{"paper_id":"353df751-7442-41be-8678-aac5ee1ed173","body_text":"Extracellular IL-37 Enhances Osteogenic and Odontogenic Differentiation of Human Dental Pulp Stem Cells via Autophagy Pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Extracellular IL-37 Enhances Osteogenic and Odontogenic Differentiation of Human Dental Pulp Stem Cells via Autophagy Pathway Na Li, Yan Chen, Ming Yan, Yanqiu Wang, Jintao Wu, Lin Fu, Jinhua Yu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-291517/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background The osteogenic and odontogenic differentiation of dental pulp stem cells (DPSCs) contributes to the restoration and regeneration of dental tissues. Previous study indicated that IL-37 has often been identified as an anti-inflammatory factor that affects other pro-inflammatory signals. It is known to be a factor capable of inducing in vitro osteogenic differentiation of bone marrow mesenchymal stem cells (BMMSCs). The aims of this study were to explore the effects of IL-37 on the differentiation of DPSCs. Methods DPSCs were cultured in growth medium with different concentration of IL-37, ALP activity was done to detect the optimal concentration for the following experiments. CCK-8 were conducted to assess the effect of IL-37 on proliferation of DPSCs. To assess differentiation, alkaline phosphatase activity, ALP staining, alizarin red S staining and real‐time RT‐PCR of DSPP, Runx2, ALP, and OSX were measured. Western blot was conducted to examine the levels of autophagy related markers (Beclin1, P62, LC3). Results Cells cultured with 1 ng/mL IL-37 owned the highest ALP activity. IL-37 enhanced the osteogenic and odontogenic differentiation of DPSCs following upregulated the expression of Beclin1, downregulated the expression of P62, and reduced the ratio of LC3II/I, whereas depletion of autophagy suppressed DPSCs osteogenic and odontogenic differentiation. Conclusion IL-37 increased osteogenic and odontogenic differentiation via autophagy. Stem Cell & Developmental Cell Biology dental pulp stem cells IL-37 osteogenic odontogenic differentiation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Dental pulp is the soft tissue inside tooth, which plays an indispensable role in the homeostasis of vital teeth [ 1 ]. The function of dental pulp is to support dentin formation and regeneration [ 2 ]. A range of injuries or diseases including caries, pulpitis, periapical periodontitis, tooth trauma, etc. can result in pulp necrosis, further teeth losing [ 3 ]. For therapeutic strategies for the kind of teeth above, vital pulp therapy (VPT) and regenerative endodontic treatment (RET) attracted recent attention to remain functional of teeth. The aims of VPT are to preserve and save dental pulp vitality, to induce dental pulp stem cells (DPSCs) to differentiate into osteoblasts and odontoblasts and ultimately form the hard tissue such as the tertiary dentin. RET known as revascularization aims to promote normal physiological development in teeth with necrotic pulp and act as a substitute for injured dental structures. DPSCs have been regarded as an important candidate for such treatment. Their capability of differentiation into odontogenic and osteogenic stem cells associated with biomaterials and growth factors is critical for dental pulp regeneration [ 4 , 5 ]. Mesenchymal stem cells (MSCs) have a significant role in pulp regeneration therapy for the reconstruction of tissues. Due to the easily available source of dental tissues, dental stem cells are considered good candidates for tissue engineering applications. Human MSCs are a serviceable therapeutic tool for tissue engineering. DPSCs are identified as a type of MSCs that were originally isolated from human dental pulp tissue [ 6 ]. DPSCs have a lot of merits of easy access with the least invasive procedures and without any ethical controversy, and retain capacities of clonogenic formation, high proliferation, excellent regeneration, multilineage differentiation potential, and little inherent immunogenicity. As has been widely acknowledged, DPSCs can be induced to differentiate into a good many of directions, including osteogenic, dentinogenic, adipogenic, chondrogenic, myogenic, and neurogenic differentiation [ 7 ]. Compared with other MSCs from tissues as follows: bone marrow [ 8 ], peripheral blood [ 9 ], adipose tissue [ 10 ], and umbilical cord blood [ 11 , 12 ], DPSCs demonstrate higher clonogenic and proliferative potential. Therefore, DPSCs become an engaging tool cell source for tissue engineering and regenerative medicine. During the developmental process of MSCs, extracellular cues tend to exert its function in determining the fate of MSCs. Previous studies have revealed that in chronic inflammatory bone diseases, bone regeneration can be inhibited, and the osteogenic differentiation of DPSCs can be influenced by inflammatory microenvironments [ 13 ]. Interleukin 1 family member 7 (IL-1F7), a novel anti-inflammatory cytokine was recently proposed to be renamed Interleukin-37 (IL-37) [ 14 ]. IL-37 functions as a natural inhibitor of inflammatory and immune responses [ 15 ]. IL-37 is an anti-inflammatory factor that affects other pro-inflammatory signals, such as those mediated by tumor necrosis factor α (TNF-α), IL-1β, and IL-18 [ 16 ]. It was reported that IL-37 can promoted BMMSCs to differentiate into osteogenic lineage cells in vitro [ 17 ]. Recent studies have shown that abnormal expression of IL-37 in several autoimmune orthopedic diseases, such as ankylosing spondylitis and rheumatoid arthritis [ 18 ]. Most recently, studies demonstrated a connection between IL-37 and several bone metabolism-related inflammatory cytokines and reported that recombinant IL-37 (rhIL-37) inhibited the expression of pro-inflammatory cytokines, such as IL-6, TNF-α, IL-17, and IL-23 in patients with ankylosing spondylitis [ 19 ]. The new study has indicated that IL-37 suppresses osteoclast formation and bone resorption in vivo [ 20 ]. A better understanding of the molecular mechanisms that govern odontogenesis and osteogenesis might provide us with new perspectives on treatment of many oral diseases. Recent reports have provided evidence that macromolecular degradation in stem cells in a process of differentiation occurs through autophagy [ 21 ]. Autophagy or “self-eating”, is a conservative cellular degradation pathway that recycles cellular content [ 22 ]. Upon activation of autophagy, degradation of intracellular protein and organelles via a process that involves the delivery of cytoplasmic cargo to lysosomes and release of metabolites required for anabolic processes, such as cell growth, proliferation and differentiation [ 23 ]. When cells are subjected to external stress, such as nutrition deficiency, oxidative stress, hypoxia, tumor formation, aging or infection, autophagy plays an important role as a cell survival mechanism [ 24 , 25 ]. Recent studies have indicated that autophagy is an essential part in the functioning and maintenance of stem cells, acting to maintain their stemness, regulate their self-renewal, and mediate their differentiation capacity [ 26 , 27 ] [ 28 ]. In addition, accumulating evidence has demonstrated that autophagy is also involved in osteogenesis and bone development [ 29 , 30 ]. Autophagy is also an essential process that maintains mineralizing capacity, and balance the population of osteoblasts and osteoclasts [ 31 ]. The members in our team have demonstrated that autophagy is involved in the odontogenic and osteogenic differentiation in stem cells of apical papilla and rBMMSCs [ 32 , 33 ]. We hypothesis that autophagy might be involved in IL-37-mediated DPSCs osteogenic and odontogenic differentiation. Therefore, the aim of the present study was to verify whether IL-37 is able to promote the osteogenic and odontogenic differentiation of DPSCs and whether autophagy was involved in the regulation of osteo/odontogenic differentiation of DPSCs in vitro. 2. Materials And Methods 2.1. Isolation and Cell culture Fresh extracted third molars were collected from patients (age:17–23 years old) with the patient's consent. Tooth was cleaned with PBS (Gibco, USA). The pulp tissue was minced into smaller fragments and then immersed into a solution (3 mg/mL collagenase type I (Sigma, USA) and 4 mg/mL dispase (Gibco, USA)) for 1 h. Cell suspensions were seeded into culture dishes containing complete medium. 2.2. Cell phenotype analysis 2.2.1. Immunofluorescence staining Single cell suspensions were seeded on top of coverslips. After removing the medium, cells were fixed and washed. Briefly, after permeabilization with Triton X-100 for 12 min, cells were blocked with BSA (Boster, China) overnight, and then incubated with primary antibodies (anti-STRO-1, 1:100) overnight at 4℃. Cells were incubated with Cy3-conjugated secondary antibodies (Abcolonal, China). Following counterstained with DAPI, cells were photographed using a fluorescence microscope (Leica, Germany). 2.2.2 Flow cytometric analysis Cells were contained the following monoclonal antibodies for 1 h on ice: CD90/FITC, CD105/PerCP-Cy5.5, CD34/PE, CD45/PE, and CD73/PE (1:100, BD Biosciences, USA). Cell were washed and resuspended for analysis using a FACScan. The data were analyzed on the software (FlowJo, USA). 2.2.3. Colony-forming assay After cultured for 10 days later, cells were stained with toluidine blue (Beyotime, China). Photographs were taken under the microscope (Leica, Germany). 2.2.4. Multiple lineage differentiation Cells were cultured in osteoinductive medium (OM) of 50 mg/ml ascorbic acid, 10 mM sodium β-glycerophosphate, 10 nM dexamethasone (Sigma, USA). After 2 weeks, cells were stained with Alizarin Red S (Sigma, USA) to detect mineral deposits. Cells were incubated in adipogenic medium (Cyagen Biosciences Inc, USA) for 4 weeks. Then, cells were stained with Oil Red O reagent of the kit to reveal lipid droplets. Cell pellets were prepared for a three-dimensional culture system. Cells were cultured in chondrogenic differentiation medium (Cyagen Biosciences Inc, USA) for 28 days. Alcian blue staining was utilized to examine the cartilage nodules. 2.3 ALP activity assay Cells were incubated with different concentrations of IL-37 (0, 0.1, 1, 10, and 100 ng/mL) for 5 days. ALP activity of DPSCs was detected according to manufacturer’s instruction. 2.4 ALP staining Cells were seeded on 12-well plates and incubated with different cultured medium in different groups for 5 days. ALP staining was performed using an ALP staining kit (Beyotime Biotechnology, China) according to the manufacturer's instruction. 2.5 Alizarin red staining DPSCs were cultured in OM for 14 days in the presence or absence of IL-37. The formation of mineralized nodules of DPSCs was evaluated by alizarin red S staining. For quantitative analysis, 10% cetylpyridinium chloride (CPC) was added and the absorbance was measured at 562 nm. 2.6 CCK-8 To assess the effect of IL-37 on the proliferation of DPSCs, cells were incubated with different groups concentrations of IL-37 (0, 1 ng/mL) for 0, 1, 3, 5, or 7 days. Then, the cells were incubated in the mixture (CCK-8: α-MEM = 1:9) for 2 h. 2.7 EdU assay Cell proliferation ratio was measured using EdU Cell Proliferation Assay Kit according to the protocol of manufacturer. 2.8 RNA extraction and PCR analysis Total RNA was isolated and reversed to cDNA by the RT Reagent Kit (Vazyme, China). Real-time qPCR reactions were carried out SYBR Green Mix (Vazyme, China). The gene specific primers are listed in Table 1 . Table 1 Primer sequences for real-time quantitative PCR analysis of gene expression . Target gene Sequences (5′ − 3′) Product size (bp) GenBank accession number RUNX2 Forward, TCTTAGAACAAATTCTGCCCTTT 136 NM_001024630.3 Reverse, TGCTTTGGTCTTGAAATCACA OSX Forward, CCTCCTCAGCTCACCTTCTC 148 NM_001173467.1 Reverse, GTTGGGAGCCCAAATAGAAA ALP Forward, GACCTCCTCGGAAGACACTC 137 NM_000478.4 Reverse, TGAAGGGCTTCTTGTCTGTG DSPP Forward, ATATTGAGGGCTGGAATGGGGA 136 NM_014208.3 Reverse, TTTGTGGCTCCAGCATTGTCA GAPDH Forward, GAAGGTGAAGGTCGGAGTC Reverse, GAGATGGTGATGGGATTTC 225 NM_002046.3 2.9 Western Blot Analysis Cells were lysed in lysis buffer radioimmunoprecipitation assay (RIPA: PMSF = 100:1). Western blot was conducted according to previous studies [ 33 ]. 2.10 TEM Cells were collected after treated with or without 1 ng/mL IL-37 for 12 h. After fixation, dehydration, embedding, sectioning and staining, samples were viewed with a Hitachi Model H-7500 TEM (Hitachi, Japan). 