{"paper_id":"353ae48c-ecde-48e2-b46c-d083b89f9466","body_text":"Activin signaling pathway specialization during embryonic and skeletal muscle development in rainbow trout (Oncorhynchus mykiss) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Activin signaling pathway specialization during embryonic and skeletal muscle development in rainbow trout (Oncorhynchus mykiss) Jasmine Richman, Michael Phelps This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3934487/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 25 Jul, 2024 Read the published version in Marine Biotechnology → Version 1 posted 10 You are reading this latest preprint version Abstract Activin signaling is essential for proper embryonic, skeletal muscle, and reproductive development. Duplication of the pathway in teleost fish has enabled diversification of gene function across the pathway but how gene duplication influences the function of activin signaling in non-mammalian species is poorly understood. Full characterization of activin receptor signaling pathway expression was performed across embryonic development and during early skeletal muscle growth in rainbow trout (RBT, Oncorhynhus mykiss ). Rainbow trout are a model salmonid species that have undergone two additional rounds of whole genome duplication. There was limited expression of activin Ab in RBT embryos despite these genes exhibiting significantly elevated expression in post-hatch skeletal muscle. Divergent expression patterns were also observed for activin receptor type IIB ohnologs. CRISPR targeting of activin Aa2 and activin Ab2 did not identify any developmental or growth phenotypes in edited RBT, however, a high percentage of in-frame alleles were identified in activin Aa2 targeted fish. The research identifies mechanisms of specialization among the duplicated activin ohnologs across embryonic development and during periods of high muscle growth in larval and juvenile fish. The knowledge gained provides critical insights into viable gene-targeting approaches for engineering the activin receptor signaling pathway to improve physiological performance in salmonid species. Activin Myostatin Rainbow Trout CRISPR Skeletal Muscle Development Figures Figure 1 Figure 2 Figure 3 Introduction There is substantial interest in understanding the mechanisms regulating skeletal muscle growth and development in vertebrates as a means to enhance muscle mass in agricultural animals. Myostatin is one of the most well-characterized regulators of muscle fiber size and has been targeted to enhance muscle mass in numerous organisms (McPherron et al. 1997 ; Chisada et al. 2011 ; Luo et al. 2014 ; Crispo et al. 2015 ; Khalil et al. 2017 ; Ohama et al. 2020 ) In mammals however, evidence suggests that myostatin does not act alone and that the signaling molecule activin A has a similar function to that of myostatin in regulating skeletal muscle growth (Latres et al. 2017 ). Unlike myostatin, activin A is expressed in a wide range of tissues in mammals and is essential for embryonic development, making the study of activin A function challenging. In rainbow trout (RBT, Oncorhynchus mykiss ), muscle-specific overexpression of a truncated form of the activin receptor 2B (Acvr2b) or the inhibitor follistatin, increased skeletal muscle mass (Medeiros et al. 2009 ; Phelps et al. 2013 ). However, these transgenes are broad inhibitors of the activin receptor signaling pathway and therefore were unable to identify specific activin receptor signaling molecules (e.g., myostatin or activin) that were important for driving the observed increase in muscle mass. Knockout of the myostatin ligand in red sea bream ( Pagrus major , (Kishimoto et al. 2018 ), channel catfish ( Ictalurus punctatus , (Khalil et al. 2017 ), and olive flounder ( Paralichthys olivaceus , (Kim et al. 2019 ) has been shown to increase muscle mass or body condition in fish. These studies suggest a conserved function for myostatin in regulating skeletal muscle growth in fish. The role of activin A in fish remains poorly understood. Activin A and B were first identified as key regulators of follicle-stimulating hormone (FSH) and luteinizing hormone (LH) production and secretion and function through direct interactions with the pituitary. In mammals they stimulate FSH and LH synthesis in the pituitary or promote gonadotropin-releasing hormone (GnRH) production from the hypothalamus (Corrigan et al. 1991 ). In addition to reproduction, activin A and B have a breadth of other regulatory roles throughout the body including involvement in bone development, erythropoiesis, differentiation of retinal progenitors, neural protection, spinal cord development, adipogenesis, maintaining glucose homeostasis, and airway remodeling (Oue et al. 1994 ; Wu et al. 1999 , 2014 ; Hughes et al. 1999 ; Davis et al. 2000 ; Sakai and Eto 2001 ; Kariyawasam et al. 2011 ; Dani 2013 ; Breda and Rivella 2014 ; Dutta et al. 2014 ; Gao et al. 2019 ). In salmonids, the activin signaling pathway has been expanded multiple times throughout evolution through two whole genome duplication events (WGD; Berthelot et al. 2014 ; Lien et al. 2016 )). Most of the ohnologs in the activin signaling pathway have been retained through each of these duplication events and it is unknown how gene duplication has influenced the function of the signaling pathway compared to mammals. The myostatin gene for example has three functional forms and a pseudogene in salmonids and is expressed in a wider array of tissues in fish than in mammals (Rescan et al. 2001 ). There are also four forms of activin A and activin B in salmonids (Dimos and Phelps 2023 ). Given the essential role of the activin receptor signaling pathway during embryonic development in mammals, we performed gene expression profiling of the pathway across RBT embryonic development and during muscle growth and development in fry and juveniles. Two lines of activin A knockout RBT were also generated to gain insight into the function of these genes during the early life stages of RBT. Through our analysis, we identified key expression dynamics throughout embryonic development and high levels of expression of activin C and bambi in RBT skeletal muscle. Disruption of two activin A ligands revealed a potential role for activin Ab ( inhbaa2 ) during embryonic development but no change in body weight or length was identified in gene edited fry. The results of the research provide important insights into the regulation of activin signaling during embryonic development and skeletal muscle growth in fish. Materials and Methods Animal Care and Growth The RBT used in this study were housed at the Washington State University, Thorgaard Center for Salmonid Physiology and Genomics (TCSPG). All experiments were performed in accordance with the Animal Care and Use Committees of Washington State University under preapproved protocol #6607. Unfertilized RBT eggs and milt were sourced from TroutLodge Inc. (Bonney Lake, WA). Following fertilization and microinjection, the zygotes were stored in a vertical tray incubator in individual trays until hatching. After yolk sac absorption, the fish were transferred to a recirculating rack system and fed twice daily with larval starter feed (Bio-Oregon, Longview, WA). Rainbow trout embryos and fish were raised in 10°C water and exposed to a natural seasonal photoperiod. Growth was measured from gene-edited RBT and control trout at 2 months of age. The fish were anesthetized in 50mg/liter MS-222 (tricaine methanesulphonate) and a weight and length was recorded. From the weight and length measurements condition factor, a measure of body morphology was calculated ( \\(\\frac{Weight \\left(g\\right) \\times 100}{{Length\\left(cm\\right)}^{3}}\\) ). Sampling Developmental Stages Total RNA was extracted from whole embryos or musculature of female RBT (Troutlodge). The onset of embryonic muscle development was identified by quantifying myod1 expression at 15 developmental time points ranging from 2 hours post fertilization (hpf) to 420 degree days post fertilization (dd), using NanoString Technology (Seattle, WA; Fig. 1 d). The myod1 NanoString probe was designed to a conserved region of three myod1 ohnologs (NM_001124720.1; XR_005051975.1; XM_036979132.1) such that the expression level of myod1 represented the cumulative expression of all three ohnologs (Online Resource 1). Expression analysis of the activin signaling pathway was performed at the following developmental time points: embryo (80dd), early-eyed embryo (170dd), mid-eyed embryo (250dd), eyed embryo (340dd), newly hatched alevin, fry epaxial skeletal muscle (2 weeks post yolk absorption), parr epaxial skeletal muscle (3 months post-hatch), and juvenile epaxial skeletal muscle (8 months post-hatch, Fig. 1 ). The NanoString activin signaling pathway code set consisted of 49 activin signaling pathway gene targets that represented ohnologs from 19 distinct gene families (Online Resource 1). Raw expression counts for the activin signaling pathway were normalized to the reference expression of ef1a (NM_001124339.1), actb (NM_001124235.1), and tbp (XM_021581318.1), while the expression of myod1 was normalized to ef1a , tbp , rpl8 (XM_021578858.2), and rpl13 (XM_021586171.2). For embryonic samples less than 100dd old, a syringe was used to remove 10 embryos per sample. Samples older than 100dd had RNA extracted directly from a single whole embryo. RNA was extracted from the tissue samples using either TRIzol or RNA extraction kits (Zymo Research, Irvine CA). RNA quantity and quality were assessed using a Qubit fluorometer and 5200 fragment analyzer, respectively. NanoString analysis was performed by the WSU Laboratory for Biotechnology and Bioanalysis (LBB) core ( myod1 ) or the Fred Hutchinson Cancer Research Center, Genomics and Bioinformatics core (activin pathway). All expression data was quality control checked, normalized to reference gene expression, and analyzed using nSolver version 4.0 software. gRNA Design and Production The activin Aa2 ( inhbaa2 , LOC110535572), and activin Ab2 ( inhbab2 , LOC110529989) genes of RBT were targeted using CRISPR/Cas9 technology. Ohnolog specific target sites were identified by aligning the O. mykiss inhbaa and inhbab ohnologs and identifying guide RNA (gRNA) sites that targeted unique regions between the ohnologs with CHOPCHOP CRISPR design program (Montague et al. 2014 ). Loss of melanin pigmentation was used as a reporter to identify gene edited fish by co-targeting slc45a2 with two gRNAs in addition to the gene of interest as has been done previously in Atlantic salmon (Edvardsen et al. 2014 ). The CRISPR gRNAs were in vitro transcribed from PCR templates. The forward primer used for producing the gRNA PCR template consisted of a tripartite sequence containing a 5’ T7 RNA polymerase promoter sequence (TTAATACGACTCACTATA), the gRNA target site of interest starting with GG, and a 22bp sequence matching the 5’ end of the Cas9 CRISPR gRNA scaffold sequence (GTTTTAGAGCTAGAAATAGCAA; Online