id\":79604816,\"identity\":\"91c10e27-a7a8-441a-b820-c3335244db0f\",\"added_by\":\"auto\",\"created_at\":\"2025-03-31 16:07:02\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2804462,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5333939/v1/7448c76e-5d18-4159-8ab3-3d41d39086f2.pdf\"},{\"id\":70381188,\"identity\":\"7d5d67d8-bd0d-471c-ab91-2923733ec83c\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 16:04:03\",\"extension\":\"txt\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":361293,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"phageXH12genomeannotation.txt\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5333939/v1/413277f7cd5ca86f03aa5721.txt\"}],\"financialInterests\":\"\",\"formattedTitle\":\"Isolation, identification and genome analysis of a new Escherichia coli phage XH12 and enhancement of antibacterial activity of its lysozyme by chimeric cationic peptides\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003e \\u003cem\\u003eE. coli\\u003c/em\\u003e is a common and widely distributed opportunistic pathogen, which can cause gastrointestinal, urinary tract, arthritis, meningitis and septic infections in humans and many animals under certain condition [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. \\u003cem\\u003eE. coli\\u003c/em\\u003e biofilms help the bacteria survive in adverse environmental conditions, contributing to persistent infection and resistance to conventional antibiotics [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Due to the effectiveness and broad spectrum of antibiotics, antibiotics have become the main means of treating microbial infectious diseases, however, the abuse of antibiotics lead to the continuous emergence of drug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e, especially the emergence of carbapenem-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e poses a serious threat to human health, traditional antibiotics are difficult to deal with the threat of drug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e to human health [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. At present, the discovery of new antibiotics is increasingly difficult, and the development rate of new antibiotics is much slower than the emergence of drug-resistant bacteria [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. Therefore, in addition to antibiotics, there is an urgent need for humans to seek more means to fight bacterial infections, such as phage therapy [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003ePhages are the organisms with the largest diversity and abundance in the biosphere of the earth [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. Phages are predators in the ecosystem, natural enemies of pathogenic bacteria of animals and plants, and important members of microorganisms in the human body [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. Phages play an important role in the type, quantity and distribution regulation of human flora, which is significant importance to human health [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. The eradication of multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e strains and biofilms by phages has been studied for many years, and good results have been achieved [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. After phages infect bacteria, new phages particles synthesized in the bacteria must pass through the cell membrane and cell wall structure of the bacteria before they can be released to the outside of the bacteria. For cell membrane barriers, phages encode holins that punch holes in the cell membrane to destroy the bacterial cell membrane. For cell wall barriers, phages destroy the integrity of the cell wall by encoding lysozyme that binds to specific structures on the cell wall and hydrolyzes specific chemical bonds [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. dsDNA phages rely primarily on holins and lysozyme to lyse bacteria, holins can form transmembrane pores on the cell membrane at a specific time point and change the permeability of the host cell membrane, and lysozyme can reach the cell wall through the pores formed by holins on the cell membrane and hydrolyze and destroy peptidoglycan. This causes the host bacteria to lyse and die under osmotic pressure, releasing their progeny phages [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003ePhage encoded lysozyme can selectively and quickly kill specific bacteria, the structure of phage lysozyme is similar, with a typical structure consisting of one or more N-terminal cell wall catalytic domains and a C-terminal cell wall binding domain [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. The lysozyme of Gram-positive phages has been studied more, because the structural characteristics of most Gram-positive bacteria show that the structure of the cell wall adjacent to the cell membrane is the same as the structure of the outer surface of the bacterial cell wall. This provides a possibility for phage lysozyme to directly contact and hydrolyze cell wall peptidoglycan [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. However, Gram-negative bacteria are not easily invaded by exogenous lysozyme due to their protective outer membrane. Therefore, usually with the help of membrane-destabilizing factors such as EDTA or malic acid to assist lysozyme to cross the outer membrane to reach the peptidoglycan [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. It has been reported that natural phage lysozyme of Gram-negative bacteria have extracellular lytic activity, many researchers believe that hydrophobic peptides or polycationic peptides at the ends of lysozymes can help lysozyme to lyse Gram-negative bacteria from the outside, the effects of C-terminal positive ion and hydrophobic amino acids have also been proved [\\u003cspan additionalcitationids=\\\"CR20\\\" citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eIn this study, we isolated a lytic \\u003cem\\u003eE. coli\\u003c/em\\u003e phage from sewage, name it XH12. The biological characteristics of phage XH12 were analyzed, the antibacterial activity of the lysozyme Lys12 encoded by the phage XH12 was analyzed. In order to improve the antibacterial activity of lys12, we fused 5 cationic amino acid polypeptides (KRKRK) and 10 cationic amino acid polypeptides (KRKRKRKRKR) to the C-terminus of lys12 to obtain two fusion lysozymes (5aa, 10aa). The bactericidal effects of those lysozymes on \\u003cem\\u003eE. coli\\u003c/em\\u003e were tested in vitro. Our results showed that fusion lysozymes (5aa, 10aa) have antibacterial activity against \\u003cem\\u003eE. coli\\u003c/em\\u003e from the outside, we hope this study can provide a reference for the development of lysozyme against Gram-negative bacteria to prevent and treat multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e infection.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eBacterial strains and culture conditions\\u003c/h2\\u003e \\u003cp\\u003eAll \\u003cem\\u003eE. coli\\u003c/em\\u003e strains (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e) were laboratory-preserved multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e. All strains were cultured in Luria-Bertani (LB) at 37\\u0026deg;C.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePhage isolation, propagation, and purification\\u003c/h2\\u003e \\u003cp\\u003eWe first centrifuged the sewages sample at 8000 g for 10 minutes, and then filtered the clarified supernatant through a 0.22 \\u0026micro;m filter to remove residual bacteria. 10 ml of filtered sample was added to 90 ml of sterile broth medium in a 250 ml culture flask, 100 \\u0026micro;l host \\u003cem\\u003eE. coli\\u003c/em\\u003e (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e) was added into culture flask. Mixed liquor was incubated under 37℃ for 12 h, 10 ml of the enrichment culture was added into a 50 ml sterile centrifuge tube and centrifuged at 8,000 g for 10 min. Supernatant was filtered through a 0.22 \\u0026micro;m filter, 100 \\u0026micro;l host \\u003cem\\u003eE. coli\\u003c/em\\u003e was coated on LB solid plate, 2 \\u0026micro;l of undiluted supernatant was dropped on the plate to form plaques. A single plaque was selected and cultured with 1 ml host \\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3 at 37℃ for 6 h, culture solution was filtered through a 0.22 \\u0026micro;m filter. 