{"paper_id":"365801b3-736e-4544-89b4-3ea6d38eec6c","body_text":"Repeat breeder (RB) is generally defined as any cow that has failed to conceive after at least three inseminations. In both dairy and beef cattle herds, the presence of RB cows can directly lead a large economic loss for producers due to an extension of the length of the open period and frequent artificial insemination (AI) [ 1 ]. In addition to management problems such as inadequate estrus detection and AI techniques, various physiological problems of individual cows are one of major causes of repeat breeding. For example, infections of uterus, cervix and/or vagina, dysfunctions of uterus or ovary, obstructed oviducts, defective oocytes and anatomical defects of the reproductive tracts are involved in conception failure, early embryonic death and endocrine disorders of RB animals. [ 1 ]. It has been reported that embryo transfer is effective to improve the fertility of RB cows and heifers [ 2 ,  3 ]. On the other hand, a study of reciprocal transfers of embryos between RB and virgin heifers showed that a higher proportion of embryos transferred from RB to virgin heifers than from virgin to RB heifers survived at day 16 to 17, suggesting that the uterine environment in RB heifers is less suitable than in the virgins for supporting a successful embryo development [ 4 ]. This became more evident by transfer of identical demi-embryos to RB and virgin recipient heifers resulted less number of morphologically normal and elongated embryos in the RB heifers than in the virgin heifers at day 15 [ 5 ]. About an association between alteration of uterine environment and repeat breeding, Katagiri et al. have demonstrated that there is a close relationship between the endometrial epidermal growth factor profile and diminished fertility of RB cows [ 6 ].\nThe molecular mechanisms underlying endometrial function may contribute to reproductive performance in cattle. Increasing evidence using global gene expression analysis has identified numerous differentially expressed genes and related functional pathways in bovine endometrium among highly fertile, subfertile and infertile animal strains during estrous cycle or early pregnancy [ 7 – 10 ]. Recent studies have also investigated gene expression profiles under various conditions of the bovine endometrium during the estrous cycle and/or during early pregnancy using DNA microarray or RNA sequencing [ 11 – 18 ]. In addition, microarray studies have revealed that heat stress and steroid hormones directly affect bovine endometrial gene expression profiles [ 19 ,  20 ].\nIn ruminants, the endometrium shows structural and physiological differences depending on the uterine compartments. The caruncular (CAR) areas are aglandular and a limited area that forms placentomes by fusing with the fetal extraembryonic membrane [ 21 ,  22 ]. On the other hand, the intercaruncular (ICAR) areas contain endometrial glands that synthesize and secrete substances or factors that are essential for survival and development of the conceptus [ 23 ,  24 ]. A study that directly compared the gene expression profiles of CAR and ICAR during implantation in cows showed 1177 and 453 differentially expressed genes (DEG) were found for cyclic and pregnant animals, respectively [ 13 ]. In addition, it has been reported that tissues of the ipsilateral uterine horn to the ovary with the corpus luteum (CL) contain greater quantities of progesterone (P4) and are more sensitive to P4 as compared with tissues on the contralateral side [ 25 ]. Although a previous study demonstrated that a few genes show differences in expression between ipsilateral and contralateral uterine horns during the bovine estrous cycle [ 11 ], we consider that it is important to analyze each compartment of the bovine endometrium separately in order to understand enodometrial function more comprehensively.\nThese previous studies suggest that alteration of the endometrial function due to changes in gene expression may contribute to their lower reproductive performance in RB cows, whereas details of the molecular mechanisms and biological pathways of their endometria still need to be elucidated. Thus, we hypothesized that there is a characteristic gene expression profile in the endometrium of the RB cows. This study aimed to investigate differences in gene expression profiles of the endometrium between RB and non-RB cows during the mid-luteal phase of the estrous cycle. In pregnant cattle, maternal recognition of pregnancy occurs around Day 14–15 [ 26 ]. In addition, it has been reported that the majority of early embryo losses in cattle have occurred within 16 days of gestation (i.e. during the mid-luteal phase) [ 27 ,  28 ]. Therefore, the basal gene expression profiles of endometrium at mid luteal phase would have the most important association with reproductive performance.\n\nThis study was carried out using non-lactating Japanese Black cows at the institute’s ranch (age: 7.8 ± 0.9 years, parity: 3.3 ± 0.8, open period from last parturition to first AI in this study: 104 ± 9.6 month). Repeat breeder cows ( n  = 4) were defined based on a previous study by Dochi et al. [ 3 ]. Briefly, the RB cows had three characteristics as follows: (1) detectable estrous behavior, but not always normal estrous cycles; (2) not conceiving after three or more inseminations following normal estrous behavior; and (3) healthy uterus and ovaries, as determined by transrectal palpation. Non-RB cows ( n  = 4) conceived within three inseminations. The non-RB cows were confirmed to be pregnant by transrectal ultrasonography (HS-1500V; Honda Electronics. Co., Aichi, Japan) at 40 days after insemination, then abortion was induced by a single intramuscular injection of 500 μg of prostaglandin F2α (cloprostenol [Dalmazin]; Kyoritsu Seiyaku. Co., Tokyo, Japan) followed by repeated normal estrous cycles at least twice. Both RB and non-RB cows were slaughtered on Day 15 of the estrous cycle (the day of estrus was designated as Day 0) and the uterus and both ovaries together were collected. Uterine horns were identified as ipsilateral to the ovary containing the CL or contralateral. We collected CAR and ICAR in the endometrium from the middle area of each uterine horns. The uterine horns were cut opened longitudinally using scissors and CAR were carefully dissected first not to include ICAR, subsequently, ICAR areas were cut off. Collected samples were snap-frozen in liquid nitrogen and stored at −80 °C until RNA extraction. Whole cross section of the uterus for immunohistochemistry were collected from the middle area of ipsilateral uterine horn of all cows and fixed in 10% formalin (v/v), embedded in paraffin wax, and then stored at 4 °C until use. All procedures in animal experiments were carried out in accordance with guidelines approved by the Animal Ethics Committee of the National Institute of Agrobiological Sciences for the use of animals (permission number: H18-036).