{"paper_id":"36094ad5-3a2c-4b23-9532-be40e05b7ea8","body_text":"Targeted CRISPR Screens Reveal Genes Essential  1 \nfor Cryptosporidium Survival in the Host Intestine 2 \n 3 \n 4 \n 5 \nLucy C Watson1, Katarzyna A Sala 1, Netanya Bernitz 1, Lotta Baumgärtel 1, Mitchell A 6 \nPallett1, N Bishara Marzook 1, Lorian Cobra Straker2, Duo Peng3, Lucy Collinson2, Adam 7 \nSateriale1# 8 \n 9 \nAKiliations 10 \n1Cryptosporidiosis Laboratory, The Francis Crick Institute, London, NW1 1AT 11 \n2Electron Microscopy Science Technology Platform, The Francis Crick Institute, NW1 1AT 12 \n3Chan Zuckerberg Biohub, San Francisco, CA, 94158 13 \n# Corresponding author 14 \n 15 \n 16 \n 17 \n 18 \n 19 \n 20 \n 21 \n 22 \n 23 \n 24 \n 25 \n 26 \n 27 \n 28 \n 29 \n 30 \n 31 \n 32 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 2 \nAbstract 33 \n 34 \nThe Cryptosporidium parasite is one of the leading causes of diarrheal morbidity and 35 \nmortality in children, and adolescent infections are associated with chronic malnutrition. 36 \nThere are no vaccines available for protection and only one drug approved for treatment 37 \nthat has limited eKicacy. A major barrier to developing new therapeutics is a lack of 38 \nfoundational knowledge of Cryptosporidium biology, including which parasite genes are 39 \nessential for survival and virulence.  Here, we iteratively improve the tools for genetically 40 \nmanipulating Cryptosporidium and develop a targeted CRISPR-based screening method 41 \nto rapidly assess how the loss of individual parasite genes influence survival in vivo. Using 42 \nthis method we examine the parasite’s pyrimidine salvage pathway and a set of leading 43 \nCryptosporidium vaccine candidates. From this latter group we determined the parasite 44 \ngene known as Cp23 to be essential for survival, which was confirmed through inducible 45 \nknockout in vitro and in vivo. Parasites deficient in Cp23 were able to replicate within and 46 \nemerge from infected epithelial cells, yet unable to  initiate gliding motility which is 47 \nessential for the reinfection of neighbouring cells.  The targeted screening method 48 \npresented here is highly versatile and will enable researchers to more rapidly expand the  49 \nknowledge base for Cryptosporidium infection biology , paving the way for new 50 \ntherapeutics.         51 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 3 \nIntroduction 52 \n 53 \nDiarrhoeal related infections are a major cause of morbidity and mortality in children 54 \naround the world (Troeger et al., 2017) , (Troeger et al., 2018) . Cryptosporidiosis is 55 \nconsistently found to be one of the leading causes of a moderate -to-severe diarrhoeal 56 \ndisease in infants (KotloK et al., 2013) , (KotloK et al., 2019) . Unlike other diarrheal 57 \ndiseases that are attributed with high incidence rates, such as rotavirus or Shigella, there 58 \nare no eKective drugs or vaccines for Cryptosporidium. Nitazoxanide, the only Food and 59 \nDrug Administration approved drug for treatment, is not eKective in 60 \nimmunocompromised individuals, only partially eKective in adults, and not approved for 61 \nuse in children, the patient population that needs intervention the most (Abubakar et al., 62 \n2007), (Amadi et al., 2009). One reason for this scarcity of therapeutics is a historic lack 63 \nof eKective systems to study the parasite. While there have been recent improvements in 64 \ngenetic manipulation (Vinayak et al., 2015) , drug target identification  (Caldwell et al., 65 \n2024), (Manjunatha et al., 2024) , (Ajiboye et al., 2024) , and animal models of infection  66 \n(Sateriale et al., 2019) , our comprehension of Cryptosporidium biology remains very 67 \nbasic. Specifically, there is a limited understanding of the Cryptosporidium genes that 68 \ncontribute to parasite fitness and survival,  genes that would be the most suitable targets 69 \nfor therapeutic intervention.   70 \n 71 \nReverse genetic approaches have been instrumental in identifying parasite genes that 72 \ninfluence survival and convey fitness in other Apicomplexan parasites (Sidik et al., 2016), 73 \n(Young et al., 2019), (Bushell et al., 2017), (Butterworth et al., 2023), (Smith et al., 2022). 74 \nToxoplasma, which has historically served as a facile model for Apicomplexa, has 75 \nbenefited from a high transfection eKiciency coupled with non-homologous end joining 76 \n(NHEJ) to be at the forefront of Apicomplexa  CRISPR screening (Sidik et al., 2016) . Like 77 \nCryptosporidium, the Plasmodium parasite lacks NHEJ pathways, so CRISPR -Cas9 78 \ndriven double stranded breaks can only be fixed by homologous repair. This lack of NHEJ 79 \ncan be leveraged to implement precise CRISPR screening, yet to date, no such screening 80 \nmethod exists in Cryptosporidium. Here, we overcome the current technical barriers for 81 \nCryptosporidium genetic manipulation to develop a reproducible method for pooled in 82 \nvivo CRISPR screens.  83 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 4 \n 84 \nCryptosporidium has a highly streamline genome and lacks many basic metabolic 85 \npathways. Because of this, it is thought to be heavily reliant on its host cell for nutrients. 86 \nThis is particularly evident in the nucleotide salvage pathway, where Cryptosporidium is 87 \nbelieved to be capable of scavenging both nucleotides and nucleotide precursors from 88 \nthe host enterocyte (Pawlowic et al., 2019). Despite a compact genome, both purine and 89 \npyrimidine salvage pathways show evidence of redundancy. The purine salvage pathway 90 \nhas been well studied in Cryptosporidium, revealing that many genes in the pathway can 91 \nbe independently eliminated, resulting in little or no deficit in parasite growth (Pawlowic 92 \net al., 2019) . Surprisingly, this includes inosine monophosphate dehydrogenase 93 \n(IMPDH), a gene once considered to be a crucial drug target based on metabolic mapping 94 \n(Striepen et al., 2004), (JeKeries et al., 2015). The absence of a growth defect in parasites 95 \nthat lack IMPDH suggests that Cryptosporidium can not only synthesise purine 96 \nnucleotides, but also take them up directly from the infected host cell. Less is known 97 \nabout the pyrimidine salvage pathway in Cryptosporidium, however, there is still 98 \nevidence of redundancy. Thymidine kinase (TK) and dihydrofolate reductase -thymidine 99 \nsynthase (DHFR -TS) both convert their respective substrates (deoxythymidine or 100 \ndeoxyuridine monophosphate) to deoxythymidine monophosphate. For this reason, TK 101 \nand DHFR -TS are both independently non -essential for DNA synthesis and parasite 102 \ngrowth (Vinayak et al., 2015) , (Pawlowic et al., 2019) . Using our in vivo pooled CRISPR 103 \nscreen, we discovered that most of the pyrimidine salvage genes significantly contribute 104 \nto parasite fitness within the intestine. 105 \n 106 \nIt is widely accepted that protective immunity can be acquired to Cryptosporidium, as 107 \nincidences of Cryptosporidium infections decrease with age (Haque et al., 2009), (KotloK 108 \net al., 2013) , (Sow et al., 2016) , and experimental infection with attenuated parasites 109 \nleads to protection in calves and mice (Jenkins et al., 2004) , (Sateriale et al., 2019) . 110 \nConsidering the success of the vaccination campaign for rotavirus  (Yen et al., 2014) , 111 \n(O'Ryan, 2017), a diarrheal pathogen with a similar patient population and pathogenesis, 112 \na Cryptosporidium vaccine is predicted to greatly reduce morbidity and mortality in 113 \nchildren. Numerous protein antigens have been associated with protection in humans 114 \nand several prominent surface proteins have been suggested as vaccine candidates 115 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 5 \n(Gilchrist et al., 2023), (Manque Patricio et al., 2011), (Askari et al., 2016). Yet, if and how 116 \nmany of these proteins contribute to parasite fitness is unclear. Here, we assess the 117 \nrelative fitness contributions during infection for a panel of proposed Cryptosporidium 118 \nvaccine candidates (collected from the literature). As Cp23 (also known as the 119 \nCryptosporidium immunodominant antigen 23) is one of the leading vaccine candidates, 120 \nand strongly correlated with protection in humans (Gilchrist et al., 2023), we investigated 121 \nhow this protein specifically contributes to parasite virulence and fitness.  122 \n 123 \nResults 124 \n 125 \nIterative improvements to improve Cryptosporidium genetic manipulation. To 126 \ndevelop CRISPR screening, we first sought to improve Cryptosporidium transfection 127 \neKiciency. To transfect Cryptosporidium, dormant oocysts are treated with bile salts and 128 \nwarmed to body temperature to simulate the conditions of a human intestine. Under 129 \nthese conditions, the environmentally hardy oocysts ‘excyst’ , releasing four motile and 130 \ntransfectable sporozoites that readily invade intestinal epithelial cells. To optimise 131 \ntransfection, we transfected Cryptosporidium parvum  parasites with a vector that 132 \ncontained both luminescent ( NanoLuciferase) and fluorescent (mCherry) reporters 133 \nunder constitutive expression and allowed the transfected parasites to infect an 134 \nintestinal cell (HCT8) monolayer. Numerous electroporation programs were trialled using 135 \ntransient expression, with FL115 demonstrating the highest luminescen ce (Sup. 1a).  136 \nFurthermore, various combinations of bile salts and incubation media were tested for 137 \ntheir eKect on parasite transfection. Notably, incubation in sodium taurocholate led to 138 \nhigher transfection eKiciency compared to the deoxy form, sodium taurodeoxycholate 139 \n(Sup. 1b). Combined, these adjustments resulted in more than a 50-fold improvement in 140 \ntransfection eKiciency (Sup. 1c & d).  141 \n 142 \nAs Cryptosporidium parasites lack NHEJ, CRISPR driven injury of the genome is required 143 \nto drive homologous recombination for genetic manipulation. Although this represents a 144 \nsignificant barrier to high -throughput screening, the parasite’s lack of NHEJ very likely 145 \ncontributes to its uniquely high level of genetic editing specificity. Indeed, an ‘oK -target’ 146 \ngenomic insertion has yet to be reported by Cryptosporidium researchers. Further, the 147 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 6 \nparasite predominantly exists in a haploid state during its life cycle and has a minimal 148 \nrequirement of homology for eKicient editing. To determine the smallest reliable 149 \nallowance for eKicient repair, we tested the eKiciency of editing using diKering length 150 \nhomology arms to integrate a nanoluciferase gene into the dispensable TK locus. A 151 \npositive correlation between the length of the homology arms and the eKiciency of repair 152 \nwas observed, with 50bp (the longest length tested) being the most eKicient, while no 153 \nintegration was observed in the absence of CRISPR driven injury of TK (Sup. 1e).  154 \n 155 \nTo allow for pooled genetic knockout screens, we reasoned that a one-plasmid approach 156 \nwould be required, where a single plasmid delivers the Cas9 -expression vector, a target 157 \nspecific gRNA, and a segment of DNA to be inserted at the target genomic locus (repair 158 \nDNA). The repair DNA contains homologous flanks surrounding an expression cassette 159 \nwith the selectable marker and a genetic barcode for identification. Further, to enable 160 \nhigh-throughput creation of targeted libraries, we developed a two -step Golden Gate 161 \nassembly method, where first a 300bp segment containing all gene -specific (unique) 162 \nDNA is integrated into the Cas9-expression vector. In the second step of the assembly, a 163 \nnon-unique expression cassette is inserted that will integrate into the genome, enabling 164 \nthe use of virtually any combination of selection markers or reporters (Fig. 1a). To fit all 165 \nunique DNA into a 300bp oligo nucleotide, we used a 50bp gRNA which simultaneously 166 \nserves as one of the homology sites for genomic integration. To test the feasibility of this 167 \napproach, we generated a vector targeting TK, a gene that is known to be dispensable for 168 \nparasite growth. The TK targeting vector was transfected into Cryptosporidium parvum 169 \n(C. parvum)  sporozoites that were used to infect genetically immunocompromised 170 \n(interferon gamma deficient Ifng-/-) mice and luminescence was measured in mouse 171 \nfaecal material 7 days post transfection, comparable to what is observed when using a 172 \nseparate DNA repair template and a Cas9 -expression vector (Fig. 1b). As we redefined 173 \nthe method to generate Cryptosporidium transgenics, we confirmed the approach’s 174 \nspecificity via whole genome sequencing, and as expected, the only genome alteration 175 \nobserved was at the targeted site within the coding region of the TK gene (Fig. 1c).  