100 \\u0026micro;L 10-fold serially diluted phages and 100 \\u0026micro;L host \\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3 was mixed with LB soft agar, and poured onto LB plates, single plaque was continually isolated on the plate and purified several times in succession and purified phages were collected and stored at 4℃.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eTransmission electron microscopy (TEM)\\u003c/h2\\u003e \\u003cp\\u003eNaCl was added into phage solution until the final concentration was 1 mol/L, phage solution was centrifuged at 12,000 g for 5 min, we retained the supernatant. PEG 8000 was added into the supernatant until its mass volume fraction reached 10%. Phage solution was placed in a 4℃ overnight to settle, phage solution was centrifuged at 10000 g for 5 minutes. The supernatant was abandoned, and re-suspended with 5 mL SM buffer and stored at 4℃. We dropped 10 \\u0026micro;L of phages solution on the copper mesh and added 5 \\u0026micro;L 2% phosphotungstic acid to the copper mesh, the morphology of phage was observed by transmission electron microscopy (HT7700, Japan) at 80 kV.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eHost ranges of phage XH12\\u003c/h2\\u003e \\u003cp\\u003eWe mixed 200 \\u0026micro;L of bacterial cultures (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e) with 5 ml of LB soft agar, and poured the mixtures onto LB plate. 2.5 \\u0026micro;L of 10-fold serially diluted phages in 0.95% saline were spotted onto LB soft agar and incubated at 37\\u0026deg;C for 12 h. \\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3 was used as efficiency of plating (EOP) reference for phage XH12. The ratio of plaque forming units (pfu) of XH12 from each tested strains to the pfu from the reference strain as each susceptible strain EOP. Phage titers below 10\\u003csup\\u003e5\\u003c/sup\\u003e pfu/ml were considered that phages had no lytic ability to the tested strain.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eOne‑step growth curve\\u003c/h2\\u003e \\u003cp\\u003eA one-step growth curve was generated as described previously [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. Phage XH12 was mixed with \\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3 at a multiplicity of infection (MOI) of 1, and allowed to incubate for 5 min at 37\\u0026deg;C. Then, the mixture was centrifuged at 8000 g for 5 min, 10 ml of preheated LB liquid medium at 37℃ was used to resuspend the bacteria. We incubated the mixture in a 37℃ shaker, at the same time, time t\\u003csub\\u003e0\\u003c/sub\\u003e\\u0026thinsp;=\\u0026thinsp;0 was started, samples were collected every 20 min for 120 min continuously, the titer of phage XH12 was determined after centrifugation at 10,000 g for 5 min. The experiment was repeated three times.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStability determination of phage XH12\\u003c/h2\\u003e \\u003cp\\u003eThe thermal stability was determined by incubating phages at 10\\u0026deg;C intervals of temperature from 40\\u0026deg;C to 90\\u0026deg;C for 1 h, phages were taken at 10-minute intervals for a total of 60 minutes and the titer of phage XH12 was determined. For pH stability test, phage XH12 titer was measured after phages were incubated at room temperature by mixing with equal volume of pH buffer solutions at different pH values ranging from 2 to 13 for 1 h. The experiment was repeated three times.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eEffect of phage XH12 on\\u003c/b\\u003e \\u003cb\\u003eE. coli\\u003c/b\\u003e \\u003cb\\u003ebiofilms\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003e2 ml LB broth and 100 \\u0026micro;L of \\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3 (10\\u003csup\\u003e8\\u003c/sup\\u003e cfu/ml) suspensions were added into 96-well plate, the biofilms was formed after incubation at 37℃ for 48 h. We discarded the planktonic cells and washed three times with PBS, 100 \\u0026micro;L phages (10\\u003csup\\u003e8\\u003c/sup\\u003e pfu/mL) was added into 96-well plate as experimental group, and 100 \\u0026micro;L PBS was added into 96-well plate as control group. 96-well plate was cultured in a constant temperature incubator at 37℃ for 4 h, 8 h, 12 h, and 24 h respectively. We discarded the planktonic cells and washed three times with PBS, 200 \\u0026micro;L methanol was added into each well, after 30 minutes, the methanol was discarded. We added 200 \\u0026micro;L 1% crystal violet dye solution to each well, dyed it for 30 min, lightly washed it with 200 \\u0026micro;L PBS for three times, and dried it at room temperature. Finally, 200 \\u0026micro;L 33% glacial acetic acid was added into each well, optical density at 600 nm was measured after dissolution for 15 min. The biofilms reduction rate was determined by calculating the ratio of the biomass reduction of the biofilms to the control biofilms.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eExtraction and analysis of phage genome\\u003c/h2\\u003e \\u003cp\\u003ePhage solution was added into 50 ml centrifuge tube, added 1% chloroform by volume, centrifuged at 12,000 g for 6 min. 1/4 volume of PEG/NaCl was added into phage solution, centrifuged at 12,000 g for 20 min, supernatant was abandoned and used 2 ml PBS to re-suspension precipitation. Added 20 \\u0026micro;l 10% SDS and incubated in a water bath at 68℃ for 15 min. Added equal volume phenol: chloroform: isoamyl alcohol\\u0026thinsp;=\\u0026thinsp;25:24:1 into liquor and centrifuged at 12,000 g for 5 min, retained the supernatant, phage genome was purified from the supernatant by DNA purification column.\\u003c/p\\u003e \\u003cp\\u003ePhage XH12 genome sequencing was completed by Sangon Biotech (Shanghai) company. The annotation of ORF was carried out with the NCBI online tool BLASTp (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://blast.ncbi.nlm.nih.gov/\\u003c/span\\u003e\\u003cspan address=\\\"http://blast.ncbi.nlm.nih.gov/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e), we used tRNAscan-SE server (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://lowelab.ucsc.edu/tRNAscan-SE/\\u003c/span\\u003e\\u003cspan address=\\\"http://lowelab.ucsc.edu/tRNAscan-SE/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) to make tRNA predictions. Phage XH12 phylogenetic tree was constructed by MEGA 7.0 software based on large subunits of terminal enzymes (ORF192), we drew whole genome map with CGView server (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://cgview.ca\\u003c/span\\u003e\\u003cspan address=\\\"http://cgview.ca\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). Online prediction server (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://cge.cbs.dtu.dk/services/ResFinder/\\u003c/span\\u003e\\u003cspan address=\\\"https://cge.cbs.dtu.dk/services/ResFinder/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e and \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://cge.cbs.dtu.dk/services/VirulenceFinder/\\u003c/span\\u003e\\u003cspan address=\\\"https://cge.cbs.dtu.dk/services/VirulenceFinder/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) were used to predict antibiotic resistance genes and virulence factors. The full genome sequence of phage XH12 has been deposited into the GenBank database with accession number PQ327946. We predicted a lysozyme gene (ORF142), named Lys12. We used I-TASSER (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://seq2fun.dcmb.med.umich.edu/I-TASSER/\\u003c/span\\u003e\\u003cspan address=\\\"https://seq2fun.dcmb.med.umich.edu/I-TASSER/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) to predict the three-dimensional structure of the lysozyme protein. We used HDOCK Server (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://hdock.phys.hust.edu.cn/\\u003c/span\\u003e\\u003cspan address=\\\"http://hdock.phys.hust.edu.cn/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) to simulate the binding of lysozyme protein to peptidoglycans.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eCloning, expression, and purification of Lys12 and fusion lysozyme.