Resource 2). This unique forward primer was used to amplify a 76bp Cas9 gRNA scaffold sequence when combined with a reverse primer designed to the 3’ end of the CRISPR/Cas9 scaffold (aaaagcaccgactcggtgcc; Online Resource 2). The gRNA template created with these primers produced a dsDNA product with the 5’ end coding for the T7 RNA polymerase promoter sequence followed by the target gRNA and scaffold sequence. The PCR reaction consisted of 1 ng of purified scaffold sequence or a plasmid containing the Cas9 CRISPR scaffold sequence as a template, 0.625U of OneTaq polymerase (New England Biolabs, NEB), 500 nM each of the forward and reverse primers, 200 uM of each dNTP, and 1X OneTaq reaction buffer. The reaction conditions were 30s at 94°C, followed by 30 cycles of denaturation at 94°C for 20s, annealing at 60°C for 20s, and elongation at 68°C for 5s, with a final elongation period at 68°C for 2 min. The resulting PCR product was then purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific, Waltham, MA) and quantification and purity were determined using a Nanodrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA). After purification, the amplified DNA was transcribed into RNA using the T7 HighScribe Kit (NEB), according to manufacturer protocols and purified with an RNA cleanup kit (Monarch, NEB). The in vitro transcribed gRNAs were quantified on a qubit fluorometer (Thermo) and quality was assessed using agarose gel electrophoresis (3.0ul purified gRNA, 3.0ul 2X RNA loading dye (NEB), 2% agarose gel, ran at 90V for 45 minutes). Microinjections Rainbow trout eggs and sperm were fertilized and stored on ice in isotonic Ginsburg solution (6.5g NaCl, 0.25g KCl, 0.2g NaHCO 3 , 0.3g CaCl 2 , fill to 1L with DI H 2 O) until injection. The CRISPR microinjection mix was made by pre-complexing the CRISPR ribonucleoprotein complex (RNP) with 5000 ng of Cas9 protein (TruCut Cas9 Protein v2, Thermo), 625ng of each slc45a2 gRNA and 1250ng of the gene target gRNA on ice for 15 minutes. Following complex formation, nuclease free water, potassium chloride (100 mM), Tris-EDTA (10X), and phenol red (0.15%) were added to the microinjection mix. Eggs were then microinjected using glass needles pulled by a Narishige needle puller and a Pneumatic PicoPump (World Precision Instruments, Sarasota, FL) to inject each egg with 18 nl of the CRISPR RNP mix. Following injection, eggs were immediately water hardened in fresh water and held at 10°C until they could be transferred to vertical tray incubators. Genotyping CRISPR Edits Genomic DNA (gDNA) used in confirming genome editing efficiency was extracted from fin tissue using the Qiagen DNeasy Blood and Tissue extraction kit (Hilden, Germany), following manufacturers recommendations. Custom barcoded Illumina PCR primer combinations were used to amplify 222bp ( inhbaa2 ) and 366bp ( inhbab2 ) regions surrounding the inhbaa2 and inhbab2 target sites, respectively (Online Resource 2). The PCR reactions were run using 67 ng of gDNA, 1U Q5 polymerase (NEB), 200 uM of each dNTP and 500 nM of gene-specific forward and reverse primers. The reactions were performed under the following conditions: initial denaturation of 98°C for 30s, followed by 36 cycles of denaturation at 98°C for 10s, annealing at 64°C for 20s, and elongation at 72°C for 30s with a final elongation step at 72°C for 2 minutes. The PCR product size was verified using gel electrophoresis. The amplicons were purified using the GeneJET PCR Purification Kit (Thermo) and quantified with a Nanodrop spectrophotometer. Amplicon sequencing was used to identify edited alleles (Amplicon-EZ, Genewiz, South Plainfield, NJ). Statistical Analysis A one-way ANOVA was used to identify statistical differences in gene expression across developmental time (n = 3 or 4) as well as for analysis of growth (i.e., weight and length) in gene-edited RBT. The level of significance was set at p < 0.05 for all experiments. Results Expression of the activin receptor signaling pathway genes throughout development. The expression level of 49 activin receptor signaling pathway genes was quantified using NanoString technology at five developmental time points (80, 170, 250, 340 dd and in post-hatch alevin, Fig. 1 a). Most activin signaling pathway genes exhibited low or no expression at 80dd with many genes increasing expression throughout development (Fig. 1 a). The membrane-bound pathway antagonist bambia1 was found to be the most highly expressed gene at 80 dd of development (1659.94 ± 117.98) falling significantly to a relatively steady albeit still high level of expression after 168 dd (526.53 ± 18.17; Online Resource 3). This expression pattern was only observed for bambia1 as its duplicated ohnolog bambia2 was expressed at a much lower level throughout development (Online Resource 3). Detailed examination of the differential expression of activin pathway molecules revealed that activin type I receptors ( acvr1 ) and activin type IIa ( acvr2a ) receptors exhibited either stable or increasing levels of expression throughout development (ANOVA p < 0.05; Fig. 1 b). In contrast to the expression pattern of acvr1 and acvr2a receptors, activin type IIb receptors ( acvr2b ) were highly expressed early in development but then most ohnologs significantly declined in expression level over time (ANOVA p < 0.05; Fig. 1 b). Activin A ligands increased in expression in the developing embryo with most ligands having low to no expression at 80dd with expression first detected by 170dd (Fig. 1 c). Interestingly, the inhbab2 and mstnb ohnologs ( mstnb2 is an expressed pseudogene) had very low expression during RBT embryonic development. Myostatin A expression ( mstna1 and mstna2 combined) increased in the later stages of embryonic development with significant increases not detected until 340 dd of development (ANOVA p < 0.05; Fig. 1 c). Since the activin receptor signaling pathway is an important regulator of skeletal muscle growth and development we were interested in benchmarking the timing of activin pathway expression against the timing of embryonic skeletal muscle development. The onset of embryonic skeletal muscle development was identified by measuring the expression of myod1 , a key regulator of myoblast proliferation. The expression of myod1 was detected at 190dd of development in RBT and continued to increase throughout embryonic development (Fig. 1 d). In addition to embryonic development, the expression of the activin receptor signaling pathway was also examined in fry, parr, and juvenile RBT epaxial skeletal muscle. The inhbcb2 and inhbba2 genes were the only ligands that exhibited consistently increased expression in parr and juveniles, compared to fry (Fig. 2 a). Approximately half of the ligand gene families (8 out of 17) showed reduced expression in both later life stages and six genes showed elevated expression only in parr with a reduction in expression in juveniles (Fig. 2 a). In contrast to ligands, the majority of receptors had elevated expression levels in parr and juveniles compared to fry (Fig. 2 a). The activin type IIb receptors ( acvr2ba and acvr2bb ) were a notable exception as they were all downregulated in parr and juvenile fish compared to fry (Fig. 2 a). The level of inhbab2 (activin Ab2) and all mstn ( mstna1/2 and mstnb1 ) ligand ohnologs were significantly higher in fry, parr, and juvenile skeletal muscle than during embryonic development when both of these factors were expressed at only minimal levels (Fig. 2 b). Interestingly, activin C ( inhbc ) is expressed in the skeletal muscle of fry, parr, and juvenile fish but the ohnologs exhibit differential regulation with age (Fig. 2 c). The inhbcb1 ohnolog is downregulated with age, while inhbcb2 is upregulated in parr and juveniles compared to fry (Fig. 2 c). To examine the role of activin ligands during RBT development we employed CRISPR/Cas9 genome editing technology to knockout the function of activin Ab2 ( inhbab2 ) and activin Aa2 ( inhbaa2 ) ligands and examine the function of these genes on embryonic development and initial growth. Five successfully edited RBT from inhbab2 and inhbaa2 targeted families were identified by full loss of pigmentation (biallelic knockout of the slc45a2 gene) and genotyped for loss of function alleles in their targeted genes (Fig. 3 a). Random insertion and deletion (InDel) mutations were detected at high frequency in all P0 founders from both inhbab2 and inhbaa2 families and no indels were detected in closely related ohnologs (Fig. 3 a). All of the InDel mutations detected in inhbab2 -targeted fish resulted in null frameshift mutations in the inhbab2 gene (Fig. 3 a). Interestingly, only one inhbaa2 targeted fish was found to contain multiple null frameshift mutations with the other 4 fish presenting both frameshift and in-frame alleles or frameshift and wildtype alleles at the target site (Fig. 3 a). No developmental defects were identified and there was no visual morphological difference between gene edited fry and non-edited wildtype fry (Fig. 3 a). No statistical difference in body length, weight, or condition factor was detected at 2 months of age between inhbab2, inhbaa2 knockout fish and wildtype fish (Fig. 3 a). Discussion The activin receptor signaling pathway, a member of the transforming growth factor-β superfamily, is highly conserved across vertebrate species but WGD events in the teleost lineage have resulted in significant expansion of the signaling pathway in these species (Huminiecki et al. 2009 ; Phelps et al. 2013 ). Despite relative conservation of many signaling pathway components at the protein level, significant differential regulation has been identified between fish and mammals (Rescan et al. 2001 ; Garikipati et al. 2006 ; Gabillard et al. 2013 ). We examined the function of the activin receptor signaling pathway across RBT development and in the skeletal muscle of fry, parr, and juvenile fish to gain insight into the function of the pathway in teleost fish. Only a limited number of pathway components were expressed at 80dd of development but bambia1 , exhibited very high levels of expression in the early embryo which differed significantly from the pattern of expression exhibited by bambia2 . Bambi is a membrane-bound inhibitor of the activin receptor signaling pathway with a known function in vertebrate development (Onichtchouk et al. 1999 ; Grotewold et al. 2001 ). It has been found to be co-expressed with Bmp4 in several vertebrate species and is believed to have a role in regulating Bmp embryonic patterning (Reichert et al. 2013 ), however, loss of function studies have not been able to establish a clear developmental phenotype (Chen et al. 2007 ). While most activin ligands and receptors increased expression throughout development the activin type IIb receptors ( acvr2b ) were downregulated over time (Fig. 1 ). Activation of the activin receptor signaling pathway requires the recruitment of both type II and type I serine-threonine kinase receptors after ligand binding (Massagué 2012 ). Loss of acvr2b function in mice leads to reduced follicle-stimulating hormone levels and some skeletal and facial deformities, but the mice are viable (Matzuk et al. 1995a ). The observation of opposing expression patterns between acvr2a and acvr2b receptors suggests the potential for key functional differences between these receptors during embryonic development in trout. In mammals, the activin type II receptors (A and B) have overlapping functions and can compensate for the loss of a single receptor in skeletal muscle (Lee et al. 2020 ). Whether these receptors have redundant functions in embryonic development in mammals is unknown. The developmental timing of the expression of activin receptor ligands corresponded to the timing of myod1 expression (i.e., 170 dd; Fig. 1 c and 1 d). In fact, except for moderate expression of inhbaa1 observed at 80 dd, there was minimal expression of the activin ligands prior to 170 dd (Fig. 1 ). Both myostatin and activin A are regulators of skeletal muscle growth in mammals (Latres et al. 2017 ). While myostatin contributes to the regulation of teleost skeletal muscle growth (Ohama et al. 2020 ), the role of activin A in fish is largely unknown. The activin ligands were expressed at a significantly higher level in the skeletal muscle tissue of fry, parr, and juvenile fish than in embryos. This is especially representative of inhbab2 and mstnb genes which exhibited little to no expression during embryonic development but were significantly up-regulated in post-hatch skeletal muscle (Fig. 1 ). Activin A has been challenging to study in mammals given its multi-functional role in embryonic development, muscle growth, and reproductive development (Latres et al. 2017 ; Lee et al. 2020 ). Duplication of activin A in RBT may have facilitated diversification (i.e., subfunctionalization) of the activin A ohnologs such that the functions that are carried out by a single gene in mammals are now regulated by independent genes in fish. Interestingly, activin B ( inhbb ) exhibited double or triple the level of expression throughout RBT development than activin A (Fig. 1 c). All four of the activin B ohnologs also increased their expression level during RBT development while only the activin Aa ohnologs were expressed in RBT embryos (Fig. 1 c). This may highlight a greater role for activin B in RBT development than activin A. In mice, inhbb knockout animals are viable but have eyelid fusion defects at birth and are therefore prone to eye lesions and females have significantly impaired reproductive ability (Vassalli et al. 1994 ). Since activin signaling molecules are dimers they are able to function as either homo or heterodimers between activin A and B proteins (e.g., AA, BB or AB; (Appiah Adu-Gyamfi et al. 2020 ). The signaling dynamics of activin dimers during development is complex and poorly understood but there is strong evidence that activin A can compensate for the loss of activin B (Vassalli et al. 1994 ). Diversification of gene function was observed in the differential expression pattern of activin Cb ( inhbcb ) during RBT muscle development. Activin C was not expressed in RBT embryos but activin Cb1 ( inhbcb1 ) and inhbcb2 were down-regulated and up-regulated in juvenile skeletal muscle, respectively (Fig. 2 c). Activin C is expressed in the liver and adipose tissue of mammals with no recorded function in skeletal muscle (Goebel et al. 2022 ). It was originally suggested that activin C may be an inhibitor of activin A by forming heterodimers with reduced function, but recent studies have shown that activin C is able to stimulate the activin receptor signaling pathway but that it has lower affinity for acvr2 receptors and is resistant to follistatin inhibition (Goebel et al. 2022 ). More research is needed to understand how activin C functions in fish and what its role is in skeletal muscle growth, given its high expression in this tissue. The activin Aa2 ( inhbaa2 ) and Ab2 ( inhbab2 ) genes targeted in CRISPR/Cas9 gene knockout RBT represented one ohnolog from each of the salmonid specific ohnolog pairs (i.e., inhbaa and inhbab , Ss4R; (Berthelot et al. 2014 ). The expression of inhbaa2 exhibited a consistent increase in expression throughout development while inhbab2 was not expressed during development but was significantly up-regulated in skeletal muscle after hatch (Figs. 1 and 2 ). Given this expression pattern, it is hypothesized that only inhbaa2 has a role during embryonic development and that inhbab2 may have specialized for other physiological functions, such as regulating skeletal muscle growth. Activin A knockout mice die shortly after birth from cranial facial deformities (Matzuk et al. 1995b ). We did not observe any developmental defects in the inhbaa2 or inhbab2 knockout fish. However, while all of the InDel mutations identified in inhbab2 knockout fish resulted in frameshift mutations, only one of the inhbaa2 targeted fish was identified with multiple null mutations. The remaining inhbaa2 targeted fish either had in-frame or wildtype genotypes in addition to having one null allele. While embryonic viability is difficult to quantify in gene-edited founders given the high mortality that naturally occurs after microinjection, the unexpectedly high percentage of in-frame mutant alleles in inhbaa2 targeted fish compared to inhbab2 targeted fish may indicate a role for activin Aa2 in RBT embryonic development. We did not observe any significant difference in weight, length or condition factor in the gene-edited models that were developed (Fig. 3 b). This is not unexpected as the activin pathway is known to exhibit functionally redundant genes (Lee et al. 2020 ) and duplication of the pathway in RBT has only increased the potential for redundant relationships between the activin A ohnologs. Myostatin knockout double muscling phenotypes in fish are often limited and may not manifest as an increase in overall size but instead as an increase in muscle mass per body length (i.e., condition factor; Phelps et al. 2013 ; Kim et al. 2019 )). This results in fish with a significantly bulky appearance but may actually exhibit reduced body length compared to controls (Phelps et al. 2013 ; Kim et al. 2019 ). Given the extensive duplication of the activin receptor signaling pathway in salmonids and the resulting regulatory complexity, more functional studies are needed to determine the role of activin A in embryonic development in trout. The detailed expression profile of the activin pathway as well as the relative lack of full biallelic inhbaa2 knockout fish identified in this study provide clues to the potential importance of activin A for RBT development and that duplication of activin A has led to unique specializations of the gene family in salmonids. Declarations Funding The work was funded by the United States Department of Agriculture, National Institute of Food and Agriculture grant [2021-67015-33400]. Data Availability All NanoString nCounter gene expression data is located in the NCBI Gene Expression Omnibus data archive (GSE224617) and at https://mphelpslab.org/resources. Competing Interests The authors have no competing interests to declare Acknowledgments The authors would like to acknowledge the support of animal husbandry staff at the TCSPG for care of experimental fish lines as well as Troutlodge for supplying RBT gametes. References Appiah Adu-Gyamfi E, Tanam Djankpa F, Nelson W, et al (2020) Activin and inhibin signaling: From regulation of physiology to involvement in the pathology of the female reproductive system. Cytokine 133:155105. https://doi.org/10.1016/j.cyto.2020.155105 Berthelot C, Brunet F, Chalopin D, et al (2014) The rainbow trout genome provides novel insights into evolution after whole-genome duplication in vertebrates. Nature Communications 5:3657. https://doi.org/10.1038/ncomms4657 Breda L, Rivella S (2014) Modulators of Erythropoiesis: Emerging Therapies For Hemoglobinopathies And Disorders Of Red Cell Production. Hematol Oncol Clin North Am 28:375–386. https://doi.org/10.1016/j.hoc.2013.12.001 Chen J, Bush JO, Ovitt CE, et al (2007) The TGF-β pseudoreceptor gene Bambi is dispensable for mouse embryonic development and postnatal survival. genesis 45:482–486. https://doi.org/10.1002/dvg.20320 Chisada S, Okamoto H, Taniguchi Y, et al (2011) Myostatin-deficient medaka exhibit a double-muscling phenotype with hyperplasia and hypertrophy, which occur sequentially during post-hatch development. Developmental Biology 359:82–94. https://doi.org/10.1016/j.ydbio.2011.08.027 Corrigan AZ, Bilezikjian LM, Carroll RS, et al (1991) Evidence for an Autocrine Role of Activin B within Rat Anterior Pituitary Cultures. Endocrinology 128:1682–1684. https://doi.org/10.1210/endo-128-3-1682 Crispo M, Mulet AP, Tesson L, et al (2015) Efficient Generation of Myostatin Knock-Out Sheep Using CRISPR/Cas9 Technology and Microinjection into Zygotes. PLOS ONE 10:e0136690. https://doi.org/10.1371/journal.pone.0136690 Dani C (2013) Activins in adipogenesis and obesity. Int J Obes 37:163–166. https://doi.org/10.1038/ijo.2012.28 Davis AA, Matzuk MM, Reh TA (2000) Activin A Promotes Progenitor Differentiation into Photoreceptors in Rodent Retina. Molecular and Cellular Neuroscience 15:11–21. https://doi.org/10.1006/mcne.1999.0806 Dimos B, Phelps M (2023) A homology guide for Pacific salmon genus Oncorhynchus resolves patterns of ohnolog retention, resolution and local adaptation following the salmonid-specific whole-genome duplication event. Ecology and Evolution 13:e9994. https://doi.org/10.1002/ece3.9994 Dutta DJ, Zameer A, Mariani JN, et al (2014) Combinatorial actions of Tgfβ and Activin ligands promote oligodendrocyte development and CNS myelination. Development 141:2414–2428. https://doi.org/10.1242/dev.106492 Edvardsen RB, Leininger S, Kleppe L, et al (2014) Targeted mutagenesis in Atlantic salmon (Salmo salar L.) using the CRISPR/Cas9 system induces complete knockout individuals in the F0 generation. PLoS One 9:e108622. https://doi.org/10.1371/journal.pone.0108622 Gabillard J-C, Biga PR, Rescan P-Y, Seiliez I (2013) Revisiting the paradigm of myostatin in vertebrates: Insights from fishes. General and Comparative Endocrinology 194:45–54. https://doi.org/10.1016/j.ygcen.2013.08.012 Gao Y, Zhang R, Dai S, et al (2019) Role of TGF-β/Smad Pathway in the Transcription of Pancreas-Specific Genes During Beta Cell Differentiation. Frontiers in Cell and Developmental Biology 7: Garikipati DK, Gahr SA, Rodgers BD (2006) Identification, characterization, and quantitative expression analysis of rainbow trout myostatin-1a and myostatin-1b genes. Journal of Endocrinology 190:879–888. https://doi.org/10.1677/joe.1.06866 Goebel EJ, Ongaro L, Kappes EC, et al (2022) The orphan ligand, activin C, signals through activin receptor-like kinase 7. eLife 11:e78197. https://doi.org/10.7554/eLife.78197 Grotewold L, Plum M, Dildrop R, et al (2001) Bambi is coexpressed with Bmp-4 during mouse embryogenesis. Mechanisms of Development 