176 \n 177 \nCRISPR KO screen of the pyrimidine salvage pathway. To assess the feasibility and 178 \nreproducibility of a recombination -based in vivo  screen, we designed a pilot screen 179 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 7 \ntargeting 11 genes in the parasite’s pyrimidine salvage pathway (Table. 1). We ran parallel 180 \nscreens employing either 1 or 2 targeting vectors per gene, hence 11 or 22 gRNAs, 181 \nrespectively. Targeted KO vectors were transfected into C. parvum sporozoites, which 182 \nwere propagated in Ifng-/-  mice under paromomycin selection (Fig. 1d). Luminescence 183 \nfrom the integrated nanoluciferase reporter was detected in mouse faecal material 8 184 \ndays post transfection, in both the 1 and 2 KO vector per gene pyrimidine salvage screens 185 \n(Fig. 1e) . From the output, faecal material from the infected mice, p arasites were 186 \npurified, their DNA extracted, and the barcodes amplified via high fidelity PCR. From the 187 \ninput, transfected parasites used to infect the mice, DNA was extracted and the barcodes 188 \namplified via high fidelity PCR. Both the output and input barcodes were sequenced and 189 \nused to calculate fold enrichment scores for each gene. Fold enrichment scores serve as 190 \na measure of relative fitness , genes whose barcodes show a negative enrichment are 191 \npresumed to be important to parasite survival and therefore highly fitness conferring (Fig. 192 \n1f). Importantly, fold enrichment scores between the 1 and 2 KO vector screens were 193 \nstrongly correlated, achieving an R 2 of 0.842 (Fig. 1g) . Of the 11 genes included in the 194 \npyrimidine salvage screen, only 3 were low fitness conferring: dihydrofolate reductase – 195 \nthymidylate synthase ( DHFR-TS) (cgd4_4460), thymidine kinase ( TK) (cgd5_4440) and 196 \ndCMP deaminase (cgd2_2780). As mentioned previously, TK and DHFR -TS play 197 \nredundant roles in synthesis of Cryptosporidium dTMP , making them independently non-198 \nessential for DNA synthesis and parasite growth. Thus, the results of our pilot screen 199 \neKectively mirror those of previous experiments attempting individual knockouts of these 200 \ngenes in vivo (Vinayak et al., 2015), (Pawlowic et al., 2019).  201 \n 202 \nRefining diCRE-mediated genetic editing in Cryptosporidium. To validate our results 203 \nfrom the pyrimidine salvage screen, we sought to use an inducible Cre -recombinase 204 \nsystem to remove genes at their genetic locus. This method has been previously adapted 205 \nfor use in C. parvum, employing the conditional split recombinase (diCRE), which 206 \ndimerises upon rapamycin addition and excises DNA between loxP recombination sites, 207 \none of which is embedded within a n artificial intron introduced into the target gene’s 208 \ncoding sequence (Tandel et al., 2023), (Shaw et al., 2024). This system demonstrated high 209 \neKiciency, but low-to-moderate activity in the absence of the rapamycin induction (i.e. 210 \nleakiness). To refine this system, we tested a validated intron from the male gamete 211 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 8 \nfusion factor HAP2 (cgd8_2220). Insertion of this intron within the nanoluciferase 212 \nreporter with and without the loxP recombination site did not aKect the measured 213 \nluminescence during in vitro infection (Sup. 2a ). Using this validated intron/loxP 214 \ncombination, we generated a stable C. parvum diCRE parasite line targeting TK with the 215 \ndiCRE subunits, FRB -Cre60 and FKBP -Cre59, expressed under the same promoter, 216 \nseparated via a self-cleaving T2A skip peptide (TK-T2A-diCRE) (Sup. 2b). However, when 217 \ninvestigating the excision dynamics of this C. parvum  TK-T2A-diCRE line, by infecting 218 \nHCT8 monolayers in the presence or absence of rapamycin, we noted a high level of 219 \nexcision in the absence of rapamycin, similar to what has been reported previously (Sup. 220 \n2c). We reasoned that the T2A skip peptide may not be functioning properly and causing 221 \nbackground induction in Cryptosporidium. Consequently, we generated a stable 222 \ntransgenic parasite line targeting TK where the diCRE segments were under independent 223 \naldolase and tubulin promoters (TK-diCRE) (Sup. 2d). When investigating the excision 224 \ndynamics of this TK -diCRE line, we observed complete excision of the loxP -flanked TK 225 \nsegment at 24 hours post rapamycin induction, and no measurable excision in the non-226 \ninduced controls (Sup. 2e). Using these TK-diCRE parasites (Sup. 3a), we performed a 227 \ntime course to measure the dynamics of knockout at both the DNA and protein level (via 228 \na C -terminal HA tag). DNA excision had not occurred by 8 hours post rapamycin 229 \ntreatment but was complete by 24 hours, and no excision was detected in the non -230 \ninduced control (Sup. 3b). Likewise, protein levels started to decrease by 12 hours post 231 \nrapamycin treatment and were approximately 95% reduced compared to the non-232 \ninduced controls by 24 hours. In contrast, the protein level s remained high throughout 233 \nthe time course in the non-induced controls (Sup. 3c & d).  234 \n 235 \nRibonucleotide reductase is required for parasite DNA replication and survival. 236 \nRibonucleotide reductases (RNRs) catalyse the conversion of nucleotides to 237 \ndeoxynucleotides, an essential step for DNA synthesis in all organisms. In our pyrimidine 238 \nsalvage screen, RNR showed the lowest fold enrichment score, indicating a high eKect 239 \non parasite fitness. Our first attempt to create RNR -diCRE parasites was unsuccessful, 240 \nlikely due to the addition of a C -terminal HA epitope tag. It has been suggested that the 241 \nC-terminus of RNR is required for its function in other organisms and this may hold true 242 \nfor Cryptosporidium (Cohen et al., 1986) , (Dutia et al., 1986) . The second attempt to 243 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 9 \ngenerate RNR-diCRE parasites, without the C -terminal HA epitope tag, was successful 244 \n(Sup. 3e). In vitro, rapamycin induced DNA excision of both TK- and RNR-diCRE parasites 245 \nappears to follow similar dynamics, although we note some partial excision in the RNR -246 \ndiCRE parasites at later timepoints (Fig. 2a & b ). Further, functional deletion of both TK 247 \nand RNR was confirmed using 5 -ethynyl2´-deoxyuridine (EdU), a thymidine analogue. 248 \nThymidine kinase is required for EdU phosphorylation and incorporation, and it has been 249 \nshown before that loss of the TK gene in Cryptosporidium leads to a failure to incorporate 250 \nEdU (Vinayak et al., 2015). In contrast, RNR deletion will not block EdU phosphorylation, 251 \nbut rather incorporation, as DNA synthesis cannot occur without other 252 \ndeoxynucleotides. We observed a complete lack of EdU incorporation in rapamycin 253 \ntreated TK and RNR-diCRE parasites, while EdU incorporation was observed in the non -254 \ninduced and wildtype controls (Sup. 3f). In vitro, deletion of TK led to no growth defect, 255 \nwhereas deletion of RNR strongly attenuated parasite growth by 24 hours post infection 256 \n(Fig. 2c) . Similarly, rapamycin treatment of TK -diCRE infected mice lead to no growth 257 \ndefect, but rapamycin treatment of RNR -diCRE infected mice completely inhibited 258 \nparasite growth (Fig. 2d) , demonstrating that RNR is indeed essential for parasite 259 \nsurvival, further underlining the reliability of the in vivo CRISPR screening method.    260 \n 261 \nCRISPR KO screen of Cryptosporidium vaccine candidates. Both the 1 and 2 KO vector 262 \nper gene pyrimidine salvage screens were reproducible, but to circumvent potential low 263 \neKiciency gRNAs, we chose to screen the leading Cryptosporidium vaccine candidates 264 \nwith 2 KO vectors per gene. In total, 11 vaccine candidates (22 KO vectors) were chosen 265 \ndue to their reported surface location and implication of immunogenicity and/or immune 266 \nprotection in the literature (Table. 2). Luminescence from the nanoluciferase reporter 267 \nwas detected in mouse faecal material around 7 days post transfection in both screens 268 \n(Fig. 3a). As before, parasites were purified, DNA extracted, and barcodes were amplified 269 \nvia high fidelity PCR. The sequenced barcode counts were used to calculate fold 270 \nenrichment scores for each gene (Fig. 3b) , and importantly these scores were 271 \ncomparable, achieving an R2 of 0.611 (Fig. 3c). Of the 11 genes in the vaccine candidate 272 \nscreen, only 2 were low fitness conferring: cgd6_1660 (thrombospondin repeat protein 273 \n11 (TSP11)) and cgd6_32 (apical glycoprotein 1 (AGP1)). The remaining 9 genes appeared 274 \nto confer some level of fitness. Akey et al., recently demonstrated that AGP1 was 275 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 10 \ndispensable for parasite survival, while apical glycoprotein 2 (AGP2) (cgd7_4330) was 276 \nlikely essential, both phenotypes that our pooled in vivo  CRISPR screen recapitulated 277 \n(Akey et al., 2023).  278 \n 279 \nTo gain more insight into growth and competition of pooled KO parasites, we conducted 280 \nan additional 1 KO vector per gene vaccine candidate screen, where instead of amplifying 281 \nDNA barcodes from parasites purified around the peak of infection, we amplified 282 \nbarcodes directly from individual faecal collections (Fig. 3d ). This alternative method 283 \noKered greater temporal and spatial resolution of infection where fold enrichment scores 284 \ncould be easily and non -invasively be monitored throughout the experiment from either 285 \npooled collections or individual mice (Fig. 3e & f ). Individual mice demonstrated 286 \nconsiderable heterogeneity at day 8 of infection, which decreased over time and became 287 \nmore uniform by day 12. Again, this screen found that AGP1 and TSP11 were low fitness 288 \nconferring relative to the other genes within the cohort. 289 \n 290 \nImmunodominant antigen 23 is required for host cell  invasion. Immunodominant 291 \nantigen 23 (Cp23) (cgd4_3620) is one of the leading Cryptosporidium vaccine candidates, 292 \nhaving been originally discovered in 1986 (Ungar & Nash, 1986). Despite nearly 40 years 293 \nof research, there is very little known about Cp23’s role and function during 294 \nCryptosporidium infection. In our vaccine candidate screen, Cp23 displayed a low fold 295 \nenrichment score, indicating a moderate-to-high eKect on parasite fitness. To investigate 296 \nthe function of Cp23, we generated Cp23 -diCRE parasites (Sup. 4a) . In vitro , the 297 \nrapamycin induced DNA excision had started by 6 hours and was complete by 24 hours, 298 \nwith no excision observed in the uninduced controls (Fig. 4a & b) . Loss of Cp23 was 299 \nconfirmed at the protein level using a commercially available monoclonal antibody.  In 300 \nvitro, rapamycin treatment caused a significant decrease in parasite growth after 24 301 \nhours (Fig. 4c ) and rapamycin treatment of Cp23 -diCRE infected mice completely 302 \nblocked parasite growth (Fig. 4d) , demonstrating that Cp23 is indeed essential for 303 \nparasite survival.  304 \n 305 \nCp23 has been reported to be on the surface of the sporozoite (Mead et al., 1988), in the 306 \nsporozoite trails (Arrowood et al., 1991), and is predicted to localise to the micronemes 307 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 11 \n(Guérin et al., 2023). To localise Cp23 at high resolution, we used a commercial antibody 308 \nthat we genetically validated with our Cp23 -diCRE parasites  (Fig. 4e) , coupled with 309 \nexpansion and super -resolution microscopy. This revealed Cp23 was expressed at the 310 \nparasite’s pellicle throughout the life cycle (Fig. 4f) . To resolve the location further, we 311 \ncarried out transmission electron microscopy (TEM) with the immunogold labelled Cp23 312 \nantibody (Fig. 4g) . In excysted and unexcysted sporozoites, Cp23 again appeared to 313 \nprimarily localise  to the parasite pellicle, either at the plasma membrane or inner 314 \nmembrane complex (IMC). The immunogold-TEM also revealed that even in unexcysted 315 \nsporozoites, Cp23 was not present in the parasite’s micronemes. Further, we found no 316 \nevidence that Cp23 was present in sporozoite trails (Sup. 4b). When permeabilised with 317 \nTriton X-100, sporozoites demonstrated faint staining with the Cp23 antibody (Fig. 4h). 318 \nWithout permeabilisation, C. parvum  sporozoites, surprisingly, demonstrated either a 319 \ncomplete lack of Cp23 signal or a heighted intensity of signal throughout the parasite 320 \n(Fig. 4h). In these high intensity parasites, we can detect the internal control antibody 321 \n(CpTrpB - Cryptosporidium tryptophan synthase beta) at low levels. This suggests that 1) 322 \nhigh intensity Cp23 parasites are weakly permeabilised, 2) permeabilisation with Triton 323 \nX-100 aKects Cp23 localisation, likely by disrupting its membrane association, and 3) 324 \nCp23 is likely not exposed on the surface of the sporozoite.  