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003ePhage XH12 genome was used as template to amplify the coding sequence of Lys12, Lys-5aa and Lys-10aa. All PCR products were prepared with specific primer sets (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). Lys12, Lys-5aa and Lys-10aa was cloned into the \\u003cem\\u003epET\\u003c/em\\u003e-28a (+) vector between \\u003cem\\u003eBamHI\\u003c/em\\u003e and \\u003cem\\u003eXhoI\\u003c/em\\u003e sites to construct recombinant plasmid \\u003cem\\u003epET\\u003c/em\\u003e-Lys12, \\u003cem\\u003epET\\u003c/em\\u003e-5aa and \\u003cem\\u003epET\\u003c/em\\u003e-10aa. Plasmid was transformed into \\u003cem\\u003eE. coli\\u003c/em\\u003e BL21 (DE3) competent cells, single clone was selected and cultured bacterial solution until OD\\u003csub\\u003e600\\u003c/sub\\u003e is 0.5, isopropyl β-Dthiogalactoside (IPTG) was added into bacterial solution with the final concentration of 0.7 mmol/L, bacterial solution was further incubated at 18℃ for 16 h. Bacterial solution was broken by ultrasound, we retained the supernatant after centrifugation. Then, His tag present at the N-terminus of target protein was used to purify all proteins using High Affinity Ni-NTA Resin. 20 mM imidazole was used to wash the impure proteins, 300 mM imidazole was used to elute the target proteins. we used Ultrafiltration tube to concentrate the samples and remove the high concentration of imidazole and changed the buffer to PBS.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimers, phage, bacterial strains, and plasmids used in this study\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eName\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCharacteristics\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003esource\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLys12-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CG\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eGGATCC\\u003c/span\\u003eATGAATATATTTGAAATGCTT-3\\u0026acute; (\\u003cem\\u003eBamHI\\u003c/em\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLys12-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-CCG\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eCTCGAG\\u003c/span\\u003eTCATATATACGCTTTCCA-3\\u0026acute; \\u003cem\\u003e(Xho Ⅰ\\u003c/em\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e5aa-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-GCG\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eGGATCC\\u003c/span\\u003eATGAATATATTTGAAATGCTTCGTAATGACGAAGGT \\u0026minus;\\u0026thinsp;3\\u0026acute; (\\u003cem\\u003eBamHI\\u003c/em\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e5aa-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;- GCG\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eCTCGAG\\u003c/span\\u003eTCATTTGCGTTTGCGTTTTATATACGCTTTCCAA \\u0026minus;\\u0026thinsp;3\\u0026acute; \\u003cem\\u003e(Xho Ⅰ\\u003c/em\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e10aa-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-GCG\\u003cspan type=\\\"ItalicUnderline\\\" class=\\\"ItalicUnderline\\\" name=\\\"Emphasis\\\"\\u003eGGATCC\\u003c/span\\u003eATGAATATATTTGAAATGCTTCGTAATGACGAAGGTCTTAG \\u0026minus;\\u0026thinsp;3\\u0026acute; (\\u003cem\\u003eBamHI\\u003c/em\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e10aa-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5\\u0026acute;-GCG\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eCTCGAG\\u003c/span\\u003eTCAGCGTTTGCGTTTGCGTTTGCGTTTGCGTTTTATATACGCT-3\\u0026acute; \\u003cem\\u003e(Xho Ⅰ\\u003c/em\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003epET\\u003c/em\\u003e-28a (+)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eExpression vector ( kanamycin resistant)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTaKaRa tech\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003epET\\u003c/em\\u003e-Lys12\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRecombinant vector( kanamycin resistant)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003epET\\u003c/em\\u003e-5aa\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRecombinant vector( kanamycin resistant)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003epET\\u003c/em\\u003e-10aa\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRecombinant vector( kanamycin resistant)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eDH5α \\u003cem\\u003eE. coli\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAmplification host for plasmid\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTaKaRa Bitech\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBL21 \\u003cem\\u003eE. coli\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eExpression host for recombinant plasmid\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTaKaRa tech\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eXH12\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eEscherichia coli\\u003c/em\\u003e phage\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLys12\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eThe protein expressed by pET-Lys12 recombinant vector\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e5aa\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eThe protein expressed by pET-5aa recombinant vector\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e10aa\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eThe protein expressed by pET-10aa recombinant vector\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eOne of the host bacteria of phage XH12\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe underlined base sequences indicate restriction enzyme sites for \\u003cem\\u003eXhoⅠ\\u003c/em\\u003e and \\u003cem\\u003eBamHI\\u003c/em\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAntibacterial activity of Lys12\\u003c/h2\\u003e \\u003cp\\u003eTo determine the most appropriate EDTA pretreatment concentration, a single colony of the target strain (\\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3) was cultured in LB liquid medium at 37℃ with shaking at 180 rpm until the OD\\u003csub\\u003e600\\u003c/sub\\u003e of the cell culture was in the range of 0.6. Then the cells were washed twice and diluted to 10\\u003csup\\u003e6\\u003c/sup\\u003e cfu/ml with LB broth. EDTA with the final concentration of 5 mM ,10 mM, 25 mM and 50 mM were added into bacterial suspension, the OD\\u003csub\\u003e600\\u003c/sub\\u003e value was measured at one-hour intervals for 5 h.\\u003c/p\\u003e \\u003cp\\u003eEDTA with a final concentration of 5 mM was incubated with 10\\u003csup\\u003e8\\u003c/sup\\u003e cfu/ml \\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3 for 15 min, cells were washed twice and adjusted to 10\\u003csup\\u003e8\\u003c/sup\\u003e cfu/ml with LB broth. Purified Lys12 was diluted to 400 \\u0026micro;g/ml with PBS, 100 \\u0026micro;L bacterial suspension and 100 \\u0026micro;L Lys12 were mixed as experimental group, 100 \\u0026micro;L bacterial suspension and100 \\u0026micro;L PBS were mixed as control group, 100 \\u0026micro;L without EDTA pretreatment \\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3 (10\\u003csup\\u003e8\\u003c/sup\\u003e cfu/ml) and 100 \\u0026micro;L Lys12 were mixed to determine lys12 antibacterial activity, all mixtures were incubated at 37℃ for 5 h. The OD\\u003csub\\u003e600\\u003c/sub\\u003e absorbance value was measured at 1 h intervals for 5 h, the samples were diluted and coated on LB agar plate at 0 h and 5 h respectively for the count of viable colonies. All experiments were repeated three times.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAntimicrobial activity assay of fusion lysozyme\\u003c/h2\\u003e \\u003cp\\u003eA single colony of the target strain (\\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3) was cultured in LB liquid medium at 37℃ with shaking at 180 rpm until the OD\\u003csub\\u003e600\\u003c/sub\\u003e of the cell culture was in the range of 0.6. Then the cells were washed twice and adjusted to 10\\u003csup\\u003e8\\u003c/sup\\u003e cfu/ml with LB broth. To compare the antimicrobial activity of Lys12 and fusion lysozyme, purified Lys12, 5aa, 10aa were diluted to 400 \\u0026micro;g/ml with PBS, 100 \\u0026micro;L bacterial suspension and 100 \\u0026micro;L each of Lys12 and two fusion lysozymes (5aa, 10aa) were mixed as experimental group, bacterial suspensions and 100 \\u0026micro;L of PBS were mixed as control group. After incubated at 37℃ for 5h, the number of live colonies was measured by colony forming unit methods. All experiments were repeated three times.