2.11 Immunofluorescence staining After cell attachment, the culture solid was replaced by complete medium and IL-37 (1 ng/mL) for 12 h. Cells were stained with primary antibody including DSPP, RUNX2, ALP, LC3 (1:100) according to the steps above. 2.12 Statistical analysis Data are shown as mean ± SEM and were tested for statistical significance using ANOVA. 3. Results 3.1 Characterization of SCAPs and screening for the optimal IL-37 concentration DPSCs were isolated and displayed a typical cobblestone-like morphology. Primary DPSCs were observed as shown in Fig. 1 A. PDSCs in passage 3 were typical fibroblast-like or spindle-like in Fig. 1 B. Immunofluorescence staining indicated that isolated DPSCs were positive for the established MSCs-specific surface marker STRO-1 (Fig. 1 C). Flow cytometry analysis showed a pronounced expression of mesenchymal stem cell markers including CD73, CD90, and CD105, while they also showed the negativity for hematopoietic cell marker CD34 and leucocyte maker CD45. Cell surface markers: CD34 (0.07%); CD45 (0.30%); CD73 (99.6%); CD90 (93.3%); CD105 (87.5%) (Fig. 1 D). The result of colony-forming assay showed that DPSCs could form single cell colonies. A single colony stained with crystal violet was observed under the microscope (Fig. 1 E). Furthermore, results of oil red O staining, alizarin red S (ARS) staining and Alcian blue staining showed that DPSCs could differentiate into adipocytes, osteoblasts, and chondrocyte (Fig. 1 F, G, H). 3.2 Effect of IL-37 on the proliferation of DPSCs At day 5, ALP activity assay showed that ALP activity was the highest in the 1 ng/mL IL-37 group (Fig. 2 A; P < 0.01 ). As compared with other groups, the 1 ng/mL IL-37 group also presented the highest ALP protein and gene expression after being induced for 5 days (Fig. 2 B, C, D; P < 0.01 ). Therefore, 1ng/mL IL-37 was selected to be the optimal concentration for our further study. To evaluate the impact of IL-37 on the proliferation of DPSCs, CCK-8 analysis and EdU assay were performed. As indicated by the results of EdU assay (Fig. 2 E, F; p > 0.05 ), and CCK-8 (Fig. 2 G; p > 0.05 ), 1ng/mL IL-37 exerted almost no significant effect on the proliferation of SCAPs as compared with the control group. 3.3 IL-37 induced the osteo/odontogenic differentiation of SCAPs To analyze the influence of IL-37 on the osteo/odontogenic differentiation and mineralization of DPSCs, cells were treated with 1 ng/mL IL-37. The protein expression of osteogenic and odontogenic markers in hDPSCs were examined cultured with or without 1 ng/mL IL-37 for 0, 3 and 7 days. Cells cultured with 1 ng/mL IL-37 expressed markedly higher levels of DSPP, RUNX2, ALP and OSX than those control groups for 3, 7 days, while, there is no difference between control group and IL-37 group for 0 day (Fig. 3 A and B). Consistently, qRT-PCR showed that the osteogenic and odontogenic markers DSPP, RUNX2, ALP and OSX were also increased in the IL-37 treatment groups for 3, 7 days (Fig. 3 C; p < 0.05 or 0.01 ). To further confirm whether IL-37 mediate osteogenic and odontogenic differentiation of DPSCs, cells were then cultured in OM with and without IL-37. Compared with control group, ALP staining revealed that ALP activity was significantly higher with administration of 1 ng/mL IL-37 (Fig. 3 D). ALP activity assay confirmed the results of staining (Fig. 3 E, p < 0.01 ). A similar trend in Alizarin Red S staining was detected after induction for 14 days. DPSCs treated with 1 ng/mL IL-37 and IL-37 + MM presented more mineralized nodules than control group or MM group (Fig. 3 F). CPC assay revealed that extracellular calcium deposition was significantly increased in IL-37 group at day 14 as compared with the control group (Fig. 3 G; p < 0.01 ). In addition, immunofluorescence assay showed that the osteoblastic and odontoblastic markers DSPP and RUNX2 were upregulated in 1 ng/mL IL-37-treated group (Fig. 2 H, I). Above all, these results indicated that 1 ng/mL IL-37 enhanced the osteo/odontogenic differentiation of DPSCs. 3.4 1 ng/mL IL-37 triggered autophagy of DPSCs To explored the mechanism of IL-37-enhanced odontoblastic and osteoblastic differentiation potential of DPSCs, western blot was conducted. DPSCs were treated with 1 ng/mL IL-37. Exposure of DPSCs to complete medium containing 1 ng/mL IL-37 resulted in elevated protein expression of autophagy‐related protein Beclin1 and the expression ratio of LC3-II/I in a time‐dependent manner while the expression of p62 was decreased (Fig. 4 C, D). The images of immunostaining with LC3 showed that endogenous LC3 dot form in IL-37‐treated DPSCs was significantly higher than control group (Fig. 4 E). Meanwhile, to further confirm the induction of autophagy in IL-37‐treated DPSCs, the formation of autophagosomes was observed by means of TEM. The photos of TEM showed more autophagosomes in 1 ng/mL IL-37‐treated DPSCs group at 7 days than those in the control group (Figure F). These observations strongly suggested IL-37 activated autophagy in IL-37-treated DPSCs. 3.5 The autophagy inhibitor 3-MA suppresses IL-37-mediated enhancement osteoblastic and odontoblastic differentiation of DPSCs To further validate our findings, autophagy was inhibited with specific inhibitor 3-MA, respectively. Western blot analysis indicated that the ratio of LC3-II to LC3-I, Beclin1 expression levels in IL-37 + 3-MA group were significantly lower than the IL-37 group, while 3-MA significantly up-regulated P62 protein levels, suggesting that autophagy was suppressed when autophagy inhibitor3-MA treatment was applied (Fig. 5 A, B). The result indicated that 3-MA showed obviously autophagy inhibition. RT-PCR and western blot were conducted to investigate the effects of IL-37 on osteoblastic and odontoblastic differentiation of DPSCs following autophagy inhibitor treatment. Western blot analysis showed that the inhibitor 3-MA dramatically suppressed IL-37‐mediated enhancement of DSPP, RUNX2, ALP and OSX expression in DPSCs at protein levels (Fig. 5 C, D). Similarly, the inhibitor 3-MA suppressed IL-37‐enhanced the expression of DSPP , OCN , RUNX2 and OSX in DPSCs at gene level (Fig. 5 E). To investigate the role of autophagy in IL-37-induced mineralization, ALP staining, ALP activity assay, ARS staining and CPC assay were performed. The results of ALP staining and ALP assay showed that ALP activity of IL-37-treated DPSCs was inhibited with the addition of autophagy inhibitor 3-MA on day 5 (Fig. 5 F, G). After induction for 2 weeks, the amount of minerals was significantly decreased in the presence of autophagy inhibitor 3-MA compared with IL-37 treatment alone (Fig. 5 H, I). As shown by immunostaining analysis, the expression of DSPP and RUNX2 increased remarkably in IL-37-treated DPSCs compared with IL-37 + 3-MA (Fig. 5 J, K). These results indicated that IL-37‐enhanced osteoblastic and odontoblastic differentiation of DPSCs were repressed by autophagy inhibition. 3.6. Upregulation of autophagy by rapamycin further promoted odontogenic and osteogenic differentiation of DPSCs To further examine the effect of autophagy on osteogenic and odontogenic differentiation of DPSCs, cells were cultured in medium in the presence of rapamycin. The result also indicated that rapamycin treatment significantly up-regulated Beclin1 protein levels, increased the ratio of LC3-II to LC3-I and down-regulated P62 protein level compared with the IL-37 group (Fig. 5 A, B). Besides, hDPSCs exposed to rapamycin significantly increased autophagy activity. Western blot analysis and qRT-PCR were conducted to detect the inducer of autophagy rapamycin on the osteogenic and odontogenic differentiation of DPSCs at the RNA and protein levels. The results of western blot showed that the expression of osteogenic and odontogenic markers DSPP, RUNX2, ALP and OSX were all up-regulated in IL-37 + rapamycin group comparing with IL-37 (Fig. 6 C, D). PCR assay for mRNA expression of odontogenesis/osteogenesis-related molecules showed that autophagy activation by rapamycin enhanced IL-37-induces differentiation (Fig. 6 E). ALP staining and ALP activity assay showed that rapamycin upregulated ALP activity compared with IL-37 groups (Fig. 6 F, G). ARS staining indicated that the number of mineralized nodules was observed more in the rapamycin group (Fig. 6 H). CPC assay showed that the group treated with IL-37 + rapamycin presented higher calcium contents as compared with IL-37 group (Fig. 6 I). Besides, immunofluorescence assay showed that osteogenic and odontogenic markers DSPP, RUNX2 were upregulated in IL-37 + rapamycin-treated group (Fig. 6 J, K). All these data indicated that autophagy plays a catalytic role in IL-37-induced osteogenic and odontogenetic differentiation of hDPSCs. Discussion Osteogenic differentiation and odontogenic differentiation are crucial characteristics of the oral stem cells pluripotency. They play key roles in the maintenance, tissue regeneration and engineering. In this study, we demonstrated that IL-37 and the related target autophagy pathway play an important role in the osteo/odontogenic differentiation of DPSCs. DPSCs consist of heterogeneous multipotent cell populations, which have the potential to differentiate into osteoblasts and odontoblasts. Osteogenic and odontogenic differentiation result in the expression of related genes and proteins such as DSPP, RUNX2, ALP, OSX. This study emphasized a novel and promising role of IL-37 in regulating the odontogenic and osteogenic differentiation of DPSCs. IL-37 is recently identified as an anti-inflammatory cytokine [ 34 ]. A Chinese study reported that patients carrying a mutation in the coding region of IL-37 have lower disease activity scores and less pain, which indicated significant function for the anti-inflammatory effects of IL- 37[ 35 ]. Previous studies demonstrated that cytokines were associated with autophagy. For example, in addition to controlling the migration of macrophages into degenerative tissues, IL-33, one of cytokines, also regulated autophagy in these tissues [ 36 ]. The level of IL-37 is normally low, but this significantly increases under severe inflammatory conditions. It has been previously found that IL-37 plays an important regulatory role in the development of several inflammatory and autoimmune diseases [ 37 , 38 ]. Recent studies investigated that IL-37 mediates a variety of anti-cancer effects in multiple types of cancer [ 39 ]. Recently, it was reported that IL-37 promoted the osteogenic differentiation of BMSCs [ 17 ]. In this study, we found that extracellular IL-37 accelerated the osteogenic and odontogenic differentiation of DPSCs via autophagy when at 1 ng/mL, while there is no significant effect on the proliferation. The autophagy pathway is normally inhibited by 3-MA and activated by rapamycin [ 40 ]. Autophagy is a major intracellular mechanism to protect cells from stress stimulation and maintain the properties of stem cells [ 30 , 41 ]. Autophagy plays an important role in the osteogenic and odontogenic differentiation of hDPSCs under specific condition [ 1 ]. During cellular differentiation, autophagy occurs in order to meet metabolic needs associated with morphological and functional changes. Several proteins, including LC3, p62, and Beclin1 have been involved in autophagy and are used as markers for the activation of the process. LC3 is the most widely used autophagic marker. LC3 is usually produced by ubiquitin, the residues of which are exposed on the vesicular membrane surface after ATG4 homolog catalysis, and forms LC3-I in the cytoplasm [ 41 ]. LC3‐I can specifically bind phosphatidylethanolamine on the vesicle membrane surface and eventually forms LC3‐II, which is an integral membrane protein present in autophagosomes [ 42 ]. Accumulation of LC3 II is thus used as a marker for activation of autophagy, which can directly reveal autophagy. Beclin‐1 is an autophagy-initiated protein. P62 possesses LC3‐interacting region and serves as a signaling hub of autophagy. P62 is degraded through the process of autophagy, therefore the degradation of P62 expression level can serve as a marker of autophagic clearance [ 30 ]. The increases of Beclin1, an autophagy initiation protein, is also accompanied by activation of the process. In this study, IL-37 promoted LC3 I/II conversion, increased the protein levels of Beclin1 and decreased the protein expression of P62. ALP has a vital function during mineralization of osteoblasts and odontoblast, and its activity is upregulated at an early stage of calcification [ 43 ]. In this study, 1 ng/ml