325 \n 326 \nWithin our synchronised in vitro model of infection, C. parvum parasites egress from their 327 \ninfected cell and re-invade nearby epithelial cells around 18 hours post infection, starting 328 \nanother round of asexual reproduction. By 22 hours, this reinvasion event is mostly 329 \ncomplete. To determine the biological function of Cp23, we examined our Cp23 -diCRE 330 \nparasites in the context of this reinfection event, when DNA excision and depletion of 331 \nCp23 has started. At 22 hours, Cp23-diCRE parasites without rapamycin treatment were 332 \nmostly newly invaded life stages (1n or 2n = 81% of parasites observed, n = 356/438). 333 \nWhen Cp23 was ablated by rapamycin, fewer parasites observed were newly invaded life 334 \nstages (1n or 2n =  45%, n = 77/173) (Fig. 4i & Sup. 4c & e) . In wildtype controls, both in 335 \nthe presence and absence of rapamycin, again, most of the life stages observed were 336 \nnewly invaded (1n or 2n = 83%, n = 176/203 and 171/213 respectively) (Fig. 4i & Sup. 4d 337 \n& e) . We hypothesised that the reduced percentage of newly invaded para sites when 338 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 12 \nCp23 was ablated might be due to a defect in reinvasion. To examine this more closely, 339 \nlive microscopy was carried out in the presence and absence of rapamycin (Fig. 4j & k , 340 \nsupplementary videos S1 -4). When Cp23 was ablated, merozoites could egress, but 341 \nwere then unable to move to another cell to initiate reinvasion. Apicomplexan parasites, 342 \nsuch as Cryptosporidium, are known to use a method of locomotion called gliding 343 \nmotility, where parasites secrete proteins  that are then bound by their own surface 344 \nreceptors, allowing for forward propulsion using an actomyosin-based complex (referred 345 \nto as the glideosome) (Keeley & Soldati, 2004). Loss of Cp23 in Cryptosporidium appears 346 \nto specifically block this gliding motility that is essential for reinfection.     347 \n 348 \nDiscussion 349 \n 350 \nReverse genetic screens play an important role in molecular biology and have 351 \ntransformed the field for many pathogens. Here, we overcome the current technical 352 \nbarriers to develop a pooled in vivo CRISPR KO method that allows for reverse genetic 353 \nscreening in Cryptosporidium. As Cryptosporidium lacks the molecular machinery for 354 \nNHEJ, our method had to employ homologous recombination to create stable 355 \ntransgenics. We leveraged two important features of Cryptosporidium genetics: 1) the 356 \nparasite spends nearly all of its life cycle in a haploid form, thus requiring only one 357 \nrecombination event, and 2) there is a minimal length requirement for homologous 358 \nrecombination, in fact 30bp of DNA flanking the Cas9 cut site appears to be suKicient in 359 \nour experiments. Our two-step cloning approach for generating these targeted KO vectors 360 \nis designed to be versatile, allowing for a n unlimited range of selection markers and 361 \nreporters that can be inserted into the genome, which will allow researchers to develop 362 \nnew and innovative screens.   363 \n 364 \nWithin an infected host, Cryptosporidium undergoes multiple rounds of asexual 365 \nreproduction before diKerentiating into sexual forms (male and female) that unite to 366 \nallow for genetic recombination. During the sexual cycle, transgenic parasites in these 367 \nCRISPR screens can mate and this has the potential to influence results. This risk is 368 \npartially mitigated by two factors: 1) the parasite must complete at least three rounds of 369 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 13 \nasexual replication prior to sexual diKerentiation and potential recombination. This gives 370 \nample time for any genes that are detrimental to parasite fitness to exert their eKect; 2) 371 \nCryptosporidium has a relatively high rate of recombination, which should allow for 372 \ngenes, even those in close proximity, to segregate in a nearly random fashion (Kimball et 373 \nal., 2024). In both the pyrimidine salvage and vaccine candidate screens, we identified 374 \nhigh and low fitness conferring genes in close proximity to each other (Sup. 5a). Despite 375 \nthese mitigating factors, there is the potential for sublethal gene knockouts to exert 376 \nsynergistic or antagonistic eKects and this possibility must be considered during the 377 \ndesign process and while analysing and interpreting results. 378 \n 379 \nAnother important factor to consider is the amplifying eKect of relative fitness screens 380 \nwithin an in vivo model of infection. Genes that have a mild eKect on parasite survival and 381 \nfitness can be outcompeted within a larger pool. This appears to be the case for uracil 382 \nphosphoribosyltransferase (UPRT, cgd1_1900), which catalyses the conversion of uracil 383 \nand phosphoribosylpyrophosphate to uridine monophosphate. UPRT has recently been 384 \nshown to be non-essential to parasite survival, yet the authors noted that their UPRT KO 385 \nCryptosporidium parasites appeared to have a growth defect (Kimball et al., 2024). In our 386 \nin vivo screens, UPRT had a negative fold enrichment, indicating that UPRT contributes 387 \nhighly to parasite fitness and this likely reflects the observed growth defect. In contrast 388 \nto UPRT, dCMP deaminase (cgd2_2780) had little eKect on parasite fitness.  dCMP 389 \ndeaminase catalyses the conversion of deoxycytidine-monophosphate ( dCMP) to 390 \ndeoxyuridine-monophosphate (dUMP), which is then transformed into deoxythymidine -391 \nmonophosphate (dTMP) by DHFR -TS. Thymidine kinase  can also produce dTMP , likely 392 \nexplaining why the loss of dCMP deaminase had little eKect on parasite fitness.  393 \n 394 \nMost of the genes in the vaccine candidate CRISPR screen were identified as  fitness 395 \nconferring, with the exception of apical glycoprotein 1 (AGP1) and thrombospondin 396 \nrepeat protein 11 (TSP11). Akey et al. previous showed AGP1 was dispensable for parasite 397 \nsurvival and AGP2 was likely essential, both phenotypes that were recapitulated within 398 \nour screens (Akey et al., 2023) . Recently , it has been suggested that there may be 399 \nredundancy in the Cryptosporidium thrombospondin protein family (TSPs), as there are 400 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 14 \n12 members, many with similar domain structures  (John et al., 2023) . Although the 401 \nCryptosporidium TSPs currently have an unknown function, orthologous Apicomplexan 402 \nTSP genes play a role in adhesion and motility . We included two TSPs in the vaccine 403 \ncandidate screen: 1) TSP8 ( cgd6_780, also known as MIC1) and 2) TSP11 (cgd6_1660). 404 \nTSP8/MIC1 is a known micronemal protein (Putignani et al., 2008) and was identified as 405 \nhigh fitness conferring. In contrast, TSP11 was dispensable, demonstrating that there is 406 \nat least some redundancy within the Cryptosporidium TSP protein family . We also 407 \nconfirmed GP40 (cgd6_1080, also known as GP60) and GP900 (cgd7_4020), antigens 408 \nthat are associated with protection from reinfection in humans, influence parasite fitness 409 \nin vivo (Gilchrist et al., 2023).  410 \n 411 \nCp23 is one of the leading cryptosporidiosis vaccine candidates, and here we 412 \ndemonstrated that it is highly fitness conferring, both in vitro and in vivo. Cp23 was first 413 \nidentified in 1986 (Ungar & Nash, 1986) , and recent studies have revealed Cp23 414 \nrecognising IgA and IgG are correlated with protection against Cryptosporidium infection 415 \nin humans (Gilchrist et al., 2023). Until now, the function and precise localisation of Cp23 416 \nhas been unclear. Here we validate a commercial Cp23 monoclonal antibody using 417 \ndiCRE mediated excision of the target gene, then use a combination of ultrastructure 418 \nexpansion, super -resolution, and transmission electron microscopy, to describe the 419 \nlocalisation of Cp23 throughout the parasite life cycle at high resolution. Although our 420 \nlocalisation agrees with previously published studies that detects Cp23 at the pellicle  421 \n(Enriquez & Riggs, 1998), our data suggests that Cp23 may not be exposed at the surface 422 \nof the sporozoite. Cp23 has no detectable signal peptide, transmembrane domain or GPI-423 \nanchor, yet was recently  demonstrated to be  both myristoylated and palmitoylated  424 \n(Haserick et al., 2017) . Myristylation is a  non-reversible lipid modifications that is 425 \ncommonly found in proteins that are anchored to internal membranes in other 426 \nApicomplexan parasites (Schlott et al., 2018), (Broncel et al., 2020). There are, however, 427 \nsome exceptions to th is rule. TgMIC7 is a micronemal protein in Toxoplasma that is 428 \nmyristoylated prior to traKicking to the parasite surface (Broncel et al., 2020). Yet, TgMIC7 429 \ncontains a transmembrane domain that likely facilitates entry into the secretory pathway, 430 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 15 \nwhereas Cp23 does not . While we cannot rule out traKicking of Cp23 to the outer 431 \nmembrane of the parasite, our data supports an internal localisation.  432 \n 433 \nDespite this internal localisation, it is clear Cp23 IgA and IgG have both been correlated 434 \nwith protection in the clinic (Gilchrist et al., 2023). One interpretation of this correlation 435 \nis that antibodies recognising Cp23 arise from severe Cryptosporidium infection(s) where 436 \ncell-based adaptive immunity against the parasite has developed. Controlled 437 \nexperiments using a natural murine model of Cryptosporidium suggest that antibody -438 \nbased immunity is dispensable for resolution of infection (Sateriale et al., 2019). Further, 439 \nwe found that the genetically validated Cp23 antibody used in this study was unable to 440 \nblock parasite attachment or invasion in vitro (Sup. 6a - b). However, it has been reported 441 \nthat antibodies to Cp23 may have a protective eKect in vivo, thus we cannot definitively 442 \nrule out the possibility of Cp23 -directed protection, whether through antibody or cell -443 \nbased immunity (Enriquez & Riggs, 1998). Certainly, more investigation is warranted given 444 \nwe now know Cp23’s essential role in parasite motility and survival.  445 \n 446 \nWith the  targeted in vivo  CRISPR screening method developed here, we assessed the 447 \nfitness contributions of 22 Cryptosporidium genes. This number is near to the total 448 \nnumber of Cryptosporidium genes with a genetically verified impact on parasite virulence 449 \nor survival, prior to this study . As this screening technology develops and improves, we 450 \nanticipate greater throughput, allowing for the assessment of a variety of phenotypes on 451 \na larger scale. This rapid assessment of phenotypes will allow us to expand the 452 \nknowledge base for Cryptosporidium and explore basic biology that is essential for 453 \ndeveloping more eKective interventions. 454 \n 455 \nMethods  456 \n 457 \nPlasmid design and construction.  Genomic sites for CRISPR directed repair were 458 \npredicted using a customised version of EuPaGDT that retrieved 50bp of flanking DNA 459 \nsurrounding the predicted PAM site (Alvarez-Jarreta et al., 2023). Golden Gate Assembly 460 \nor Gibson Assembly was used to generate all vector s used in this work. Golden Gate 461 \nAssembly used, BsaI, BbsI -HF or BsmBI (New England BioLabs (NEB)) restriction 462 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 16 \nenzymes. Gibson Assembly used HiFi DNA Assembly (NEB). To generate KO vectors for 463 \nCRISPR screening, 2 consecutive Golden Gate reactions were performed. Firstly, 464 \nbetween a Cas9-U6 vector and a 300bp unique segment containing 50bp homology arms 465 \n(one of which contained the 50bp gRNA), tracrRNA and a DNA barcode, creating a Cas9-466 \nunique plasmid. Secondly, between this Cas9 -unique plasmid and a n interchangeable 467 \nselection cassette, in turn creating the KO vector. To generate diCRE mediated inducible 468 \nknockouts, a gene of interest (GOI) was recodonised and cloned into a LoxP-Nluc-NeoR-469 \ndiCRE vector via Gibson Assembly. To generate Cas9-U6-gRNA vectors, a 20bp gRNA was 470 \ncloned into the Cas9 -U6-BsaI vector via Golden Gate Assembly (Vinayak et al., 2015) , 471 \n(Pawlowic et al., 2017).  472 \n 473 \nCulturing host cells.  Human ileocecal adenocarcinoma cells (HCT8) were cultured in 474 \nRMPI-1640 medium (Gibco) supplemented with 10% heat -inactivated foetal bovine 475 \nserum (Merck), 120U/mL penicillin (Life Technologies) and 0.1% amphotericin B (Gibco) 476 \nat 37 °C under 5% CO 2. Cells were passaged at approximately 70% confluence using 477 \n0.25% trypsin-EDTA (Gibco). Cells were used for experiments between passage numbers 478 \n5 and 25. For super resolution and ultrastructure expansion microscopy, cells were 479 \nseeded in 24 -well plates containing coverslips. For high throughput microscopy 480 \nquantifications, cells were seeded in black 96 -well clear bottom tissue culture -treated 481 \nplates (Corning). For transient transfections using luminescence, cells were seeded in 482 \n24-well tissue culture-treated plates (Corning).  