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eAll data were expressed as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation (SD) and were analyzed using GraphPad Prism 8.0 software.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePhage isolation and morphology\\u003c/h2\\u003e \\u003cp\\u003ePhage XH12 was isolated from sewage using \\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3 as host bacteria, after purification, phage XH12 with a diameter of 2 mm was produced on a double-layer plate (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). Transmission electron microscopy (TEM) images showed that the XH12 had a typical icosahedral head structure and a retractable tail, with a head diameter of about 110 nm and a tail length of about 130 nm, which was consistent with the characteristics of \\u003cem\\u003eMyoviridae\\u003c/em\\u003e, we named it as phage XH12, XH12 for short.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eHost range and EOP investigation\\u003c/h2\\u003e \\u003cp\\u003eThe host range of phage XH12 was determined using 40 strains (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e), and the EOP of XH12 was determined using \\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3 as indicator bacteria. The EOP values of phage XH12 against different strains are listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e. The higher the EOP value, the stronger the lytic activity of phage XH12 against the strain. In summary, phage XH12 can lyse 81% (30/37) of multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e strains, but has no antibacterial activity against \\u003cem\\u003eSalmonella typhimurium\\u003c/em\\u003e, \\u003cem\\u003ePseudomonas aeruginosa\\u003c/em\\u003e, and \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e. These results indicated that phage XH12 had high host specificity, broad spectrum and strong lytic activity.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eHost range of phage XH12.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"9\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c8\\\" colnum=\\\"8\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c9\\\" colnum=\\\"9\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eNo.\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eStrain\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003esource\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eEOP\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eNo.\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eStrain\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003esource\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c9\\\" namest=\\\"c8\\\"\\u003e \\u003cp\\u003eEOP\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.856\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e21\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-21\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.956\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.893\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e22\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-22\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e1.000\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e23\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-23\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.932\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e24\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-24\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e1.023\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e25\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-25\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.974\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.963\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e26\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-26\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.687\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e7\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-7\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.942\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e27\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-27\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.874\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e8\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-8\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.836\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e28\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-28\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e/\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.971\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e29\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-29\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.684\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.896\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e30\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-30\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e/\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e11\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-11\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.876\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e31\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-31\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.896\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e12\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-12\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.763\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e32\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-32\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.757\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e13\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-13\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.857\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e33\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-33\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.963\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e14\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-14\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.863\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e34\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-34\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e/\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e15\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-15\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.914\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e35\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eP. aeruginosa\\u003c/em\\u003e ATCC27853\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e16\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-16\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e36\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. typhimurium\\u003c/em\\u003e ATCC14028\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e17\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-17\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.871\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e37\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e ATCC25922\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.968\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e18\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-18\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.842\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e38\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e DH5α\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.986\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e19\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-19\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.963\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e39\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e BL21\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e0.971\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e20\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-20\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.971\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e40\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. aureus\\u003c/em\\u003e ATCC25923\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eclinical\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"1\\\" nameend=\\\"c9\\\" namest=\\\"c9\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe ratio of pfu produced by phage XH12 in sensitive strains to that produced by indicator strain \\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3 was measured by EOP. \\u0026ldquo;-\\u0026rdquo; indicates that phage XH12 does not form plaque on the agar plate. \\u0026ldquo;/\\u0026rdquo; indicates a phage titer lower than 10\\u003csup\\u003e5\\u003c/sup\\u003e pfu/ml.