was the optimal concentration of IL-37 to promote differentiation of DPSCs by detecting the ALP activity at day 5, as well as the mRNA level and protein level of ALP at day 5. Our results showed that the expression levels of osteogenic and odontogenic markers, including DSPP, RUNX2, ALP, and OSX were upregulated at 3, 7 days of differentiation, indicating that 1 ng/mL IL-37 can enhance the osteo/odontogenic differentiation of DPSCs. The autophagy pathway was shown to positively regulate differentiation of MSCs. We proceeded to investigate whether autophagy was activated by IL-37, the key proteins in autophagy signaling were evaluated. Consistent with pathway analysis, the protein expressions of Beclin 1, the ratio of LC3 II/I were significantly increased while the expression of P62 was reduced, when DPSCs were treated with IL-37 for 6, 12, 24 h. To further confirm whether autophagy signaling was implicated in the process of IL-37 enhanced osteogenic and odontogenic differentiation of DPSCs, we evaluated the expression of related markers above with or without autophagy inhibitor 3-MA. While 3-MA was used, we found that all the markers of osteogenesis and odontogenesis were dramatically reduced. These in vitro results demonstrated that autophagy is an important mechanism in IL-37 enhanced osteo/odontogenic differentiation of hDPSCs. Rapamycin, as autophagy activator was used to further detect the relationship between autophagy and osteo/odontogenic differentiation of IL-37 treated DPSCs. Osteogenic and odontogenic differentiation of IL-37 enhanced DPSCs further increased with rapamycin treatment. In summary, the present study revealed that IL-37 could induce osteogenic and odontogenic differentiation in DPSCs, which involved the upregulation of autophagy. The results expanded our knowledge on the role of IL-37 in osteogenesis and odontogenesis of DPSCs, and also suggested that IL-37 may be a potential drug for pulp treatment in the future and provided insight into the molecular mechanism of vital pulp therapy. Also, kinetic in vivo measurements should be carried out in future studies. Conclusion Overall, IL--37 enhances differentiation of DPSCs into odontoblasts and osteoblasts via autophagy signaling pathways. Abbreviations 3-MA 3-methyladenine; ALP: alkaline phosphatase; ARS: alizarin red staining; α-MEM: alpha modified eagle’s medium; BMMSCs: bone marrow mesenchymal stem cells; BSA: bovine serum albumin; CCK-8: cell counting kit -8 assays; DAPI 4-6-diamidino-2-phenylindole; DPSCs: dental pulp stem cells; DSPP dentin sialophosphoprotein; FBS fetal bovine serum; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; IL-37 Interleukin-37; LC3 microtubule-associated protein 1 light chain 3; MTOR mechanistic target of rapamycin; OSX: osterix; PBS: phosphate buffered saline; real time RT-PCR: real time reverse-transcription polymerase chain reaction; RIPA: radio immunoprecipitation assay; RUNX2: runt-related transcription 2. Declarations Acknowledgements Not applicable. Conflict of interest The authors declare no conflicts of interest. Authors Contributions Na Li conceived and designed the study, collected and assembled data, and wrote the manuscript. Yan Chen and Ming Yan performed the data analysis and interpretation. Yanqiu Wang, Jintao Wu completed data analysis and interpretation. Lin Fu reviewed the data. Jinhua Yu conceived and designed the study, provided financial support and study material, performed the data analysis and interpretation, and approved the final version of the manuscript. All authors read and approved the manuscript. Funding This work was supported by the National Natural Science Foundation of China (grant numbers: 81873707 and 81900962), Medical Talent Project of Jiangsu Province (grant number: ZDRCA2016086), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD, grant number: 2018-87), and Science and Technology Development Project of Jiangsu Province (grant number: BE2017731). Availability of data and materials The datasets used and analyzed during the current study are available from the corresponding author on reasonable request. Ethics approval and consent to participate Studies were carried out in accordance with the Declaration of Helsinki and got the approval of the Ethical Committee of Nanjing Medical University. Consent for publication Not applicable. References Jingwen Yang Y Z, Chunyan Wan, Zheyi Sun, Shuai Nie, Shujuan Jian, Lu Zhang, Guang-tai Song, Zhi Chen. Autophagy in SDF-1a-mediated DPSC migration and pulp regeneration. Biomaterials. 2015;44:11-23. Jingyuan Li C P, Yang Chai. Cellular and molecular mechanisms of tooth root development Development. 2017;144:374-384. Jing Zou M M, Clarice S Law, Yale Rao, Xuedong Zhou Common dental diseases in children and malocclusion. International Journal of Oral Science. 2018;13:7. Kun Xuan B L, Hao Guo, Wei Sun, Xiaoxing Kou, Xiaoning He, Yongjie Zhang, Jin Sun, Anqi Liu, Li Liao, Shiyu Liu, Wenjia Liu, Chenghu Hu, Songtao Shi, Yan Jin. Deciduous autologous tooth stem cells regenerate dental pulp after implantation into injured teeth. Science Translational Medicine. 2018;10:eaaf3227. Joanna Metlerska I F, Alicja Nowicka. Efficacy of Autologous Platelet Concentrates in Regenerative Endodontic Treatment: A Systematic Review of Human Studies. Journal of Endodontics 2019;45:20-30. Wenkai Jiang D W, Amr Alraies, Qian Liu, Bangfu Zhu, Alastair J. Sloan, Longxing Ni, and Bing Song. Wnt-GSK3β/β-Catenin Regulates the Differentiation of Dental Pulp Stem Cells into Bladder Smooth Muscle Cells. Stem Cells International. 2019. Xuan Wang T W, Long Jiang, Du Rong, Yaqin Zhu. Deferoxamine-Induced Migration and Odontoblast Differentiation via ROS- Dependent Autophagy in Dental Pulp Stem Cells. Cellular Physiology and Biochemistry. 2017;43:2535-2547. M F Pittenger A M M, S C Beck, R K Jaiswal, R Douglas, J D Mosca, M A Moorman, D W Simonetti, S Craig, D R Marshak. Multilineage potential of adult human mesenchymal stem cells. Science. 1999;284:143-147. Brian M Strem K C H, Min Zhu, Isabella Wulur, Zeni Alfonso, Ronda E Schreiber, John K Fraser, Marc H Hedrick. Multipotential differentiation of adipose tissue-derived stem cells. The Keio Journal of Medicine. 2005;54:132-141. W A Robinson J E K, B L Pike. Colony growth of human leukemic peripheral blood cells in vitro. Blood. 1971;38:500-508. Karen Bieback S K, Harald Klüter, Hermann Eichler. Critical parameters for the isolation of mesenchymal stem cells from umbilical cord blood. Stem Cells. 2004;22:625-634. Yasuyuki Fujii Y K K, Hironori Hojo, Fumiko Yano, Marika Sato, Ung-il Chung, Shinsuke Ohba and Daichi Chikazu. Bone regeneration by human dental pulp stem cells using a helioxanthin derivative and cell-sheet technology. Stem Cell Research & Therapy. 2018;9:24. Xuechao Yang S Z, Xin Pang, Mingwen Fan. Pro-inflammatory cytokines induce odontogenic differentiation of dental pulp-derived stem cells. Journal of Cell Biochemistry. 2012;113:669-677. Giulio Cavalli C A D. Suppression of inflammation and acquired immunity by IL- 37. Immunological Review. 2018;281:179-190. Giulio Cavalli C A D. Suppression of Inflammation and Acquired Immunity by IL-37 Immunol Rev. 2018;281:179-190. Yunbo Yang Z-X Z, Dameng Lian, Aaron Haig, Rabindra N Bhattacharjee, Anthony M Jevnikar IL-37 inhibits IL-18-induced tubular epithelial cell expression of pro-inflammatory cytokines and renal ischemia-reperfusion injury. Kidney International. 2015;87:396-408. Chenyi Ye W Z, Kai Hang, Mo Chen, Weiduo Hou, Jianzhong Chen, Xi Chen, Erman Chen, Lan Tang, Jinwei Lu, Qianhai Ding, Guangyao Jiang, Baojian Hong, Rongxin He. Extracellular IL-37 promotes osteogenic differentiation of human bone marrow mesenchymal stem cells via activation of the PI3K/AKT signaling pathway. Cell Death and Disease. 2019;10:753. Libin Yang J Z, Jingang Tao, Tan Lu. Elevated Serum Levels of Interleukin-37 Are Associated With Inflammatory Cytokines and Disease Activity in Rheumatoid Arthritis APMIS. 2015;123:1025-1031. Bingni Chen K H, Liang Ye, Yanqun Li, Jiawei Zhang, Jinshun Zhang, Xinmin Fan, Xiaokai Liu, Li Li, Jinxia Sun, Jing Du, Zhong Huang Interleukin-37 is increased in ankylosing spondylitis patients and associated with disease activity. J Transl Med. 2015;13:36. Jafari Saeed H K, Keisuke Kimura, Masahiko Ishida, Haruki Sugisawa, Yumiko Ochi, Akiko Kishikawa, Teruko Takano-Yamamoto. IL-37 Inhibits Lipopolysaccharide-Induced Osteoclast Formation and Bone Resorption in Vivo. Immunol Lett. 2016;175:8-15. Patricia Boya P C, Natalia Rodriguez-Muela. Autophagy in stem cells: repair, remodelling and metabolic reprogramming. Development. 2018;145:dev146506. Thomas Riffelmacher F C R, and Anna Katharina Simon. Autophagy dictates metabolism and differentiation of inflammatory immune cells. Autophagy. 2018;14:199-204. Tingting Li D Z, Tong Mou, Zhen Guo, Junliang Pu, Qingsong Chen, Xufu Wei, Zhongjun Wu. IL-37 induces autophagy in hepatocellular carcinoma cells by inhibiting the PI3K/AKT/mTOR pathway. Molecular Immunology. 2017;87:132-140. Noboru Mizushima B L. Autophagy in mammalian development and differentiation. Nat Cell Biol 2010;2010:9. Lorenzo Galluzzi E H B, Andrea Ballabio, Patricia Boya 8 , José Manuel Bravo-San Pedro, Francesco Cecconi, Augustine M Choi, Charleen T Chu, Patrice Codogno, Maria Isabel Colombo, Ana Maria Cuervo, Jayanta Debnath, Vojo Deretic, Ivan Dikic, Eeva-Liisa Eskelinen, Gian Maria Fimia, Simone Fulda, David A Gewirtz, Douglas R Green, Malene Hanse, J Wade Harper, Marja Jäättelä, Terje Johansen, Gabor Juhasz, Alec C Kimmelman, Claudine Kraft, Nicholas T Ktistakis, Sharad Kumar, Beth Levine, Carlos Lopez-Otin, Frank Madeo, Sascha Martens, Jennifer Martinez, Alicia Melendez, Noboru Mizushima, Christian Münz, Leon O Murphy, Josef M Penninger, Mauro Piacentini, Fulvio Reggiori, David C Rubinsztein, Kevin M Ryan, Laura Santambrogio, Luca Scorrano, Anna Katharina Simon, Hans-Uwe Simon, Anne Simonsen, Nektarios Tavernarakis , Sharon A Tooze, Tamotsu Yoshimori, Junying Yuan, Zhenyu Yue, Qing Zhong, Guido Kroemer Molecular Definitions of Autophagy and Related Processes EMBO J. 2017;36:1811-1836. Carlo Rodolfo S D B, Francesco Cecconi. Autophagy in stem and progenitor Cell. Cell Mol Life Sci. 2016;73:475-496. Patricia Boya P C, Natalia Rodriguez-Muela Autophagy in Stem Cells: Repair, Remodelling and Metabolic Reprogramming Development. 2018;145:dev146506. Yang Ma M Q, Ying An, Liqiang Zhang, Rui Yang, Daniel H Doro, Wenjia Liu, Yan Jin. Autophagy controls mesenchymal stem cell properties and senescence during bone aging. Aging Cell 2018;17:e12709. Meng Qi L Z, Yang Ma, Yi Shuai, Liya Li, Kefu Luo, Wenjia Liu, Yan Jin. Autophagy Maintains the Function of Bone Marrow Mesenchymal Stem Cells to Prevent Estrogen Deficiency-Induced Osteoporosis. Theranostics. 2017;7:4498-4516. Yongxian Wan N Z, Yulin Li, Weikang Zhao, Dianming Jiang. Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae. Biochemical and Biophysical Research Communications. 2017;1. Valérie Pierrefite-Carle S S-D, Véronique Breuil, Olivier Camuzard, Georges F Carle. Autophagy in Bone: Self-eating to Stay in Balance. Ageing Res Rev 2015;2015:Pt B. Yin Pan R G B, Zehan Li, Yanqiu Wang, Ming Yan, Jinhua Yu. Sodium fluoride regulates the osteo/odontogenic differentiation of stem cells from apical papilla by modulating autophagy. J Cell Physiol 2019. Jiamin Lu Z L, Xiao Wu, Yan Chen, Ming Yan, Xingyun Ge and Jinhua Yu. iRoot BP Plus promotes osteo/odontogenic differentiation of bone marrow mesenchymal stem cells via MAPK pathways and autophagy. Stem Cell Research & Therapy. 2019;10:222. Ping Ouyang W A, Renhuai Chen, He Zhang, Danrui Chen, Enping Jiang, Wei Zhu, Peng Li , Hongsheng Guo, Zhangquan Chen, Sen Wang. IL-37 Promotes Cell Apoptosis in Cervical Cancer Involving Bim Upregulation Onco Targets Ther 2019;12:2703-2712. B Pei S X, T Liu, F Pan, J Xu, C Ding. Associations of the IL-1F7 Gene Polymorphisms With Rheumatoid Arthritis in Chinese Han Population Int J Immunogenet. 2013;40:199-203. Jean Wu C C, Cindy Zhou, Susumu Nakae, John Hicks, Henry P Adams, Yahuan Lou. IL-33 is required for disposal of unnecessary cells during ovarian atresia through regulation of autophagy and macrophage migration. J Immunol 2015;194:2140-2147. Susanne Pfeiler H W, Malte Kelm 1 , Norbert Gerdes. IL-1 Family Cytokines in Cardiovascular Disease. Cytokine 2019;22:154215. Xinyu Zhuang B W, Jian Li, Haiming Shi, Bo Jin, Xinping Luo. The Emerging Role of interleukin-37 in Cardiovascular Diseases Immun Inflamm Dis 2017;5:373-379. Yazhuo Jiang Y W, Liang Liang, Yang Gao, Juan Chen, Yi Sun, Yongyi Cheng, Yonggang Xu. IL-37 Mediates the Antitumor Activity in Renal Cell Carcinoma Med Oncol. 