For live imaging, cells were seeded in µ-483 \nslide 8-well high chambers (Ibidi). 484 \n 485 \nOocysts and excystation. C. parvum IOWAII strain oocysts were purchased from Bunch 486 \nGrass Farm (Deary, ID). Oocysts were stored at 4°C and used within 3 months of the date 487 \nof isolation. The oocysts were excysted by incubating on ice with 1% sodium hypochlorite 488 \n(VWR) in H 20 for 5 minutes, followed by incubating with 0.75% sodium taurocholate 489 \n(Merck) in RPMI-1640 medium with 1% f oetal bovine serum at 37 °C (10 minutes for cell 490 \nmonolayer infections without transfection and 50 minutes prior to transfection). For in 491 \nvitro infections, primed oocysts were used to infect HCT8 monolayers. To proceed with 492 \ntransfections, more than 60% of oocysts had to have excysted, observed using light 493 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 17 \nmicroscopy at 50 minutes post sodium taurocholate treatment (Eclipse TS2R Nikon). For 494 \nSupplementary Figure 1, 0.75% sodium taurocholate was substituted with either 0.75% 495 \nsodium deoxycholate (Sigma) or 0.75% sodium taurodeoxycholate (Sigma), and 1% 496 \nRPMI-1640 was substituted with PBS. 497 \n 498 \nGeneration of transgenic parasites. Excysted sporozoites were suspended in Lonza SF 499 \nbuKer, combined with the appropriate DNA and electroporated using program ‘FL115’ on 500 \nan AMAXA Nucleofactor 4D electroporator (Lonza) (FL115 was used for all transfections 501 \nunless otherwise stated). For transient transfections in vitro , 5.0 x 10 6 oocysts were 502 \nexcysted and sporozoites were  transfected in the 20 μL 16 -well Nucleocuvette Strip 503 \nformat with 20µg of plasmid. For generating stable transgenic parasites in vivo, 2.5 x 107 504 \noocysts were excysted and sporozoites were  transfected in the 100 μL Nucleocuvette 505 \nVessel format with 20 µg of Cas9 -U6-gRNA plasmid and 40 µg of repair cassette 506 \ncontaining the 50bp homology arms. For CRISPR screens, 5.0 x 10 6 sporozoites were 507 \nexcysted and sporozoites were transfected with 30µg of KO vector for each gene (when 2 508 \nKO vectors were used, 15 µg of each KO vector was used). Transfections to knockout 509 \nindividual genes were performed separately (when 2 KO vectors per gene were used, 510 \ntransfections of KO vectors for the same gene were performed together). Parasites were 511 \npooled post transfection in 1% RMPI-1640 (Gibco) to infect mice and 4 or 5 mice were 512 \ninfected for each screen.  513 \n 514 \nMouse model of infection.  Interferon gamma deficient ( Ifng-/-) mice were bred and 515 \nhoused in pathogen -free conditions in the Biological Research Facility at The Francis 516 \nCrick Institute. Mice of both sexes were used for experiments. To increase infection 517 \neKiciency, mice were pretreated with an antibiotic cocktail: 1g/L ampicillin (Merck), 1g/L 518 \nstreptomycin (Merck) and 0.5g/L vancomycin (Cambridge Biosciences) in their drinking 519 \nwater for 3 to 10 days prior to infection with transfected sporozoites. Before infection, 520 \nmice received saturated sodium bicarbonate (Thermo Fisher Scientific) via oral gavage to 521 \nneutralise their stomach acid. A second oral gavage was then undertaken 5 minutes 522 \nthereafter with transfected sporozoites. Neither oral gavage exceeded the maximum 523 \nvolume of 0.1mL per 10g of body weight. For selection of transgenic parasites, 16mg/mL 524 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 18 \nparomomycin (BioServ) was administered in the mice’s drinking water. To induce excision 525 \nwhen diCRE-expressing transgenic parasites were used in vivo, 0.05 mg/mL rapamycin 526 \n(Stratech Scientific) was administered in the mice’s drinking water. No drug treatment 527 \nlasted more than 3 consecutive weeks. During murine infections, faecal material was 528 \ncollected daily and stored at 4°C. All experiments involving mice was done under the care 529 \nand supervision of the Francis Crick Institute veterinary and Biological Research Facility 530 \nstaK, under protocols approved under project license PP8575470.  531 \n 532 \nMeasuring parasite shedding by nanoluciferase.  Faecal material was collected and 533 \n20mg was lysed in faecal lysis buKer (50mM Tris -hydrochloric acid, 10% glycerol, 1% 534 \nTriton X-100, 2mM dithiothreitol, 2mM ethylenediaminetetraacetic acid (EDTA)). The 535 \nlysate was clarified and combined with an equal volume of a 1:50 Nano -Glo Luciferase 536 \nAssay Substrate: Nano-Glo Luciferase Assay BuKer (Promega). Luminescence was read 537 \nat 200 gain on the BioTek Cytation5 (Agilent Technologies).  538 \n 539 \nIsolation of oocysts from mouse faeces. Faecal collections from the peak of infection 540 \nwere pooled, combined with cold water and filtered through a 250mm mesh. The faecal 541 \nsuspension was then mixed 1:1 with saturated sucrose and pelleted by centrifugation at 542 \n1000g for 10 minutes. Oocysts, located in the supernatant, were washed with cold water 543 \nand pelleted by centrifugation at 100 0g for 5 minutes. A caesium gradient was used to 544 \nisolate 750µL of oocysts. Pure oocysts were washed with saline and stored for up to 6 545 \nmonths at 4°C in saline.  546 \n 547 \nCRISPR screening barcoding . To obtain barcodes from the output, barcodes could 548 \neither be extracted from the peak of infection or directly from daily faecal samples. To do 549 \nso from the peak of infection,  oocysts were purified from pooled faecal material (5 to 7 550 \ndays surrounding the peak of infection) , excysted and gDNA was extracted using the 551 \nDNeasy Blood & Tissue Kit (Qiagen). To do so from daily faecal samples, DNA was 552 \nextracted from 100mg of faeces using the QIAamp PowerFecal Pro DNA Kit (Qiagen). 553 \nBarcodes were obtained from the input material  (100µL of the pool of transfected 554 \nparasites used to infect the mice)  using the QIAquick PCR Purification Kit (Qiagen). 555 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 19 \nBarcodes from the input and output were amplified with high  fidelity KAPA polymerase 556 \n(Roche) (2 5 cycles, annealing 68°C and extension 15 seconds), and amplicon 557 \nsequencing flanks were added with high  fidelity KAPA polymerase (Roche) (10 cycles, 558 \n68°C annealing and 15 seconds extension). The success of the nested PCR was 559 \nconfirmed via gel electrophoresis and barcodes were submitted for amplicon 560 \nsequencing to The Genomics Science Technology Platform at The Francis Crick Institute. 561 \nIllumina MiSeq platform with a paired -end 250bp run configuration on a Nano flow cell 562 \nwas used.  563 \n 564 \nCRISPR screening analysis. The 7bp barcode between the barcode primer binding sites 565 \nwas bioinformatically extracted from both input and output samples. Barcodes for each 566 \ngene were counted and the percentage of the barcode in the pool calculated for both the 567 \ninput and output. Using the % barcode in the pool for the input and output, fold changes 568 \nof all genes were calculated: 569 \n𝑙𝑜𝑔!\t𝑓𝑜𝑙𝑑\t𝑐ℎ𝑎𝑛𝑔𝑒 = 𝑙𝑜𝑔! -%\t𝑏𝑎𝑟𝑐𝑜𝑑𝑒\t𝑖𝑛\t𝑜𝑢𝑡𝑝𝑢𝑡\n%\t𝑏𝑎𝑟𝑐𝑜𝑑𝑒\t𝑖𝑛\t𝑖𝑛𝑝𝑢𝑡 5 570 \n 571 \nImmunofluorescence microscopy.  At the required timepoint, HCT8 cell monolayers 572 \nwere washed with 1X PBS, fixed with 4% PFA/PBS (Alfa Aesar) for 15 minutes, 573 \npermeabilised with 0.25% Triton  X-100 (Merck) for 10 minutes and blocked with 4% 574 \nBSA/PBS (Merck) overnight at 4ºC. Primary antibodies were incubated in 1% BSA/PBS for 575 \n2 hours and then cell monolayers washed 5 times with 1X PBS. Secondary antibodies 576 \nwere incubated for 1 hour in 1% BSA/PBS along with the fluorescein labelled 1:4000 Vicia 577 \nvillosa lectin (VVL) (Vector Lab) or 1:1000 Helix pomatia agglutinin (HPA) (Invitrogen) that 578 \nstains parasites. Nuclei were stained by incubating with 1:10,000 Hoechst 33342 579 \n(Invitrogen) in 1X PBS for 5 minutes. For the EdU assays, 10mM EdU was incubated from 580 \n28 to 32 hours post infection and stained as the described in the Click -iT EdU Cell 581 \nProliferation Kit for Imaging (C10340, Invitrogen). Stained monolayers  were washed with 582 \n1X PBS, the coverslips mounted with ProLong Gold Antifade (Thermo Fisher Scientific) 583 \nand visualised using a VisiTech instant super resolution imaging system (VT -iSIM). 584 \nAlternatively, when super resolution was not required, the BioTek Cytation5 (Agilent 585 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 20 \nTechnologies) was used to visualise the stained monolayer.  See Table 6 for a full list of 586 \nantibodies used in this work.  587 \n 588 \nUltrastructure expansion microscopy. This protocol has been adapted from LiKner and 589 \nAbsalon, 2021. For the expansion of sporozoites, coverslips were coated with 0.1mg/mL 590 \npoly-D-lysine for 1 hour and then washed twice with 1X PBS. Excysted sporozoites in 1% 591 \nRPMI-1640 were added and allowed to  adhere for 10 minutes at 37°C. Adhered 592 \nsporozoites or cell monolayers to expand were fixed with 4% PFA/PBS for 15 minutes at 593 \n37°C. Protein crosslinking prevention was performed by adding 1.4% formaldehyde/ 2% 594 \nacrylamide in 1X PBS to each sample, then incubating overnight at 37°C. To perform 595 \ngelation, TEMED and APS were added to a monomer solution (19% w/w sodium acrylate 596 \n/ 10% v/v acrylamide / 0.1% v/v N,N’ -methylenebisacrylamide in 1X PBS) and pipetted 597 \nunder each coverslip in a pre -cooled humid chamber which was then incubated for 5 598 \nminutes on ice. To complete gelation, the humid chamber was incubated for 1 hour at 599 \n37°C. To separate gels from the coverslips, the coverslips were incubated with a 600 \ndenaturation buKer (200mM SDS, 200mM NaCl, 50mM Tris in water, pH 9) for 15 minutes. 601 \nTo complete the denaturation of the sample, the gel was incubated in a denaturation 602 \nbuKer for 90 minutes at 95°C. To expand the sample, the gel was incubated with dH20 for 603 \n30 minutes, three times in total at room temperature (RT). Following the first round of 604 \nexpansion, the sample was shrunk by incubating with 1X PBS, 2 times in total at RT. To 605 \nblock the sample, 2% BSA/PBS was incubated for 1 hour at RT. To stain the sample, 606 \nprimary antibodies were incubated in 2% BSA/PBS overnight at RT. Gels were then 607 \nwashed 3 times in total with 0.5% Tween 20/PBS for 10 minutes. Directly conjugated and 608 \nsecondary antibodies were incubated in 1X PBS for 3 hours at RT. The gel was then 609 \nwashed 3 times in total with 0.5% Tween20/PBS for 10 minutes. A second round of 610 \nexpansion took place by incubating the gel with dH 20 for 30 minutes, three times at RT. 611 \nThe gel was measured to calculate the expansion factor, mounted onto a 0.1mg/mL poly-612 \nD-lysine coated 60mm dish and visualised on the VT-iSIM microscope.  613 \n 614 \nImmunogold electron microscopy. 1x107 oocysts were excysted for 1 hour, pelleted and 615 \nre-suspended in fixative (8% formaldehyde in 0.4M HEPES buffer, pH 7.4) for 15 minutes 616 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 21 \nat RT. Samples were washed with 0.2M HEPES and a secondary fixation ( 2% 617 \nformaldehyde + 0.05% glutaraldehyde in 0.2M HEPES) step was carried out at 4 oC 618 \novernight. Samples were dehydrated and infiltrated with LR white resin at -20oC 619 \novernight. Prior to polymerisation, samples were brought back to RT for 1 hour and then 620 \npolymerised at 60 oC for 24 hours. The samples were sectioned using a Leica U C7 621 \nultramicrotome with a 45° Diatome diamond knife, achieving sections of 70nm 622 \nthickness. The sections were collected on nickel grids and immunogold labelled. To do 623 \nso, the samples were quenched with PBS/glycine for 2 minutes three times and then 624 \nblocked with 1% BSA/PBS for 5 minutes at RT. A 1:10 dilution of the primary Cp23 625 \nantibody was incubated in 1% BSA/PBS for 1 hour and then samples were washed twice 626 \nwith 0.1% BSA/PBS. A 1:50 dilution of the protein -A gold bound to 10nm gold particles 627 \n(PAG-10) was incubated with the sample in 0.1% BSA/PBS for 20 minutes and then 628 \nwashed twice with PBS. A post fixation step was carried out with 1% glutaraldehyde for 5 629 \nminutes and samples were washed with Milli-Q H20 for 1 minute 6 times in total. Samples 630 \nwere incubated in 1% uranyl acetate for 10 minutes and air dried. Transmission electron 631 \nmicroscopy was carried out on the 120 -kV JEOL JEM -1400Flash Electron Microscope 632 \n(JEOL Ltd., Welwyn Garden City, UK) with a JEOL Matataki Flash camera. 633 \n 634 \nLive microscopy. At 18 hours post -infection, phase contrast imaging was performed 635 \nusing an Eclipse Ts2R microscope (Nikon) with a 40X/0.55 NA Ph1 ADL objective (Nikon), 636 \ndigital sight 10 camera (Nikon) and a TPi-TCSX (Tokai Hit) heated stage set at 37oC. Images 637 \nwere acquired at 25fps for 1 hour to capture egressing merozoites. Images were imported 638 \ninto ImageJ2 Version 2 and the number of gliding merozoites was manually observed. 639 \nImage sequences were converted to movies to acquire short videos of egressing 640 \nmerozoites.  