100:327–330. https://doi.org/10.1016/S0925-4773(00)00524-4 Hughes PE, Alexi T, Williams CE, et al (1999) Administration of recombinant human activin-A has powerful neurotrophic effects on select striatal phenotypes in the quinolinic acid lesion model of Huntington’s disease. Neuroscience 92:197–209. https://doi.org/10.1016/S0306-4522(98)00724-6 Huminiecki L, Goldovsky L, Freilich S, et al (2009) Emergence, development and diversification of the TGF-βsignalling pathway within the animal kingdom. BMC Evol Biol 9:28. https://doi.org/10.1186/1471-2148-9-28 Kariyawasam HH, Semitekolou M, Robinson DS, Xanthou G (2011) Activin-A: a novel critical regulator of allergic asthma. Clinical & Experimental Allergy 41:1505–1514. https://doi.org/10.1111/j.1365-2222.2011.03784.x Khalil K, Elayat M, Khalifa E, et al (2017) Generation of Myostatin Gene-Edited Channel Catfish (Ictalurus punctatus) via Zygote Injection of CRISPR/Cas9 System. Sci Rep 7:7301. https://doi.org/10.1038/s41598-017-07223-7 Kim J, Cho JY, Kim J-W, et al (2019) CRISPR/Cas9-mediated myostatin disruption enhances muscle mass in the olive flounder Paralichthys olivaceus. Aquaculture 512:734336. https://doi.org/10.1016/j.aquaculture.2019.734336 Kishimoto K, Washio Y, Yoshiura Y, et al (2018) Production of a breed of red sea bream Pagrus major with an increase of skeletal muscle mass and reduced body length by genome editing with CRISPR/Cas9. Aquaculture 495:415–427. https://doi.org/10.1016/j.aquaculture.2018.05.055 Latres E, Mastaitis J, Fury W, et al (2017) Activin A more prominently regulates muscle mass in primates than does GDF8. Nat Commun 8:15153. https://doi.org/10.1038/ncomms15153 Lee S-J, Lehar A, Liu Y, et al (2020) Functional redundancy of type I and type II receptors in the regulation of skeletal muscle growth by myostatin and activin A. Proceedings of the National Academy of Sciences 117:30907–30917. https://doi.org/10.1073/pnas.2019263117 Lien S, Koop BF, Sandve SR, et al (2016) The Atlantic salmon genome provides insights into rediploidization. Nature 533:200–205. https://doi.org/10.1038/nature17164 Luo J, Song Z, Yu S, et al (2014) Efficient Generation of Myostatin (MSTN) Biallelic Mutations in Cattle Using Zinc Finger Nucleases. PLOS ONE 9:e95225. https://doi.org/10.1371/journal.pone.0095225 Massagué J (2012) TGFβ signalling in context. Nat Rev Mol Cell Biol 13:616–630. https://doi.org/10.1038/nrm3434 Matzuk MM, Kumar TR, Bradley A (1995a) Different phenotypes for mice deficient in either activins or activin receptor type II. Nature 374:356–360. https://doi.org/10.1038/374356a0 Matzuk MM, Kumar TR, Vassalli A, et al (1995b) Functional analysis of activins during mammalian development. Nature 374:354–356. https://doi.org/10.1038/374354a0 McPherron AC, Lawler AM, Lee S-J (1997) Regulation of skeletal muscle mass in mice by a new TGF-p superfamily member. Nature 387:83–90. https://doi.org/10.1038/387083a0 Medeiros EF, Phelps MP, Fuentes FD, Bradley TM (2009) Overexpression of follistatin in trout stimulates increased muscling. American Journal of Physiology - Regulatory, Integrative and Comparative Physiology 297:R235–R242. https://doi.org/10.1152/ajpregu.91020.2008 Montague TG, Cruz JM, Gagnon JA, et al (2014) CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Research 42:W401–W407. https://doi.org/10.1093/nar/gku410 Ohama M, Washio Y, Kishimoto K, et al (2020) Growth performance of myostatin knockout red sea bream Pagrus major juveniles produced by genome editing with CRISPR/Cas9. Aquaculture 529:735672. https://doi.org/10.1016/j.aquaculture.2020.735672 Onichtchouk D, Chen Y-G, Dosch R, et al (1999) Silencing of TGF-β signalling by the pseudoreceptor BAMBI. Nature 401:480–485. https://doi.org/10.1038/46794 Oue Y, Kanatani H, Kiyoki M, et al (1994) Effect of local injection of activin A on bone formation in newborn rats. Bone 15:361–366. https://doi.org/10.1016/8756-3282(94)90301-8 Phelps MP, Jaffe IM, Bradley TM (2013) Muscle growth in teleost fish is regulated by factors utilizing the activin II B receptor. J Exp Biol 216:3742–3750. https://doi.org/10.1242/jeb.086660 Reichert S, Randall RA, Hill CS (2013) A BMP regulatory network controls ectodermal cell fate decisions at the neural plate border. Development 140:4435–4444. https://doi.org/10.1242/dev.098707 Rescan PY, Jutel I, Rallière C (2001) Two myostatin genes are differentially expressed in myotomal muscles of the trout (Oncorhynchus mykiss). J Exp Biol 204:3523–3529 Sakai R, Eto Y (2001) Involvement of activin in the regulation of bone metabolism. Molecular and Cellular Endocrinology 180:183–188. https://doi.org/10.1016/S0303-7207(01)00496-8 Vassalli A, Matzuk MM, Gardner HA, et al (1994) Activin/inhibin beta B subunit gene disruption leads to defects in eyelid development and female reproduction. Genes Dev 8:414–427. https://doi.org/10.1101/gad.8.4.414 Wu DD, Lai M, Hughes PE, et al (1999) Expression of the activin axis and neuronal rescue effects of recombinant activin A following hypoxic-ischemic brain injury in the infant rat. Brain Research 835:369–378. https://doi.org/10.1016/S0006-8993(99)01638-8 Wu H, Mezghenna K, Marmol P, et al (2014) Differential regulation of mouse pancreatic islet insulin secretion and Smad proteins by activin ligands. Diabetologia 57:148–156. https://doi.org/10.1007/s00125-013-3079-6 Additional Declarations No competing interests reported. Supplementary Files OnlineResource1.xlsx OnlineResource2.xlsx OnlineResource3.png Online Resource 3 Normalized expression of bambia ohnologs across embryonic development in RBT Cite Share Download PDF Status: Published Journal Publication published 25 Jul, 2024 Read the published version in Marine Biotechnology → Version 1 posted Editorial decision: Revision requested 10 Apr, 2024 Reviews received at journal 04 Apr, 2024 Reviews received at journal 29 Mar, 2024 Reviewers agreed at journal 22 Mar, 2024 Reviewers agreed at journal 21 Mar, 2024 Reviewers agreed at journal 21 Mar, 2024 Reviewers invited by journal 21 Mar, 2024 Editor assigned by journal 01 Mar, 2024 Submission checks completed at journal 01 Mar, 2024 First submitted to journal 06 Feb, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3934487\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":275914015,\"identity\":\"e00b64bc-ddf4-4b5a-8a25-c186843aec05\",\"order_by\":0,\"name\":\"Jasmine Richman\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Washington State University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jasmine\",\"middleName\":\"\",\"lastName\":\"Richman\",\"suffix\":\"\"},{\"id\":275914016,\"identity\":\"53216db2-fb95-41e5-9492-b873545e8221\",\"order_by\":1,\"name\":\"Michael Phelps\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+0lEQVRIiWNgGAWjYDACZgY2IGnBwCDBwHgASMpBhNkIapEAI6AWC2PCWhhQtVQkNhDSotvO/OzBjwoJBnPp5gOHC/5IpG84f8aA4UPZYZxazA6zmRv2nJFgsJxzLOHwzDaJ3A03cgwYZ5zDp4WHTYK3TYLBAKjyMG+DRO62GzwGzLxt+LVI/v0H0pL/4TAP0GFmQIcx/yWgRRpoOMgWBpCNCWYHcgyYGfFqYTOTljkmwWM5I80A5BfD/TfSCg72nEvHreX84WeSb2ps5Mwlkh8+LvhTJy/Zf3jjgx9l1ji1wACPAQMoWqHgAEH1IICiZRSMglEwCkYBMgAANBZTRql+FwUAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Washington State University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Michael\",\"middleName\":\"\",\"lastName\":\"Phelps\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-02-06 16:30:48\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3934487/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3934487/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1007/s10126-024-10345-5\",\"type\":\"published\",\"date\":\"2024-07-25T16:16:06+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":52020369,\"identity\":\"625a09a2-f55f-4aed-b85a-a9a39e191d5f\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 14:06:53\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":874301,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eExpression of the activin receptor signaling pathway during RBT embryonic development. (a) Global pattern of gene expression across five developmental time points spanning from 80-degree days (dd) of development until hatch. Normalized expression changes across development for (b) receptors and (c) signaling pathway ligands. (d) The expression of the myogenic transcription factor \\u003cem\\u003emyod1\\u003c/em\\u003e was used as a marker of skeletal muscle development across embryonic development in RBT\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3934487/v1/9bc07234d99e7d61b27f9c89.jpg\"},{\"id\":52019942,\"identity\":\"8fe7fb24-242c-47d3-a216-ed45f83103a9\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 13:58:53\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":711037,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eChanges in the expression of the activin receptor signaling pathway throughout early skeletal muscle growth in RBT. (a) The fold change in activin signaling pathway ligands and receptors in parr and juvenile fish compared to two-week-old fry. (b) Comparison of expression levels during embryonic development and post-hatch skeletal muscle for \\u003cem\\u003einhbab2\\u003c/em\\u003e, \\u003cem\\u003emstna\\u003c/em\\u003e and \\u003cem\\u003emstnb1\\u003c/em\\u003e. (c) Differential expression of \\u003cem\\u003einhbcb\\u003c/em\\u003e ohnologs in post-hatch skeletal muscle\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3934487/v1/b2497794dc276deaac54455d.jpg\"},{\"id\":52019946,\"identity\":\"35e1b8b4-342c-44e3-823b-d87dd7dd4499\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 13:58:53\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1322382,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eFunctional characterization of \\u003cem\\u003einhbab2\\u003c/em\\u003e and \\u003cem\\u003einhbaa2\\u003c/em\\u003e ligands in gene edited knockout RBT. (a) CRISPR target sites in \\u003cem\\u003einhbab2\\u003c/em\\u003e and \\u003cem\\u003einhbaa2\\u003c/em\\u003e and the number fish will multiple null frameshift mutations, null and in-frame InDel mutations (IF), or wildtype (WT) and null mutations. Red base pairs represent the CRISPR gRNA target site, light blue bases represent the CRISPR protospacer adjacent motif (PAM). Purple letters represent inserted bases and dashes represent deleted bases. Yellow arrows signify the location of the gRNA target site in either the second (\\u003cem\\u003einhbab2\\u003c/em\\u003e) or third exon (\\u003cem\\u003einhbaa2\\u003c/em\\u003e) of the target gene. (b) The weight, length and condition factor of wildtype, \\u003cem\\u003einhbab2\\u003c/em\\u003e, and \\u003cem\\u003einhbaa2\\u003c/em\\u003egene edited RBT\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3934487/v1/1c161048ac20321bba8fea53.jpg\"},{\"id\":61596110,\"identity\":\"c284dbf2-e71e-4f8e-b71f-f5c6ac7fb300\",\"added_by\":\"auto\",\"created_at\":\"2024-08-01 17:24:49\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3336846,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3934487/v1/974703c3-8b12-4b83-b1a7-3571da7d89f7.pdf\"},{\"id\":52019941,\"identity\":\"3ed67f7b-fff4-4f94-9702-d4c573e06246\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 13:58:53\",\"extension\":\"xlsx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":13980,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"OnlineResource1.