\nTotal RNA was extracted from each sample by acid guanidinium thiocyanate-phenol-chloroform with ISOGEN (Nippon Gene, Tokyo, Japan) according to the manufacturer’s instructions. All RNA samples were then treated with TURBO DNase (TURBO DNA-free™ Kit, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions to remove contaminating genomic DNA. The quantity and quality of the total RNA samples were assessed using a NanoDrop spectrophotometer (ND-1000; NanoDrop Technology Inc., Wilmington, DE, USA) and an Experion automated electrophoresis system with an Experion RNA StdSens kit (Bio-Rad Laboratories, Hercules, CA, USA), respectively. A custom-made bovine oligonucleotide microarray with 15,000 unique genes ( GPL9284 ) fabricated by Agilent Technologies (Santa Clara, CA, USA) was used in this study, which was performed as described previously [ 29 ]. Sixty-mer nucleotide probes for the customized microarray were synthesized on a glass slide. We performed one-color microarray analysis. cDNA synthesis, Cy3-labeled cRNA preparation, hybridization, and the washing and scanning of array slides were performed according to the Agilent one color microarray-based gene expression analysis protocol. Briefly, 400 ng of total RNA from each sample were reverse-transcribed into cDNA using the Quick Amp Labeling Kit (Agilent Technologies) with an oligo dT-based primer, and then Cy3-labelled cRNA was prepared by in vitro transcription. Labeled cRNA was purified with an RNeasy Mini Kit (Qiagen, Hilden, Germany), and the concentration and Cy3 dye incorporation (pmol Cy3/μg cRNA) were measured with a spectrophotometer. Labeled cRNA (600 ng) was fragmented and hybridized using the Gene Expression Hybridization Kit (Agilent Technologies), according to the manufacturer’s instructions. The arrays were washed using a Gene Expression Wash Pack Kit (Agilent Technologies) and scanned using an Agilent Microarray Scanner. Feature Extraction ver. 9.5 was used for image analysis and data extraction. Microarray data from each sample were imported into GeneSpring 12 (Agilent Technologies) for further data characterization. The GEO accession numbers are as follows. Platform:  GPL9284 ; samples:  GSM2093338  to  GSM2093369 ; series:  GSE79367 . To identify putative biological functions of DEG between RB and non-RB cows in each endometrial compartment, we performed functional annotation chart analysis of the lists of DEG using the Database for Annotation, Visualization and Integrated Discovery (DAVID;  http://david.abcc.ncifcrf.gov/ ) based on Genebank Accession IDs [ 30 ]. Gene Ontology (GO) Biological Process was selected as the functional annotation category for the analysis with the threshold for minimum gene counts belonging to an annotation term set to 5 and an EASE score set to 0.05. The GO terms were ranked according to their  P -values describing the significance of gene-term enrichment.\nTo validate the results of microarray analysis, we confirmed mRNA expression of the following representative genes using quantitative real-time RT-PCR (qPCR) analysis: (1) top two up- or down-regulated known genes in each endometrial compartment; and (2) top five up- or down-regulated known genes in the whole uterus. Details of the procedures for single-strand cDNA synthesis and qPCR were previously described [ 31 ]. Briefly, 50 ng of total RNA from the same sample used for the microarray were reverse-transcribed into cDNA for 30 min at 48 °C using MultiScribe TM  Reverse Transcriptase (Applied Biosystems, Foster City, CA, USA) with a random primer, dNTP mixture, MgCl 2  and RNase inhibitor. After heat inactivation of the reverse transcriptase for 5 min at 95 °C, PCR and resulting relative increase in reporter fluorescent dye emission were monitored in real time using an Mx3000P qPCR system (Agilent Technologies). Primers were designed using Primer Express computer software program (Applied Biosystems) or Primer3 Plus software ( www.bioinformatics.nl/primer3plus/ ) based on the bovine sequences. The primer sequences for each gene are listed in Table  1 . Thermal-cycling conditions included an initial sample incubation at 50 °C for 2 min and at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and at 60 °C for 1 min. The cycle threshold value (C T ) indicate the quantity of the target gene in each sample. The relative difference in initial amount of each mRNA species (or cDNA) was determined by comparing the C T  values. The standard curves for each gene were generated by serially diluting plasmids containing cDNA of each individual gene to quantify the mRNA concentrations. We confirmed the utility of the dissociation curve for detecting the SYBR Green-based objective amplicon because SYBR Green also detects double-stranded DNA including Primer dimers, contaminating DNA and PCR products from misannealed primers. Non-specific amplicons appear as a peak separate from the desired amplicon peak. The expression ratio of each gene to  SUZ12  mRNA, which has been demonstrated to be suitable for normalization in bovine endometrial tissue [ 32 ], was calculated to adjust for any variations in the qPCR reaction. Table 1 Details of the primers used for quantitative real-time RT-PCR analysis Gene (GenBank accession number) Primer Sequence Position \n CHGA \n Forward 5′-GCCGAAAGAGGTGACAGAAGA-3′ 538-558 ( NM_181005 ) Reverse 5′-GTCTCCGTCCGAGTCTTCATC-3′ 637-617 \n CNGA1 \n Forward 5′-AGCAGAGATCGCCATCAATGT-3′ 1574-1594 ( NM_174278 ) Reverse 5′-ACCAACTCCACCAACAGACCA-3′ 1663-1643 \n CPXM2 \n Forward 5′- ACCAGTGGATTGAAGTGGACG-3′ 581-601 ( NM_001206057 ) Reverse 5′- TCACTCAGCCAGAGTGAGTTCCT-3′ 665-643 \n FAM83D \n Forward 5′- GGCTCCTACAGTTTTACATGGACAG-3′ 788-812 ( NM_001083393 ) Reverse 5′-CAACCACTTGGCCAGACAGAA-3′ 863-843 \n FMO2 \n Forward 5′- AAGCCAGACATCCTTTCTCTCTTG -3′ 1459-1482 ( NM_001163274 ) Reverse 5′- CCCAACCAGGCGATACTGATA-3′ 1554-1532 \n GSTA3 \n Forward 5′-AGAGCCATCCTCAGCTACCTTG-3′ 254-275 ( NM_001077112 ) Reverse 5′-TCGATCCTGACTGTCTCCTTCA-3′ 327-306 \n IFIH1 \n Forward 5′-GGGACTAACAGCTTCACCAGGT-3′ 1764-1785 ( XM_002685338 ) Reverse 5′-GGTAACTGCATCAAGATTGGCA-3′ 1860-1839 \n IGG1C \n Forward 5′-ACCAAGGTGGACAAGGCTGTT-3′ 274-294 ( S82409 ) Reverse 5′-GGAAGATGAAGACAGAGGGTCCT-3′ 370-348 \n KCNA2 \n Forward 5′-TGGGTTCCCTATGTGCAATTG-3′ 1644-1664 ( NM_001101195 ) Reverse 5′-TCCCGGTGGTAGAAGTAGTTGAA-3′ 1734-1712 \n KLHL24 \n Forward 5′- TTATTGGCAAGGAGGAGATGGT-3′ 901-922 ( NM_001206196 ) Reverse 5′- TCTCAGATCAACAGCGCGAT-3′ 968-949 \n