641 \n 642 \nPermeabilisation assay. Coverslips placed in 24-well plates were coated with 0.1mg/mL 643 \npoly-D-lysine for 1 hour and washed twice with 1X PBS. Excysted sporozoites in serum 644 \nfree RMPI-1640 were allowed to adhere for 10 minutes at 37oC. Adhered sporozoites were 645 \nfixed with 1% PFA/PBS for 20 minutes at RT. For the permeabilised condition, 0.1% Triton 646 \nX-100 was used to permeabilise for 10 minutes at RT. For the non -permeabilised 647 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 22 \ncondition, 1X PBS was instead incubated for 10 minutes at RT. Both conditions were 648 \nblocked with 4% BSA/PBS overnight at 4°C. Primary antibodies were incubated in 1% 649 \nBSA/PBS for 2 hours at RT. The coverslips were washed 5 times and secondary antibodies 650 \nwere incubated in 1% BSA/PBS for 1 hour at RT. All coverslips were mounted with ProLong 651 \nGold Antifade (Thermo Fisher Scientific) and visualised using a VT-iSIM.  652 \n 653 \nAttachment assay. Coverslips placed in 24 -well plates were coated with 0. 025mg/mL 654 \npoly-D-lysine for 1 hour and washed twice with 1X PBS.  60,000 oocysts per well were 655 \nexcysted and sporozoites were added and spun at 80g for 1 minute to adhere. Attachment 656 \nwas performed in Ringer’s solution (10mM Hepes pH 6.7, 10mM Glucose , 2mM CaCl 2, 657 \n1mM MgCl 2, 3mM KCl, 3mM NaH 2PO4 and 155mM NaCl)  for 15 minutes at 37 °C. 658 \nSporozoites were fixed using 8% PFA/PBS leak in resulting in 4% PFA/PBS/Ringer’s 659 \nfixation for 15 minutes at RT. Sporozoites were washed 3 times in total with 1X PBS and 660 \nblocked with 4% BSA/PBS overnight at 4 °C. Sporozoites were stained with 1:5000 Helix 661 \npomatia agglutinin (HPA) in 1% BSA/PBS for 1 hour at RT .  The BioTek Cytation5 (Agilent 662 \nTechnologies) was used to visualise the attached sporozoites. Images were exported as 663 \nTIFs into ImageJ2 Version 2 and the below macro was used to analyse the data:  664 \n 665 \nrun(\"Subtract Background... \" , \"rolling=50\"); 666 \nsetAutoThreshold(\"Default dark\"); 667 \n//run(\"Threshold... \"); 668 \nsetAutoThreshold(\"Triangle dark\"); 669 \nsetOption(\"BlackBackground\" , true); 670 \nrun(\"Convert to Mask\");  671 \nrun(\"Median... \" , \"radius=2\"); 672 \nrun(\"Analyze Particles... \" , \"size=50-10000 circularity=0.00-1 display summarize overlay\");  673 \n  674 \nNeutralisation assay. HCT8 cells were seeded to confluency in 96-well clear bottom 675 \ntissue culture -treated plates (Corning). An 8 -point 2 -fold dilution series of the Cp23 676 \nantibody (Stratech, LS -C137378) and the IgG isotype control (Stratech, GTX35009 + 677 \n0.02% Proclin 300 (Merck, 48912 -U) was prepared (0.02mg/mL to 0.0002mg/mL)  in 96-678 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 23 \nwell non -tissue culture -treated plates. 25,000 oocysts per well were excysted  and 679 \nincubated with the antibody dilution series for 5 minutes at 37 °C. Post antibody 680 \nincubation, the sporozoites were added to the  96-well plate containing HCT8 cells in 1% 681 \nRPMI-1640. At 24 hours post-infection, cell monolayers were washed with 1X PBS, fixed 682 \nwith 4% PFA/PBS (Alfa Aesar) for 15 minutes, permeabilised with 0.25% Triton  X-100 683 \n(Sigma) for 10 minutes and blocked with 4% BSA/PBS (Merck) overnight at 4oC. Parasites 684 \nwere stained with 1:4000 Vicia villosa lectin (VVL) and host nuclei were stained with 685 \n1:10,000 Hoechst 33342 (Invitrogen) in 1% BSA/PBS for 1 hour at RT. Cell monolayers 686 \nwere washed and visualised on the BioTek Cytation5 (Agilent Technologies). 2x2 tiled 687 \nimages per well were acquired with the 20X objective. The Gen5 analysis soft ware 688 \n(Agilent Technologies) was used to count the number of host cell nuclei and parasites for 689 \nparasite per nuclei calculations.  690 \n 691 \nAcknowledgements  692 \n 693 \nWe would like to thank Pippa Hawes of The Francis Crick Electron Microscopy Scientific 694 \nTechnology Platform for her helpful discussions and Elena Rodrigues of the 695 \nCryptosporidiosis Laboratory for preparing Cryptosporidium samples for electron 696 \nmicroscopy. Further, we would like to thank Nicholas Chisholm and other members of 697 \nthe Biological Research Facility, as well as the Genomics Scientific Technology Platform 698 \nat The Francis Crick Institute for their contributions to this work. We would also like to 699 \nthank Rodrigo Baptista of Houston Methodist for his insight and helpful conversations.  700 \nThis work was supported by the Francis Crick Institute —which receives its core funding 701 \nfrom Cancer Research UK, the UK Medical Research Council, and the We llcome Trust 702 \n(CC2063) – and a UKRI grant awarded to A.S. (101042783). 703 \n 704 \nAuthor Contributions 705 \n 706 \nL.C.W & A.S, with help from K.S, N.B, L.B & N.B.M , pioneered the CRISPR screening 707 \napproach. M.P developed the attachment assay. L.C.S & L.C carried out TEM. D.P 708 \ndeveloped the customised version of EuPaGDT used for predicting CRISPR guides. L.C.W 709 \nand A.S wrote the manuscript with contribution from all of the authors.  710 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 24 \n 711 \nReferences  712 \n 713 \nAbubakar, I., Aliyu, S. H., Arumugam, C., Usman, N. K., & Hunter, P . R. (2007, Apr). 714 \nTreatment of cryptosporidiosis in immunocompromised individuals: systematic 715 \nreview and meta -analysis. Br J Clin Pharmacol, 63 (4), 387 -393. 716 \nhttps://doi.org/10.1111/j.1365-2125.2007.02873.x  717 \n 718 \nAjiboye, J., Teixeira, J. E., Gasonoo, M., Mattice, E. B., Korwin -Mihavics, B., Miller, P ., 719 \nCameron, A. C., Stebbins, E., Campbell, S. D., Griggs, D. W., Spangenberg, T., 720 \nMeyers, M. J., & Huston, C. D. (2024, Sep 27). Identification of potent and orally 721 \neKicacious phosphodiesterase inhibitors in Cryptosporidium parvum -infected 722 \nimmunocompromised male mice. Nat Commun, 15 (1), 8272. 723 \nhttps://doi.org/10.1038/s41467-024-52658-y  724 \n 725 \nAkey, M. E., Xu, R., Ravindran, S., Funkhouser -Jones, L., & Sibley, L. D. (2023, Feb 28). 726 \nApical Secretory Glycoprotein Complex Contributes to Cell Attachment and Entry 727 \nby Cryptosporidium parvum. mBio, 14 (1), e0306422. 728 \nhttps://doi.org/10.1128/mbio.03064-22  729 \n 730 \nAlvarez-Jarreta, J., Amos, B., Aurrecoechea, C., Bah, S., Barba, M., Barreto, A., Basenko, 731 \nE. Y ., Belnap, R., Blevins, A., Böhme, U., Brestelli, J., Brown, S., Callan, D., 732 \nCampbell, L. I., Christophides, G. K., Crouch, K., Davison, H. R., DeBarry, J. D., 733 \nDemko, R., Doherty, R., Duan, Y ., Dundore, W., Dyer, S., Falke, D., Fischer, S., 734 \nGajria, B., Galdi, D., Giraldo -Calderón, G. I., Harb, O. S., Harper, E., Helb, D., 735 \nHowington, C., Hu, S., Humphrey, J., Iodice, J., Jones, A., Judkins, J., Kelly, S. A., 736 \nKissinger, J. C., Kittur, N., Kwon, D. K., Lamoureux, K., Li, W., Lodha, D., 737 \nMacCallum, R. M., Maslen, G., McDowell, M. A., Myers, J., Nural, M. V ., Roos, D. 738 \nS., Rund, S. S. C., Shanmugasundram, A., Sitnik, V ., Spruill, D., Starns, D., Tomko, 739 \nS. S., Wang, H., Warrenfeltz, S., Wieck, R., Wilkinson, P . A., & Zheng, J. (2023). 740 \nVEuPathDB: the eukaryotic pathogen, vector and host bioinformatics resource 741 \ncenter in 2023. Nucleic Acids Research, 52 (D1), D808 -D816. 742 \nhttps://doi.org/10.1093/nar/gkad1003  743 \n 744 \nAmadi, B., Mwiya, M., Sianongo, S., Payne, L., Watuka, A., Katubulushi, M., & Kelly, P . 745 \n(2009, Dec 2). High dose prolonged treatment with nitazoxanide is not eKective for 746 \ncryptosporidiosis in HIV positive Zambian children: a randomised controlled trial. 747 \nBMC Infect Dis, 9, 195. https://doi.org/10.1186/1471-2334-9-195  748 \n 749 \nArrowood, M. J., Sterling, C. R., & Healey, M. C. (1991, Apr). Immunofluorescent 750 \nmicroscopical visualization of trails left by gliding Cryptosporidium parvum 751 \nsporozoites. J Parasitol, 77(2), 315-317.  752 \n 753 \nAskari, N., Shayan, P ., Mokhber -Dezfouli, M. R., Ebrahimzadeh, E., Lotfollahzadeh, S., 754 \nRostami, A., Amininia, N., & Ragh, M. J. (2016). Evaluation of recombinant P23 755 \nprotein as a vaccine for passive immunization of newborn calves against 756 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 25 \nCryptosporidium parvum. Parasite Immunology, 38 (5), 282 -289. 757 \nhttps://doi.org/https://doi.org/10.1111/pim.12317  758 \n 759 \nBroncel, M., Dominicus, C., Vigetti, L., Nofal, S. D., Bartlett, E. J., Touquet, B., Hunt, A., 760 \nWallbank, B. A., Federico, S., Matthews, S., Young, J. C., Tate, E. W., Tardieux, I., & 761 \nTreeck, M. (2020, 2020/07/03). Profiling of myristoylation in Toxoplasma gondii 762 \nreveals an N -myristoylated protein important for host cell penetration. eLife, 9, 763 \ne57861. https://doi.org/10.7554/eLife.57861  764 \n 765 \nBushell, E., Gomes, A. R., Sanderson, T., Anar, B., Girling, G., Herd, C., Metcalf, T., 766 \nModrzynska, K., Schwach, F ., Martin, R. E., Mather, M. W., McFadden, G. I., Parts, 767 \nL., Rutledge, G. G., Vaidya, A. B., Wengelnik, K., Rayner, J. C., & Billker, O. (2017, 768 \nJul 13). Functional Profiling of a Plasmodium Genome Reveals an Abundance of 769 \nEssential Genes. Cell, 170 (2), 260 -272.e268. 770 \nhttps://doi.org/10.1016/j.cell.2017.06.030  771 \n 772 \nButterworth, S., Kordova, K., Chandrasekaran, S., Thomas, K. K., Torelli, F ., Lockyer, E. J., 773 \nEdwards, A., Goldstone, R., Koshy, A. A., & Treeck, M. (2023, Oct 11). High -774 \nthroughput identification of Toxoplasma gondii eKector proteins that target host 775 \ncell transcription. Cell Host Microbe, 31 (10), 1748 -1762.e1748. 776 \nhttps://doi.org/10.1016/j.chom.2023.09.003  777 \n 778 \nCaldwell, N., Peet, C., Miller, P ., Colon, B. L., Taylor, M. G., Cocco, M., Dawson, A., Lukac, 779 \nI., Teixeira, J. E., Robinson, L., Frame, L., Seizova, S., Damerow, S., Tamaki, F ., Post, 780 \nJ., Riley, J., Mutter, N., Hanna, J. C., Ferguson, L., Hu, X., Tinti, M., Forte, B., 781 \nNorcross, N. R., Campbell, P . S., Svensen, N., Caldwell, F . C., Jansen, C., Postis, 782 \nV ., Read, K. D., Huston, C. D., Gilbert, I. H., Baragaña, B., & Pawlowic, M. C. (2024). 783 \n<i>Cryptosporidium</i> lysyl -tRNA synthetase inhibitors define the interplay 784 \nbetween solubility and permeability required to achieve eKicacy. Science 785 \nTranslational Medicine, 16(770), eadm8631. 786 \nhttps://doi.org/doi:10.1126/scitranslmed.adm8631  787 \n 788 \nCohen, E. A., Gaudreau, P ., Brazeau, P ., & Langelier, Y . (1986, 1986/05/01). Specific 789 \ninhibition of herpesvirus ribonucleotide reductase by a nonapeptide derived from 790 \nthe carboxy terminus of subunit 2. Nature, 321 (6068), 441 -443. 791 \nhttps://doi.org/10.1038/321441a0  792 \n 793 \nDutia, B. M., Frame, M. C., Subak -Sharpe, J. H., Clark, W. N., & Marsden, H. S. (1986, 794 \n1986/05/01). Specific inhibition of herpesvirus ribonucleotide reductase by 795 \nsynthetic peptides. Nature, 321 (6068), 439 -441. 796 \nhttps://doi.org/10.1038/321439a0  797 \n 798 \nEnriquez, F . J., & Riggs, M. W. (1998, Sep). Role of immunoglobulin A monoclonal 799 \nantibodies against P23 in controlling murine Cryptosporidium parvum infection. 800 \nInfect Immun, 66(9), 4469-4473. https://doi.org/10.1128/iai.66.9.4469-4473.1998  801 \n 802 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 26 \nGilchrist, C. A., Campo, J. J., Pablo, J. V ., Ma, J. Z., Teng, A., Oberai, A., Shandling, A. D., 803 \nAlam, M., Kabir, M., Faruque, A. S. G., Haque, R., & Petri, W. A., Jr. (2023, Aug 15). 804 \nSpecific Cryptosporidium antigens associate with reinfection immunity and 805 \nprotection from cryptosporidiosis. J Clin Invest, 133 (16). 806 \nhttps://doi.org/10.1172/jci166814  807 \n 808 \nGuérin, A., Strelau, K. M., Barylyuk, K., Wallbank, B. A., Berry, L., Crook, O. M., Lilley, K. 809 \nS., Waller, R. F ., & Striepen, B. (2023, Apr 12). Cryptosporidium uses multiple 810 \ndistinct secretory organelles to interact with and modify its host cell. Cell Host 811 \nMicrobe, 31(4), 650-664.e656. https://doi.org/10.1016/j.chom.2023.03.001  812 \n 813 \nHaque, R., Mondal, D., Karim, A., Molla, I. H., Rahim, A., Faruque, A. S., Ahmad, N., 814 \nKirkpatrick, B. D., Houpt, E., Snider, C., & Petri, W. A., Jr. (2009, May 1). Prospective 815 \ncase-control study of the association between common enteric protozoal 816 \nparasites and diarrhea in Bangladesh. Clin Infect Dis, 48 (9), 1191 -1197. 817 \nhttps://doi.org/10.1086/597580  818 \n 819 \nHaserick, J. R., Klein, J. A., Costello, C. E., & Samuelson, J. (2017). Cryptosporidium 820 \nparvum vaccine candidates are incompletely modified with O -linked-N-821 \nacetylgalactosamine or contain N -terminal N -myristate and S -palmitate. PLOS 822 \nONE, 12(8), e0182395. https://doi.org/10.1371/journal.pone.0182395  823 \n 824 \nJeKeries, R., Yang, R., Woh, C. K., Weldt, T., Milech, N., Estcourt, A., Armstrong, T., 825 \nHopkins, R., Watt, P ., Reid, S., Armson, A., & Ryan, U. M. (2015, 2015/01/01/). 