2015;32:250. Rodrigo Dutra Nunes G V-M, Débora Monteiro Moretti, Priscilla Medeiros-Castro, Carlucio Rocha-Santos , Carlos Renato de Oliveira Daumas-Filho, Paula Rego Barros Bittencourt-Cunha, Karina Martins-Cardoso, Cecília Oliveira Cudischevitch, Rubem Figueiredo Sadok Menna-Barreto, José Henrique Maia Oliveira, Desiely Silva Gusmão, Francisco José Alves Lemos, Daniela Sales Alviano, Pedro Lagerblad Oliveira, Carl Lowenberger, David Majerowicz, Ricardo Melo Oliveira, Rafael Dias Mesquita, Georgia Correa Atella, Mário Alberto Cardoso Silva-Neto Polyphenol-rich diets exacerbate AMPK-mediated autophagy, decreasing proliferation of mosquito midgut microbiota, and extending vector lifespan. PLoS Neglected Tropical Disease. 2016;10:e0005034. Kanchan Phadwal A S W, Anna Katharina Simon. Tightrope act: autophagy in stem cell renewal, differentiation, proliferation, and aging. Cell and Molecular Life Science. 2013;70:89-103. Xichun Wang Y J, Lei Zhu, Li Cao, Wei Xu, Sajid Ur Rahman, Shibin Feng, Yu Li, Jinjie Wu. Autophagy protects PC12 cells against deoxynivalenol toxicity via the Class III PI3K/beclin 1/Bcl‐2 pathway. Journal of Cell Physiology. 2020;235:7803-7815. Jinghui Li F Z, Ning Zhang, Xuefei Geng, Cen Meng, Xiaoying Wang, Ying Yang. Osteogenic capacity and cytotherapeutic potential of periodontal ligament cells for periodontal regeneration in vitro and in vivo. PeerJ. 2019;7:e6589. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-291517\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research\",\"associatedPublications\":[],\"authors\":[{\"id\":15081328,\"identity\":\"5cd59395-f560-4393-8275-afce99e93036\",\"order_by\":0,\"name\":\"Na Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Nanjing Medical University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Na\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":15081329,\"identity\":\"1633e7ec-b5ac-412f-920f-7ce6bd8fe0e1\",\"order_by\":1,\"name\":\"Yan Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Nanjing University Medical School Affiliated Stomatological Hospital: Nanjing Stomatological Hospital\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yan\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":15081330,\"identity\":\"ec01e24f-b661-4762-8990-0818e2b4bb43\",\"order_by\":2,\"name\":\"Ming Yan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Nanjing Medical University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ming\",\"middleName\":\"\",\"lastName\":\"Yan\",\"suffix\":\"\"},{\"id\":15081331,\"identity\":\"c809cdd1-2fff-419d-a539-8a4becd5c96c\",\"order_by\":3,\"name\":\"Yanqiu Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Nanjing Medical University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yanqiu\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":15081332,\"identity\":\"867c4c9e-9ab7-40ec-b305-095acf21d951\",\"order_by\":4,\"name\":\"Jintao Wu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Nanjing Medical University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jintao\",\"middleName\":\"\",\"lastName\":\"Wu\",\"suffix\":\"\"},{\"id\":15081333,\"identity\":\"47744cb3-444c-42b1-beab-f4c7d505719e\",\"order_by\":5,\"name\":\"Lin Fu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Nanjing Medical University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lin\",\"middleName\":\"\",\"lastName\":\"Fu\",\"suffix\":\"\"},{\"id\":15081334,\"identity\":\"420171ad-319f-4dc8-9b11-b625c5be741c\",\"order_by\":6,\"name\":\"Jinhua Yu\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0ElEQVRIiWNgGAWjYHCChAOMDQwM/EAGiAdiE6lFsoEELRBlBgcQbPzA4EbCw8OFOw7LG99ueLqZh8FGdsMB5mcPCGhJODzzzGHDbXcOpN3mYUgz3nCAzdyAoBbetsOM224kgLQcTtxwgIdNghgt9ptngLX8J15L4gYJsJYDhLVInnkA0pKePAPosJtzDJKNZx5mM8Orhe94TvJn3jZr2/4ZOWk33lTYyfYdb36GV4vCAZ4EKBPEAAUVMz71QCDfwH4AyoQzRsEoGAWjYBSgAgAKL1VYlDy4XgAAAABJRU5ErkJggg==\",\"orcid\":\"https://orcid.org/0000-0003-4874-9910\",\"institution\":\"Nanjing Medical University\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jinhua\",\"middleName\":\"\",\"lastName\":\"Yu\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2021-03-02 22:57:28\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-291517/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-291517/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":6984767,\"identity\":\"45021676-a676-4c4b-ae15-e89d7c982e4e\",\"added_by\":\"auto\",\"created_at\":\"2021-03-15 20:45:08\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":656993,\"visible\":true,\"origin\":\"\",\"legend\":\"Identification of DPSCs\\n(A) Morphology of primary DPSCs after 1 weeks of culture; (B) hDPSCs at passage 3 were grown in culture medium with a long spindle shape; (C) Immunofluorescence staining of STRO-1 of DPSCs; (D) Immunophenotype analysis of DPSCs was determined by flow cytometry assay; (E) Colonies derived from single cell were observed and photographed under the microscope; (F) Adipocyte staining by Oil Red O upon adipogenic induction for 4 weeks; (G) Mineral deposits stained by Alizarin Red S in DPSCs following osteogenic differentiation for 2 weeks; (H) Chondrogenic staining by Alcian blue after cells were induced to differentiate into chondrogenic lineages for 28 days. \\n\",\"description\":\"\",\"filename\":\"OnlineFigure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-291517/v1/955dd24b3892e1a39a79073d.png\"},{\"id\":6984770,\"identity\":\"ada4fe02-8fb4-4e0f-a34f-826b108b0b00\",\"added_by\":\"auto\",\"created_at\":\"2021-03-15 20:45:09\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":121223,\"visible\":true,\"origin\":\"\",\"legend\":\"Screening for the optimal IL-37 concentration and effect of IL-37 on the proliferation of DPSCs\\n(A) The effect of different concentrations of IL-37 on the ALP activity in DPSCs; (B)The effect of different concentrations of IL-37 on the mRNA expression level of ALP in DPSCs; (C) The effect of different concentrations of IL-37 on the protein expression level of ALP in DPSCs; (D) Relative quantitative analysis of western blot analyses for ALP; (E) Cell viability was determined by EdU staining; (F) Relative quantitative analysis of EdU staining; (G) CCK-8 analysis showing that IL-37 has no significant effect on DPSC proliferation. \\n\",\"description\":\"\",\"filename\":\"OnlineFigure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-291517/v1/40559e34aea526be13232327.png\"},{\"id\":6985094,\"identity\":\"2efc2235-2240-470c-a03a-639b8b4b2fac\",\"added_by\":\"auto\",\"created_at\":\"2021-03-15 20:48:08\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":323652,\"visible\":true,\"origin\":\"\",\"legend\":\"IL-37 enhances the osteo/odontogenic differentiation capacity of hDPSCs\\n(A) Western blot analyses of osteo/odontogenic proteins including DSPP, RUNX2, ALP, and OSX; (B) Relative quantitative analysis of western blot (DSPP, RUNX2, ALP, and OSX); (C) Relative mRNA expression of osteo/odontogenic genes (DSPP, RUNX2, ALP, and OSX) on day 0, 3, and 7; (D) Results of ALP staining on day 5; (E) Relative ALP activity on day 5; (F) Results of ARS on day 14; (G) Relative quantitative analysis of the ARS; (H) Immunofluorescence detection indicated that IL-37 increased the protein expression of DSPP; (I) Immunofluorescence detection indicated that IL-37 increased the protein expression of RUNX2.\\n\",\"description\":\"\",\"filename\":\"OnlineFigure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-291517/v1/678b05fdae6324865bae8b7f.png\"},{\"id\":6984771,\"identity\":\"002d316c-1c5a-4524-946b-eb38db0cdf06\",\"added_by\":\"auto\",\"created_at\":\"2021-03-15 20:45:09\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":193703,\"visible\":true,\"origin\":\"\",\"legend\":\"IL-37 activated autophagy of DPSCs\\n(A) Western blot was conducted to detect the autophagy-related markers (LC3, Beclin1, and p62); (B) Quantification was done by ImageJ. p\\u003c0.05, **p \\u003c 0.001; (C) The images of LC3 (red) and DAPI (blue) in DPSCs by immunofluorescence staining. Scale bar = 50 μm; (D) Transmission electron microscopy analysis of autophagosomes in IL-37 group and control group. Autophagosomes are indicated by black arrows. \\n\",\"description\":\"\",\"filename\":\"OnlineFigure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-291517/v1/a92424d5272faa44acde78e5.png\"},{\"id\":6985545,\"identity\":\"c26032b2-a2f3-4f74-9e7f-2b89236615a1\",\"added_by\":\"auto\",\"created_at\":\"2021-03-15 20:51:09\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":276996,\"visible\":true,\"origin\":\"\",\"legend\":\"3-MA reverses IL-37-induced autophagy enhanced osteogenic and odontogenic effects in DPSCs\\n(A) Western blot analysis of LC3, Beclin1 and p62 in DPSCs treated with or without 3-MA; (B) The ratio of LC3-II/LC3-I and quantification of P62, Beclin1 were done by Image J. * p\\u003c 0.05, **p\\u003c 0.01 C. (C) Western blot analysis of osteogenic and odontogenic markers in DPSCs; (D) Relative quantitative analysis of western blot analyses for DSPP, RUNX2, ALP, and OSX; (E) Relative mRNA expression of osteo/odontogenic genes (DSPP, RUNX2, ALP, and OSX); (F) Results of ALP staining on day 5; (G) Relative ALP activity on day 5; (H) Results of ARS on day 14; (I) Relative quantitative analysis of the ARS; (J) Immunofluorescence detection indicated that 3-MA decreased the protein expression of DSPP; (K) Immunofluorescence detection indicated that 3-MA decreased the protein expression of RUNX2.\\n\",\"description\":\"\",\"filename\":\"OnlineFigure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-291517/v1/35a436835556631457a2075b.png\"},{\"id\":6985095,\"identity\":\"ac85e8c8-1c6b-47ea-b3b2-0164231bdf15\",\"added_by\":\"auto\",\"created_at\":\"2021-03-15 20:48:08\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":271084,\"visible\":true,\"origin\":\"\",\"legend\":\"The effects of autophagy activator rapamycin on osteo/odontoblastic differentiation of IL-37-induced DPSCs\\n(A) Western blot analysis of LC3, Beclin1 and p62 in DPSCs treated with or without rapamycin; (B) The ratio of LC3-II/LC3-I and quantification of P62, Beclin1 were analyzed by Image J. * p\\u003c 0.05, **p\\u003c 0.01; (C) Western blot analysis of osteogenic and odontogenic markers in DPSCs; (D) Relative quantitative analysis of western blot analyses for DSPP, RUNX2, ALP, and OSX; (E) Relative mRNA expression of osteo/odontogenic genes (DSPP, RUNX2, ALP, and OSX); (F) Results of ALP staining on day 5; (G) Relative ALP activity on day 5; (H) Results of ARS on day 14; (I) The quantity result for ARS staining; (J) Immunofluorescence detection indicated that rapamycin increased the protein expression of DSPP; (K) Immunofluorescence detection indicated that rapamycin increased the protein expression of RUNX2.\\n\",\"description\":\"\",\"filename\":\"OnlineFigure6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-291517/v1/3f0e3e6eff9b37a5a1b1cd10.png\"},{\"id\":13679293,\"identity\":\"b5633708-6cee-4d2f-bedd-320f158e7c8c\",\"added_by\":\"auto\",\"created_at\":\"2021-09-17 11:43:09\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":4117691,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-291517/v1/4b46f8b6-128c-44f4-86c4-8f0dec72b0d3.pdf\"}],\"financialInterests\":\"\",\"formattedTitle\":\"\\u003cp\\u003eExtracellular IL-37 Enhances Osteogenic and Odontogenic Differentiation of Human Dental Pulp Stem Cells via Autophagy Pathway\\u003c/p\\u003e\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\" \\u003cp\\u003eDental pulp is the soft tissue inside tooth, which plays an indispensable role in the homeostasis of vital teeth [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. The function of dental pulp is to support dentin formation and regeneration [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. A range of injuries or diseases including caries, pulpitis, periapical periodontitis, tooth trauma, etc. can result in pulp necrosis, further teeth losing [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. For therapeutic strategies for the kind of teeth above, vital pulp therapy (VPT) and regenerative endodontic treatment (RET) attracted recent attention to remain functional of teeth. The aims of VPT are to preserve and save dental pulp vitality, to induce dental pulp stem cells (DPSCs) to differentiate into osteoblasts and odontoblasts and ultimately form the hard tissue such as the tertiary dentin. RET known as revascularization aims to promote normal physiological development in teeth with necrotic pulp and act as a substitute for injured dental structures. DPSCs have been regarded as an important candidate for such treatment. Their capability of differentiation into odontogenic and osteogenic stem cells associated with biomaterials and growth factors is critical for dental pulp regeneration [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. Mesenchymal stem cells (MSCs) have a significant role in pulp regeneration therapy for the reconstruction of tissues. Due to the easily available source of dental tissues, dental stem cells are considered good candidates for tissue engineering applications.