KRT35 \n Forward 5′- GAGACCGAGGTATCCATGCG-3′ 587-606 ( NM_001076073 ) Reverse 5′- TTCTTGAGGCAGAGCAGCTC -3′ 726-707 \n LPLUNC1 \n Forward 5′- TCGGTGTGTTCAACCCTAAGC-3′ 1280-1300 ( NM_174697 ) Reverse 5′- TTCTCGTTTGGCAGCAGGAT -3′ 1355-1336 \n PIPOX \n Forward 5′- ACAGCATTAACACCGAGTCGG-3′ 2140-2160 ( NM_001014878 ) Reverse 5′- GGCAGTTATGAGCCTGTTTCCT-3′ 2210-2189 \n PLEKHA5 \n Forward 5′- GATGGATTCAAGAACGGAACG-3′ 2655-2675 ( XM_002687754 ) Reverse 5′- TTCCACAGTCATCCTAGGTCGA-3′ 2739-2718 \n PRF1 \n Forward 5′-CAAGCCAAATGCTAATGTCCGT-3′ 408-429 ( NM_001143735 ) Reverse 5′-AAAGCGACACTCCACTAAGTCCAT-3′ 531-508 \n PRSS2 \n Forward 5′-GTGAGGCTGGGAGAATACAACA-3′ 211-232 ( NM_174690 ) Reverse 5′-ATGATCTTGGACGCATCGATGA-3′ 281-260 \n SLC39A2 \n Forward 5′- TTGGCTGCCTATTTGCCCT-3′ 355-373 ( NM_001205648 ) Reverse 5′- CTGGAACCACTTGAAGCAGATG-3′ 428-407 \n THBS4 \n Forward 5′- CACTCTGAACGAGCTCTACGTGAT 3′ 331-354 ( NM_001034728 ) Reverse 5′- GAAGAGTAAAGGCCGAAGATGGT-3′ 411-389 \n SUZ12 \n Forward 5′-GAACACCTATCACACACATTCTTGT-3′ 1565-1589 ( NM_001205587 ) Reverse 5′-TAGAGGCGGTTGTGTCCACT-3′ 1694-1675\nDetails of the primers used for quantitative real-time RT-PCR analysis\nImmunohistochemistry for chromogranin A (CHGA), glutathione  S -transferase A3 (GSTA3) and trypsin 2 (PRSS2) was performed in the endometrium of both RB and non-RB cows on Day 15 of the estrous cycle using the automated Ventana HX System Discovery with a DabMapKit (Roche Diagnostics, Basel, Switzerland) as described previously in detail by our laboratory [ 33 ]. Uterine cross sections 7-μm-thick were incubated at room temperature with rabbit polyclonal anti-human CHGA antibody (1.0 mg/ml, 20085, ImmunoStar Inc., Hudson, WI, USA), rabbit polyclonal anti-human GSTA3 antibody (0.5 mg/ml, orb5362, Biorbyt LLC, San Francisco, CA, USA) or rabbit polyclonal anti-bovine PRSS2 antibody (10 mg/ml, OASA07087, Aviva Systems Biology, San Diego, CA, USA) diluted 1:100 (anti-CHGA), 1:20 (anti-GSTA3) or 1:200 (anti-PRSS2) in Discovery Ab diluents (Roche) for 12 h. The signals were detected using anti-rabbit IgG-Biotin conjugate (Sigma) diluted 1:500 for 1 h. Negative controls were performed using normal rabbit IgG (0.5 mg/ml, 20304, Imgenex, San Diego, CA, USA) diluted at concentrations equivalent to the primary antibodies. The sections were observed with a Leica DMRE HC microscope (Leica Microsystems, Wetzlar, Germany) and a Nikon Digital Sight DS-Fi1-L2 (Nikon Instruments Co., Tokyo, Japan).\nMicroarray data were analyzed statistically with an unpaired Student’s  t -test and summarized using GeneSpring 12 (Agilent Technologies). The analysis of each uterine compartment was performed by comparing the gene datasets which composed by microarray data of four cows in each RB and non-RB group ( n  = 4/group). The analysis of whole uterus was performed by comparing the gene datasets which composed by microarray data of all four compartments of four cows in each RB and non-RB group ( n  = 16/group). The qPCR results were analyzed using a Mann–Whitney  U  test. Results are presented as the mean ± SEM. Statistical significance is considered to be at  P  < 0.05.\n\nA total of 405 and 397 genes were differentially expressed in CAR and ICAR of the ipsilateral uterine horn of RB cows, respectively when compared with non-RB cows (adjusted  P -value <0.05, fold-change >1.0). All data of individual gene changes in CAR and ICAR are available in Additional file  1 : Tables S1 and S2, respectively. Out of these, 128 genes were up-regulated and 277 genes were down-regulated in CAR, whereas 169 genes were up-regulated and 228 genes were down-regulated in ICAR. The top 10 up- and down-regulated known genes in CAR are shown in Table  2 . The most pronounced up- and down-regulation of gene expression in RB cows was observed for  GSTA3  (Glutathione  S -transferase, alpha 3; 19.2-fold) and  CPXM2  (Carboxypeptidase X (M14 family), member 2; 5.3-fold), respectively. The top five functional annotations of DEG in the CAR of ipsilateral uterine horns between RB and non-RB cows are listed in Table  3 . The GO terms involved in anatomical structure development, developmental process, cellular process, multicellular organismal development and biosynthetic process were highly enriched in up-regulated genes, whereas the GO terms involved in cellular process, cytoskeleton organization, biological adhesion, cell adhesion and cellular component organization were highly enriched in down-regulated genes. Table 2 Top 10 up- and down-regulated known genes in CAR of ipsilateral uterine horns of RB cows GenBank accession ID Gene symbol Gene description Fold change \n P -value Up-regulated genes   NM_001077112 GSTA3 Glutathione S-transferase, alpha 3 19.2 0.0016   NM_001206196 KLHL24 Kelch-like 24 (Drosophila) 3.0 0.0273   XM_588022 SPOPL Speckle-type POZ protein-like 2.8 0.0239   NM_001103317 ERCC2 Excision repair cross-complementing rodent repair deficiency, complementation group 2 2.5 0.0437   XM_002696037 CD300LG CD300 molecule-like family member g 2.2 0.0378   NM_001075908 STK33 Serine/threonine kinase 33 2.1 0.0351   NM_174607 SLC5A3 Solute carrier family 5 (inositol transporters), member 3 2.0 0.0126   NM_001192523 KCNMB4 Potassium large conductance calcium-activated channel, subfamily M, beta member 4 2.0 0.0307   NM_001083638 MEF2A Myocyte enhancer factor 2A 2.0 0.0290   XM_002695445 ZNF211 Zinc finger protein 211 2.0 0.0063 Down-regulated genes   NM_001206057 CPXM2 Carboxypeptidase X (M14 family), member 2 5.3 0.0496   NM_001076073 KRT35 Keratin 35 4.1 0.0279   NM_001101239 GRP Gastrin-releasing peptide 3.6 0.0319   NM_001245926 FGF9 Fibroblast growth factor 9 3.5 0.0066   NM_174145 PKP1 Plakophilin 1 (ectodermal dysplasia/skin fragility syndrome) 2.9 0.0021   NM_001076864 TMEM129 Transmembrane protein 129 2.6 0.0087   NM_001105478 SSLP1 Secreted seminal-vesicle Ly-6 protein 1 2.5 0.0474   NM_001077962 STAC SH3 and cysteine rich domain 2.4 0.0157   NM_001077945 PFN3 Profilin 3 2.4 0.0106   NM_001012685 FCAR Fc fragment of IgA, receptor for 2.3 0.0322 \n Table 3 Top 5 functional annotations of up- and down-regulated genes in CAR of ipsilateral uterine horns Term Count \n P -value Up-regulated genes  GO:0048856 ~ anatomical structure development 11 0.0029  GO:0032502 ~ developmental process 11 0.0161  GO:0009987 ~ cellular process 31 0.0186  GO:0007275 ~ multicellular organismal development 10 0.0230  GO:0009888 ~ tissue development 5 0.0246 Down-regulated genes  GO:0009987 ~ cellular process 95 <0.0001  GO:0007010 ~ cytoskeleton organization 8 0.0061  GO:0022610 ~ biological adhesion 11 0.0065  GO:0007155 ~ cell adhesion 11 0.0065  GO:0016043 ~ cellular component organization 23 0.0099\nTop 10 up- and down-regulated known genes