826 \nTarget validation of the inosine monophosphate dehydrogenase (IMPDH) gene in 827 \nCryptosporidium using Phylomer® peptides. Experimental Parasitology, 148, 40-828 \n48. https://doi.org/https://doi.org/10.1016/j.exppara.2014.11.003  829 \n 830 \nJenkins, M., Higgins, J., Kniel, K., Trout, J., & Fayer, R. (2004, Oct). Protection of calves 831 \nagainst cryptosporiosis by oral inoculation with gamma -irradiated 832 \nCryptosporidium parvum oocysts. J Parasitol, 90 (5), 1178 -1180. 833 \nhttps://doi.org/10.1645/ge-3333rn  834 \n 835 \nJohn, A., S, M. B., Madiedo Soler, N., Wiradiputri, K., Tichkule, S., Smyth, S. T., Ralph, S. 836 \nA., Jex, A. R., Scott, N. E., T onkin, C. J., & Goddard -Borger, E. D. (2023, Mar). 837 \nConservation, abundance, glycosylation profile, and localization of the TSP 838 \nprotein family in Cryptosporidium parvum. J Biol Chem, 299 (3), 103006. 839 \nhttps://doi.org/10.1016/j.jbc.2023.103006  840 \n 841 \nKeeley, A., & Soldati, D. (2004, 2004/10/01/). The glideosome: a molecular machine 842 \npowering motility and host -cell invasion by Apicomplexa. Trends in Cell Biology, 843 \n14(10), 528-532. https://doi.org/https://doi.org/10.1016/j.tcb.2004.08.002  844 \n 845 \nKimball, A., Funkhouser-Jones, L., Huang, W., Xu, R., Witola, W. H., & Sibley, L. D. (2024). 846 \nMendelian segregation and high recombination rates facilitate genetic analyses in 847 \nCryptosporidium parvum. PLOS Genetics, 20 (6), e1011162. 848 \nhttps://doi.org/10.1371/journal.pgen.1011162  849 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 27 \n 850 \nKotloK, K. L., Nasrin, D., Blackwelder, W. C., Wu, Y ., Farag, T., Panchalingham, S., Sow, S. 851 \nO., Sur, D., Zaidi, A. K. M., Faruque, A. S. G., Saha, D., Alonso, P . L., Tamboura, B., 852 \nSanogo, D., Onwuchekwa, U., Manna, B., Ramamurthy, T., Kanungo, S., Ahmed, 853 \nS., Qureshi, S., Quadri, F ., Hossain, A., Das, S. K., Antonio, M., Hossain, M. J., 854 \nMandomando, I., Acácio, S., Biswas, K., Tennant, S. M., Verweij, J. J., Sommerfelt, 855 \nH., Nataro, J. P ., Robins -Browne, R. M., & Levine, M. M. (2019). The incidence, 856 \naetiology, and adverse clinical consequences of less severe diarrhoeal episodes 857 \namong infants and children residing in low-income and middle-income countries: 858 \na 12-month case-control study as a follow -on to the Global Enteric Multicenter 859 \nStudy (GEMS). The Lancet Global Health, 7 (5), e568 -e584. 860 \nhttps://doi.org/10.1016/S2214-109X(19)30076-2  861 \n 862 \nKotloK, K. L., Nataro, J. P ., Blackwelder, W. C., Nasrin, D., Farag, T. H., Panchalingam, S., 863 \nWu, Y ., Sow, S. O., Sur, D., Breiman, R. F ., Faruque, A. S., Zaidi, A. K., Saha, D., 864 \nAlonso, P . L., Tamboura, B., Sanogo, D., Onwuchekwa, U., Manna, B., 865 \nRamamurthy, T., Kanungo, S., Ochieng, J. B., Omore, R., Oundo, J. O., Hossain, A., 866 \nDas, S. K., Ahmed, S., Qureshi, S., Quadri, F ., Adegbola, R. A., Antonio, M., 867 \nHossain, M. J., Akinsola, A., Mandomando, I., Nhampossa, T., Acácio, S., Biswas, 868 \nK., O'Reilly, C. E., Mintz, E. D., Berkeley, L. Y ., Muhsen, K., Sommerfelt, H., Robins-869 \nBrowne, R. M., & Levine, M. M. (2013, Jul 20). Burden and aetiology of diarrhoeal 870 \ndisease in infants and young children in developing countries (the Global Enteric 871 \nMulticenter Study, GEMS): a prospective, case-control study. Lancet, 382(9888), 872 \n209-222. https://doi.org/10.1016/s0140-6736(13)60844-2  873 \n 874 \nLi, M., Yang, F ., Hou, T., Gong, X., Li, N., Sibley, L. D., Feng, Y ., Xiao, L., & Guo, Y . (2024, 875 \n2024/09/19). Variant surface protein GP60 contributes to host infectivity of 876 \nCryptosporidium parvum. Communications Biology, 7 (1), 1175. 877 \nhttps://doi.org/10.1038/s42003-024-06885-0  878 \n 879 \nManjunatha, U. H., Lakshminarayana, S. B., Jumani, R. S., Chao, A. T., Young, J. M., Gable, 880 \nJ. E., Knapp, M., Hanna, I., Galarneau, J. R., Cantwell, J., Kulkarni, U., Turner, M., 881 \nLu, P ., Darrell, K. H., Watson, L. C., Chan, K., Patra, D., Mamo, M., Luu, C., Cuellar, 882 \nC., Shaul, J., Xiao, L., Chen, Y . B., Carney, S. K., Lakshman, J., Osborne, C. S., 883 \nZambriski, J. A., Aziz, N., Sarko, C., & Diagana, T. T. (2024, Nov). Cryptosporidium 884 \nPI(4)K inhibitor EDI048 is a gut -restricted parasiticidal agent to treat paediatric 885 \nenteric cryptosporidiosis. Nat Microbiol, 9 (11), 2817 -2835. 886 \nhttps://doi.org/10.1038/s41564-024-01810-x  887 \n 888 \nManque Patricio, A., Tenjo, F ., Woehlbier, U., Lara Ana, M., Serrano Myrna, G., Xu, P ., Alves 889 \nJoão, M., Smeltz Ronald, B., Conrad Daniel, H., & Buck Gregory, A. (2011, 890 \n2011/11/01). Identification and Immunological Characterization of Three 891 \nPotential Vaccinogens against Cryptosporidium Species. Clinical and Vaccine 892 \nImmunology, 18(11), 1796-1802. https://doi.org/10.1128/CVI.05197-11  893 \n 894 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 28 \nMead, J. R., Arrowood, M. J., & Sterling, C. R. (1988, Feb). Antigens of Cryptosporidium 895 \nsporozoites recognized by immune sera of infected animals and humans. J 896 \nParasitol, 74(1), 135-143.  897 \n 898 \nO'Ryan, M. (2017). Rotavirus Vaccines: a story of success with challenges ahead. 899 \nF1000Res, 6, 1517. https://doi.org/10.12688/f1000research.11912.1  900 \n 901 \nPawlowic, M. C., Somepalli, M., Sateriale, A., Herbert, G. T., Gibson, A. R., Cuny, G. D., 902 \nHedstrom, L., & Striepen, B. (2019). Genetic ablation of purine salvage in 903 \nCryptosporidium parvum reveals nucleotide uptake from the host cell. 904 \nProceedings of the National Academy of Sciences, 116 (42), 21160 -21165. 905 \nhttps://doi.org/doi:10.1073/pnas.1908239116  906 \n 907 \nPawlowic, M. C., Vinayak, S., Sateriale, A., Brooks, C. F ., & Striepen, B. (2017, Aug 11). 908 \nGenerating and Maintaining Transgenic Cryptosporidium parvum Parasites. Curr 909 \nProtoc Microbiol, 46, 20b.22.21-20b.22.32. https://doi.org/10.1002/cpmc.33  910 \n 911 \nPutignani, L., Possenti, A., Cherchi, S., Pozio, E., Crisanti, A., & Spano, F . (2008, Jan). The 912 \nthrombospondin-related protein CpMIC1 (CpTSP8) belongs to the repertoire of 913 \nmicronemal proteins of Cryptosporidium parvum. Mol Biochem Parasitol, 157(1), 914 \n98-101. https://doi.org/10.1016/j.molbiopara.2007.09.004  915 \n 916 \nSateriale, A., Šlapeta, J., Baptista, R., Engiles, J. B., Gullicksrud, J. A., Herbert, G. T., 917 \nBrooks, C. F ., Kugler, E. M., Kissinger, J. C., Hunter, C. A., & Striepen, B. (2019, Jul 918 \n10). A Genetically Tractable, Natural Mouse Model of Cryptosporidiosis OKers 919 \nInsights into Host Protective Immunity. Cell Host Microbe, 26 (1), 135-146.e135. 920 \nhttps://doi.org/10.1016/j.chom.2019.05.006  921 \n 922 \nSchlott, A. C., Holder, A. A., & Tate, E. W. (2018, 2018/04/13). N-Myristoylation as a Drug 923 \nTarget in Malaria: Exploring the Role of N -Myristoyltransferase Substrates in the 924 \nInhibitor Mode of Action. ACS Infectious Diseases, 4 (4), 449 -457. 925 \nhttps://doi.org/10.1021/acsinfecdis.7b00203  926 \n 927 \nShaw, S., Cohn, I. S., Baptista, R. P ., Xia, G., Melillo, B., Agyabeng-Dadzie, F ., Kissinger, J. 928 \nC., & Striepen, B. (2024). Genetic crosses within and between species of 929 \nCryptosporidium. Proceedings of the National Academy of Sciences, 121 (1), 930 \ne2313210120. https://doi.org/doi:10.1073/pnas.2313210120  931 \n 932 \nSidik, S. M., Huet, D., Ganesan, S. M., Huynh, M. H., Wang, T., Nasamu, A. S., Thiru, P ., 933 \nSaeij, J. P . J., Carruthers, V . B., Niles, J. C., & Lourido, S. (2016, Sep 8). A Genome-934 \nwide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. 935 \nCell, 166(6), 1423-1435.e1412. https://doi.org/10.1016/j.cell.2016.08.019  936 \n 937 \nSmith, T. A., Lopez -Perez, G. S., Herneisen, A. L., Shortt, E., & Lourido, S. (2022, 938 \n2022/06/01). Screening the Toxoplasma kinome with high -throughput tagging 939 \nidentifies a regulator of invasion and egress. Nature Microbiology, 7(6), 868-881. 940 \nhttps://doi.org/10.1038/s41564-022-01104-0  941 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 29 \n 942 \nSow, S. O., Muhsen, K., Nasrin, D., Blackwelder, W. C., Wu, Y ., Farag, T. H., Panchalingam, 943 \nS., Sur, D., Zaidi, A. K., Faruque, A. S., Saha, D., Adegbola, R., Alonso, P . L., 944 \nBreiman, R. F ., Bassat, Q., Tamboura, B., Sanogo, D., Onwuchekwa, U., Manna, B., 945 \nRamamurthy, T., Kanungo, S., Ahmed, S., Qureshi, S., Quadri, F ., Hossain, A., Das, 946 \nS. K., Antonio, M., Hossain, M. J., Mandomando, I., Nhampossa, T., Acácio, S., 947 \nOmore, R., Oundo, J. O., Ochieng, J. B., Mintz, E. D., O'Reilly, C. E., Berkeley, L. Y ., 948 \nLivio, S., Tennant, S. M., Sommerfelt, H., Nataro, J. P ., Ziv -Baran, T., Robins -949 \nBrowne, R. M., Mishcherkin, V ., Zhang, J., Liu, J., Houpt, E. R., KotloK, K. L., & 950 \nLevine, M. M. (2016, May). The Burden of Cryptosporidium Diarrheal Disease 951 \namong Children < 24 Months of Age in Moderate/High Mortality Regions of Sub -952 \nSaharan Africa and South Asia, Utilizing Data from the Global Enteric Multicenter 953 \nStudy (GEMS). PLoS Negl Trop Dis, 10 (5), e0004729. 954 \nhttps://doi.org/10.1371/journal.pntd.0004729  955 \n 956 \nStriepen, B., Pruijssers, A. J., Huang, J., Li, C., Gubbels, M. J., Umejiego, N. N., Hedstrom, 957 \nL., & Kissinger, J. C. (2004, Mar 2). Gene transfer in the evolution of parasite 958 \nnucleotide biosynthesis. Proc Natl Acad Sci U S A, 101 (9), 3154 -3159. 959 \nhttps://doi.org/10.1073/pnas.0304686101  960 \n 961 \nTandel, J., Walzer, K. A., Byerly, J. H., Pinkston, B., Beiting, D. P ., & Striepen, B. (2023, Apr 962 \n25). Genetic Ablation of a Female -Specific Apetala 2 Transcription Factor Blocks 963 \nOocyst Shedding in Cryptosporidium parvum. mBio, 14 (2), e0326122. 964 \nhttps://doi.org/10.1128/mbio.03261-22  965 \n 966 \nTroeger, C., Blacker, B. F ., Khalil, I. A., Rao, P . C., Cao, S., Zimsen, S. R. M., Albertson, S. 967 \nB., Stanaway, J. D., Deshpande, A., Abebe, Z., Alvis -Guzman, N., Amare, A. T., 968 \nAsgedom, S. W., Anteneh, Z. A., Antonio, C. A. T., Aremu, O., Asfaw, E. T., Atey, T. 969 \nM., Atique, S., Avokpaho, E. F . G. A., Awasthi, A., Ayele, H. T., Barac, A., Barreto, M. 970 \nL., Bassat, Q., Belay, S. A., Bensenor, I. M., Bhutta, Z. A., Bijani, A., Bizuneh, H., 971 \nCastañeda-Orjuela, C. A., Dadi, A. F ., Dandona, L., Dandona, R., Do, H. P ., Dubey, 972 \nM., Dubljanin, E., Edessa, D., Endries, A. Y ., Eshrati, B., Farag, T., Feyissa, G. T., 973 \nForeman, K. J., Forouzanfar, M. H., Fullman, N., Gething, P . W., Gishu, M. D., 974 \nGodwin, W. W., Gugnani, H. C., Gupta, R., Hailu, G. B., Hassen, H. Y ., Hibstu, D. T., 975 \nIlesanmi, O. S., Jonas, J. B., Kahsay, A., Kang, G., Kasaeian, A., Khader, Y . S., Khalil, 976 \nI. A., Khan, E. A., Khan, M. A., Khang, Y .-H., Kissoon, N., Kochhar, S., KotloK, K. L., 977 \nKoyanagi, A., Kumar, G. A., Magdy Abd El Razek, H., Malekzadeh, R., Malta, D. C., 978 \nMehata, S., Mendoza, W., Mengistu, D. T., Menota, B. G., Mezgebe, H. B., Mlashu, 979 \nF . W., Murthy, S., Naik, G. A., Nguyen, C. T., Nguyen, T. H., Ningrum, D. N. A., Ogbo, 980 \nF.  A . ,  O l a g u n j u ,  A .  T. ,  Pa u d e l ,  D. ,  Pl a t t s-Mills, J. A., Qorbani, M., Rafay, A., Rai, R. 981 \nK., Rana, S. M., Ranabhat, C. L., Rasella, D., Ray, S. E., Reis, C., Renzaho, A. M. N., 982 \nRezai, M. S., Ruhago, G. M., Safiri, S., Salomon, J. A., Sanabria, J. R., Sartorius, B., 983 \nSawhney, M., Sepanlou, S. G., Shigematsu, M., Sisay, M., Somayaji, R., 984 \nSreeramareddy, C. T., Sykes, B. L., TaKere, G. R., Topor-Madry, R., Tran, B. X., Tuem, 985 \nK. B., Ukwaja, K. N., Vollset, S. E., Walson, J. L., Weaver, M. R., Weldegwergs, K. G., 986 \nWerdecker, A., Workicho, A., Yenesew, M., Yirsaw, B. D., Yonemoto, N., El Sayed 987 \nZaki, M., Vos, T., Lim, S. S., Naghavi, M., Murray, C. J. L., Mokdad, A. H., Hay, S. I., 988 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 30 \n& Reiner, R. C., Jr. (2018). Estimates of the global, regional, and national morbidity, 989 \nmortality, and aetiologies of diarrhoea in 195 countries: a systematic analysis for 990 \nthe Global Burden of Disease Study 2016. The Lancet Infectious Diseases, 18(11), 991 \n1211-1228. https://doi.org/10.1016/S1473-3099(18)30362-1  992 \n 993 \nTroeger, C., Forouzanfar, M., Rao, P . C., Khalil, I., Brown, A., Reiner, R. C., Fullman, N., 994 \nThompson, R. L., Abajobir, A., Ahmed, M., Alemayohu, M. A., Alvis -Guzman, N., 995 \nAmare, A. T., Antonio, C. A., Asayesh, H., Avokpaho, E., Awasthi, A., Bacha, U., 996 \nBarac, A., Betsue, B. D., Beyene, A. S., Boneya, D. J., Malta, D. C., Dandona, L., 997 \nDandona, R., Dubey, M., Eshrati, B., Fitchett, J. R. A., Gebrehiwot, T. T., Hailu, G. 998 \nB., Horino, M., Hotez, P . J., Jibat, T., Jonas, J. B., Kasaeian, A., Kissoon, N., KotloK, 999 \nK., Koyanagi, A., Kumar, G. A., Rai, R. K., Lal, A., El Razek, H. M. A., Mengistie, M. 1000 \nA., Moe, C., Patton, G., Platts -Mills, J. A., Qorbani, M., Ram, U., Roba, H. S., 1001 \nSanabria, J., Sartorius, B., Sawhney, M., Shigematsu, M., Sreeramareddy, C., 1002 \nSwaminathan, S., Tedla, B. A., Jagiellonian, R. T. -M., Ukwaja, K., Werdecker, A., 1003 \nWiddowson, M.