\\u003c/p\\u003e \\u003cp\\u003eHuman MSCs are a serviceable therapeutic tool for tissue engineering. DPSCs are identified as a type of MSCs that were originally isolated from human dental pulp tissue [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. DPSCs have a lot of merits of easy access with the least invasive procedures and without any ethical controversy, and retain capacities of clonogenic formation, high proliferation, excellent regeneration, multilineage differentiation potential, and little inherent immunogenicity. As has been widely acknowledged, DPSCs can be induced to differentiate into a good many of directions, including osteogenic, dentinogenic, adipogenic, chondrogenic, myogenic, and neurogenic differentiation [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. Compared with other MSCs from tissues as follows: bone marrow [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e], peripheral blood [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e], adipose tissue [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e], and umbilical cord blood [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e], DPSCs demonstrate higher clonogenic and proliferative potential. Therefore, DPSCs become an engaging tool cell source for tissue engineering and regenerative medicine.\\u003c/p\\u003e \\u003cp\\u003eDuring the developmental process of MSCs, extracellular cues tend to exert its function in determining the fate of MSCs. Previous studies have revealed that in chronic inflammatory bone diseases, bone regeneration can be inhibited, and the osteogenic differentiation of DPSCs can be influenced by inflammatory microenvironments [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. Interleukin 1 family member 7 (IL-1F7), a novel anti-inflammatory cytokine was recently proposed to be renamed Interleukin-37 (IL-37) [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. IL-37 functions as a natural inhibitor of inflammatory and immune responses [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. IL-37 is an anti-inflammatory factor that affects other pro-inflammatory signals, such as those mediated by tumor necrosis factor α (TNF-α), IL-1β, and IL-18 [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. It was reported that IL-37 can promoted BMMSCs to differentiate into osteogenic lineage cells \\u003cem\\u003ein vitro\\u003c/em\\u003e [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. Recent studies have shown that abnormal expression of IL-37 in several autoimmune orthopedic diseases, such as ankylosing spondylitis and rheumatoid arthritis [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. Most recently, studies demonstrated a connection between IL-37 and several bone metabolism-related inflammatory cytokines and reported that recombinant IL-37 (rhIL-37) inhibited the expression of pro-inflammatory cytokines, such as IL-6, TNF-α, IL-17, and IL-23 in patients with ankylosing spondylitis [\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. The new study has indicated that IL-37 suppresses osteoclast formation and bone resorption \\u003cem\\u003ein vivo\\u003c/em\\u003e [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eA better understanding of the molecular mechanisms that govern odontogenesis and osteogenesis might provide us with new perspectives on treatment of many oral diseases. Recent reports have provided evidence that macromolecular degradation in stem cells in a process of differentiation occurs through autophagy [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Autophagy or \\u0026ldquo;self-eating\\u0026rdquo;, is a conservative cellular degradation pathway that recycles cellular content [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. Upon activation of autophagy, degradation of intracellular protein and organelles via a process that involves the delivery of cytoplasmic cargo to lysosomes and release of metabolites required for anabolic processes, such as cell growth, proliferation and differentiation [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. When cells are subjected to external stress, such as nutrition deficiency, oxidative stress, hypoxia, tumor formation, aging or infection, autophagy plays an important role as a cell survival mechanism [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Recent studies have indicated that autophagy is an essential part in the functioning and maintenance of stem cells, acting to maintain their stemness, regulate their self-renewal, and mediate their differentiation capacity [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e] [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. In addition, accumulating evidence has demonstrated that autophagy is also involved in osteogenesis and bone development [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. Autophagy is also an essential process that maintains mineralizing capacity, and balance the population of osteoblasts and osteoclasts [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. The members in our team have demonstrated that autophagy is involved in the odontogenic and osteogenic differentiation in stem cells of apical papilla and rBMMSCs [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eWe hypothesis that autophagy might be involved in IL-37-mediated DPSCs osteogenic and odontogenic differentiation. Therefore, the aim of the present study was to verify whether IL-37 is able to promote the osteogenic and odontogenic differentiation of DPSCs and whether autophagy was involved in the regulation of osteo/odontogenic differentiation of DPSCs \\u003cem\\u003ein vitro.\\u003c/em\\u003e\\u003c/p\\u003e \"},{\"header\":\"2. Materials And Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.1. Isolation and Cell culture\\u003c/h2\\u003e\\u003cp\\u003eFresh extracted third molars were collected from patients (age:17\\u0026ndash;23 years old) with the patient's consent. Tooth was cleaned with PBS (Gibco, USA). The pulp tissue was minced into smaller fragments and then immersed into a solution (3 mg/mL collagenase type I (Sigma, USA) and 4 mg/mL dispase (Gibco, USA)) for 1 h. Cell suspensions were seeded into culture dishes containing complete medium.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.2. Cell phenotype analysis\\u003c/h2\\u003e\\u003cdiv id=\\\"Sec5\\\" class=\\\"Section3\\\"\\u003e\\u003ch2\\u003e2.2.1. Immunofluorescence staining\\u003c/h2\\u003e\\u003cp\\u003eSingle cell suspensions were seeded on top of coverslips. After removing the medium, cells were fixed and washed. Briefly, after permeabilization with Triton X-100 for 12 min, cells were blocked with BSA (Boster, China) overnight, and then incubated with primary antibodies (anti-STRO-1, 1:100) overnight at 4℃. Cells were incubated with Cy3-conjugated secondary antibodies (Abcolonal, China). Following counterstained with DAPI, cells were photographed using a fluorescence microscope (Leica, Germany).\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec6\\\" class=\\\"Section3\\\"\\u003e\\u003ch2\\u003e2.2.2 Flow cytometric analysis\\u003c/h2\\u003e\\u003cp\\u003eCells were contained the following monoclonal antibodies for 1 h on ice: CD90/FITC, CD105/PerCP-Cy5.5, CD34/PE, CD45/PE, and CD73/PE (1:100, BD Biosciences, USA). Cell were washed and resuspended for analysis using a FACScan. The data were analyzed on the software (FlowJo, USA).\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec7\\\" class=\\\"Section3\\\"\\u003e\\u003ch2\\u003e2.2.3. Colony-forming assay\\u003c/h2\\u003e\\u003cp\\u003eAfter cultured for 10 days later, cells were stained with toluidine blue (Beyotime, China). Photographs were taken under the microscope (Leica, Germany).\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec8\\\" class=\\\"Section3\\\"\\u003e\\u003ch2\\u003e2.2.4. Multiple lineage differentiation\\u003c/h2\\u003e\\u003cp\\u003eCells were cultured in osteoinductive medium (OM) of 50 mg/ml ascorbic acid, 10 mM sodium β-glycerophosphate, 10 nM dexamethasone (Sigma, USA). After 2 weeks, cells were stained with Alizarin Red S (Sigma, USA) to detect mineral deposits.\\u003c/p\\u003e\\u003cp\\u003eCells were incubated in adipogenic medium (Cyagen Biosciences Inc, USA) for 4 weeks. Then, cells were stained with Oil Red O reagent of the kit to reveal lipid droplets.\\u003c/p\\u003e\\u003cp\\u003eCell pellets were prepared for a three-dimensional culture system. Cells were cultured in chondrogenic differentiation medium (Cyagen Biosciences Inc, USA) for 28 days. Alcian blue staining was utilized to examine the cartilage nodules.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.3 ALP activity assay\\u003c/h2\\u003e\\u003cp\\u003eCells were incubated with different concentrations of IL-37 (0, 0.1, 1, 10, and 100 ng/mL) for 5 days. ALP activity of DPSCs was detected according to manufacturer\\u0026rsquo;s instruction.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.4 ALP staining\\u003c/h2\\u003e\\u003cp\\u003eCells were seeded on 12-well plates and incubated with different cultured medium in different groups for 5 days. ALP staining was performed using an ALP staining kit (Beyotime Biotechnology, China) according to the manufacturer's instruction.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.5 Alizarin red staining\\u003c/h2\\u003e\\u003cp\\u003eDPSCs were cultured in OM for 14 days in the presence or absence of IL-37. The formation of mineralized nodules of DPSCs was evaluated by alizarin red S staining. For quantitative analysis, 10% cetylpyridinium chloride (CPC) was added and the absorbance was measured at 562 nm.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.6 CCK-8\\u003c/h2\\u003e\\u003cp\\u003eTo assess the effect of IL-37 on the proliferation of DPSCs, cells were incubated with different groups concentrations of IL-37 (0, 1 ng/mL) for 0, 1, 3, 5, or 7 days. Then, the cells were incubated in the mixture (CCK-8: α-MEM\\u0026thinsp;=\\u0026thinsp;1:9) for 2 h.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.7 EdU assay\\u003c/h2\\u003e\\u003cp\\u003eCell proliferation ratio was measured using EdU Cell Proliferation Assay Kit according to the protocol of manufacturer.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.8 RNA extraction and PCR analysis\\u003c/h2\\u003e\\u003cp\\u003eTotal RNA was isolated and reversed to cDNA by the RT Reagent Kit (Vazyme, China). Real-time qPCR reactions were carried out SYBR Green Mix (Vazyme, China). The gene specific primers are listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003ePrimer sequences for real-time quantitative PCR analysis of gene expression\\u003c/em\\u003e.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"1\\\"\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eTarget gene Sequences (5\\u0026prime;\\u0026thinsp;\\u0026minus;\\u0026thinsp;3\\u0026prime;) Product size (bp) GenBank accession number\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eRUNX2\\u003c/em\\u003e Forward, TCTTAGAACAAATTCTGCCCTTT 136 NM_001024630.3\\u003c/p\\u003e\\u003cp\\u003eReverse, TGCTTTGGTCTTGAAATCACA\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eOSX\\u003c/em\\u003e Forward, CCTCCTCAGCTCACCTTCTC 148 NM_001173467.1\\u003c/p\\u003e\\u003cp\\u003eReverse, GTTGGGAGCCCAAATAGAAA\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eALP\\u003c/em\\u003e Forward, GACCTCCTCGGAAGACACTC 137 NM_000478.4\\u003c/p\\u003e\\u003cp\\u003eReverse, TGAAGGGCTTCTTGTCTGTG\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eDSPP\\u003c/em\\u003e Forward, ATATTGAGGGCTGGAATGGGGA 136 NM_014208.3\\u003c/p\\u003e\\u003cp\\u003eReverse, TTTGTGGCTCCAGCATTGTCA\\u003c/p\\u003e\\u003cp\\u003e\\u003cem\\u003eGAPDH\\u003c/em\\u003e Forward, GAAGGTGAAGGTCGGAGTC\\u003c/p\\u003e\\u003cp\\u003eReverse, GAGATGGTGATGGGATTTC 225 NM_002046.3\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.9 Western Blot Analysis\\u003c/h2\\u003e\\u003cp\\u003eCells were lysed in lysis buffer radioimmunoprecipitation assay (RIPA: PMSF\\u0026thinsp;=\\u0026thinsp;100:1). Western blot was conducted according to previous studies [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e].