in CAR of ipsilateral uterine horns of RB cows\nTop 5 functional annotations of up- and down-regulated genes in CAR of ipsilateral uterine horns\nThe top 10 up- and down-regulated known genes in ICAR are shown in Table  4 . The highest increase and decrease in gene expression in RB cows were observed in  LPLUNC1  (Von Ebner minor salivary gland protein; 3.7-fold) and  THBS4  (Thrombospondin 4; 3.4-fold), respectively. Table  5  summarizes the top five functional annotations of DEG in ICAR between RB and non-RB cows. As a result of DAVID analysis, only four GO terms related to metabolic process, cellular metabolic process, cellular biosynthetic process and chemical homeostasis were identified in up-regulated genes. In down-regulated genes, the GO terms involved in metabolic process, cellular metabolic process, cellular process, primary metabolic process and protein metabolic process were highly enriched. Table 4 Top 10 up- and down-regulated known genes in ICAR of ipsilateral uterine horns of RB cows GenBank accession ID Gene symbol Gene description Fold change \n P -value Up-regulated genes   NM_174697 LPLUNC1 Von Ebner minor salivary gland protein 3.7 0.0214   NM_001075162 FMO2 Flavin containing monooxygenase 2 (non-functional) 3.3 0.0348   NM_001166616 C5 Complement component 5 3.2 0.0429   XM_002692160 FOXA2 Forkhead box A2 3.0 0.0350   NM_181027 AKR1C4 Aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4) 2.9 0.0104   NM_001045878 GATM Glycine amidinotransferase (L-arginine:glycine amidinotransferase) 2.8 0.0472   NM_001206196 KLHL24 Kelch-like 24 (Drosophila) 2.6 0.0301   NM_001034419 HPGD Hydroxyprostaglandin dehydrogenase 15-(NAD) 2.6 0.0293   XM_001254052 ZNED1 DNA-directed RNA polymerase I subunit RPA12-like 2.4 0.0476   NM_001038096 CFI Complement factor I 2.4 0.0096 Down-regulated genes   NM_001034728 THBS4 Thrombospondin 4 3.4 0.0106   NM_001083393 FAM83D Protein FAM83D 2.6 0.0011   NM_001105411 GFRA1 GDNF family receptor alpha 1 2.4 0.0391   NM_001206057 CPXM2 Carboxypeptidase X (M14 family), member 2 2.3 0.0231   NM_178572 CA2 Carbonic anhydrase II 2.3 0.0474   NM_001099381 GALK1 Galactokinase 1 2.1 0.0466   NM_001035050 VTN Vitronectin 2.0 0.0464   NM_174745 MMP2 Matrix metallopeptidase 2 (gelatinase A, 72 kDa gelatinase, 72 kDa type IV collagenase) 1.9 0.0387   NM_001075730 STRA6 Stimulated by retinoic acid gene 6 1.9 0.0405   NM_174558 KCNK17 Potassium channel, subfamily K, member 17 1.9 0.0496 \n Table 5 Top 5 functional annotations of up- and down-regulated genes in ICAR of ipsilateral uterine horns Term Count \n P -value Up-regulated genes  GO:0008152 ~ metabolic process 38 0.0033  GO:0044237 ~ cellular metabolic process 29 0.0242  GO:0044249 ~ cellular biosynthetic process 15 0.0345  GO:0048878 ~ chemical homeostasis 5 0.0423 Down-regulated genes  GO:0008152 ~ metabolic process 66 <0.0001  GO:0044237 ~ cellular metabolic process 8 <0.0001  GO:0009987 ~ cellular process 11 0.0001  GO:0044238 ~ primary metabolic process 11 0.0009  GO:0019538 ~ protein metabolic process 23 0.0023\nTop 10 up- and down-regulated known genes in ICAR of ipsilateral uterine horns of RB cows\nTop 5 functional annotations of up- and down-regulated genes in ICAR of ipsilateral uterine horns\nA total of 443 and 257 genes were differentially expressed in CAR and ICAR of the contralateral uterine horn of RB cows, respectively when compared with non-RB cows (adjusted  P -value <0.05, fold-change >1.0). All data of individual gene changes in CAR and ICAR are available in Additional file  1 : Tables S3 and S4, respectively. Out of these, 333 genes were up-regulated and 110 genes were down-regulated in CAR, whereas 121 genes were up-regulated and 136 genes were down-regulated in ICAR. The top 10 up- and down-regulated known genes in CAR are shown in Table  6 . Similar to CAR of the ipsilateral side, the most pronounced up-regulated gene in RB cows was  GSTA3  (Glutathione  S -transferase, alpha 3; 12.7-fold). The most down-regulated gene in RB cows was  SLC39A2  (Solute carrier family 39 (zinc transporter), member 2; 2.7-fold). Table  7  shows the top five functional annotations of DEG in CAR between RB and non-RB cows. Biological functions of positive regulation of biological process, positive regulation of cellular process, organ morphogenesis, anatomical structure morphogenesis, and anatomical structure development were highly enriched in up-regulated genes, whereas biological functions of regulation of protein kinase activity, regulation of kinase activity, regulation of transferase activity and carboxylic acid metabolic process were highly enriched in down-regulated genes. Table 6 Top 10 up- and down-regulated known genes in CAR of contralateral uterine horns of RB cows GenBank accession ID Gene symbol Gene description Fold change \n P -value Up-regulated genes   NM_001077112 GSTA3 Glutathione S-transferase, alpha 3 12.7 0.0080   NM_001014878 PIPOX Pipecolic acid oxidase 8.4 0.0261   NM_001024569 ELF5 E74-like factor 5 (ets domain transcription factor) 4.3 0.0173   NM_173981 ACAN Aggrecan 3.0 0.0420   NM_174404 NRXN1 Neurexin 1 3.0 0.0065   NM_001079771 SMOC1 SPARC related modular calcium binding 1 2.7 0.0104   NM_001034351 TNNC1 Troponin C type 1 (slow) 2.6 0.0142   NM_173945 NTS Neurotensin 2.6 0.0289   NM_001206196 KLHL24 Kelch-like 24 (Drosophila) 2.4 0.0345   NM_001046585 CCL14 Chemokine (C-C motif) ligand 14 2.4 0.0358 Down-regulated genes   NM_001205648 SLC39A2 Solute carrier family 39 (zinc transporter), member 2 2.7 0.0110   XM_002687754 PLEKHA5 Pleckstrin homology domain containing, family A member 5 2.2 0.0181   NM_001077962 STAC SH3 and cysteine rich domain 2.0 0.0456   NM_001098061 SQLE Squalene epoxidase 2.0 0.0268   NM_174145 PKP1 Plakophilin 1 (ectodermal dysplasia/skin fragility syndrome) 1.9 0.0304   NM_001098938 CYP39A1 Cytochrome P450, family 39, subfamily A, polypeptide 1 1.9 0.0262   NM_174489 VLDLR Very low density lipoprotein receptor 1.9 0.0063   NM_001034660 SLC5A11 Solute carrier family 5 (sodium/glucose cotransporter), member 11 1.8 0.0061   NM_001075803 FH Fumarate hydratase 1.8 0.0009   NM_001099399 CMTM3 CKLF-like MARVEL transmembrane domain containing 3 1.8 0.0434 \n Table 7 Top 5 functional annotations of up- and down-regulated genes in CAR of contralateral uterine horns Term Count \n P -value Up-regulated genes  GO:0048518 ~ positive regulation of biological process 25 <0.0001  GO:0048522 ~ positive regulation of cellular process 22 <0.0001  GO:0009887 ~ organ morphogenesis 12 <0.0001  GO:0009653 ~ anatomical structure morphogenesis 16 0.0001  GO:0048856 ~ anatomical structure development 24 0.0002 Down-regulated genes  GO:0045859 ~ regulation of protein kinase activity 5 0.0029  GO:0043549 ~ regulation of kinase activity 5 0.0035  GO:0051338 ~ regulation of transferase activity 5 0.0040  GO:0043436 ~ oxoacid metabolic process 7 0.0075  GO:0019752 ~ carboxylic acid metabolic process 7 0.0075\nTop 10 up- and down-regulated known genes in CAR of contralateral uterine horns of RB cows\nTop 5 functional annotations of up- and down-regulated genes in CAR of contralateral uterine horns\nTable  8  shows the top 10 up- and down-regulated known genes in ICAR. The highest increase and decrease in gene expression in RB cows were found for  PIPOX  (Pipecolic acid oxidase; 8.8-fold) and  IFIH1  (Interferon induced with helicase C domain 1; 4.0-fold), respectively. The top five functional annotations of DEG in the ICAR of contralateral uterine horns between RB and non-RB cows are listed in Table  9 . The GOs containing genes regulating gene expression, regulation of primary metabolic process, regulation of macromolecule metabolic process, metabolic process and regulation of metabolic process were highly enriched in up-regulated genes. In down-regulated genes, the GO terms involved in primary metabolic process, transport, establishment of localization, localization and metabolic process were highly enriched. Table 8 Top 10 up- and down-regulated known genes in ICAR of contralateral uterine horns of RB cows GenBank accession ID Gene symbol Gene description Fold change \n P -value Up-regulated genes   NM_001014878 PIPOX Pipecolic acid oxidase 8.8 0.0156   NM_174278 CNGA1 Cyclic nucleotide gated channel alpha 1 6.8 0.0390   NM_001033608 GSTA3 Glutathione S-transferase, alpha 3 6.6 0.0340   NM_001046400 MIF Macrophage migration inhibitory factor (glycosylation-inhibiting factor) 3.1 0.0118   NM_001046400 ZNRD1 Zinc ribbon domain containing 1 2.8 0.0400   NM_001206196 KLHL24 Kelch-like 24 (Drosophila) 2.6 0.0212   NM_001076517 LY6D Lymphocyte antigen 6 complex, locus D 2.5 0.0414   NM_001035473 GK5 Glycerol kinase 5 2.2 0.0210   NM_001075890 KLK10 Kallikrein-related peptidase 10 2.1 0.0445   NM_001083791 SH3BGRL2 SH3 domain binding glutamic acid-rich protein like 2 1.9 0.0030 Down-regulated genes   XM_002685338 IFIH1 Interferon induced with helicase C domain 1 4.0 0.0485   NM_001101195 KCNA2 Potassium voltage-gated channel, shaker-related subfamily, member 2 3.5 0.0204   NM_180998 LTF Lactotransferrin 2.9 0.0286   NM_001076843 SLC30A3 Solute carrier family 30 (zinc transporter), member 3 2.6 0.0289   NM_001076494 C8H8orf13 Chromosome 8 open reading frame 13 ortholog 2.5 0.0406   NM_001105411 GFRA1 GDNF family receptor alpha 1 2.5 0.0383   NM_174018 CFTR Cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) 2.5 0.0316   NM_001077941 MARCH3 Membrane-associated ring finger (C3HC4) 3 2.5 0.0158   NM_173959 SCD Stearoyl-CoA desaturase (delta-9-desaturase) 2.0 0.0096   NM_174602 SLC2A1 Solute carrier family 2 (facilitated glucose transporter), member 1 1.9 0.0057 \n Table 9 Top 5 functional annotations of up- and down-regulated genes in ICAR of contralateral uterine horns Term Count \n P -value Up-regulated genes  GO:0010467 ~ gene expression 17 0.0004  GO:0080090 ~ regulation of primary metabolic process 19 0.0013  GO:0060255 ~ regulation of macromolecule metabolic process 19 0.0015  GO:0008152 ~ metabolic process 38 0.0033  GO:0019222 ~ regulation of metabolic process 19 0.0040 Down-regulated genes  GO:0044238 ~ primary metabolic process 34 0.0023  GO:0006810 ~ transport 17 0.0025  GO:0051234 ~ establishment of localization 17 0.0026  GO:0051179 ~ localization 18 0.0027  GO:0008152 ~ metabolic process 35 0.0028\nTop 10 up- and down-regulated known genes in ICAR of contralateral uterine horns of RB cows\nTop 5 functional annotations of up- and down-regulated genes in ICAR of contralateral uterine horns\nTo characterize differential global gene expression profiles in the endometrium of RB and non-RB cows not only locally in each endometrial compartment but also globally in the uterus, we also performed bioinformatics analysis by combining the microarray gene data sets of four endometrial compartments in each cow as whole uterus. A total of 76 genes were found to be differentially expressed in the whole uterus of RB cows when compared with non-RB cows (adjusted  P -value <0.05, fold-change >2.0). Among these, 37 genes were up-regulated and 39 genes were down-regulated. All up- and down-regulated known genes in the whole uterus are shown in Table  10 . The most pronounced up- and down-regulated gene expression in RB cows was found for  PRSS2  (Protease, serine, 2 (trypsin 2); 12.3-fold) and  CHGA  (Chromogranin A (parathyroid secretory protein 1); 3.9-fold), respectively. Table 10 Up- and down-regulated known genes in whole uterus of RB cows as compared with non-RB cows GenBank accession ID Gene symbol Gene description Fold change \n P -value Up-regulated genes   NM_174690 PRSS2 Protease, serine, 2 (trypsin 2) 12.3 0.0018   NM_001077112 GSTA3 Glutathione S-transferase, alpha 3 6.7 0.0002   NM_001014878 PIPOX Pipecolic acid oxidase 6.4 <0.0001   NM_174278 CNGA1 Cyclic nucleotide gated channel alpha 1 4.3 0.0024   S82409 IGG1C IgG1 heavy chain constant region 3.7 0.0081   BC112657 Vl1a Immunoglobulin lambda light chain variable region 3.7 0.0076   S82407 IgCgamma IgG2a heavy chain constant region 3.4 0.0347   NM_001025346 DAPL1 death associated protein-like 1 3.4 0.0075   NM_001080353 PI3 Peptidase inhibitor 3, skin-derived (SKALP) 3.2 0.0022   NM_001166616 C5 Complement component 5 2.8 0.0044   NM_001024569 ELF5 E74-like factor 5 (ets domain transcription factor) 2.8 0.0047   NM_001075910 CCDC113 Coiled-coil domain containing 113 2.7 0.0432   NM_173945 NTS Neurotensin 2.6 <0.0001   NM_001034351 TNNC1 Troponin C type 1 (slow) 2.5 0.0004   NM_001206196 KLHL24 Kelch-like 24 (Drosophila) 2.5 <0.0001   NM_001046400 ZNRD1 zinc ribbon domain containing 1 2.3 <0.0001   NM_001193109 SDCCAG8 Serologically defined colon cancer antigen 8 2.2 0.0001   NM_174010 CD36 CD36 molecule (thrombospondin receptor) 2.2 0.0073   XM_588022 SPOPL Speckle-type POZ protein-like 2.2 <0.0001   NM_173880 H4 Histone H4 2.1 0.0033   NM_001098155 ZNF322A Zinc finger protein 322A 2.1 0.0005   NM_001035380 GC Group-specific component (vitamin D binding protein) 2.0 0.0269   NM_001035473 GK5 Glycerol kinase 5 2.0 0.0003 Down-regulated genes   NM_181005 CHGA Chromogranin A (parathyroid secretory protein 1) 3.9 0.0005   NM_001076073 KRT35 Keratin 35 3.3 0.0011   NM_001034728 THBS4 Thrombospondin 4 3.2 <0.0001   NM_001206057 CPXM2 Carboxypeptidase X (M14 family), member 2 3.1 <0.0001   NM_001143735 PRF1 Perforin 1 (pore forming protein) 3.0 0.0090   NM_001002763 CDH1 Cadherin 1, type 1, E-cadherin (epithelial) 2.9 0.0097   NM_176851 FUT5 Fucosyltransferase 5 (alpha (1,3) fucosyltransferase) 2.7 0.0038   XM_002685338 IFIH1 Interferon induced with helicase C domain 1 2.5 0.0040   NM_001081734 MOCS3 Molybdenum cofactor synthesis 3 2.5 0.0465   NM_174039 DPP4 Dipeptidyl-peptidase 4 2.4 0.0158   NM_001102080 CSNK1D Casein kinase 1, delta 2.3 0.0144   NM_001102060 TBC1D10C TBC1 domain family, member 10C 2.3 0.0391   NM_001081539 C11H2orf49 Chromosome 11 open reading frame, human C2orf49 2.3 0.0354   AF068848 VpreB Surrogate light chain 2.3 0.0204   NM_001127317 MIC1 Major histocompatibility class I related protein 2.2 0.0135   NM_205801 CLDN3 Claudin 3 2.2 0.0196   NM_001077887 CLASRP CLK4-associating serine/arginine rich protein 2.2 0.0245   NM_174513 ADAP1 ArfGAP with dual PH domains 1 2.1 0.0169   NM_001105478 SSLP1 Secreted seminal-vesicle Ly-6 protein 1 2.1 0.0004   NM_001077962 STAC SH3 and cysteine rich domain 2.1 <0.0001   XM_002687754 PLEKHA5 Pleckstrin homology domain containing, family A member 5 2.1 0.0003   NM_001101239 GRP Gastrin-releasing peptide 2.1 0.0059   NM_001205648 SLC39A2 Solute carrier family 39 (zinc transporter), member 2 2.0 0.0001\nUp- and down-regulated known genes in whole uterus of RB cows as compared with non-RB cows\nWe selected the top two and top five up- and down-regulated known genes in each endometrial compartment and whole uterus between RB and non-RB cows, respectively to validate the changes in gene expression obtained from microarray analysis by qPCR. qPCR analysis clearly confirmed the microarray results in each endometrial compartment except for  FAM83D  (Fig.  1h ),  SLC39A2  (Fig.  2c ),  PLEKHA5  (Fig.  2d ) and  IFIH1  (Fig.  2g ). In the whole uterus, the microarray results were confirmed except for  PRF1  (Fig.  3j ). Fig. 1 qPCR analysis of top two up- and down-regulated known genes in ipsilateral uterine horns between RB and non-RB cows for validation of the gene expression changes obtained from microarray analysis.  a ,  b ,  c  and  d  CAR and  e ,  f ,  g  and  h  ICAR.  a ,  b ,  e  and  f  up-regulated known genes in RB cows when compared with non-RB cows.  c ,  d ,  g  and  h ) down-regulated known genes in RB cows when compared with non-RB cows. The expression of mRNA was normalized to the expression of  SUZ12  measured in the same RNA preparation. Data are shown as the mean ± SEM. Asterisks show significant differences ( P  < 0.05) \n Fig. 2 qPCR analysis of top two up- and down-regulated known genes in contralateral uterine horns between RB and non-RB cows for validation of the gene expression changes obtained from microarray analysis.  a ,  b ,  c  and  d  CAR and  e ,  f ,  g  and  h  ICAR.  a ,  b ,  e  and  f  up-regulated known genes in RB cows when compared with non-RB cows.  c ,  d ,  g  and  h  down-regulated known genes in RB cows when compared with non-RB cows. The expression of mRNA was normalized to the expression of  SUZ12  measured in the same RNA preparation. Data are shown as the mean ± SEM. Asterisks show significant differences ( P  < 0.05) \n Fig. 3 qPCR analysis of top five up- and down-regulated known genes in whole uterus between RB and non-RB cows for validation of the gene expression changes obtained from microarray analysis.  a ,  b ,  c ,  d ,  e  up-regulated known genes in RB cows when compared with non-RB cows.  f ,  g ,  h ,  i ,  j  down-regulated known genes in RB cows when compared with non-RB cows. The expression of mRNA was normalized to the expression of  SUZ12  measured in the same RNA preparation. Data are shown as the mean ± SEM. Asterisks show significant differences ( P  < 0.05)\nqPCR analysis of top two up- and down-regulated known genes in ipsilateral uterine horns between RB and non-RB cows for validation of the gene expression changes obtained from microarray analysis.  a ,  b ,  c  and  d  CAR and  e ,  f ,  g  and  h  ICAR.  a ,  b ,  e  and  f  up-regulated known genes in RB cows when compared with non-RB cows.  c ,  d ,  g  and  h ) down-regulated known genes in RB cows when compared with non-RB cows. The expression of mRNA was normalized to the expression of  SUZ12  measured in the same RNA preparation. Data are shown as the mean ± SEM. Asterisks show significant differences ( P  < 0.05)\nqPCR analysis of top two up- and down-regulated known genes in contralateral uterine horns between RB and non-RB cows for validation of the gene expression changes obtained from microarray analysis.  a ,  b ,  c  and  d  CAR and  e ,  f ,  g  and  h  ICAR.  a ,  b ,  e  and  f  up-regulated known genes in RB cows when compared with non-RB cows.  c ,  d ,  g  and  h  down-regulated known genes in RB cows when compared with non-RB cows. The expression of mRNA was normalized to the expression of  SUZ12  measured in the same RNA preparation. Data are shown as the mean ± SEM. Asterisks show significant differences ( P  < 0.05)\nqPCR analysis of top five up- and down-regulated known genes in whole uterus between RB and non-RB cows for validation of the gene expression changes obtained from microarray analysis.  a ,  b ,  c ,  d ,  e  up-regulated known genes in RB cows when compared with non-RB cows.  f ,  g ,  h ,  i ,  j  down-regulated known genes in RB cows when compared with non-RB cows. The expression of mRNA was normalized to the expression of  SUZ12  measured in the same RNA preparation. Data are shown as the mean ± SEM. Asterisks show significant differences ( P  < 0.05)\nFigure  4  shows the results of immunohistochemistry for CHGA, GSTA3 and PRSS2 in the endometrial tissues of ipsilateral uterine horns of RB and non-RB cows on Day 15 of the estrous cycle. In both RB and non-RB cows, a distinct CHGA signal was found in the uterine luminal epithelium and a part of uterine stroma under the epithelium (Fig.  4a  and  c ). CHGA protein was also detected moderately in the glandular epithelium in both RB and non-RB cows and in the uterine stroma in RB cows (Fig.  4b  and  d ). A positive GSTA3 signal was detected in the uterine luminal, uterine stroma and glandular epithelium in RB cows (Fig.  4e  and  f ), whereas positive staining was not observed in non-RB cows (Fig.  4g  and  h ). PRSS2 protein was moderately detected in the uterine luminal epithelium and glandular epithelium, and partially intense staining was observed in the uterine stroma under the epithelium in both RB and non-RB cows (Fig.  4i , j , k  and  l ). Fig. 4 Representative photomicrographs of protein localization of CHGA, GSTA3 and PRSS2 in endometrial tissue from RB and non-RB cows on Day 15 of estrous cycle. Protein localization of ( a ,  b ,  c  and  d ) CHGA, ( e ,  f ,  g  and  h ) GSTA3 and ( i ,  j ,  k  and  l ) PRSS2 in endometrial tissue from RB ( a ,  b ,  e ,  f ,  i  and  j ) and non-RB ( c ,  d ,  g ,  h ,  k  and  l ) cows was detected by immunohistochemistry. Seven-micrometer sections of bovine endometrial tissues of ipsilateral uterine horns on Day 15 of estrous cycle were immunostained with anti-human CHGA, anti-human GSTA3 and anti-bovine PRSS2 polyclonal antibodies. Positive staining of CHGA and PRSS2 were found in the uterine luminal epithelium, uterine stroma and glandular epithelium of both RB and non-RB cows. GSTA3 was detected in the uterine luminal, uterine stroma and glandular epithelium in RB cows, whereas positive staining was not observed in non-RB cows. No signal was detected in the negative control sections using normal rabbit IgG (inserted panels). LE, luminal epithelium; US, uterine stroma; GE, glandular epithelium. Scale bars = 50 μm\nRepresentative photomicrographs of protein localization of CHGA, GSTA3 and PRSS2 in endometrial tissue from RB and non-RB cows on Day 15 of estrous cycle. Protein localization of ( a ,  b ,  c  and  d ) CHGA, ( e ,  f ,  g  and  h ) GSTA3 and ( i ,  j ,  k  and  l ) PRSS2 in endometrial tissue from RB ( a ,  b ,  e ,  f ,  i  and  j ) and non-RB ( c ,  d ,  g ,  h ,  k  and  l ) cows was detected by immunohistochemistry. Seven-micrometer sections of bovine endometrial tissues of ipsilateral uterine horns on Day 15 of estrous cycle were immunostained with anti-human CHGA, anti-human GSTA3 and anti-bovine PRSS2 polyclonal antibodies. Positive staining of CHGA and PRSS2 were found in the uterine luminal epithelium, uterine stroma and glandular epithelium of both RB and non-RB cows. GSTA3 was detected in the uterine luminal, uterine stroma and glandular epithelium in RB cows, whereas positive staining was not observed in non-RB cows. No signal was detected in the negative control sections using normal rabbit IgG (inserted panels). LE, luminal epithelium; US, uterine stroma; GE, glandular epithelium. Scale bars = 50 μm\n\nThis is the first study to investigate global gene expression profiles of endometrium between RB and non-RB cows in both each endometrial compartments and the whole uterus. As we hypothesized, the microarray analysis identified a number of characteristic up- and down-regulated genes specific to each of four endometrial compartments of RB cows. The RB cows used in this study had experienced pregnancy and then became infertile. Thus, long-term infertility in the RB cows may be associated with alteration of endometrial function. Our results support that alteration of uterine environment, which may be induced by changes in the endometrial gene expression, could be a possible involvement of low fertility in the RB cattle.\nEven though the endometrial gene expression profiles were regionally different in the endometrial compartments,  GSTA3  was identified as the most pronounced up-regulated gene in the CAR of both ipsilateral and contralateral uterine horn. GSTA3 is a member of the class Alpha GST isoenzymes which exert a critical role in the detoxification of electrophilic decomposition products generated by reactive oxygen species (ROS) and metabolism of xenobiotics through glutathione conjugation with electrophilic compounds [ 34 – 37 ]. Similar to our results, a recent study has demonstrated that cows with low endometrial receptivity of the embryo show a higher expression of several oxidative stress-response genes in the endometrium compared with highly receptive cows at Day 7 of the estrous cycle [ 7 ]. Both oxidative stress and xenobiotics are directly responsible for not only an increase in embryonic mortality but also an alteration of uterine function inducing severe gynecological diseases such as endometriosis and preeclampsia [ 38 – 42 ]. We suppose that the CAR of RB cows may be accompanied by enhanced detoxification and elimination of ROS and xenobiotics. Another important contribution of GSTA3 isomerase is in the biosynthesis of steroids, especially testosterone and P4 in active steroidogenic tissues [ 43 ]. Progesterone inhibits endometrial epithelial cell proliferation, adenogenesis and uterine gland development [ 44 ,  45 ]. A previous study showed that RB cows had higher concentrations of P4 receptor in the endometrium than non-RB cows, implying the existence of a local hormonal imbalance in RB cows [ 46 ]. In the present study, the  GSTA3  was also highly expressed in the ICAR of RB cows compared with non-RB cows. In addition, immunohistochemistry revealed that a strong signal of GSTA3 protein was detected in the uterine luminal and glandular epithelium and stroma in RB cows. GSTA3 may also be involved in ICAR functions in RB cows by mediating steroidogenesis.\nGene ontology analysis using DAVID revealed that a number of biological processes and functions were different between RB and non-RB cows in both CAR and ICAR. In the CAR of RB cows, genes involved in development and morphogenesis were mainly up-regulated. These genes included 14 and 9 genes regulating embryo development and vasculature development, respectively. The CAR eventually attaches with the trophoblast to give rise to the maternal side of the placentome in pregnant animals [ 22 ,  23 ]. Up-regulation of the genes involved in embryo and vasculature development in the CAR may contribute to the success of implantation and following placental formation at the maternal-fetal interface. An increase in the regulation of these genes in the CAR may be one of the characteristics of the RB uterus. In the ICAR of both the ipsilateral and contralateral uterine horns, genes related to metabolic processes were predominantly enriched in both up- and down-regulated genes in RB cows compared with non-RB cows. The ICAR is a specific compartment containing the uterine glands, which synthesize and secrete various metabolites and histotroph required for estrous cyclicity or development of the conceptus [ 24 ]. Alterations of endometrial metabolic processes in RB cows may seriously affect maintenance of uterine function.\nThe DAVID analysis also revealed that the CAR of the ipsilateral uterine horn of RB cows is characterized by down-regulation of a number of genes associated with cytoskeleton organization, cell adhesion and cellular component organization compared with non-RB cows. Previous global gene expression studies in bovine endometrium showed that profiles of the genes assigned to these functional categories changes during estrous cycle and peri-implantation [ 11 – 13 ], suggesting that these biological functions may be responsible for the regulation of uterine environment. Additionally, the endometrial cell adhesion molecules play a role in conceptus-endometrium attachment at implantation. A direct comparison of cyclic and pregnant endometrium found cell adhesion and cytoskeleton organization molecules affected by pregnancy in both CAR and ICAR [ 13 ]. Around the implantation period, the ipsilateral uterine horn is the site of first occurrence of conceptus-endometrial contact and modification of cytological character was seen exclusively on the CAR [ 47 ,  48 ]. Therefore, the lower expression of genes regulating cytoskeleton organization and cell adhesion in CAR of RB cows may be associated with inadequate endometrial responsiveness resulting in implantation failure.