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eBiological characteristics of phage XH12\\u003c/h2\\u003e \\u003cp\\u003eThe one-step growth curve of phage XH12 showed that the incubation period of phage XH12 was about 20 min and the outbreak period was about 40 min (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). The stability test of phage XH12 showed that the titer of phage XH12 did not change much in the pH range of 4\\u0026ndash;10, and it could maintain stability, however, phage XH12 cannot survive in strong acid or alkali environments (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). In the temperature range of 40\\u0026ndash;60℃, the titer of XH12 remained basically unchanged, but the titer of XH12 decreased significantly in high temperature environment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eReduction of\\u003c/b\\u003e \\u003cb\\u003eE. coli\\u003c/b\\u003e \\u003cb\\u003ebiofilms by phage XH12\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eTo test the clear multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e biofilms activity of phage XH12, 48-hour biofilms produced by \\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3 was established on 96-well plate. Biofilms biomass was measured by OD\\u003csub\\u003e600\\u003c/sub\\u003e after phage treatment for 0, 4, 12 and 24 h. Compared with the control group, biofilms biomass decreased significantly during the first 4 hours of treatment with phage XH12. After 4 h, biofilms regeneration occurred, but biofilms biomass measured at 24 h was still lower than control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). The results showed that phage XH12 has strong clear ability on multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3 biofilms, and the highest reduction rate of biofilms was 79.2%.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAnalysis of the phage XH12 genome\\u003c/h2\\u003e \\u003cp\\u003ePhage XH12 is a double-stranded DNA molecule consisting of 170,505 bp with a GC content of 37.58%.275 putative open reading frames (ORFs) were predicted, three tRNA genes were found. In phage XH12 genome, 107 genes with gene length greater than 500 bp, 107 genes with gene length greater than 1000 bp, the longest gene length was 3876 bp, the smallest gene length was 74 bp, the total length of coding genes was 159435 bp. We predicted one lysozyme gene (ORF142), the length of the lysozyme gene sequence was 489 bp and the predicted lysozyme protein size was 23 kDa. We predicted major functional genes included amino acid transport and metabolism, nucleotide transport and metabolism, coenzyme transport and metabolism, translation, ribosome structure and biogenesis, post-translational modification, protein turnover rate, replication, recombination and repair, cell wall/membrane/envelope biogenesis, concomitant proteins, and general function prediction, the genome circle was mapped (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). The large subunit sequence of the terminal enzyme (ORF192) was selected to construct homologous evolutionary tree. Phylogenetic analysis showed that phage XH12 was closely related to \\u003cem\\u003eEscherichia\\u003c/em\\u003e phage HXO1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePurification of Lys12 and simulated lys12 docking with peptidoglycan\\u003c/h2\\u003e \\u003cp\\u003eThe predicted lyase protein encoded by phage XH12 was named Lys12, predicted Lys12 was analyzed by SDS-PAGE, molecular weight of Lys12 was about 23 kDa, which was consistent with the predicted size (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). Purified Lys12 concentration measured by NanoDrop Ultra Micro spectrophotometer was about 3.7 mg/ml. Then, we used I-TASSER to predict the three-dimensional structure of Lys12 and found the presence of a distinct pocket of active centers. We used HDOCK Server to simulate the binding of Lys12 and peptidoglycan and found that both long and short chain peptidoglycan can bind to the active center pocket of Lys12.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAntibacterial activity of Lys12\\u003c/h2\\u003e \\u003cp\\u003ePretreatment of host \\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3 with a final concentration of 5 mM EDTA was the most appropriate (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eA). Vitro antibacterial activities of Lys12 under the help of EDTA against \\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3 were determined, when \\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3 was pretreated with 5 mM EDTA, after added Lys12 with a final concentration of 200 \\u0026micro;g/ml, OD\\u003csub\\u003e600\\u003c/sub\\u003e values of \\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3 was found to obviously decrease. After 5 h, the OD\\u003csub\\u003e600\\u003c/sub\\u003e values of control remained stable at approximately 0.83, the OD\\u003csub\\u003e600\\u003c/sub\\u003e value of experimental group was less than 0.45. There was a significant difference in the OD\\u003csub\\u003e600\\u003c/sub\\u003e value compared with control group. However, when \\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3 was not pretreated used EDTA, added Lys12 with a final concentration of 200 \\u0026micro;g/ml, the OD\\u003csub\\u003e600\\u003c/sub\\u003e values of \\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3 remained stable at approximately 0.82 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eB). Meanwhile, the bacterial cell number showed an obvious decrease after treatment with Lys12, and control group remained stable after 5 h (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eC). Experimental results showed that Lys12 in the absence of EDTA pretreated showed no antibacterial activity, after \\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3 was pretreated by 5mM EDTA, Lys12 had significant antibacterial activity.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eResults of expression purification of fusion lysozyme and antibacterial activity\\u003c/h2\\u003e \\u003cp\\u003eWe fused different amounts of positively charged amino acids at the C-terminus of Lys12. 5aa means that Lys12 fused with a peptide containing 5 cationic amino acids at the C-terminus (KRKRK), 10aa means that Lys12 fused with a peptide containing 10 cationic amino acids at the C-terminus (KRKRKRKRKR) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eA). we used XH12 genome as template, obtained the genes encoding 5aa, 10aa by fusion PCR, then cloned those genes into the \\u003cem\\u003ePET\\u003c/em\\u003e-28a vector and transformed them into \\u003cem\\u003eE. coli\\u003c/em\\u003e BL21(DE3) for expression. We finally obtained purified fusion lysozyme proteins by Genscript Ni-NTA affinity chromatography and used SDS-PAGE to analysis Lys12, 5aa and 10aa (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eB). For explore the effects of the C-terminal cationic amino acids on the antibacterial activity of Lys12, we added Lys12 or fusion lysozyme 5aa,10aa into \\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3 (10\\u003csup\\u003e8\\u003c/sup\\u003e cfu/ml) at a final concentration of 200 \\u0026micro;g/ml and incubated for 5 h at 37℃, the number of viable colonies were measured by colony forming unit. The experimental results showed that bactericidal activity levels were 10aa\\u0026gt;5aa\\u0026gt;Lys12, the antibacterial activity of the fusion lysozyme increased with increasing C-terminal positive charge (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eC).