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3934487/v1/c8100e07c15f2b61734d4dfa.xlsx\"},{\"id\":52019944,\"identity\":\"48274a56-f399-4dec-b133-f753d68bf3be\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 13:58:53\",\"extension\":\"xlsx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":12747,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"OnlineResource2.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3934487/v1/d29471a9e6d61b18792b282d.xlsx\"},{\"id\":52019945,\"identity\":\"684006df-4203-4240-a352-43ae20715d46\",\"added_by\":\"auto\",\"created_at\":\"2024-03-05 13:58:53\",\"extension\":\"png\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":119504,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eOnline Resource 3\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNormalized expression of \\u003cem\\u003ebambia\\u003c/em\\u003e ohnologs across embryonic development in RBT\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"OnlineResource3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3934487/v1/55673d7b257c6dd3189870f4.png\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Activin signaling pathway specialization during embryonic and skeletal muscle development in rainbow trout (Oncorhynchus mykiss)\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eThere is substantial interest in understanding the mechanisms regulating skeletal muscle growth and development in vertebrates as a means to enhance muscle mass in agricultural animals. Myostatin is one of the most well-characterized regulators of muscle fiber size and has been targeted to enhance muscle mass in numerous organisms (McPherron et al. \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e1997\\u003c/span\\u003e; Chisada et al. \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e; Luo et al. \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e; Crispo et al. \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e; Khalil et al. \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e; Ohama et al. \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e) In mammals however, evidence suggests that myostatin does not act alone and that the signaling molecule activin A has a similar function to that of myostatin in regulating skeletal muscle growth (Latres et al. \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Unlike myostatin, activin A is expressed in a wide range of tissues in mammals and is essential for embryonic development, making the study of activin A function challenging. In rainbow trout (RBT, \\u003cem\\u003eOncorhynchus mykiss\\u003c/em\\u003e), muscle-specific overexpression of a truncated form of the activin receptor 2B (Acvr2b) or the inhibitor follistatin, increased skeletal muscle mass (Medeiros et al. \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e2009\\u003c/span\\u003e; Phelps et al. \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). However, these transgenes are broad inhibitors of the activin receptor signaling pathway and therefore were unable to identify specific activin receptor signaling molecules (e.g., myostatin or activin) that were important for driving the observed increase in muscle mass. Knockout of the myostatin ligand in red sea bream (\\u003cem\\u003ePagrus major\\u003c/em\\u003e, (Kishimoto et al. \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e), channel catfish (\\u003cem\\u003eIctalurus punctatus\\u003c/em\\u003e, (Khalil et al. \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e), and olive flounder (\\u003cem\\u003eParalichthys olivaceus\\u003c/em\\u003e, (Kim et al. \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e) has been shown to increase muscle mass or body condition in fish. These studies suggest a conserved function for myostatin in regulating skeletal muscle growth in fish. The role of activin A in fish remains poorly understood.\\u003c/p\\u003e \\u003cp\\u003eActivin A and B were first identified as key regulators of follicle-stimulating hormone (FSH) and luteinizing hormone (LH) production and secretion and function through direct interactions with the pituitary. In mammals they stimulate FSH and LH synthesis in the pituitary or promote gonadotropin-releasing hormone (GnRH) production from the hypothalamus (Corrigan et al. \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e1991\\u003c/span\\u003e). In addition to reproduction, activin A and B have a breadth of other regulatory roles throughout the body including involvement in bone development, erythropoiesis, differentiation of retinal progenitors, neural protection, spinal cord development, adipogenesis, maintaining glucose homeostasis, and airway remodeling (Oue et al. \\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e1994\\u003c/span\\u003e; Wu et al. \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e1999\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e; Hughes et al. \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e1999\\u003c/span\\u003e; Davis et al. \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e; Sakai and Eto \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e2001\\u003c/span\\u003e; Kariyawasam et al. \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e; Dani \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e; Breda and Rivella \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e; Dutta et al. \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e; Gao et al. \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eIn salmonids, the activin signaling pathway has been expanded multiple times throughout evolution through two whole genome duplication events (WGD; Berthelot et al. \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e; Lien et al. \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e)). Most of the ohnologs in the activin signaling pathway have been retained through each of these duplication events and it is unknown how gene duplication has influenced the function of the signaling pathway compared to mammals. The myostatin gene for example has three functional forms and a pseudogene in salmonids and is expressed in a wider array of tissues in fish than in mammals (Rescan et al. \\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e2001\\u003c/span\\u003e). There are also four forms of activin A and activin B in salmonids (Dimos and Phelps \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). Given the essential role of the activin receptor signaling pathway during embryonic development in mammals, we performed gene expression profiling of the pathway across RBT embryonic development and during muscle growth and development in fry and juveniles. Two lines of activin A knockout RBT were also generated to gain insight into the function of these genes during the early life stages of RBT. Through our analysis, we identified key expression dynamics throughout embryonic development and high levels of expression of activin C and \\u003cem\\u003ebambi\\u003c/em\\u003e in RBT skeletal muscle. Disruption of two activin A ligands revealed a potential role for activin Ab (\\u003cem\\u003einhbaa2\\u003c/em\\u003e) during embryonic development but no change in body weight or length was identified in gene edited fry. The results of the research provide important insights into the regulation of activin signaling during embryonic development and skeletal muscle growth in fish.\\u003c/p\\u003e\"},{\"header\":\"Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAnimal Care and Growth\\u003c/h2\\u003e \\u003cp\\u003eThe RBT used in this study were housed at the Washington State University, Thorgaard Center for Salmonid Physiology and Genomics (TCSPG). All experiments were performed in accordance with the Animal Care and Use Committees of Washington State University under preapproved protocol #6607. Unfertilized RBT eggs and milt were sourced from TroutLodge Inc. (Bonney Lake, WA). Following fertilization and microinjection, the zygotes were stored in a vertical tray incubator in individual trays until hatching. After yolk sac absorption, the fish were transferred to a recirculating rack system and fed twice daily with larval starter feed (Bio-Oregon, Longview, WA). Rainbow trout embryos and fish were raised in 10\\u0026deg;C water and exposed to a natural seasonal photoperiod. Growth was measured from gene-edited RBT and control trout at 2 months of age. The fish were anesthetized in 50mg/liter MS-222 (tricaine methanesulphonate) and a weight and length was recorded. From the weight and length measurements condition factor, a measure of body morphology was calculated (\\u003cspan class=\\\"InlineEquation\\\"\\u003e\\u003cspan class=\\\"mathinline\\\"\\u003e\\\\(\\\\frac{Weight \\\\left(g\\\\right) \\\\times 100}{{Length\\\\left(cm\\\\right)}^{3}}\\\\)\\u003c/span\\u003e\\u003c/span\\u003e).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSampling Developmental Stages\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA was extracted from whole embryos or musculature of female RBT (Troutlodge). The onset of embryonic muscle development was identified by quantifying \\u003cem\\u003emyod1\\u003c/em\\u003e expression at 15 developmental time points ranging from 2 hours post fertilization (hpf) to 420 degree days post fertilization (dd), using NanoString Technology (Seattle, WA; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ed). The \\u003cem\\u003emyod1\\u003c/em\\u003e NanoString probe was designed to a conserved region of three \\u003cem\\u003emyod1\\u003c/em\\u003e ohnologs (NM_001124720.1; XR_005051975.1; XM_036979132.1) such that the expression level of \\u003cem\\u003emyod1\\u003c/em\\u003e represented the cumulative expression of all three ohnologs (Online Resource 1). Expression analysis of the activin signaling pathway was performed at the following developmental time points: embryo (80dd), early-eyed embryo (170dd), mid-eyed embryo (250dd), eyed embryo (340dd), newly hatched alevin, fry epaxial skeletal muscle (2 weeks post yolk absorption), parr epaxial skeletal muscle (3 months post-hatch), and juvenile epaxial skeletal muscle (8 months post-hatch, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). The NanoString activin signaling pathway code set consisted of 49 activin signaling pathway gene targets that represented ohnologs from 19 distinct gene families (Online Resource 1). Raw expression counts for the activin signaling pathway were normalized to the reference expression of \\u003cem\\u003eef1a\\u003c/em\\u003e (NM_001124339.1), \\u003cem\\u003eactb\\u003c/em\\u003e (NM_001124235.1), and \\u003cem\\u003etbp\\u003c/em\\u003e (XM_021581318.1), while the expression of \\u003cem\\u003emyod1\\u003c/em\\u003e was normalized to \\u003cem\\u003eef1a\\u003c/em\\u003e, \\u003cem\\u003etbp\\u003c/em\\u003e, \\u003cem\\u003erpl8\\u003c/em\\u003e (XM_021578858.2), and \\u003cem\\u003erpl13\\u003c/em\\u003e (XM_021586171.2). For embryonic samples less than 100dd old, a syringe was used to remove 10 embryos per sample. Samples older than 100dd had RNA extracted directly from a single whole embryo. RNA was extracted from the tissue samples using either TRIzol or RNA extraction kits (Zymo Research, Irvine CA). RNA quantity and quality were assessed using a Qubit fluorometer and 5200 fragment analyzer, respectively. NanoString analysis was performed by the WSU Laboratory for Biotechnology and Bioanalysis (LBB) core (\\u003cem\\u003emyod1\\u003c/em\\u003e) or the Fred Hutchinson Cancer Research Center, Genomics and Bioinformatics core (activin pathway). All expression data was quality control checked, normalized to reference gene expression, and analyzed using nSolver version 4.0 software.