\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.10 TEM\\u003c/h2\\u003e\\u003cp\\u003eCells were collected after treated with or without 1 ng/mL IL-37 for 12 h. After fixation, dehydration, embedding, sectioning and staining, samples were viewed with a Hitachi Model H-7500 TEM (Hitachi, Japan).\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003e2.11 Immunofluorescence staining\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"Ethics-ToolTip\\\"\\u003eAfter cell attachment, the culture solid was replaced by complete medium and IL-37 (1 ng/mL) for 12 h. Cells were stained with primary antibody including DSPP, RUNX2, ALP, LC3 (1:100) according to the steps above.\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003e2.12 Statistical analysis\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eData are shown as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM and were tested for statistical significance using ANOVA.\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\" \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.1 Characterization of SCAPs and screening for the optimal IL-37 concentration\\u003c/h2\\u003e \\u003cp\\u003eDPSCs were isolated and displayed a typical cobblestone-like morphology. Primary DPSCs were observed as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA. PDSCs in passage 3 were typical fibroblast-like or spindle-like in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB. Immunofluorescence staining indicated that isolated DPSCs were positive for the established MSCs-specific surface marker STRO-1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). Flow cytometry analysis showed a pronounced expression of mesenchymal stem cell markers including CD73, CD90, and CD105, while they also showed the negativity for hematopoietic cell marker CD34 and leucocyte maker CD45. Cell surface markers: CD34 (0.07%); CD45 (0.30%); CD73 (99.6%); CD90 (93.3%); CD105 (87.5%) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD). The result of colony-forming assay showed that DPSCs could form single cell colonies. A single colony stained with crystal violet was observed under the microscope (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eE). Furthermore, results of oil red O staining, alizarin red S (ARS) staining and Alcian blue staining showed that DPSCs could differentiate into adipocytes, osteoblasts, and chondrocyte (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eF, G, H).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.2 Effect of IL-37 on the proliferation of DPSCs\\u003c/h2\\u003e \\u003cp\\u003eAt day 5, ALP activity assay showed that ALP activity was the highest in the 1 ng/mL IL-37 group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA; \\u003cem\\u003eP\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01\\u003c/em\\u003e). As compared with other groups, the 1 ng/mL IL-37 group also presented the highest ALP protein and gene expression after being induced for 5 days (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB, C, D; \\u003cem\\u003eP\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01\\u003c/em\\u003e). Therefore, 1ng/mL IL-37 was selected to be the optimal concentration for our further study. To evaluate the impact of IL-37 on the proliferation of DPSCs, CCK-8 analysis and EdU assay were performed. As indicated by the results of EdU assay (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE, F; \\u003cem\\u003ep\\u0026thinsp;\\u0026gt;\\u0026thinsp;0.05\\u003c/em\\u003e), and CCK-8 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eG; \\u003cem\\u003ep\\u0026thinsp;\\u0026gt;\\u0026thinsp;0.05\\u003c/em\\u003e), 1ng/mL IL-37 exerted almost no significant effect on the proliferation of SCAPs as compared with the control group.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.3 IL-37 induced the osteo/odontogenic differentiation of SCAPs\\u003c/h2\\u003e \\u003cp\\u003eTo analyze the influence of IL-37 on the osteo/odontogenic differentiation and mineralization of DPSCs, cells were treated with 1 ng/mL IL-37. The protein expression of osteogenic and odontogenic markers in hDPSCs were examined cultured with or without 1 ng/mL IL-37 for 0, 3 and 7 days. Cells cultured with 1 ng/mL IL-37 expressed markedly higher levels of DSPP, RUNX2, ALP and OSX than those control groups for 3, 7 days, while, there is no difference between control group and IL-37 group for 0 day (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA and B). Consistently, qRT-PCR showed that the osteogenic and odontogenic markers \\u003cem\\u003eDSPP, RUNX2, ALP and OSX\\u003c/em\\u003e were also increased in the IL-37 treatment groups for 3, 7 days (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC; \\u003cem\\u003ep\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 or 0.01\\u003c/em\\u003e). To further confirm whether IL-37 mediate osteogenic and odontogenic differentiation of DPSCs, cells were then cultured in OM with and without IL-37. Compared with control group, ALP staining revealed that ALP activity was significantly higher with administration of 1 ng/mL IL-37 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). ALP activity assay confirmed the results of staining (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eE, p\\u0026thinsp;\\u003cem\\u003e\\u0026lt;\\u0026thinsp;0.01\\u003c/em\\u003e). A similar trend in Alizarin Red S staining was detected after induction for 14 days. DPSCs treated with 1 ng/mL IL-37 and IL-37\\u0026thinsp;+\\u0026thinsp;MM presented more mineralized nodules than control group or MM group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eF). CPC assay revealed that extracellular calcium deposition was significantly increased in IL-37 group at day 14 as compared with the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eG; \\u003cem\\u003ep\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01\\u003c/em\\u003e). In addition, immunofluorescence assay showed that the osteoblastic and odontoblastic markers DSPP and RUNX2 were upregulated in 1 ng/mL IL-37-treated group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eH, I). Above all, these results indicated that 1 ng/mL IL-37 enhanced the osteo/odontogenic differentiation of DPSCs.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.4 1 ng/mL IL-37 triggered autophagy of DPSCs\\u003c/h2\\u003e \\u003cp\\u003eTo explored the mechanism of IL-37-enhanced odontoblastic and osteoblastic differentiation potential of DPSCs, western blot was conducted. DPSCs were treated with 1 ng/mL IL-37. Exposure of DPSCs to complete medium containing 1 ng/mL IL-37 resulted in elevated protein expression of autophagy‐related protein Beclin1 and the expression ratio of LC3-II/I in a time‐dependent manner while the expression of p62 was decreased (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC, D). The images of immunostaining with LC3 showed that endogenous LC3 dot form in IL-37‐treated DPSCs was significantly higher than control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eE). Meanwhile, to further confirm the induction of autophagy in IL-37‐treated DPSCs, the formation of autophagosomes was observed by means of TEM. The photos of TEM showed more autophagosomes in 1 ng/mL IL-37‐treated DPSCs group at 7 days than those in the control group (Figure F). These observations strongly suggested IL-37 activated autophagy in IL-37-treated DPSCs.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec22\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.5 The autophagy inhibitor 3-MA suppresses IL-37-mediated enhancement osteoblastic and odontoblastic differentiation of DPSCs\\u003c/h2\\u003e \\u003cp\\u003eTo further validate our findings, autophagy was inhibited with specific inhibitor 3-MA, respectively. Western blot analysis indicated that the ratio of LC3-II to LC3-I, Beclin1 expression levels in IL-37\\u0026thinsp;+\\u0026thinsp;3-MA group were significantly lower than the IL-37 group, while 3-MA significantly up-regulated P62 protein levels, suggesting that autophagy was suppressed when autophagy inhibitor3-MA treatment was applied (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA, B). The result indicated that 3-MA showed obviously autophagy inhibition. RT-PCR and western blot were conducted to investigate the effects of IL-37 on osteoblastic and odontoblastic differentiation of DPSCs following autophagy inhibitor treatment. Western blot analysis showed that the inhibitor 3-MA dramatically suppressed IL-37‐mediated enhancement of DSPP, RUNX2, ALP and OSX expression in DPSCs at protein levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC, D). Similarly, the inhibitor 3-MA suppressed IL-37‐enhanced the expression of \\u003cem\\u003eDSPP\\u003c/em\\u003e, \\u003cem\\u003eOCN\\u003c/em\\u003e, \\u003cem\\u003eRUNX2\\u003c/em\\u003e and \\u003cem\\u003eOSX\\u003c/em\\u003e in DPSCs at gene level (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eE). To investigate the role of autophagy in IL-37-induced mineralization, ALP staining, ALP activity assay, ARS staining and CPC assay were performed. The results of ALP staining and ALP assay showed that ALP activity of IL-37-treated DPSCs was inhibited with the addition of autophagy inhibitor 3-MA on day 5 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eF, G). After induction for 2 weeks, the amount of minerals was significantly decreased in the presence of autophagy inhibitor 3-MA compared with IL-37 treatment alone (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eH, I). As shown by immunostaining analysis, the expression of DSPP and RUNX2 increased remarkably in IL-37-treated DPSCs compared with IL-37\\u0026thinsp;+\\u0026thinsp;3-MA (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eJ, K). These results indicated that IL-37‐enhanced osteoblastic and odontoblastic differentiation of DPSCs were repressed by autophagy inhibition.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec23\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.6. \\u003cb\\u003eUpregulation of autophagy by rapamycin further promoted odontogenic and osteogenic differentiation of DPSCs\\u003c/b\\u003e\\u003c/h2\\u003e \\u003cp\\u003eTo further examine the effect of autophagy on osteogenic and odontogenic differentiation of DPSCs, cells were cultured in medium in the presence of rapamycin. The result also indicated that rapamycin treatment significantly up-regulated Beclin1 protein levels, increased the ratio of LC3-II to LC3-I and down-regulated P62 protein level compared with the IL-37 group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA, B). Besides, hDPSCs exposed to rapamycin significantly increased autophagy activity. Western blot analysis and qRT-PCR were conducted to detect the inducer of autophagy rapamycin on the osteogenic and odontogenic differentiation of DPSCs at the RNA and protein levels. The results of western blot showed that the expression of osteogenic and odontogenic markers DSPP, RUNX2, ALP and OSX were all up-regulated in IL-37\\u0026thinsp;+\\u0026thinsp;rapamycin group comparing with IL-37 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eC, D). PCR assay for mRNA expression of odontogenesis/osteogenesis-related molecules showed that autophagy activation by rapamycin enhanced IL-37-induces differentiation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eE). ALP staining and ALP activity assay showed that rapamycin upregulated ALP activity compared with IL-37 groups (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eF, G). ARS staining indicated that the number of mineralized nodules was observed more in the rapamycin group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eH). CPC assay showed that the group treated with IL-37\\u0026thinsp;+\\u0026thinsp;rapamycin presented higher calcium contents as compared with IL-37 group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eI). Besides, immunofluorescence assay showed that osteogenic and odontogenic markers DSPP, RUNX2 were upregulated in IL-37\\u0026thinsp;+\\u0026thinsp;rapamycin-treated group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eJ, K). All these data indicated that autophagy plays a catalytic role in IL-37-induced osteogenic and odontogenetic differentiation of hDPSCs.