-A., Yonemoto, N., El Sayed Zaki, M., Lim, S. S., Naghavi, M., Vos, 1004 \nT., Hay, S. I., Murray, C. J. L., & Mokdad, A. H. (2017, 2017/09/01/). Estimates of 1005 \nglobal, regional, and national morbidity, mortality, and aetiologies of diarrhoeal 1006 \ndiseases: a systematic analysis for the Global Burden of Disease Study 2015. The 1007 \nLancet Infectious Diseases, 17 (9), 909 -948. 1008 \nhttps://doi.org/https://doi.org/10.1016/S1473-3099(17)30276-1  1009 \n 1010 \nUngar, B. L., & Nash, T. E. (1986, Jul). Quantification of specific antibody response to 1011 \nCryptosporidium antigens by laser densitometry. Infect Immun, 53 (1), 124 -128. 1012 \nhttps://doi.org/10.1128/iai.53.1.124-128.1986  1013 \n 1014 \nVinayak, S., Pawlowic, M. C., Sateriale, A., Brooks, C. F ., Studstill, C. J., Bar -Peled, Y., 1015 \nCipriano, M. J., & Striepen, B. (2015, Jul 23). Genetic modification of the diarrhoeal 1016 \npathogen Cryptosporidium parvum. Nature, 523 (7561), 477 -480. 1017 \nhttps://doi.org/10.1038/nature14651  1018 \n 1019 \nYen, C., Tate, J. E., Hyde, T. B., Cortese, M. M., Lopman, B. A., Jiang, B., Glass, R. I., & 1020 \nParashar, U. D. (2014). Rotavirus vaccines: current status and future 1021 \nconsiderations. Hum Vaccin Immunother, 10 (6), 1436 -1448. 1022 \nhttps://doi.org/10.4161/hv.28857  1023 \n 1024 \nYoung, J., Dominicus, C., Wagener, J., Butterworth, S., Ye, X., Kelly, G., Ordan, M., 1025 \nSaunders, B., Instrell, R., Howell, M., Stewart, A., & Treeck, M. (2019, 2019/09/03). 1026 \nA CRISPR platform for targeted in vivo screens identifies Toxoplasma gondii 1027 \nvirulence factors in mice. Nature Communications, 10 (1), 3963. 1028 \nhttps://doi.org/10.1038/s41467-019-11855-w  1029 \n  1030 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 31 \n 1031 \n 1032 \nFigure 1. In vivo  CRISPR Screen  of the Cryptosporidium Pyrimidine Salvage Pathway . a. Schematic illustrates how a 1033 \nknockout vector is generated. The first Golden Gate reaction occurs between a Cas9  expression plasmid and a 300bp unique 1034 \nsegment (containing the two 50bp homology arms (one of which serves dual function as the  gRNA), a unique DNA barcode, 1035 \nBsmBI restriction enzyme sites and the tracrRNA). The second Golden Gate reaction, using the BsmBI restriction enzyme sites, 1036 \ninserts a variable selection/reporter cassette to generate a complete knockout vector. The knockout vector then contains all the 1037 \nmachinery to disrupt a gene of interest by inserting a variable selection cassette and barcode at the genomic locus. b. A knockout 1038 \nvector targeting thymidine kinase  (cgd5_4440) was generated and transfected into  C. parvum  sporozoites that were used to 1039 \ninfect Ifng-/- mice under paromomycin selection . Faecal samples were collected and the luminescence in faecal material was 1040 \nmonitored. Data shows the mean of a biological replicate ± SEM of the 2 technical replicates , n = 4 mice. c. Alignment of reads 1041 \nfrom whole genome sequencing of the thymidine kinase knockout strain to the C. parvum IOWAII genome at the site of insertion. 1042 \nNote the complete lack of alignment to the PAM site, which is removed by the homologous repair event.  d. Overview of CRISPR 1043 \nscreening method. Following construction of KO vectors (detailed in 1a),  sporozoites are transfected with gene specific KO 1044 \nvectors and used to infect mice. Specific barcodes are then amplified via high fidelity PCR and used to calculate fold enrichment 1045 \n(log2[%barcode(output) / %barcodes(input)]) which measures the relative fitness contribution of each gene. e. Mouse faecal 1046 \nmaterial was collected, and luminescence was monitored in the pooled sample from the pyrimidine salvage pathway CRISPR 1047 \nscreens at 1 and 2 KO vectors per gene. Data shown is the mean of the biological replicate ± SEM of the 2 technical replicates, 1048 \nn = 4 mice per screen. f. Rank ordered fold enrichment scores from the 1 and 2 KO vectors per gene pyrimidine salvage CRISPR 1049 \nscreens. The colour indicates the relative fitness contribution, with dark purple showing high fitness conferring and dark green 1050 \nshowing low fitness conferring. g. Comparison of the fold enrichment scores between the 1 and 2 KO vectors per gene pyrimidine 1051 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 32 \nsalvage CRISPR screens. Confidence refers to the inverse of the 95% confidence interval when comparing the log2 fold change 1052 \nscores from each screen (see methods).      1053 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 33 \n 1054 \nFigure 2. Validating Screen Results  with diCRE Mediated Excision. a-b. TK-diCRE (shown in green) and ribonucleotide 1055 \nreductase (RNR) -diCRE (shown in purple) parasites were generated and used to infect an HCT8 monolayer in the presence or 1056 \nabsence of rapamycin. Genomic DNA was extracted at 6, 24 and 48 hours and diagnostic PCRs confirmed the level of excision 1057 \nat the given time points.  c. HCT8 monolayers infected with T K-diCRE and RNR-diCRE parasites in the presence or absence of 1058 \nrapamycin. At 6, 24 and 48 hours the monolayers were fixed, stained and the number of parasites per host nuclei was quantified. 1059 \nRepresentative images are shown, with nuclei in blue (Hoechst), and parasites in green (Vicia villosa lectin ). Data shown is 1060 \nrepresentative of 2 biological replicates ± sd of 4 technical replicates. Significance is determined using a two -tailed unpaired t -1061 \ntest, ns = not significant, ** = p ≤ 0.01. d. TK-diCRE or RNR-diCRE parasites were used to infect Ifng-/- mice, which were either 1062 \ntreated with rapamycin or vehicle ( DMSO) in their drinking water starting at day 2 post infection. Data shown i s a biological 1063 \nreplicate ± SEM of the 2 technical replicates, n = 2 mice per condition.  1064 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 34 \n 1065 \n 1066 \nFigure 3. In vivo  CRISPR Screen  of Cryptosporidium Vaccine Candidates. a. Mouse faecal material was collected and 1067 \nluminescence was monitored during infection.  Each replicate was conducted with 2 KO vectors  per gene. Data shown is the 1068 \nmean of the biological replicate ± SEM of the 2 technical replicates , n = 5 Ifng-/- mice for repeat 1 and n = 3 Ifng-/- mice for repeat 1069 \n2. b. Rank ordered fold enrichment scores from the vaccine candidate CRISPR screens. The colour indicates the relative fitness 1070 \ncontribution of a gene, with dark purple being high fitness conferring and dark green being low fitness conferring.  c. Comparison 1071 \nof the fold enrichment scores between the replicate CRISPR screens for each gene. Confidence refers to the inverse of the 95% 1072 \nconfidence interval when comparing the log2 fold change scores from each screen (see methods). d. Mouse faecal material was 1073 \ncollected and luminescence was monitored during infection. Data shows a biological replicate ± SEM of the 2 technical replicates, 1074 \nn = 5 Ifng-/- mice. e-f. Barcodes from KO parasites could be easily monitored over time (e) and within individual mice (f).   1075 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 35 \nFigure 4. Immunodominant Antigen 23 is Essential and Required for Reinvasion of Host Cells. a-b. HCT8 cell monolayers 1076 \ninfected with Cp23-diCRE in the presence or absence of rapamycin . At 6, 24 and 48 hours, gDNA was extracted and diagnostic 1077 \nPCRs confirmed the level of excision at the given timepoint. c. HCT8 cell monolayers infected with Cp23-diCRE in the presence 1078 \nor absence of rapamycin . At 6, 24 and 48 hours, the monolayer was fixed and stained and the parasite per host nuclei was 1079 \nquantified. Representative images are shown, with nuclei in blue (Hoechst), and parasites in green (Vicia villosa lectin ). Data 1080 \nshown is representative of two biological replicates ± sd of the 4 technical replicates. Significance is determined using a two -1081 \ntailed unpaired t-test, ns = not significant, * = p ≤ 0.05, ** = p ≤ 0.01. d. Ifng-/- mice were infected with 50,000 Cp23-diCRE parasites 1082 \nand treated with rapamycin or DMSO control in their drinking water at 2 days post infection. Data shown is the mean of a biological 1083 \nreplicate ± SEM of the 2 technical replicates, n = 2 mice per condition.  e. Super resolution microscopy at 24 hours post infection 1084 \nin vitro with Cp23-diCRE parasites in the presence or absence of rapamycin; green ( helix pomatia agglutinin (HPA)), parasite; 1085 \nmagenta, (sytox), nuclei; red (Cp23 Ab), Cp23. Scale = 2 µm. f. Expansion microscopy of the C. parvum  asexual stages: 1086 \nsporozoite, merozoite, trophozoite  and meront, and the sexual stages: macrogamont (female) and microgamete (male); green 1087 \n(helix pomatia agglutinin (HPA)); blue (N -hydroxysuccinimide (NHS ester); magenta (sytox); red ( aCp23). Scale bar = 5 µm. 1088 \nMedian expansion factor of 4 .5. g. Transmission electron microscopy  of an excysted and unexcysted  C. parvum  sporozoite 1089 \ncoupled with immunogold labelling with Cp23 antibody. Scale = 300nm. h. Permeabilisation assay of C. parvum sporozoites. The 1090 \npermeabilised condition used  0.1% Triton X -100 and the non -permeabilised condition used PBS . Grey (tryptophan synthase 1091 \n(aTrpB); green (Vicia villosa lectin); red (aCp23); blue (Hoechst). All images were taken using the same settings and exposure. 1092 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 36 \nScale bar = 5µm. i. HCT8 cell monolayers were infected with either Cp23-diCRE or wildtype parasites in the presence or absence 1093 \nof rapamycin, and at 22 hours post infection life stage s were quantified. Data shown is 2 biological replicates, n = 438 Cp23 -1094 \ndiCRE - RAP, n = 173 Cp23-diCRE + RAP, n = 213 wildtype - RAP, n = 203 wildtype + RAP. Significance is determined using a 1095 \ntwo-tailed unpaired t -test, ns = not significant , **** = p ≤ 0.0001. j-k. Live imaging of the reinvasion event was carried out at 18 1096 \nhours post infection of an HCT8 monolayer with Cp23-diCRE parasites in the presence or absence of rapamycin. Movement of 1097 \nmerozoites was tracked using  Fiji software. Representative images are shown in k. with videos in supplementary data.  All live 1098 \nmicroscopy data shown is from 2 biological replicate s. Significance is determined using a two -tailed unpaired t -test, **** = p ≤ 1099 \n0.0001.   1100 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 37 \n 1101 \nSupplementary 1. Advancement to CRISPR Screening . a-b. Relative luminescence units (RLU) from a  HCT8 cell monolayer 1102 \ninfected for 24 hours with C. parvum parasites that were transiently transfected with a nanoluciferase-mCherry expression vector, 1103 \ntrialling multiple electroporation programs ( a) and excystation reagents used prior to transfection ( b). TDC (taurodeoxycholate), 1104 \nNaCIO (sodium hypochlorite), TC (taurocholate), RMPI (media) , DC (deoxycholate)  PBS (phosphate -buffered saline) . c. 1105 \nQuantification of the improved transfection efficiency measured by RLU. In black, the standard method, in yellow, the revised 1106 \nmethod. d. Visualisation of the increased transfection efficiency of the revised method (right panel) compared to the standard 1107 \nmethod (left panel) using the mCherry-expression vector. Blue (Hoechst), nuclei; green (Vicia villosa lectin (VVL)), parasites; red 1108 \n(mCherry Ab), mCherry/transfected parasites.  All data shows the mean ± standard deviation from 2 biological replicates.  e. RLU 1109 \nfrom a HCT8 cell monolayer infected for 24 hours with C. parvum parasites transfected with a repair cassette designed to replace 1110 \nthe thymidine kinase gene, using different lengths of homology repair. Data shows the mean ± sd from three technical replicates.   1111 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 38 \n 1112 \nSupplementary 2. Refining diCRE Mediated Excision.  a. Schematics of disruption of a nanoluciferase (Nluc) gene mid-codon 1113 \nwith a HAP2 (cgd8_2220) intron (Nluc int) or with a HAP2 intron containing a loxP sequence (Nluc loxPint). Vectors were 1114 \ntransiently transfected into C. parvum sporozoites that were allowed to infect an HCT8 monolayer for 24 hours. Data shown is 1115 \nthe mean of 2 biological replicates ± sd of 4 technical replicates . Significance is determined using a  one-way ANOVA, ns = not 1116 \nsignificant b. Schematic of the TK -T2A-diCRE parasite line and the corresponding  luminescence from mouse faecal material 1117 \nwhen generating these parasites. Data shown is a biological replicate ± SEM, n = 4 Ifng-/- mice. c. Diagnostic PCR to determine 1118 \nthe level of excision occurring in the  TK-T2A-diCRE parasite line after 24  hours infection of a HCT8 cell monolayer during 1119 \ntreatment with rapamycin . d. Schematic of the TK -diCRE parasite line and the corresponding luminescence from mouse faecal 1120 \nmaterial when generating the parasites. Data shown is a biological replicate ± SEM, n = 4 Ifng-/- mice. e. Diagnostic PCR to 1121 \ndetermine the level of excision occurring in the  TK-diCRE parasite line after 24 hours infection of a HCT8 cell monolayer during 1122 \ntreatment with rapamycin.  