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \"},{\"header\":\"Discussion\",\"content\":\"\\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e\\u003cp\\u003e \\u003cem\\u003eE. coli\\u003c/em\\u003e is widely found in nature, especially in the intestines and skins of humans and animals [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. Due to the abuse of antibiotics, multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e has emerged widely [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. Especially the urinary tract infection caused by multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e is a serious threat to human health [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. The successful discovery and widespread use of small molecule antibiotics limited the development and innovation of phage therapy. However, it is now clear that relying on small molecule antibiotics is not a long-term solution [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. Phages have many advantages such as host specificity, non-toxicity to animals, and the absence of residual effects, so phages are expected to become an alternative treatment plan for antibiotics [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. This work has already begun, with researchers and clinicians using phages screening pipelines to identify natural phages for use in patients to overcome drug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e infections [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eHowever, the high host specificity of phages seriously hinders the popularization and application of phages [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. To overcome the narrow host spectrum of phages, the most common method is to develop cocktail preparations [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. Therefore, subsequent studies can combine phage XH12 with other phages with a wide host spectrum to make up cocktail to expand the lytic spectrum. Although the effectiveness of antibiotics has declined due to bacterial resistance, it does not mean that the main position of antibiotics against drug-resistant bacteria has been shaken, and it is a good choice to use antibiotics and phages in combination against drug-resistant bacteria [\\u003cspan additionalcitationids=\\\"CR34\\\" citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. Given the increasing problem of antibiotic resistance worldwide, there is an urgent need to adopt globally coordinated phage therapy, standardize phage treatment protocols, and develop shared resources, such as through the establishment of phage libraries to optimize the production of clinical-grade phages, and extend these resources to low-and middle-income countries to alleviate the pressure on antibiotic resistance and reduce healthcare costs. Although phages are unlikely to completely replace antibiotics, in the long run, phage-based therapies could relatively reduce the threat of antibiotic resistance to human health.\\u003c/p\\u003e \\u003cp\\u003eAt present, the use of phage gene encoding products against bacterial infection has a good application prospect [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. In the process of replication, each phage will express a variety of substances that can inhibit or even kill the host bacteria. Among them, phage lysozyme has entered the application stage [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. Lysozymes have been considered potential agents for treating clinical bacterial infections [\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]. Gram-negative bacteria often have a lipopolysaccharide layer outside the cell wall, this prevents lysozymes from interacting with peptidoglycans, so lysozymes maybe more promising for the infection of Gram-positive bacteria without an outer membrane structure. For lysozymes that act on Gram-negative bacteria, physical or chemical methods can be used to improve lysozyme function. Such as high static pressure, EDTA, weak organic acids and citric acid can enhance the ability of lysozyme to penetrate the outer membrane of Gram-negative [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e]. Lysozyme chimeric cationic polypeptides or antimicrobial peptides can effectively lyse Gram-negative bacteria, the charge number and hydrophilicity of antimicrobial peptides had great influence on chimeric lysozyme activity [\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]. On account of the phospholipid bilayer of the outer membrane of the cell wall mostly carries a negative charge, therefore, increasing the amount of positive charge carried can enhance lysozyme to bind the outer membrane and cross the Gram-negative bacteria outer membrane [\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]. In our study, Lys12 combined with ethylenediaminetetraacetic acid (EDTA) had antibacterial activity against multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3. We fused 5 cationic amino acid polypeptides (KRKRK) and 10 cationic amino acid polypeptides (KRKRKRKRKR) to the C-terminus of Lys12 to obtain two fusion lysozymes (5aa, 10aa) and improved the antibacterial activity of Lys12 against multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e Eco-3 from extracellular space.\\u003c/p\\u003e \\u003cp\\u003eUsually \\u003cem\\u003eE. coli\\u003c/em\\u003e do not exist in isolation, preferring to aggregate to form biofilms [\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]. After \\u003cem\\u003eE. coli\\u003c/em\\u003e aggregation, \\u003cem\\u003eE. coli\\u003c/em\\u003e generate exopolysaccharides, proteins, nucleic acids, and lipids Constitute extracellular polymeric substances (EPS), which enhancing the \\u003cem\\u003eE. coli\\u003c/em\\u003e stability of surface adhesion. After bacteria proliferate, quorum sensing (QS) is generated and formed mature \\u003cem\\u003eE. coli\\u003c/em\\u003e biofilms [\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]. Biofilms enhance bacteria tolerant for bactericidal substances, especially to antibiotics have a great resistance [\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e]. It is difficult to effectively remove multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e biofilms by using antibiotics alone, however, we noted the effectiveness of phage XH12 against multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e biofilms, therefore, combining antibiotics with phages to remove biofilms maybe a wise choice [\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e]. We hope that our results can provide basic information for research on the application of phages and its lysozyme in the treatment of multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e and biofilm-associated infections.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;Xuhao Hou contributed to the study conceptualization, study design, and drafting of the manuscript. Yu Li, Jiaqi Pu and Wenhai Xie contributed to data collection, statistical analysis, and revising of the manuscript. Limei Zhang and Hongkuan Deng supervised this study, funding acquisition and conceptualization. All authors approved the final manuscript as submitted and agreed to be accountable for all aspects of the work.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interest\\u003c/strong\\u003e:\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no conflict of interest.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank the staff of the large instrument platform of Shandong University of technology for their assistance with TEM.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by grants from the financial support from the Shandong Provincial Natural Science Foundation (ZR2020MC184 and No. ZR2020MC074) and Shandong Medical and Health Science and Technology Development Plan Project (202203060106).