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eOsteogenic differentiation and odontogenic differentiation are crucial characteristics of the oral stem cells pluripotency. They play key roles in the maintenance, tissue regeneration and engineering. In this study, we demonstrated that IL-37 and the related target autophagy pathway play an important role in the osteo/odontogenic differentiation of DPSCs. DPSCs consist of heterogeneous multipotent cell populations, which have the potential to differentiate into osteoblasts and odontoblasts. Osteogenic and odontogenic differentiation result in the expression of related genes and proteins such as DSPP, RUNX2, ALP, OSX. This study emphasized a novel and promising role of IL-37 in regulating the odontogenic and osteogenic differentiation of DPSCs.\\u003c/p\\u003e \\u003cp\\u003eIL-37 is recently identified as an anti-inflammatory cytokine [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. A Chinese study reported that patients carrying a mutation in the coding region of IL-37 have lower disease activity scores and less pain, which indicated significant function for the anti-inflammatory effects of IL- 37[\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. Previous studies demonstrated that cytokines were associated with autophagy. For example, in addition to controlling the migration of macrophages into degenerative tissues, IL-33, one of cytokines, also regulated autophagy in these tissues [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. The level of IL-37 is normally low, but this significantly increases under severe inflammatory conditions. It has been previously found that IL-37 plays an important regulatory role in the development of several inflammatory and autoimmune diseases [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]. Recent studies investigated that IL-37 mediates a variety of anti-cancer effects in multiple types of cancer [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e]. Recently, it was reported that IL-37 promoted the osteogenic differentiation of BMSCs [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. In this study, we found that extracellular IL-37 accelerated the osteogenic and odontogenic differentiation of DPSCs via autophagy when at 1 ng/mL, while there is no significant effect on the proliferation.\\u003c/p\\u003e \\u003cp\\u003eThe autophagy pathway is normally inhibited by 3-MA and activated by rapamycin [\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]. Autophagy is a major intracellular mechanism to protect cells from stress stimulation and maintain the properties of stem cells [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]. Autophagy plays an important role in the osteogenic and odontogenic differentiation of hDPSCs under specific condition [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. During cellular differentiation, autophagy occurs in order to meet metabolic needs associated with morphological and functional changes. Several proteins, including LC3, p62, and Beclin1 have been involved in autophagy and are used as markers for the activation of the process. LC3 is the most widely used autophagic marker. LC3 is usually produced by ubiquitin, the residues of which are exposed on the vesicular membrane surface after ATG4 homolog catalysis, and forms LC3-I in the cytoplasm [\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]. LC3‐I can specifically bind phosphatidylethanolamine on the vesicle membrane surface and eventually forms LC3‐II, which is an integral membrane protein present in autophagosomes [\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]. Accumulation of LC3 II is thus used as a marker for activation of autophagy, which can directly reveal autophagy. Beclin‐1 is an autophagy-initiated protein. P62 possesses LC3‐interacting region and serves as a signaling hub of autophagy. P62 is degraded through the process of autophagy, therefore the degradation of P62 expression level can serve as a marker of autophagic clearance [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. The increases of Beclin1, an autophagy initiation protein, is also accompanied by activation of the process. In this study, IL-37 promoted LC3 I/II conversion, increased the protein levels of Beclin1 and decreased the protein expression of P62.\\u003c/p\\u003e \\u003cp\\u003eALP has a vital function during mineralization of osteoblasts and odontoblast, and its activity is upregulated at an early stage of calcification [\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]. In this study, 1 ng/ml was the optimal concentration of IL-37 to promote differentiation of DPSCs by detecting the ALP activity at day 5, as well as the mRNA level and protein level of ALP at day 5. Our results showed that the expression levels of osteogenic and odontogenic markers, including DSPP, RUNX2, ALP, and OSX were upregulated at 3, 7 days of differentiation, indicating that 1 ng/mL IL-37 can enhance the osteo/odontogenic differentiation of DPSCs. The autophagy pathway was shown to positively regulate differentiation of MSCs. We proceeded to investigate whether autophagy was activated by IL-37, the key proteins in autophagy signaling were evaluated. Consistent with pathway analysis, the protein expressions of Beclin 1, the ratio of LC3 II/I were significantly increased while the expression of P62 was reduced, when DPSCs were treated with IL-37 for 6, 12, 24 h. To further confirm whether autophagy signaling was implicated in the process of IL-37 enhanced osteogenic and odontogenic differentiation of DPSCs, we evaluated the expression of related markers above with or without autophagy inhibitor 3-MA. While 3-MA was used, we found that all the markers of osteogenesis and odontogenesis were dramatically reduced. These \\u003cem\\u003ein vitro\\u003c/em\\u003e results demonstrated that autophagy is an important mechanism in IL-37 enhanced osteo/odontogenic differentiation of hDPSCs. Rapamycin, as autophagy activator was used to further detect the relationship between autophagy and osteo/odontogenic differentiation of IL-37 treated DPSCs. Osteogenic and odontogenic differentiation of IL-37 enhanced DPSCs further increased with rapamycin treatment.\\u003c/p\\u003e \\u003cp\\u003eIn summary, the present study revealed that IL-37 could induce osteogenic and odontogenic differentiation in DPSCs, which involved the upregulation of autophagy. The results expanded our knowledge on the role of IL-37 in osteogenesis and odontogenesis of DPSCs, and also suggested that IL-37 may be a potential drug for pulp treatment in the future and provided insight into the molecular mechanism of vital pulp therapy. Also, kinetic \\u003cem\\u003ein vivo\\u003c/em\\u003e measurements should be carried out in future studies.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eOverall, IL--37 enhances differentiation of DPSCs into odontoblasts and osteoblasts via autophagy signaling pathways.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cp\\u003e3-MA 3-methyladenine; ALP: alkaline phosphatase; ARS: alizarin red staining; \\u0026alpha;-MEM: alpha modified eagle\\u0026rsquo;s medium; BMMSCs: bone marrow mesenchymal stem cells; BSA: bovine serum albumin; CCK-8: cell counting kit -8 assays; DAPI 4-6-diamidino-2-phenylindole; DPSCs: dental pulp stem cells; DSPP dentin sialophosphoprotein; FBS fetal bovine serum; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; IL-37 Interleukin-37; LC3 microtubule-associated protein 1 light chain 3; MTOR mechanistic target of rapamycin; OSX: osterix; PBS: phosphate buffered saline; real time RT-PCR: real time reverse-transcription polymerase chain reaction; RIPA: radio immunoprecipitation assay; RUNX2: runt-related transcription 2.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements \\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no conflicts of interest.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors Contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNa Li conceived and designed the study, collected and assembled data, and wrote the manuscript. Yan Chen and Ming Yan performed the data analysis and interpretation. Yanqiu Wang, Jintao Wu completed data analysis and interpretation. Lin Fu reviewed the data. Jinhua Yu conceived and designed the study, provided financial support and study material, performed the data analysis and interpretation, and approved the final version of the manuscript. All authors read and approved the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by the National Natural Science Foundation of China (grant numbers: 81873707 and 81900962), Medical Talent Project of Jiangsu Province (grant number: ZDRCA2016086), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD, grant number: 2018-87), and Science and Technology Development Project of Jiangsu Province (grant number: BE2017731).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials \\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets used and analyzed during the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate \\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eStudies were carried out in accordance with the Declaration of Helsinki and got the approval of the Ethical Committee of Nanjing Medical University.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication \\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eJingwen Yang Y Z, Chunyan Wan, Zheyi Sun, Shuai Nie, Shujuan Jian, Lu Zhang, Guang-tai Song, Zhi Chen. Autophagy in SDF-1a-mediated DPSC migration and pulp regeneration. \\u003cem\\u003eBiomaterials.\\u003c/em\\u003e 2015;44:11-23.\\u003c/li\\u003e\\n\\u003cli\\u003eJingyuan Li C P, Yang Chai. Cellular and molecular mechanisms of tooth root development \\u003cem\\u003eDevelopment.\\u003c/em\\u003e 2017;144:374-384.\\u003c/li\\u003e\\n\\u003cli\\u003eJing Zou M M, Clarice S Law, Yale Rao, Xuedong Zhou Common dental diseases in children and malocclusion. \\u003cem\\u003eInternational Journal of Oral Science.\\u003c/em\\u003e 2018;13:7.\\u003c/li\\u003e\\n\\u003cli\\u003eKun Xuan B L, Hao Guo, Wei Sun, Xiaoxing Kou, Xiaoning He, Yongjie Zhang, Jin Sun, Anqi Liu, Li Liao, Shiyu Liu, Wenjia Liu, Chenghu Hu, Songtao Shi, Yan Jin. Deciduous autologous tooth stem cells regenerate dental pulp after implantation into injured teeth. \\u003cem\\u003eScience Translational Medicine.\\u003c/em\\u003e 2018;10:eaaf3227.\\u003c/li\\u003e\\n\\u003cli\\u003eJoanna Metlerska I F, Alicja Nowicka. Efficacy of Autologous Platelet Concentrates in Regenerative Endodontic Treatment: A Systematic Review of Human Studies. \\u003cem\\u003eJournal of Endodontics \\u003c/em\\u003e2019;45:20-30.\\u003c/li\\u003e\\n\\u003cli\\u003eWenkai Jiang D W, Amr Alraies, Qian Liu, Bangfu Zhu, Alastair J. Sloan, Longxing Ni, and Bing Song. Wnt-GSK3\\u0026beta;/\\u0026beta;-Catenin Regulates the Differentiation of Dental Pulp Stem Cells into Bladder Smooth Muscle Cells. \\u003cem\\u003eStem Cells International.\\u003c/em\\u003e 2019.\\u003c/li\\u003e\\n\\u003cli\\u003eXuan Wang T W, Long Jiang, Du Rong, Yaqin Zhu. Deferoxamine-Induced Migration and Odontoblast Differentiation via ROS- Dependent Autophagy in Dental Pulp Stem Cells. \\u003cem\\u003eCellular Physiology and Biochemistry.\\u003c/em\\u003e 2017;43:2535-2547.\\u003c/li\\u003e\\n\\u003cli\\u003eM F Pittenger A M M, S C Beck, R K Jaiswal, R Douglas, J D Mosca, M A Moorman, D W Simonetti, S Craig, D R Marshak. Multilineage potential of adult human mesenchymal stem cells. \\u003cem\\u003eScience.\\u003c/em\\u003e 1999;284:143-147.\\u003c/li\\u003e\\n\\u003cli\\u003eBrian M Strem K C H, Min Zhu, Isabella Wulur, Zeni Alfonso, Ronda E Schreiber, John K Fraser, Marc H Hedrick. Multipotential differentiation of adipose tissue-derived stem cells. \\u003cem\\u003eThe Keio Journal of Medicine.\\u003c/em\\u003e 2005;54:132-141.\\u003c/li\\u003e\\n\\u003cli\\u003eW A Robinson J E K, B L Pike. Colony growth of human leukemic peripheral blood cells in vitro. \\u003cem\\u003eBlood.\\u003c/em\\u003e 1971;38:500-508.\\u003c/li\\u003e\\n\\u003cli\\u003eKaren Bieback S K, Harald Kl\\u0026uuml;ter, Hermann Eichler. Critical parameters for the isolation of mesenchymal stem cells from umbilical cord blood. \\u003cem\\u003eStem Cells.\\u003c/em\\u003e 2004;22:625-634.\\u003c/li\\u003e\\n\\u003cli\\u003eYasuyuki Fujii Y K K, Hironori Hojo, Fumiko Yano, Marika Sato, Ung-il Chung, Shinsuke Ohba and Daichi Chikazu. Bone regeneration by human dental pulp stem cells using a helioxanthin derivative and cell-sheet technology. \\u003cem\\u003eStem Cell Research \\u0026amp; Therapy.