\nCPXM2  was included in the top 10 down-regulated genes in both CAR and ICAR of the ipsilateral uterine horn. Previous microarray studies found no differences in  CPXM2  expression in the bovine endometrium between highly fertile and poor fertile, and between highly fertile and subfertile cows at Day 14 of the estrous cycle [ 9 ], while expression decreasing at Day 7 compared to Day 3 of estrus in cows with low embryo receptivity [ 7 ]. CPXM2 is assumed to be more sensitive to P4 or some CL factors in a poorly fertile endometrium that includes the RB. Although the specific roles of CPXM2 remain unknown, DAVID analysis has assigned it belongs to the biological process of proteolysis and cell adhesion. Thus,  CPXM2  may be related to alteration of endometrial cell adhesion in RB cows, as well as to the above described cell adhesion related genes that are down-regulated in the CAR of the ipsilateral uterine horn of RB cows.\nKLHL24  (Kelch-like 24) was the only gene included in the top 10 up-regulated genes in all four endometrial compartments. A member of the KLHL family including KLHL24 is known to be involved in ubiquitination [ 49 ,  50 ]. It has been reported that lower expression of genes associated with ubiquitination in high fertile as compared with subfertile cows [ 9 ]. Although the specific roles of KLHL24 have not yet been elucidated, an increase in oxidative stress stimulated  KLHL24  expression in human fibroblast cells [ 51 ], leading us to speculate that this gene is up-regulated to counteract cytoskeleton destruction by ROS- induced cell damage and/or to degrade proteins in cells exposed to ROS by ubiquitination reaction. Therefore, high expression of  KLHL24  in RB cows compared with non-RB cows support the possibility that the endometrium of RB cows is under oxidative stress. However, it has been reported that the level of  KLHL24  gene expression at Day 14 of the estrous cycle shows no significant difference among high fertile, low fertile and infertile cows [ 9 ]. The functional contribution of endometrial KLHL24 in bovine fertility remains unclear.\nAnalysis of the combined gene data sets of the four endometrial compartments revealed gene expression profiles of the whole uterus.  PRSS2  and  CHGA  were the most pronounced up- and down-regulated genes, respectively. PRSS2 is a member of the trypsin family of serine proteases and degrades type I collagen directly or indirectly by activating several procollagenolytic matrix metalloproteinases (MMPs) [ 52 ,  53 ]. CHGA works as a pro-hormone for pancreastatin, vasostatin and catestatin [ 54 – 56 ]. Full-length CHGA and vasostatin act as anti-angiogenic factors to inhibit two potent angiogenic factors, basic fibroblast growth factor (bFGF) and vascular endothelial growth factor, while CHGA cleaved by thrombin and catestatin promote angiogenesis by inducing the release of bFGF from vascular endothelial cells [ 57 ]. In the present study, we found that both PRSS2 and CHGA proteins were localized in the luminal and glandular epithelium and in the stroma of the endometrium. These localizations coincide with the tissue site of gelatinase activity of MMP-2 and the localization of MMPs and bFGF in the bovine endometrium [ 58 – 60 ], suggesting paracrine and autocrine actions of PRSS2 and CHGA with MMPs and bFGF in the bovine endometrium. In addition, genes involved in cell death ( DAPL1  and  PRF1 ) or cell attachment ( CD36 ,  CDH1 ,  CPXM2 ,  KRT35  and  THBS4 ) were also differentially expressed between RB and non-RB cows. Although further studies are needed to clarify, the endometrium of RB cows might not only be involved in the promotion of tissue remodeling and imbalance of angiogenesis but also in the degradation of cell renewal and tissue structure.\nIn cattle, around Day 15 of pregnancy is a stage of the beginning of conceptus elongation and maternal recognition of pregnancy [ 26 ]. A recent RNA-seq study identified numerous conceptus-expressed ligands that interact with corresponding receptors expressed on the endometrium and vice versa at Day 16 of pregnancy in cattle [ 61 ]. In the present study, some genes of endometrium expressed ligands ( CCL4 ,  CCL14 ,  COL1A2 ,  EDN1 ,  F2 ,  MMP2 ,  THBS4  and  TIMP3 ) and receptors ( ACVR2B ,  BMPR2 ,  CD4 ,  CD36 ,  IGF2R ,  IL10RB ,  KDR ,  TNFRSF25  and  VLDLR ) that interact with conceptus reported by Mamo et al. were differentially expressed between RB and non-RB cows. In addition, other genes encoding growth factors ( FGF9  and  GDF7 ) and cytokines ( CCL8 ,  CD14  and  CD53 ) were down-regulated in the RB cows as compared with non-RB cows. Although the functional role of these two growth factors in bovine endometrium remains to be elucidated, FGF9 induces endometrial stromal cell proliferation [ 62 ]. Up-regulation of  FGF9  and  GDF7  expressions were detected in equine and/or swine pregnant endometrium and may be implicated in embryo-maternal communication at early pregnancy [ 63 ,  64 ]. The receptors of these growth factors were expressed in not only endometrium but also conceptus at Day 16 of pregnancy in cattle [ 61 ]. Therefore, alteration of the expression of these ligands and receptors in the RB cows may affect conceptus development and maternal recognition of pregnancy if a conceptus presents in the RB cows.\n\nThe results of the present study support the hypothesis that endometrial gene expression profiles are different between RB and non-RB cows. In RB cows, characteristic gene expression was identified in both the CAR and ICAR of both ipsilateral and contralateral uterine horns. The enriched GO terms of these genes were related to cell adhesion and morphogenesis in the CAR and metabolism in the ICAR. These results suggest that local regulation of molecular mechanisms in each endometrial compartment may contribute to normal uterine physiology. Therefore, the identified candidate endometrial genes and functions are likely to be involved in bovine reproductive performance. The present study could provide an information base for understanding underlying molecular pathogenesis and developing a treatment of repeat breeding in cattle from the point of view of endometrial function.","source_license":"CC-BY-4.0","license_restricted":false}