\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eKaper JB, Nataro JP, Mobley HLT (2004) Pathogenic \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e. Nat Rev Microbiol 2:123\\u0026ndash;140\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHuang J, Lv C, Li M, Rahman T, Chang Y-F, Guo X, Song Z, Zhao Y, Li Q, Ni P (2024) Carbapenem-resistant \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e exhibit diverse spatiotemporal epidemiological characteristics across the globe. Commun Biology 7:51\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFlemming H-C, Wingender J, Szewzyk U, Steinberg P, Rice SA, Kjelleberg S (2016) Biofilms: an emergent form of bacterial life. Nat Rev Microbiol 14:563\\u0026ndash;575\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOtto M (2013) Staphylococcal Infections: Mechanisms of Biofilm Maturation and Detachment as Critical Determinants of Pathogenicity. Annu Rev Med 64:175\\u0026ndash;188\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang X, Li Q, Kang J, Yin D, Li X, Wang S, Guo Q, Song Y, Wang J, Duan JJI, Resistance D (2022) Mortality risk factors and prognostic analysis of patients with multi-drug resistant enterobacterales infection.3225\\u0026ndash;3237\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTacconelli E, Carrara E, Savoldi A, Harbarth S, Mendelson M, Monnet DL, Pulcini C, Kahlmeter G, Kluytmans J, Carmeli YJTL (2018) Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. 18:318\\u0026ndash;327\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eStrathdee SA, Hatfull GF, Mutalik VK, Schooley RTJC (2023) Phage therapy: From biological mechanisms to future directions. 186:17\\u0026ndash;31\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAl-Shayeb B, Sachdeva R, Chen L-X, Ward F, Munk P, Devoto A, Castelle CJ, Olm MR, Bouma-Gregson K, Amano YJN (2020) Clades of huge phages from across Earth\\u0026rsquo;s ecosystems. 578:425\\u0026ndash;431\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSalmond GPC, Fineran PC (2015) A century of the phage: past, present and future. Nat Rev Microbiol 13:777\\u0026ndash;786\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBreitbart M, Rohwer FJT (2005) Here a virus, there a virus. everywhere same virus? 13:278\\u0026ndash;284\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePallavali RR, Degati VL, Narala VR, Velpula KK, Yenugu S, Durbaka VRPJT, Applications R (2021) Lytic bacteriophages against bacterial biofilms formed by multidrug-resistant \\u003cem\\u003ePseudomonas aeruginosa\\u003c/em\\u003e, \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e, \\u003cem\\u003eKlebsiella pneumoniae\\u003c/em\\u003e, and \\u003cem\\u003eStaphylococcus aureus\\u003c/em\\u003e isolated from burn wounds. 2:120\\u0026ndash;130\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLai WCB, Chen X, Ho MKY, Xia J, Leung SSY (2020) Bacteriophage-derived endolysins to target gram-negative bacteria. Int J Pharm 589:119833\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYoung R (2014) Phage lysis: three steps, three choices, one outcome. J Microbiol 52:243\\u0026ndash;258\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFerraboschi P, Ciceri S, Grisenti P (2021) Applications of lysozyme, an innate immune defense factor, as an alternative antibiotic. Antibiotics 10:1534\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJar\\u0026aacute;bkov\\u0026aacute; V, Tiš\\u0026aacute;kov\\u0026aacute; L, God\\u0026aacute;ny A (2015) Phage endolysin: a way to understand a binding function of C-terminal domains a mini review. Nova Biotechnol Chim 14:117\\u0026ndash;134\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFischetti VA (2010) Bacteriophage endolysins: a novel anti-infective to control Gram-positive pathogens. Int J Med Microbiol 300:357\\u0026ndash;362\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRaz A, Serrano A, Lawson C, Thaker M, Alston T, Bournazos S, Ravetch JV, Fischetti VA (2017) Lysibodies are IgG Fc fusions with lysin binding domains targeting Staphylococcus aureus wall carbohydrates for effective phagocytosis. Proceedings of the National Academy of Sciences 114:4781\\u0026ndash;4786\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGhose C, Euler CW (2020) Gram-negative bacterial lysins. Antibiotics 9:74\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMorita M, Tanji Y, Orito Y, Mizoguchi K, Soejima A, Unno H (2001) Functional analysis of antibacterial activity of \\u003cem\\u003eBacillus amyloliquefaciens\\u003c/em\\u003e phage endolysin against Gram-negative bacteria. FEBS Lett 500:56\\u0026ndash;59\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBriers Y, Walmagh M, Van Puyenbroeck V, Cornelissen A, Cenens W, Aertsen A, Oliveira H, Azeredo J, Verween G, Pirnay J-P (2014) Engineered endolysin-based Artilysins to combat multidrug-resistant gram-negative pathogens. MBio 5:10\\u0026ndash;1128\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMa Q, Guo Z, Gao C, Zhu R, Wang S, Yu L, Qin W, Xia X, Gu J, Yan G (2017) Enhancement of the direct antimicrobial activity of Lysep3 against \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e by inserting cationic peptides into its C terminus. Antonie Van Leeuwenhoek 110:347\\u0026ndash;355\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYang Z, Liu X, Shi Y, Yin S, Shen W, Chen J, Chen Y, Chen Y, You B, Gong Y, Luo X, Zhang C, Yuan Z, Peng Y (2019) Characterization and genome annotation of a newly detected bacteriophage infecting multidrug-resistant \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e. Arch Virol 164:1527\\u0026ndash;1533\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePuvača N, de Llanos Frutos R (2021) Antimicrobial resistance in \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e strains isolated from humans and pet animals. Antibiotics 10:69\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePeng Z, Wang X, Huang J, Li B (2024) Pathogenic \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e. Molecular Medical Microbiology. Elsevier, pp 1065\\u0026ndash;1096\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMazzariol A, Bazaj A, Cornaglia G (2017) Multi-drug-resistant Gram-negative bacteria causing urinary tract infections: a review. J Chemother 29:2\\u0026ndash;9\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBrives C, Pourraz J (2020) Phage therapy as a potential solution in the fight against AMR: obstacles and possible futures. Palgrave Commun 6:1\\u0026ndash;11\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGordillo Altamirano FL, Barr JJ (2019) Phage therapy in the postantibiotic era. Clin Microbiol Rev 32:10\\u0026ndash;1128\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRahmani R, Zarrini G, Sheikhzadeh F, Aghamohammadzadeh N (2015) Effective phages as green antimicrobial agents against antibiotic-resistant hospital \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e. Jundishapur J Microbiol 8\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDe Miguel T, Rama JLR, Sieiro C, S\\u0026aacute;nchez S, Villa TG (2020) Bacteriophages and lysins as possible alternatives to treat antibiotic-resistant urinary tract infections. Antibiotics 9:466\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChung KM, Liau XL, Tang SS (2023) Bacteriophages and Their Host Range in Multidrug-Resistant Bacterial Disease Treatment. Pharmaceuticals 16:1467\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRoss A, Ward S, Hyman P (2016) More is better: selecting for broad host range bacteriophages. Front Microbiol 7:1352\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKunisch F, Campobasso C, Wagemans J, Yildirim S, Chan BK, Schaudinn C, Lavigne R, Turner PE, Raschke MJ, Trampuz A (2024) Targeting \\u003cem\\u003ePseudomonas aeruginosa\\u003c/em\\u003e biofilm with an evolutionary trained bacteriophage cocktail exploiting phage resistance trade-offs. Nat Commun 15:8572\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMartin JK, Sheehan JP, Bratton BP, Moore GM, Mateus A, Li SH-J, Kim H, Rabinowitz JD, Typas A, Savitski MM (2020) A dual-mechanism antibiotic kills gram-negative bacteria and avoids drug resistance. Cell 