\\u003c/em\\u003e 2018;9:24.\\u003c/li\\u003e\\n\\u003cli\\u003eXuechao Yang S Z, Xin Pang, Mingwen Fan. Pro-inflammatory cytokines induce odontogenic differentiation of dental pulp-derived stem cells. \\u003cem\\u003eJournal of Cell Biochemistry.\\u003c/em\\u003e 2012;113:669-677.\\u003c/li\\u003e\\n\\u003cli\\u003eGiulio Cavalli C A D. Suppression of inflammation and acquired immunity by IL- 37. \\u003cem\\u003eImmunological Review.\\u003c/em\\u003e 2018;281:179-190.\\u003c/li\\u003e\\n\\u003cli\\u003eGiulio Cavalli C A D. Suppression of Inflammation and Acquired Immunity by IL-37 \\u003cem\\u003eImmunol Rev.\\u003c/em\\u003e 2018;281:179-190.\\u003c/li\\u003e\\n\\u003cli\\u003eYunbo Yang Z-X Z, Dameng Lian, Aaron Haig, Rabindra N Bhattacharjee, Anthony M Jevnikar IL-37 inhibits IL-18-induced tubular epithelial cell expression of pro-inflammatory cytokines and renal ischemia-reperfusion injury. \\u003cem\\u003eKidney International.\\u003c/em\\u003e 2015;87:396-408.\\u003c/li\\u003e\\n\\u003cli\\u003eChenyi Ye W Z, Kai Hang, Mo Chen, Weiduo Hou, Jianzhong Chen, Xi Chen, Erman Chen, Lan Tang, Jinwei Lu, Qianhai Ding, Guangyao Jiang, Baojian Hong, Rongxin He. Extracellular IL-37 promotes osteogenic differentiation of human bone marrow mesenchymal stem cells via activation of the PI3K/AKT signaling pathway. \\u003cem\\u003eCell Death and Disease.\\u003c/em\\u003e 2019;10:753.\\u003c/li\\u003e\\n\\u003cli\\u003eLibin Yang J Z, Jingang Tao, Tan Lu. Elevated Serum Levels of Interleukin-37 Are Associated With Inflammatory Cytokines and Disease Activity in Rheumatoid Arthritis \\u003cem\\u003eAPMIS.\\u003c/em\\u003e 2015;123:1025-1031.\\u003c/li\\u003e\\n\\u003cli\\u003eBingni Chen K H, Liang Ye, Yanqun Li, Jiawei Zhang, Jinshun Zhang, Xinmin Fan, Xiaokai Liu, Li Li, Jinxia Sun, Jing Du, Zhong Huang Interleukin-37 is increased in ankylosing spondylitis patients and associated with disease activity. \\u003cem\\u003eJ Transl Med.\\u003c/em\\u003e 2015;13:36.\\u003c/li\\u003e\\n\\u003cli\\u003eJafari Saeed H K, Keisuke Kimura, Masahiko Ishida, Haruki Sugisawa, Yumiko Ochi, Akiko Kishikawa, Teruko Takano-Yamamoto. IL-37 Inhibits Lipopolysaccharide-Induced Osteoclast Formation and Bone Resorption in Vivo. \\u003cem\\u003eImmunol Lett.\\u003c/em\\u003e 2016;175:8-15.\\u003c/li\\u003e\\n\\u003cli\\u003ePatricia Boya P C, Natalia Rodriguez-Muela. Autophagy in stem cells: repair, remodelling and metabolic reprogramming. \\u003cem\\u003eDevelopment.\\u003c/em\\u003e 2018;145:dev146506.\\u003c/li\\u003e\\n\\u003cli\\u003eThomas Riffelmacher F C R, and Anna Katharina Simon. Autophagy dictates metabolism and differentiation of inflammatory immune cells. \\u003cem\\u003eAutophagy.\\u003c/em\\u003e 2018;14:199-204.\\u003c/li\\u003e\\n\\u003cli\\u003eTingting Li D Z, Tong Mou, Zhen Guo, Junliang Pu, Qingsong Chen, Xufu Wei, Zhongjun Wu. IL-37 induces autophagy in hepatocellular carcinoma cells by inhibiting the PI3K/AKT/mTOR pathway. \\u003cem\\u003eMolecular Immunology.\\u003c/em\\u003e 2017;87:132-140.\\u003c/li\\u003e\\n\\u003cli\\u003eNoboru Mizushima B L. Autophagy in mammalian development and differentiation. \\u003cem\\u003eNat Cell Biol \\u003c/em\\u003e2010;2010:9.\\u003c/li\\u003e\\n\\u003cli\\u003eLorenzo Galluzzi E H B, Andrea Ballabio, Patricia Boya 8 , Jos\\u0026eacute; Manuel Bravo-San Pedro, Francesco Cecconi, Augustine M Choi, Charleen T Chu, Patrice Codogno, Maria Isabel Colombo, Ana Maria Cuervo, Jayanta Debnath, Vojo Deretic, Ivan Dikic, Eeva-Liisa Eskelinen, Gian Maria Fimia, Simone Fulda, David A Gewirtz, Douglas R Green, Malene Hanse, J Wade Harper, Marja J\\u0026auml;\\u0026auml;ttel\\u0026auml;, Terje Johansen, Gabor Juhasz, Alec C Kimmelman, Claudine Kraft, Nicholas T Ktistakis, Sharad Kumar, Beth Levine, Carlos Lopez-Otin, Frank Madeo, Sascha Martens, Jennifer Martinez, Alicia Melendez, Noboru Mizushima, Christian M\\u0026uuml;nz, Leon O Murphy, Josef M Penninger, Mauro Piacentini, Fulvio Reggiori, David C Rubinsztein, Kevin M Ryan, Laura Santambrogio, Luca Scorrano, Anna Katharina Simon, Hans-Uwe Simon, Anne Simonsen, Nektarios Tavernarakis , Sharon A Tooze, Tamotsu Yoshimori, Junying Yuan, Zhenyu Yue, Qing Zhong, Guido Kroemer Molecular Definitions of Autophagy and Related Processes \\u003cem\\u003eEMBO J.\\u003c/em\\u003e 2017;36:1811-1836.\\u003c/li\\u003e\\n\\u003cli\\u003eCarlo Rodolfo S D B, Francesco Cecconi. Autophagy in stem and progenitor Cell. \\u003cem\\u003eCell Mol Life Sci.\\u003c/em\\u003e 2016;73:475-496.\\u003c/li\\u003e\\n\\u003cli\\u003ePatricia Boya P C, Natalia Rodriguez-Muela Autophagy in Stem Cells: Repair, Remodelling and Metabolic Reprogramming \\u003cem\\u003eDevelopment.\\u003c/em\\u003e 2018;145:dev146506.\\u003c/li\\u003e\\n\\u003cli\\u003eYang Ma M Q, Ying An, Liqiang Zhang, Rui Yang, Daniel H Doro, Wenjia Liu, Yan Jin. Autophagy controls mesenchymal stem cell properties and senescence during bone aging. \\u003cem\\u003eAging Cell \\u003c/em\\u003e2018;17:e12709.\\u003c/li\\u003e\\n\\u003cli\\u003eMeng Qi L Z, Yang Ma, Yi Shuai, Liya Li, Kefu Luo, Wenjia Liu, Yan Jin. Autophagy Maintains the Function of Bone Marrow Mesenchymal Stem Cells to Prevent Estrogen Deficiency-Induced Osteoporosis. \\u003cem\\u003eTheranostics.\\u003c/em\\u003e 2017;7:4498-4516.\\u003c/li\\u003e\\n\\u003cli\\u003eYongxian Wan N Z, Yulin Li, Weikang Zhao, Dianming Jiang. Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae. \\u003cem\\u003eBiochemical and Biophysical Research Communications.\\u003c/em\\u003e 2017;1.\\u003c/li\\u003e\\n\\u003cli\\u003eVal\\u0026eacute;rie Pierrefite-Carle S S-D, V\\u0026eacute;ronique Breuil, Olivier Camuzard, Georges F Carle. Autophagy in Bone: Self-eating to Stay in Balance. \\u003cem\\u003eAgeing Res Rev \\u003c/em\\u003e2015;2015:Pt B.\\u003c/li\\u003e\\n\\u003cli\\u003eYin Pan R G B, Zehan Li, Yanqiu Wang, Ming Yan, Jinhua Yu. Sodium fluoride regulates the osteo/odontogenic differentiation of stem cells from apical papilla by modulating autophagy. \\u003cem\\u003eJ Cell Physiol \\u003c/em\\u003e2019.\\u003c/li\\u003e\\n\\u003cli\\u003eJiamin Lu Z L, Xiao Wu, Yan Chen, Ming Yan, Xingyun Ge and Jinhua Yu. iRoot BP Plus promotes osteo/odontogenic differentiation of bone marrow mesenchymal stem cells via MAPK pathways and autophagy. \\u003cem\\u003eStem Cell Research \\u0026amp; Therapy.\\u003c/em\\u003e 2019;10:222.\\u003c/li\\u003e\\n\\u003cli\\u003ePing Ouyang W A, Renhuai Chen, He Zhang, Danrui Chen, Enping Jiang, Wei Zhu, Peng Li , Hongsheng Guo, Zhangquan Chen, Sen Wang. IL-37 Promotes Cell Apoptosis in Cervical Cancer Involving Bim Upregulation \\u003cem\\u003eOnco Targets Ther \\u003c/em\\u003e2019;12:2703-2712.\\u003c/li\\u003e\\n\\u003cli\\u003eB Pei S X, T Liu, F Pan, J Xu, C Ding. Associations of the IL-1F7 Gene Polymorphisms With Rheumatoid Arthritis in Chinese Han Population \\u003cem\\u003eInt J Immunogenet.\\u003c/em\\u003e 2013;40:199-203.\\u003c/li\\u003e\\n\\u003cli\\u003eJean Wu C C, Cindy Zhou, Susumu Nakae, John Hicks, Henry P Adams, Yahuan Lou. IL-33 is required for disposal of unnecessary cells during ovarian atresia through regulation of autophagy and macrophage migration. \\u003cem\\u003eJ Immunol \\u003c/em\\u003e2015;194:2140-2147.\\u003c/li\\u003e\\n\\u003cli\\u003eSusanne Pfeiler H W, Malte Kelm 1 , Norbert Gerdes. IL-1 Family Cytokines in Cardiovascular Disease. \\u003cem\\u003eCytokine \\u003c/em\\u003e2019;22:154215.\\u003c/li\\u003e\\n\\u003cli\\u003eXinyu Zhuang B W, Jian Li, Haiming Shi, Bo Jin, Xinping Luo. The Emerging Role of interleukin-37 in Cardiovascular Diseases \\u003cem\\u003eImmun Inflamm Dis \\u003c/em\\u003e2017;5:373-379.\\u003c/li\\u003e\\n\\u003cli\\u003eYazhuo Jiang Y W, Liang Liang, Yang Gao, Juan Chen, Yi Sun, Yongyi Cheng, Yonggang Xu. IL-37 Mediates the Antitumor Activity in Renal Cell Carcinoma \\u003cem\\u003eMed Oncol.\\u003c/em\\u003e 2015;32:250.\\u003c/li\\u003e\\n\\u003cli\\u003eRodrigo Dutra Nunes G V-M, D\\u0026eacute;bora Monteiro Moretti, Priscilla Medeiros-Castro, Carlucio Rocha-Santos , Carlos Renato de Oliveira Daumas-Filho, Paula Rego Barros Bittencourt-Cunha, Karina Martins-Cardoso, Cec\\u0026iacute;lia Oliveira Cudischevitch, Rubem Figueiredo Sadok Menna-Barreto, Jos\\u0026eacute; Henrique Maia Oliveira, Desiely Silva Gusm\\u0026atilde;o, Francisco Jos\\u0026eacute; Alves Lemos, Daniela Sales Alviano, Pedro Lagerblad Oliveira, Carl Lowenberger, David Majerowicz, Ricardo Melo Oliveira, Rafael Dias Mesquita, Georgia Correa Atella, M\\u0026aacute;rio Alberto Cardoso Silva-Neto Polyphenol-rich diets exacerbate AMPK-mediated autophagy, decreasing proliferation of mosquito midgut microbiota, and extending vector lifespan. \\u003cem\\u003ePLoS Neglected Tropical Disease.\\u003c/em\\u003e 2016;10:e0005034.\\u003c/li\\u003e\\n\\u003cli\\u003eKanchan Phadwal A S W, Anna Katharina Simon. Tightrope act: autophagy in stem cell renewal, differentiation, proliferation, and aging. \\u003cem\\u003eCell and Molecular Life Science.\\u003c/em\\u003e 2013;70:89-103.\\u003c/li\\u003e\\n\\u003cli\\u003eXichun Wang Y J, Lei Zhu, Li Cao, Wei Xu, Sajid Ur Rahman, Shibin Feng, Yu Li, Jinjie Wu. Autophagy protects PC12 cells against deoxynivalenol toxicity via the Class III PI3K/beclin 1/Bcl‐2 pathway. \\u003cem\\u003eJournal of Cell Physiology.\\u003c/em\\u003e 2020;235:7803-7815.\\u003c/li\\u003e\\n\\u003cli\\u003eJinghui Li F Z, Ning Zhang, Xuefei Geng, Cen Meng, Xiaoying Wang, Ying Yang. Osteogenic capacity and cytotherapeutic potential of periodontal ligament cells for periodontal regeneration in vitro and in vivo. \\u003cem\\u003ePeerJ.\\u003c/em\\u003e 2019;7:e6589.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"dental pulp stem cells, IL-37, osteogenic, odontogenic differentiation\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-291517/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-291517/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eBackground\\u003c/p\\u003e\\u003cp\\u003eThe osteogenic and odontogenic differentiation of dental pulp stem cells (DPSCs) contributes to the restoration and regeneration of dental tissues. Previous study indicated that IL-37 has often been identified as an anti-inflammatory factor that affects other pro-inflammatory signals. It is known to be a factor capable of inducing \\u003cem\\u003ein vitro\\u003c/em\\u003e osteogenic differentiation of bone marrow mesenchymal stem cells (BMMSCs). The aims of this study were to explore the effects of IL-37 on the differentiation of DPSCs.\\u003c/p\\u003e\\u003cp\\u003eMethods\\u003c/p\\u003e\\u003cp\\u003eDPSCs were cultured in growth medium with different concentration of IL-37, ALP activity was done to detect the optimal concentration for the following experiments. CCK-8 were conducted to assess the effect of IL-37 on proliferation of DPSCs. To assess differentiation, alkaline phosphatase activity, ALP staining, alizarin red S staining and real‐time RT‐PCR\\u0026nbsp;of DSPP, Runx2, ALP, and OSX were measured. Western blot was conducted to examine the levels of autophagy related markers (Beclin1, P62, LC3). \\u003c/p\\u003e\\u003cp\\u003eResults\\u003c/p\\u003e\\u003cp\\u003eCells cultured with 1 ng/mL IL-37 owned the highest ALP activity. IL-37 enhanced the osteogenic and odontogenic differentiation of DPSCs following upregulated the expression of Beclin1, downregulated the expression of P62, and reduced the ratio of LC3II/I, whereas depletion of autophagy suppressed DPSCs osteogenic and odontogenic differentiation. \\u003c/p\\u003e\\u003cp\\u003eConclusion\\u003c/p\\u003e\\u003cp\\u003eIL-37 increased osteogenic and odontogenic differentiation via autophagy.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Extracellular IL-37 Enhances Osteogenic and Odontogenic Differentiation of Human Dental Pulp Stem Cells via Autophagy Pathway\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2021-03-15 20:45:06\",\"doi\":\"10.21203/rs.3.rs-291517/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"8ccdf030-0c17-42fd-bc67-fee1bff19118\",\"owner\":[],\"postedDate\":\"March 15th, 2021\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":2966503,\"name\":\"Stem Cell \\u0026 Developmental Cell Biology\"}],\"tags\":[],\"updatedAt\":\"2021-03-31T20:11:31+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2021-03-15 20:45:06\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-291517\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-291517\",\"identity\":\"rs-291517\",\"version\":[\"v1\"]},\"buildId\":\"WrCJVZZCHTDjtuVLN7oU0\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}