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003egRNA Design and Production\\u003c/h2\\u003e \\u003cp\\u003eThe activin Aa2 (\\u003cem\\u003einhbaa2\\u003c/em\\u003e, LOC110535572), and activin Ab2 (\\u003cem\\u003einhbab2\\u003c/em\\u003e, LOC110529989) genes of RBT were targeted using CRISPR/Cas9 technology. Ohnolog specific target sites were identified by aligning the \\u003cem\\u003eO. mykiss inhbaa\\u003c/em\\u003e and \\u003cem\\u003einhbab\\u003c/em\\u003e ohnologs and identifying guide RNA (gRNA) sites that targeted unique regions between the ohnologs with CHOPCHOP CRISPR design program (Montague et al. \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). Loss of melanin pigmentation was used as a reporter to identify gene edited fish by co-targeting \\u003cem\\u003eslc45a2\\u003c/em\\u003e with two gRNAs in addition to the gene of interest as has been done previously in Atlantic salmon (Edvardsen et al. \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). The CRISPR gRNAs were \\u003cem\\u003ein vitro\\u003c/em\\u003e transcribed from PCR templates. The forward primer used for producing the gRNA PCR template consisted of a tripartite sequence containing a 5\\u0026rsquo; T7 RNA polymerase promoter sequence (TTAATACGACTCACTATA), the gRNA target site of interest starting with GG, and a 22bp sequence matching the 5\\u0026rsquo; end of the Cas9 CRISPR gRNA scaffold sequence (GTTTTAGAGCTAGAAATAGCAA; Online Resource 2). This unique forward primer was used to amplify a 76bp Cas9 gRNA scaffold sequence when combined with a reverse primer designed to the 3\\u0026rsquo; end of the CRISPR/Cas9 scaffold (aaaagcaccgactcggtgcc; Online Resource 2). The gRNA template created with these primers produced a dsDNA product with the 5\\u0026rsquo; end coding for the T7 RNA polymerase promoter sequence followed by the target gRNA and scaffold sequence. The PCR reaction consisted of 1 ng of purified scaffold sequence or a plasmid containing the Cas9 CRISPR scaffold sequence as a template, 0.625U of OneTaq polymerase (New England Biolabs, NEB), 500 nM each of the forward and reverse primers, 200 uM of each dNTP, and 1X OneTaq reaction buffer. The reaction conditions were 30s at 94\\u0026deg;C, followed by 30 cycles of denaturation at 94\\u0026deg;C for 20s, annealing at 60\\u0026deg;C for 20s, and elongation at 68\\u0026deg;C for 5s, with a final elongation period at 68\\u0026deg;C for 2 min. The resulting PCR product was then purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific, Waltham, MA) and quantification and purity were determined using a Nanodrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA). After purification, the amplified DNA was transcribed into RNA using the T7 HighScribe Kit (NEB), according to manufacturer protocols and purified with an RNA cleanup kit (Monarch, NEB). The \\u003cem\\u003ein vitro\\u003c/em\\u003e transcribed gRNAs were quantified on a qubit fluorometer (Thermo) and quality was assessed using agarose gel electrophoresis (3.0ul purified gRNA, 3.0ul 2X RNA loading dye (NEB), 2% agarose gel, ran at 90V for 45 minutes).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMicroinjections\\u003c/h2\\u003e \\u003cp\\u003eRainbow trout eggs and sperm were fertilized and stored on ice in isotonic Ginsburg solution (6.5g NaCl, 0.25g KCl, 0.2g NaHCO\\u003csub\\u003e3\\u003c/sub\\u003e, 0.3g CaCl\\u003csub\\u003e2\\u003c/sub\\u003e, fill to 1L with DI H\\u003csub\\u003e2\\u003c/sub\\u003eO) until injection. The CRISPR microinjection mix was made by pre-complexing the CRISPR ribonucleoprotein complex (RNP) with 5000 ng of Cas9 protein (TruCut Cas9 Protein v2, Thermo), 625ng of each \\u003cem\\u003eslc45a2\\u003c/em\\u003e gRNA and 1250ng of the gene target gRNA on ice for 15 minutes. Following complex formation, nuclease free water, potassium chloride (100 mM), Tris-EDTA (10X), and phenol red (0.15%) were added to the microinjection mix. Eggs were then microinjected using glass needles pulled by a Narishige needle puller and a Pneumatic PicoPump (World Precision Instruments, Sarasota, FL) to inject each egg with 18 nl of the CRISPR RNP mix. Following injection, eggs were immediately water hardened in fresh water and held at 10\\u0026deg;C until they could be transferred to vertical tray incubators.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eGenotyping CRISPR Edits\\u003c/h2\\u003e \\u003cp\\u003eGenomic DNA (gDNA) used in confirming genome editing efficiency was extracted from fin tissue using the Qiagen DNeasy Blood and Tissue extraction kit (Hilden, Germany), following manufacturers recommendations. Custom barcoded Illumina PCR primer combinations were used to amplify 222bp (\\u003cem\\u003einhbaa2\\u003c/em\\u003e) and 366bp (\\u003cem\\u003einhbab2\\u003c/em\\u003e) regions surrounding the \\u003cem\\u003einhbaa2\\u003c/em\\u003e and \\u003cem\\u003einhbab2\\u003c/em\\u003e target sites, respectively (Online Resource 2). The PCR reactions were run using 67 ng of gDNA, 1U Q5 polymerase (NEB), 200 uM of each dNTP and 500 nM of gene-specific forward and reverse primers. The reactions were performed under the following conditions: initial denaturation of 98\\u0026deg;C for 30s, followed by 36 cycles of denaturation at 98\\u0026deg;C for 10s, annealing at 64\\u0026deg;C for 20s, and elongation at 72\\u0026deg;C for 30s with a final elongation step at 72\\u0026deg;C for 2 minutes. The PCR product size was verified using gel electrophoresis. The amplicons were purified using the GeneJET PCR Purification Kit (Thermo) and quantified with a Nanodrop spectrophotometer. Amplicon sequencing was used to identify edited alleles (Amplicon-EZ, Genewiz, South Plainfield, NJ).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical Analysis\\u003c/h2\\u003e \\u003cp\\u003eA one-way ANOVA was used to identify statistical differences in gene expression across developmental time (n\\u0026thinsp;=\\u0026thinsp;3 or 4) as well as for analysis of growth (i.e., weight and length) in gene-edited RBT. The level of significance was set at p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 for all experiments.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e \\u003cem\\u003eExpression of the activin receptor signaling pathway genes throughout development.\\u003c/em\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe expression level of 49 activin receptor signaling pathway genes was quantified using NanoString technology at five developmental time points (80, 170, 250, 340 dd and in post-hatch alevin, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea). Most activin signaling pathway genes exhibited low or no expression at 80dd with many genes increasing expression throughout development (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea). The membrane-bound pathway antagonist \\u003cem\\u003ebambia1\\u003c/em\\u003e was found to be the most highly expressed gene at 80 dd of development (1659.94\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;117.98) falling significantly to a relatively steady albeit still high level of expression after 168 dd (526.53\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;18.17; Online Resource 3). This expression pattern was only observed for \\u003cem\\u003ebambia1\\u003c/em\\u003e as its duplicated ohnolog \\u003cem\\u003ebambia2\\u003c/em\\u003e was expressed at a much lower level throughout development (Online Resource 3). Detailed examination of the differential expression of activin pathway molecules revealed that activin type I receptors (\\u003cem\\u003eacvr1\\u003c/em\\u003e) and activin type IIa (\\u003cem\\u003eacvr2a\\u003c/em\\u003e) receptors exhibited either stable or increasing levels of expression throughout development (ANOVA p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb). In contrast to the expression pattern of \\u003cem\\u003eacvr1\\u003c/em\\u003e and \\u003cem\\u003eacvr2a\\u003c/em\\u003e receptors, activin type IIb receptors (\\u003cem\\u003eacvr2b\\u003c/em\\u003e) were highly expressed early in development but then most ohnologs significantly declined in expression level over time (ANOVA p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb).\\u003c/p\\u003e \\u003cp\\u003eActivin A ligands increased in expression in the developing embryo with most ligands having low to no expression at 80dd with expression first detected by 170dd (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec). Interestingly, the \\u003cem\\u003einhbab2\\u003c/em\\u003e and \\u003cem\\u003emstnb\\u003c/em\\u003e ohnologs (\\u003cem\\u003emstnb2\\u003c/em\\u003e is an expressed pseudogene) had very low expression during RBT embryonic development. Myostatin A expression (\\u003cem\\u003emstna1\\u003c/em\\u003e and \\u003cem\\u003emstna2\\u003c/em\\u003e combined) increased in the later stages of embryonic development with significant increases not detected until 340 dd of development (ANOVA p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec).\\u003c/p\\u003e \\u003cp\\u003eSince the activin receptor signaling pathway is an important regulator of skeletal muscle growth and development we were interested in benchmarking the timing of activin pathway expression against the timing of embryonic skeletal muscle development. The onset of embryonic skeletal muscle development was identified by measuring the expression of \\u003cem\\u003emyod1\\u003c/em\\u003e, a key regulator of myoblast proliferation. The expression of \\u003cem\\u003emyod1\\u003c/em\\u003e was detected at 190dd of development in RBT and continued to increase throughout embryonic development (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ed).