181:1518\\u0026ndash;1532\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTaati Moghadam M, Amirmozafari N, Shariati A, Hallajzadeh M, Mirkalantari S, Khoshbayan A, Masjedian Jazi F (2020) How phages overcome the challenges of drug resistant bacteria in clinical infections. Infect Drug Resist :45\\u0026ndash;61\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMalik S, Nehra K, Rana JS (2021) Bacteriophage cocktail and phage antibiotic synergism as promising alternatives to conventional antibiotics for the control of multi-drug-resistant uropathogenic \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e. Virus Res 302:198496\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLin J, Du F, Long M, Li P (2022) Limitations of phage therapy and corresponding optimization strategies: a review. Molecules 27:1857\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eStrathdee SA, Hatfull GF, Mutalik VK, Schooley RT (2023) Phage therapy: From biological mechanisms to future directions. Cell 186:17\\u0026ndash;31\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOliveira H, Thiagarajan V, Walmagh M, Sillankorva S, Lavigne R, Neves-Petersen MT, Kluskens LD, Azeredo J (2014) A thermostable Salmonella phage endolysin, Lys68, with broad bactericidal properties against gram-negative pathogens in presence of weak acids. PLoS ONE 9:e108376\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSchmelcher M, Donovan DM, Loessner MJ (2012) Bacteriophage endolysins as novel antimicrobials. Future Microbiol 7:1147\\u0026ndash;1171\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVarotsou C, Premetis GE, Labrou NE (2023) Characterization and engineering studies of a new endolysin from the \\u003cem\\u003ePropionibacterium acnes\\u003c/em\\u003e bacteriophage PAC1 for the development of a broad-spectrum artilysin with altered specificity. Int J Mol Sci 24:8523\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYan G, Yang R, Fan K, Dong H, Gao C, Wang S, Yu L, Cheng Z, Lei L (2019) External lysis of \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e by a bacteriophage endolysin modified with hydrophobic amino acids. Amb Express 9:1\\u0026ndash;7\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDang H, Lovell CR (2016) Microbial Surface Colonization and Biofilm Development in Marine Environments. Microbiol Mol Biol Rev 80:91\\u0026ndash;138\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu S, Lu H, Zhang S, Shi Y, Chen Q (2022) Phages against pathogenic bacterial biofilms and biofilm-based infections: a review. Pharmaceutics 14:427\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNiveditha S, Pramodhini S, Umadevi S, Kumar S, Stephen S (2012) The isolation and the biofilm formation of uropathogens in the patients with catheter associated urinary tract infections (UTIs). J Clin Diagn research: JCDR 6:1478\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAlmalki MA, Varghese R (2020) Prevalence of catheter associated biofilm producing bacteria and their antibiotic sensitivity pattern. J King Saud University-Science 32:1427\\u0026ndash;1433\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eComeau AM, T\\u0026eacute;tart F, Trojet SN, Pr\\u0026egrave;re M-F, Krisch HM (2007) Phage-antibiotic synergy (PAS): β-lactam and quinolone antibiotics stimulate virulent phage growth. PLoS ONE 2:e799\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCoulter LB, McLean RJC, Rohde RE, Aron GM (2014) Effect of bacteriophage infection in combination with tobramycin on the emergence of resistance in \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e and \\u003cem\\u003ePseudomonas aeruginosa\\u003c/em\\u003e biofilms. Viruses 6:3778\\u0026ndash;3786\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"archives-of-virology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"arvi\",\"sideBox\":\"Learn more about [Archives of Virology](https://www.springer.com/journal/705)\",\"snPcode\":\"705\",\"submissionUrl\":\"https://submission.nature.com/new-submission/705/3\",\"title\":\"Archives of Virology\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"Multidrug-resistant E. coli, Phages, Biofilms, Phage lysozyme, Chimeric lysozyme\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-5333939/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-5333939/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eAntibiotics are no longer adequate to address the threat of antibiotic resistance, especially \\u003cem\\u003ePseudomonas aeruginosa\\u003c/em\\u003e, \\u003cem\\u003eAcinetobacter baumannii\\u003c/em\\u003e, \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e and other gram-negative pathogens, which pose a serious threat to human health worldwide. The antibiotic resistance pandemic requires the search for new antimicrobials as alternatives that are effective and less prone to resistance. Phages and its lysozyme become an attractive alternative to currently available antibiotics. However, gram-negative bacteria have outer membrane that acts as a strong barrier, so lysozymes are often used in combination with outer membrane permeator, or are modified to overcome the outer membrane barrier. To combat drug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e, in this study, we used multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e eco-3 as host bacteria, a lytic phage XH12 was isolated from sewages, phage XH12 can lyse about 81% (30/37) of \\u003cem\\u003eE. coli\\u003c/em\\u003e strains tested. The biological characteristics and genome of phage XH12 were analyzed, and we found that lysozyme Lys12 encoded by phage XH12 combined with ethylenediaminetetraacetic acid (EDTA) had antibacterial activity against \\u003cem\\u003eE. coli\\u003c/em\\u003e. Two fusion lysozymes were obtained by fusing different amounts of cationic amino acid polypeptides with the C-terminal of Lys12. The fusion lysozymes could improve the antibacterial activity against \\u003cem\\u003eE. coli\\u003c/em\\u003e from extracellular space. The study of phage XH12 and its lysozyme will provide basic information for further study of the treatment of multidrug-resistant \\u003cem\\u003eE. coli\\u003c/em\\u003e infection.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Isolation, identification and genome analysis of a new Escherichia coli phage XH12 and enhancement of antibacterial activity of its lysozyme by chimeric cationic peptides\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-12-02 15:55:57\",\"doi\":\"10.21203/rs.3.rs-5333939/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"reviewerAgreed\",\"content\":\"\",\"date\":\"2024-12-03T13:25:37+00:00\",\"index\":0,\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2024-11-14T18:46:50+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2024-11-12T10:27:17+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Archives of Virology\",\"date\":\"2024-11-11T09:47:38+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"decision\",\"content\":\"Minor Revision\",\"date\":\"2024-10-29T11:41:24+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"archives-of-virology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"arvi\",\"sideBox\":\"Learn more about [Archives of Virology](https://www.springer.com/journal/705)\",\"snPcode\":\"705\",\"submissionUrl\":\"https://submission.nature.com/new-submission/705/3\",\"title\":\"Archives of Virology\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"6ef581b6-2d7e-43d4-b60d-9251970cf703\",\"owner\":[],\"postedDate\":\"December 2nd, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-03-31T15:59:59+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-5333939\",\"link\":\"https://doi.org/10.1007/s00705-025-06274-w\",\"journal\":{\"identity\":\"archives-of-virology\",\"isVorOnly\":false,\"title\":\"Archives of Virology\"},\"publishedOn\":\"2025-03-27 15:57:15\",\"publishedOnDateReadable\":\"March 27th, 2025\"},\"versionCreatedAt\":\"2024-12-02 15:55:57\",\"video\":\"\",\"vorDoi\":\"10.1007/s00705-025-06274-w\",\"vorDoiUrl\":\"https://doi.org/10.1007/s00705-025-06274-w\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-5333939\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-5333939\",\"identity\":\"rs-5333939\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}