1123 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 39 \n 1124 \nSupplementary 3. diCRE Mediated Excision of  TK and RNR . a. Schematic and genotyping PCR of TK-diCRE parasites. b. 1125 \nTK-diCRE parasites were allowed to infect a HCT8 monolayer and g enomic DNA was extracted at 2, 4, 8, 24, 32 and 48 hours 1126 \npost infection in the presence and absence of rapamycin. Diagnostic PCRs confirmed the level of excision that had occurred at 1127 \nthe respective timepoint. c-d. TK-diCRE parasites were  allowed to infect a HCT8 monolayer in the presence and absence of 1128 \nrapamycin, and the monolayer was fixed and stained at 4, 8, 12, 16, 24, 32 and 48 hours post infection.  The HA tag per parasite 1129 \nwas quantified by automated imaging , representation images are shown in d; blue (Hoechst); green (Vicia villosa lectin (VVL)); 1130 \nred ( aHA). Data shown is representative of 2 biological replicates, each with 2 technical replicates ± sd. e. Schematic and 1131 \ngenotyping PCR of RNR-diCRE parasites. f. EdU assay with quantifications showing newly synthesised DNA  between 28 and 1132 \n32 hours in wildtype, TK- and RNR-diCRE parasites in  the presence and absence of rapamycin . Blue (Hoechst); green, ( Vicia 1133 \nvillosa lectin (VVL)); magenta, (EdU). Data shown is two biological replicates with the number of parasites quantified indicated. 1134 \nScale bar = 10µm. 1135 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 40 \n 1136 \nSupplementary 4. Immunodominant Antigen 23 is Essential and Required for Reinvasion of Host Cells. a. Schematic and 1137 \ngenotyping PCR of Cp23-diCRE parasites. b. Visualising gliding C. parvum sporozoites using super-resolution microscopy. Green 1138 \n(Vicia villosa lectin (VVL) which marks both parasite and trail ); red (aCp23); blue (Hoechst). Scale bar = 5 µm. c-e. Cp23-diCRE 1139 \nand wildtype parasites were  allowed to infect an HCT8 monolayer in the presence or absence of rapamycin . At 22 hours post 1140 \ninfection the life cycle stage was quantified. Data shows 2 biological replicates . Significance is determined using a two -tailed 1141 \nunpaired t-test, ns = not significant, **** = p ≤ 0.0001. Representative images are shown in e. Blue (Hoechst); green (Vicia villosa 1142 \nlectin (VVL)); magenta (phallodin - actin); red (aCp23). Scale bar = 10 µm.   1143 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 41 \n 1144 \nSupplementary 5. Chromosome Locations of the Genes Knocked Out During CRISPR Screens. a-b. Locations of the genes 1145 \nfrom the pyrimidine salvage (a) and vaccine candidate (b) CRISPR screens. The colour indicates the relative fitness of the gene 1146 \nknocked out with dark purple being a highly fitness conferring gene and dark green being a low fitness conferring gene.   1147 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 42 \n 1148 \nSupplementary 6. Immunodominant Antigen 23 Antibody Does Not Neutralise Infection In Vitro. a. Quantifying the number 1149 \nof attached sporozoites on a poly-D treated surface when incubated with the Cp23 antibody or isotype control antibody dilution 1150 \nseries. Data shows the mean ± sd of 4 technical replicates. The black line shows Cp23 antibody incubations, the grey line shows 1151 \nisotype control antibody incubations, and the dotted line shows no antibody control incubations. b. Quantification of invasion 1152 \n(parasite per host nuclei) when cell monolayers are infected in the presence of the  Cp23 antibody or isotype control . The data 1153 \nshows the mean and ± sd of the 4 technical replicates. The back line shows Cp23 antibody incubations, the grey line shows 1154 \nisotype control antibody incubations, and the dotted line shows no antibody control incubations.   1155 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 43 \nSupplementary videos. Live imaging of the reinvasion event was carried out at 18 hours post infection of an HCT8 monolayer 1156 \nwith Cp23-diCRE parasites in the presence of rapamycin  or vehicle (DMSO) control. 1157 \nVideo S1.  DMSO treatment 1 1158 \nVideo S2.  DMSO treatment 2 1159 \nVideo S3. Rapamycin treatment 1  1160 \nVideo S4. Rapamycin treatment 2  1161 \n 1162 \n 1163 \nTable 1. Genes in the Pyrimidine Salvage CRISPR Screen 1164 \nGene ID Name Gene Fitness Contribution  \ncgd1_1900 Fur1p like uracil phosphoribosyltransferase (UPRT) Dispensable but fitness conferring \n(Kimball et al., 2024) \ncgd1_3140 Adenylate kinase/UMP-CMP kinase  \ncgd2_1630 Cytidine and deoxycytidylate deaminase family  \ncgd2_2780 dCMP deaminase  \ncgd4_4460 Bifunctional dihydrofolate reductase/thymidylate synthase (DHFR)  Dispensable \n(Pawlowic et al., 2019) \ncgd5_1710 CTP synthase  \ncgd5_3630 Thymidylate kinase  \ncgd5_4440 Thymidine kinase (TK) Dispensable \n(Vinayak et al., 2015)  \ncgd6_1950 Ribonucleotide reductase (RNR)   \ncgd7_1470 Cytidine and deoxycytidylate deaminase zinc -binding domain \ncontaining protein \n \ncgd8_2810 Phosphoribulokinase/uridine kinase/Uracil \nphosphoribosyltransferase \n \n 1165 \n 1166 \nTable 2. Genes in the Vaccine Candidate CRISPR Screen 1167 \nGene ID Name Gene Fitness Contributions  \ncgd3_3370 Uncharacterized protein  \ncgd4_32 Apical glycoprotein 1 (AGP1) Dispensable \n(Akey et al., 2023) \ncgd4_3620 Immunodominant antigen 23393226 (Cp23)   \ncgd6_1080 Glycoprotein GP40 (GP60) Dispensable, but fitness conferring \n(Li et al., 2024) \ncgd6_1660 Uncharacterized protein with Thrombospondin type -1 (TSP1) repeat (TSP11)  \ncgd6_2330 Uncharacterized protein  \ncgd6_780 Thrombospondin type -1 (TSP1) repeat/EGF -like domain containing protein \n(TSP8/MIC1) \n \ncgd7_1960 WD40/YVTN repeat-like+signal peptide-containing protein  \ncgd7_4020 Cryptopsporidial mucin (GP900)  \ncgd7_4330 Apical glycoprotein 2 (AGP2) Likely Essential \n(Akey et al., 2023) \ncgd7_5520 Hemogen  \n  1168 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 44 \nTable 3. Homology Arms/gRNAs used in Pyrimidine Salvage 1 KO Vector CRISPR Screen  1169 \nKO Vector Target Hom1/gRNA Hom2 \ncgd1_1900_319 CTAATAGGATCTGGTGAAGCGATGGAGAATGCGCTTAGATTTGTATGCAG CAAATTCGTTTTCAGAAGAGTTATTTAATAACACCTTCCCTATTCTACAT \ncgd1_3140_313 TCAGTATCTGGAATAATCTTATACCAACCATCTAAATTATTTTGGTTACG AGATGCAAGAGTATGGTTGGAATGATAAATATTTTTTGATTGATGGTTTT \ncgd2_1630_243 AACGTAAGCTATAGAAACTATAAATTAAGTAAATAAACATATATTACTCA TTAACTTAACTATTAATTTTTCTAAAGCAACAATTTCACAGTGTCTAGTT \ncgd2_2780_524 CTCTTCAAAATCTTGAACCAATATTGAGGCAAGTTCTTTTAACTTTCCTG GAATGCAAATTTTGAAGAAGTTGAAAAATCTATTGAGGTATTAAAAAATT \ncgd4_4460_156 TAATTGTGACTCGAATAAGAAGAATGCACTAATTATGGGAAGAAAAACAT GGAAATAACGACAATTTTTCTATTTTTAAGAGGTCTTCTTCCAATTGAAT \ncgd5_1710_235 ATAGATCCTTATTTGAATATTGACGCAGGGACTATGTCTCCCTTTGAGCA TTCCCAAATCCAAATCGACTTCCTCTCCATCATCTAATACAAAAACCTCA \ncgd5_3630_140 ATATGAAATTGGGGGTAAGAAGAGGGGGATATGCTGGCAGAAAGAGAGAA GAATCCCTCTCCTCCATTAGTAATTTTGACTAACTTTAGATAAAGGAATT \ncgd5_4440_332 AGAGAATTATGCATTGTTGTTGATAAGCTAAATATTCCAGTACTATGCTA ATAAGTATTTACTTCCTTCAAATAAATTTCCCTTAAAGTCTGTTCTCAAA \ncgd6_1950_240 TGTGTAGATTAGAAGTCGATATCCGAGCAGCGAGTTTAGAGAAATCATTG ATCTGAATTGGACGAACTTGCTTCGCAAACTTGTGCATATATGGCAGCTA \ncgd7_1470_400 GATAAAGGCCAAATTTTTGAAAGTTGGGAAAACTTTTCCCTAGTTAATGG AAGAAAACCATATTGATAAAATTTGGAATGTAATAGAGGTTCCAAAGAAT \ncgd8_2810_291 TTCTGTGGACTTTGAACTTCTATACAATGTTTTACTAAGTTTGAAAAACG TTCCAATCTCTTATGTTGTTTAAAACAGTAGTTAGGGATGTGAACCCCTT \n 1170 \n 1171 \nTable 4. Homology Arms/gRNAs used in Pyrimidine Salvage 2 KO Vector CRISPR Screen  1172 \nKO Vector Target Hom1/gRNA Hom2 \ncgd1_1900_232 CTTCCTTATGATTATAAGGAAATTAAAACCCCAAATGGAATCGAAGTCAA CACCAGATCCTATTAGGCTCACGCCGCAGATGGGAGTGTTAAATGCAATT \ncgd1_3140_162 AATGTCTAGAAAGGATGAAACCAGCGAGTTAATTGACAGTTATATCAGAG CATCTTCTTCTTTAACAAACCAACAGTAATCTCAACAGGAACAATTAATC \ncgd2_1630_37 TATAACAATGAAGAGTTAGAGATGTTTATGAAAAGAGCGATTGAACTAGT TCTGACTAAAAATAATAAATTATTACAGCTTTACAAAGATATTAGCTTTA \ncgd2_2780_222 ATGTGGCAAAAAAGCAATAAGACAAATTTGCTTTTGCGGAAGCGATTCAG TATCATGAAAGCTTTCTTTGCTCTGAACCTAATACAATCATCATAAGATT \ncgd4_4460_9 TGTGAATTTCAGAACTTTTAAAATGAGTAAAAAGAACGTTTCAATTGTTG CCAAGGTAATTGTCCGTTAATTCCTATTCCTCTACTCAAAACAGAAGCTG \ncgd5_1710_160 CTAGGTAAAGGAATAGCTATAAGCTCGCTTGGCTTATGCCTTAAAAGCAG CTGCGTCAATATTCAAATAAGGATCTATTTTTATCGCTGTTACATTATAT \ncgd5_3630_73 GTATTAGAAGGAACAGATAGGTAAGTTTGTTAAAATTTAAATATTAAGAG CAGCATATCCCCCTCTTCTTACCCCCAATTTCATATTTATTTCTTCTCCA \ncgd5_4440_223 ATTTTTTCCTTATTATTTTCTTGATTAATAATATCAAGTAGTTTTAAATC GCTCAATTTGCTCTAGAATTGGTCTCTCAGAAAAAGCACACACATTCACT \ncgd6_1950_124 CTATATAGACCATTTATCACTGCTTGAGTAACCCTCGCTGGGTCAACAAG CATTTGACCAGATTCTTAGCAGAATCACTAAATTATCATATGGACTTCAT \ncgd7_1470_202 AATTCCAAGTCATTCTCTTTAATAACTACTTTACGCATTCTTTTTATGTG CTAATGAATTTTCAAGATTTGTTAATAATGACCAGTTTACAAAGAGATTC \ncgd8_2810_203 TTACGGTAATTGAGACTGATAGTTTTTATAAAACTCCTGTCTTAGAAGAG TCAAAGTCCACAGAATTAGGATGATCAAAGTTGTAGTCTGCCATAGTTTG \n* Table 3 KO used in addition to Table 4 KO vectors 1173 \n 1174 \n 1175 \nTable 5. Homology Arms/gRNAs used in Vaccine Candidate 2 KO Vector CRISPR Screen  1176 \nKO Vector Target Hom1/gRNA Hom2 \ncgd7-4020_67_revco ACTCGATTTAAATGCAAGTGAAAAAAGTGGGTTCATAATAACAGCCACAA GGTGAAGTCAAAAATCATGGTGAACATTAAAGTGAGCTCATCGGCAATAG \ncgd7-4020_188_revco TCTTGCCAGTAGAATCAATAAGCAAGAAAGTTGTTGGGTCTAAATCTGAA ATTGAATCATCTGGTGCAGTTTCAAATGAAAAATTTGTAATCCCATCTCT \ncgd4-32_141_revcom GATTGCCACGTCAAGTTTAAATCTATTGCATTACTTGCCATTAATTCCTC GTGGCAAACTTATTGACTCAATAAACGAAAATTATGATAGATTTTCATAT \ncgd4-32_293 CTGAACTCTTCAACAAGAGAAGAATTAAAAACAAACTGGAGTTACACTAC TACCTTCTAATGCATTGATTGTGCACGAAACAGAACTTAGATTTTTGACT \ncgd4-3620_84_revcom CTTTGTTTGTTAGCATCTGCTGCAGATTTATTTTCAGCAACTTTAGTTTC ATTTTTAGTTTTATTATTCAATATTAAAAATGGGTTGTTCATCATCAAAG \ncgd4-\n3620_183_revcom GACTTCTTTGGTTCTTCTGGCTTTTGTTGAGCTTGGTTGCTGATTGGAGC AAAGAGAATTAGCTGAAAAGAAGGCTCAATTAGCCAAGGCTGTAAAGAAT \ncgd6-\n1080_106_revcom AACATCCTTTAAAGTTCCTCTGAGTGGAACGGCTGGGGCTGAGAATACAG AAGGAAGATGAGATTGTCGCTCATTATCGTATTACTCTCCGTTATAGTCT \ncgd6-1080_632 CAGGATTTCAGCACTCTCTCTGCTAATTCAAGTAGTCCAACTGAAAATGG TTTCCTCTGAGAGTGATCTTCTTGATCTTGATGAAGCCTGACCCGCAGAT \ncgd6-780_211_revcom AGAATACCAAGGTAGCTTATTTGAACTAAATGTATATACTAACCCTTCAC AAATTCTTTACCACCAAGTTTCAGTTGGACAAAAGCATGGAAAGATATTA \ncgd6-780_347_revcom TAGATTCCACATCTACTGTTTGTGCTGCAAAATTTATCATCAACTTACAG GCAGAAAATGATAAAGAAACTTTGGTAACAATTCAGAATGGTGATTTATA \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint \n\n 45 \ncgd7-4330_329 ACTCCATCAATATCAGGATATAATCGATGCGCTGTAATTATTGGTCTGAG TTCCTAAAGAGATGTTTTTGGAGCCAAAAGGACTAACATGAATTCTATCT \ncgd7-\n4330_517_revcom GTTATCAACGTTAGTAATTCCCTGTGATATTGGCGTAGAAACAACTTGAG CGTACCAGAATATGCCAGATACGGGGCTATTCATTCTGGGTACAGTCCTT \ncgd3-3370_100 ATTCCTAGCAGGGTTGTTTCTCAACACCCTTCTGGGATGCGCTTCTGTTT ACTTTCTCTTGGAACAGATGCAGCTGGAGGAATTTCGGTTTCTGATGATG \ncgd3-3370_1241 GGTTCTGCAGTTGGTAGATACAAATGTAGAGTTGGAGAAACGTCTTGTTA TTTCTACTTTTTGACCGGGAGATAATGGGTTTTGTAGTCTAAATTCAGAA \ncgd6-2330_164 GCTAGTTGTTTGAATGCTTCGTACTCATTCATTGAAGGTGGCATGACACC ATTCTAACGATGCAGATGGTAAAAGAACGACAGAAACACGGATAGCATCG \ncgd6-\n2330_316_revcom ACCATTCTTGTAAAGTGAATATGCTCTTAATGAAGCTATGCCACTTTCAA TTCTTCATTCCAGAATATTGCAACATTAAGATTCGGTGTGGACTCATGTT \ncgd6-1660_124 ATGCTTGGGGCCAGAGCATGTAGAATTTCATTTGGTCAACGGAAATAAAG TTTTCTATTTTCAACTTCGAACCTGCCATTTCCTTCTATTTGATTTAAAT \ncgd6-1660_998 GTAATAATTTTGAGCGAATCCCGAAATGAAATAAGGCCATACGGCTATAG CGTTGTTTAAGTCAATATTTTCGATAAATTGAGTCAGTATCATAGGGCTT \ncgd7-1960_160 AGCTTCAGAAGCAAAGGTAGAAACAGAAAACCCATTGCTATCAAGTACAG CATGGAAAGCAACTTATCAGAACAACAGGCACATGGATTGTTAGAACAAT \ncgd7-1960_317 TTAAAGAATCTATTTTGCACTTTAGCATGTAACGAGGAGTCATCAGACAT AACATCCTGACTCGCATACAGACAAGACCATAATTTCATTTGACAATGTT \ncgd7-\n5520_1216_revco CGCTAAGTCTTTCTCAGAACCAAAAGTCATTTTATTCTCAGCGCGATTAA TTTCTATACAAAAACATGTTTTGAAAAGAATGAAGCACATTGTCTTAAAC \ncgd7-\n5520_1115_revco AAACACAAGCGATTGAATAACTTACAGCTTCAAGAGCGTGTTTCCTATCA TTTGAGCTTGGCTTGATAAATGGTAGTTGGCTCGGAGGTGATATTTTTAT \n 1177 \n 1178 \nTable 6. List of Antibodies Used in this Work 1179 \nAntibody \nDilution factor \n(IFA or Expansion*) \nSource Catalogue \nmCherry Monoclonal Antibody (16D7) 1:1000 Invitrogen M11217 \nAnti-Cryptosporidium Immunodominant \nAntigen Cp23 \n1:1000 or 1:250* Stratech LS-C137378 \nLot #234986 \nVicia villosa lectin (VVL) 1:4000 2B Scientific FL-1231-2 \nLectin HPA AF488 1:5000 or 1:1000* Invitrogen L11271 \nHPA-Alexa 647 1:5000 Thermo Fischer L32454 \nHoechst 33342  1:10,000 Invitrogen H3570 \nGoat anti-Rabbit AF 647 1:1000 Invitrogen A-21245 \nGoat anti-Mouse AF546 1:1000 or 1:250* Invitrogen A-11030 \nGoat anti-Rat AF647 1:1000 Invitrogen A-21247 \nAlexa Fluor™ 405 NHS Ester 1:250* Thermo Scientific A30000 \nSYTOX Deep Red Nuclei Acid Stain 1:1000* Invitrogen S11381 \nAnti-TrpB 1:1000 Kind gift from lab of \nBoris Striepen \nGenerated towards \nTrpB protein  \nClick-IT Plus EdU Cell Proliferation Kit, \nAlexa Fluor 647 \n10mM  Thermo Fischer  C10340 \n 1180 \n.CC-BY 4.0 International licenseperpetuity. It is made available under a \npreprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in \nThe copyright holder for thisthis version posted November 22, 2024. ; https://doi.org/10.1101/2024.11.22.624643doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}