\\u003c/p\\u003e \\u003cp\\u003eIn addition to embryonic development, the expression of the activin receptor signaling pathway was also examined in fry, parr, and juvenile RBT epaxial skeletal muscle. The \\u003cem\\u003einhbcb2\\u003c/em\\u003e and \\u003cem\\u003einhbba2\\u003c/em\\u003e genes were the only ligands that exhibited consistently increased expression in parr and juveniles, compared to fry (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea). Approximately half of the ligand gene families (8 out of 17) showed reduced expression in both later life stages and six genes showed elevated expression only in parr with a reduction in expression in juveniles (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea). In contrast to ligands, the majority of receptors had elevated expression levels in parr and juveniles compared to fry (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea). The activin type IIb receptors (\\u003cem\\u003eacvr2ba\\u003c/em\\u003e and \\u003cem\\u003eacvr2bb\\u003c/em\\u003e) were a notable exception as they were all downregulated in parr and juvenile fish compared to fry (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea). The level of \\u003cem\\u003einhbab2\\u003c/em\\u003e (activin Ab2) and all \\u003cem\\u003emstn\\u003c/em\\u003e (\\u003cem\\u003emstna1/2\\u003c/em\\u003e and \\u003cem\\u003emstnb1\\u003c/em\\u003e) ligand ohnologs were significantly higher in fry, parr, and juvenile skeletal muscle than during embryonic development when both of these factors were expressed at only minimal levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eb). Interestingly, activin C (\\u003cem\\u003einhbc\\u003c/em\\u003e) is expressed in the skeletal muscle of fry, parr, and juvenile fish but the ohnologs exhibit differential regulation with age (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ec). The \\u003cem\\u003einhbcb1\\u003c/em\\u003e ohnolog is downregulated with age, while \\u003cem\\u003einhbcb2\\u003c/em\\u003e is upregulated in parr and juveniles compared to fry (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ec).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eTo examine the role of activin ligands during RBT development we employed CRISPR/Cas9 genome editing technology to knockout the function of activin Ab2 (\\u003cem\\u003einhbab2\\u003c/em\\u003e) and activin Aa2 (\\u003cem\\u003einhbaa2\\u003c/em\\u003e) ligands and examine the function of these genes on embryonic development and initial growth. Five successfully edited RBT from \\u003cem\\u003einhbab2\\u003c/em\\u003e and \\u003cem\\u003einhbaa2\\u003c/em\\u003e targeted families were identified by full loss of pigmentation (biallelic knockout of the \\u003cem\\u003eslc45a2\\u003c/em\\u003e gene) and genotyped for loss of function alleles in their targeted genes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea). Random insertion and deletion (InDel) mutations were detected at high frequency in all P0 founders from both \\u003cem\\u003einhbab2\\u003c/em\\u003e and \\u003cem\\u003einhbaa2\\u003c/em\\u003e families and no indels were detected in closely related ohnologs (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea). All of the InDel mutations detected in \\u003cem\\u003einhbab2\\u003c/em\\u003e-targeted fish resulted in null frameshift mutations in the \\u003cem\\u003einhbab2\\u003c/em\\u003e gene (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea). Interestingly, only one \\u003cem\\u003einhbaa2\\u003c/em\\u003e targeted fish was found to contain multiple null frameshift mutations with the other 4 fish presenting both frameshift and in-frame alleles or frameshift and wildtype alleles at the target site (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea). No developmental defects were identified and there was no visual morphological difference between gene edited fry and non-edited wildtype fry (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea). No statistical difference in body length, weight, or condition factor was detected at 2 months of age between \\u003cem\\u003einhbab2, inhbaa2\\u003c/em\\u003e knockout fish and wildtype fish (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThe activin receptor signaling pathway, a member of the transforming growth factor-β superfamily, is highly conserved across vertebrate species but WGD events in the teleost lineage have resulted in significant expansion of the signaling pathway in these species (Huminiecki et al. \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2009\\u003c/span\\u003e; Phelps et al. \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). Despite relative conservation of many signaling pathway components at the protein level, significant differential regulation has been identified between fish and mammals (Rescan et al. \\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e2001\\u003c/span\\u003e; Garikipati et al. \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e; Gabillard et al. \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). We examined the function of the activin receptor signaling pathway across RBT development and in the skeletal muscle of fry, parr, and juvenile fish to gain insight into the function of the pathway in teleost fish. Only a limited number of pathway components were expressed at 80dd of development but \\u003cem\\u003ebambia1\\u003c/em\\u003e, exhibited very high levels of expression in the early embryo which differed significantly from the pattern of expression exhibited by \\u003cem\\u003ebambia2\\u003c/em\\u003e. Bambi is a membrane-bound inhibitor of the activin receptor signaling pathway with a known function in vertebrate development (Onichtchouk et al. \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e1999\\u003c/span\\u003e; Grotewold et al. \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2001\\u003c/span\\u003e). It has been found to be co-expressed with Bmp4 in several vertebrate species and is believed to have a role in regulating Bmp embryonic patterning (Reichert et al. \\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e), however, loss of function studies have not been able to establish a clear developmental phenotype (Chen et al. \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2007\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eWhile most activin ligands and receptors increased expression throughout development the activin type IIb receptors (\\u003cem\\u003eacvr2b\\u003c/em\\u003e) were downregulated over time (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). Activation of the activin receptor signaling pathway requires the recruitment of both type II and type I serine-threonine kinase receptors after ligand binding (Massagu\\u0026eacute; \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e). Loss of acvr2b function in mice leads to reduced follicle-stimulating hormone levels and some skeletal and facial deformities, but the mice are viable (Matzuk et al. \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e1995a\\u003c/span\\u003e). The observation of opposing expression patterns between acvr2a and acvr2b receptors suggests the potential for key functional differences between these receptors during embryonic development in trout. In mammals, the activin type II receptors (A and B) have overlapping functions and can compensate for the loss of a single receptor in skeletal muscle (Lee et al. \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). Whether these receptors have redundant functions in embryonic development in mammals is unknown.\\u003c/p\\u003e \\u003cp\\u003eThe developmental timing of the expression of activin receptor ligands corresponded to the timing of \\u003cem\\u003emyod1\\u003c/em\\u003e expression (i.e., 170 dd; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec and \\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ed). In fact, except for moderate expression of \\u003cem\\u003einhbaa1\\u003c/em\\u003e observed at 80 dd, there was minimal expression of the activin ligands prior to 170 dd (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). Both myostatin and activin A are regulators of skeletal muscle growth in mammals (Latres et al. \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). While myostatin contributes to the regulation of teleost skeletal muscle growth (Ohama et al. \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e), the role of activin A in fish is largely unknown. The activin ligands were expressed at a significantly higher level in the skeletal muscle tissue of fry, parr, and juvenile fish than in embryos. This is especially representative of \\u003cem\\u003einhbab2\\u003c/em\\u003e and \\u003cem\\u003emstnb\\u003c/em\\u003e genes which exhibited little to no expression during embryonic development but were significantly up-regulated in post-hatch skeletal muscle (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). Activin A has been challenging to study in mammals given its multi-functional role in embryonic development, muscle growth, and reproductive development (Latres et al. \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e; Lee et al. \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). Duplication of activin A in RBT may have facilitated diversification (i.e., subfunctionalization) of the activin A ohnologs such that the functions that are carried out by a single gene in mammals are now regulated by independent genes in fish. Interestingly, activin B (\\u003cem\\u003einhbb\\u003c/em\\u003e) exhibited double or triple the level of expression throughout RBT development than activin A (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec). All four of the activin B ohnologs also increased their expression level during RBT development while only the activin Aa ohnologs were expressed in RBT embryos (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec). This may highlight a greater role for activin B in RBT development than activin A. In mice, \\u003cem\\u003einhbb\\u003c/em\\u003e knockout animals are viable but have eyelid fusion defects at birth and are therefore prone to eye lesions and females have significantly impaired reproductive ability (Vassalli et al. \\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e1994\\u003c/span\\u003e). Since activin signaling molecules are dimers they are able to function as either homo or heterodimers between activin A and B proteins (e.g., AA, BB or AB; (Appiah Adu-Gyamfi et al. \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). The signaling dynamics of activin dimers during development is complex and poorly understood but there is strong evidence that activin A can compensate for the loss of activin B (Vassalli et al. \\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e1994\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eDiversification of gene function was observed in the differential expression pattern of activin Cb (\\u003cem\\u003einhbcb\\u003c/em\\u003e) during RBT muscle development. Activin C was not expressed in RBT embryos but activin Cb1 (\\u003cem\\u003einhbcb1\\u003c/em\\u003e) and \\u003cem\\u003einhbcb2\\u003c/em\\u003e were down-regulated and up-regulated in juvenile skeletal muscle, respectively (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ec). Activin C is expressed in the liver and adipose tissue of mammals with no recorded function in skeletal muscle (Goebel et al. \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). It was originally suggested that activin C may be an inhibitor of activin A by forming heterodimers with reduced function, but recent studies have shown that activin C is able to stimulate the activin receptor signaling pathway but that it has lower affinity for acvr2 receptors and is resistant to follistatin inhibition (Goebel et al. \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). More research is needed to understand how activin C functions in fish and what its role is in skeletal muscle growth, given its high expression in this tissue.\\u003c/p\\u003e \\u003cp\\u003eThe activin Aa2 (\\u003cem\\u003einhbaa2\\u003c/em\\u003e) and Ab2 (\\u003cem\\u003einhbab2\\u003c/em\\u003e) genes targeted in CRISPR/Cas9 gene knockout RBT represented one ohnolog from each of the salmonid specific ohnolog pairs (i.e., \\u003cem\\u003einhbaa\\u003c/em\\u003e and \\u003cem\\u003einhbab\\u003c/em\\u003e, Ss4R; (Berthelot et al. \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). The expression of \\u003cem\\u003einhbaa2\\u003c/em\\u003e exhibited a consistent increase in expression throughout development while \\u003cem\\u003einhbab2\\u003c/em\\u003e was not expressed during development but was significantly up-regulated in skeletal muscle after hatch (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). Given this expression pattern, it is hypothesized that only \\u003cem\\u003einhbaa2\\u003c/em\\u003e has a role during embryonic development and that \\u003cem\\u003einhbab2\\u003c/em\\u003e may have specialized for other physiological functions, such as regulating skeletal muscle growth. Activin A knockout mice die shortly after birth from cranial facial deformities (Matzuk et al. \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e1995b\\u003c/span\\u003e). We did not observe any developmental defects in the \\u003cem\\u003einhbaa2\\u003c/em\\u003e or \\u003cem\\u003einhbab2\\u003c/em\\u003e knockout fish. However, while all of the InDel mutations identified in \\u003cem\\u003einhbab2\\u003c/em\\u003e knockout fish resulted in frameshift mutations, only one of the \\u003cem\\u003einhbaa2\\u003c/em\\u003e targeted fish was identified with multiple null mutations. The remaining \\u003cem\\u003einhbaa2\\u003c/em\\u003e targeted fish either had in-frame or wildtype genotypes in addition to having one null allele. While embryonic viability is difficult to quantify in gene-edited founders given the high mortality that naturally occurs after microinjection, the unexpectedly high percentage of in-frame mutant alleles in \\u003cem\\u003einhbaa2\\u003c/em\\u003e targeted fish compared to \\u003cem\\u003einhbab2\\u003c/em\\u003e targeted fish may indicate a role for activin Aa2 in RBT embryonic development. We did not observe any significant difference in weight, length or condition factor in the gene-edited models that were developed (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eb). This is not unexpected as the activin pathway is known to exhibit functionally redundant genes (Lee et al. \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e) and duplication of the pathway in RBT has only increased the potential for redundant relationships between the activin A ohnologs. Myostatin knockout double muscling phenotypes in fish are often limited and may not manifest as an increase in overall size but instead as an increase in muscle mass per body length (i.e., condition factor; Phelps et al. \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e; Kim et al. \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e)). This results in fish with a significantly bulky appearance but may actually exhibit reduced body length compared to controls (Phelps et al. \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e; Kim et al. \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). Given the extensive duplication of the activin receptor signaling pathway in salmonids and the resulting regulatory complexity, more functional studies are needed to determine the role of activin A in embryonic development in trout. The detailed expression profile of the activin pathway as well as the relative lack of full biallelic \\u003cem\\u003einhbaa2\\u003c/em\\u003e knockout fish identified in this study provide clues to the potential importance of activin A for RBT development and that duplication of activin A has led to unique specializations of the gene family in salmonids.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe work was funded by the United States Department of Agriculture, National Institute of Food and Agriculture grant [2021-67015-33400].\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData Availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll NanoString nCounter gene expression data is located in the NCBI Gene Expression Omnibus data archive (GSE224617) and at https://mphelpslab.org/resources.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting Interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors have no competing interests to declare\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors would like to acknowledge the support of animal husbandry staff at the TCSPG for care of experimental fish lines as well as Troutlodge for supplying RBT gametes. \\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eAppiah Adu-Gyamfi E, Tanam Djankpa F, Nelson W, et al (2020) Activin and inhibin signaling: From regulation of physiology to involvement in the pathology of the female reproductive system. Cytokine 133:155105. https://doi.org/10.1016/j.cyto.2020.155105\\u003c/li\\u003e\\n\\u003cli\\u003eBerthelot C, Brunet F, Chalopin D, et al (2014) The rainbow trout genome provides novel insights into evolution after whole-genome duplication in vertebrates. Nature Communications 5:3657. https://doi.org/10.1038/ncomms4657\\u003c/li\\u003e\\n\\u003cli\\u003eBreda L, Rivella S (2014) Modulators of Erythropoiesis: Emerging Therapies For Hemoglobinopathies And Disorders Of Red Cell Production. Hematol Oncol Clin North Am 28:375\\u0026ndash;386. https://doi.org/10.1016/j.hoc.2013.12.001\\u003c/li\\u003e\\n\\u003cli\\u003eChen J, Bush JO, Ovitt CE, et al (2007) The TGF-\\u0026beta; pseudoreceptor gene Bambi is dispensable for mouse embryonic development and postnatal survival. genesis 45:482\\u0026ndash;486. https://doi.org/10.1002/dvg.20320\\u003c/li\\u003e\\n\\u003cli\\u003eChisada S, Okamoto H, Taniguchi Y, et al (2011) Myostatin-deficient medaka exhibit a double-muscling phenotype with hyperplasia and hypertrophy, which occur sequentially during post-hatch development. Developmental Biology 359:82\\u0026ndash;94. https://doi.org/10.1016/j.ydbio.2011.08.027\\u003c/li\\u003e\\n\\u003cli\\u003eCorrigan AZ, Bilezikjian LM, Carroll RS, et al (1991) Evidence for an Autocrine Role of Activin B within Rat Anterior Pituitary Cultures. Endocrinology 128:1682\\u0026ndash;1684. https://doi.org/10.1210/endo-128-3-1682\\u003c/li\\u003e\\n\\u003cli\\u003eCrispo M, Mulet AP, Tesson L, et al (2015) Efficient Generation of Myostatin Knock-Out Sheep Using CRISPR/Cas9 Technology and Microinjection into Zygotes. PLOS ONE 10:e0136690. https://doi.org/10.1371/journal.pone.0136690\\u003c/li\\u003e\\n\\u003cli\\u003eDani C (2013) Activins in adipogenesis and obesity. Int J Obes 37:163\\u0026ndash;166. https://doi.org/10.1038/ijo.2012.28\\u003c/li\\u003e\\n\\u003cli\\u003eDavis AA, Matzuk MM, Reh TA (2000) Activin A Promotes Progenitor Differentiation into Photoreceptors in Rodent Retina. Molecular and Cellular Neuroscience 15:11\\u0026ndash;21. https://doi.org/10.1006/mcne.1999.0806\\u003c/li\\u003e\\n\\u003cli\\u003eDimos B, Phelps M (2023) A homology guide for Pacific salmon genus Oncorhynchus resolves patterns of ohnolog retention, resolution and local adaptation following the salmonid-specific whole-genome duplication event. Ecology and Evolution 13:e9994. https://doi.org/10.1002/ece3.9994\\u003c/li\\u003e\\n\\u003cli\\u003eDutta DJ, Zameer A, Mariani JN, et al (2014) Combinatorial actions of Tgf\\u0026beta; and Activin ligands promote oligodendrocyte development and CNS myelination. Development 141:2414\\u0026ndash;2428. https://doi.org/10.1242/dev.106492\\u003c/li\\u003e\\n\\u003cli\\u003eEdvardsen RB, Leininger S, Kleppe L, et al (2014) Targeted mutagenesis in Atlantic salmon (Salmo salar L.) using the CRISPR/Cas9 system induces complete knockout individuals in the F0 generation. PLoS One 9:e108622. https://doi.org/10.1371/journal.pone.0108622\\u003c/li\\u003e\\n\\u003cli\\u003eGabillard J-C, Biga PR, Rescan P-Y, Seiliez I (2013) Revisiting the paradigm of myostatin in vertebrates: Insights from fishes. General and Comparative Endocrinology 194:45\\u0026ndash;54. https://doi.org/10.1016/j.ygcen.2013.08.012\\u003c/li\\u003e\\n\\u003cli\\u003eGao Y, Zhang R, Dai S, et al (2019) Role of TGF-\\u0026beta;/Smad Pathway in the Transcription of Pancreas-Specific Genes During Beta Cell Differentiation. Frontiers in Cell and Developmental Biology 7:\\u003c/li\\u003e\\n\\u003cli\\u003eGarikipati DK, Gahr SA, Rodgers BD (2006) Identification, characterization, and quantitative expression analysis of rainbow trout myostatin-1a and myostatin-1b genes. Journal of Endocrinology 190:879\\u0026ndash;888. https://doi.org/10.1677/joe.1.06866\\u003c/li\\u003e\\n\\u003cli\\u003eGoebel EJ, Ongaro L, Kappes EC, et al (2022) The orphan ligand, activin C, signals through activin receptor-like kinase 7. eLife 11:e78197. https://doi.org/10.7554/eLife.78197\\u003c/li\\u003e\\n\\u003cli\\u003eGrotewold L, Plum M, Dildrop R, et al (2001) Bambi is coexpressed with Bmp-4 during mouse embryogenesis. Mechanisms of Development 100:327\\u0026ndash;330. https://doi.org/10.1016/S0925-4773(00)00524-4\\u003c/li\\u003e\\n\\u003cli\\u003eHughes PE, Alexi T, Williams CE, et al (1999) Administration of recombinant human activin-A has powerful neurotrophic effects on select striatal phenotypes in the quinolinic acid lesion model of Huntington\\u0026rsquo;s disease. Neuroscience 92:197\\u0026ndash;209. https://doi.org/10.1016/S0306-4522(98)00724-6\\u003c/li\\u003e\\n\\u003cli\\u003eHuminiecki L, Goldovsky L, Freilich S, et al (2009) Emergence, development and diversification of the TGF-\\u0026beta;signalling pathway within the animal kingdom. BMC Evol Biol 9:28. https://doi.org/10.1186/1471-2148-9-28\\u003c/li\\u003e\\n\\u003cli\\u003eKariyawasam HH, Semitekolou M, Robinson DS, Xanthou G (2011) Activin-A: a novel critical regulator of allergic asthma. Clinical \\u0026amp; Experimental Allergy 41:1505\\u0026ndash;1514. https://doi.org/10.1111/j.1365-2222.2011.03784.x\\u003c/li\\u003e\\n\\u003cli\\u003eKhalil K, Elayat M, Khalifa E, et al (2017) Generation of Myostatin Gene-Edited Channel Catfish (Ictalurus punctatus) via Zygote Injection of CRISPR/Cas9 System. Sci Rep 7:7301. https://doi.org/10.1038/s41598-017-07223-7\\u003c/li\\u003e\\n\\u003cli\\u003eKim J, Cho JY, Kim J-W, et al (2019) CRISPR/Cas9-mediated myostatin disruption enhances muscle mass in the olive flounder Paralichthys olivaceus. Aquaculture 512:734336. https://doi.org/10.1016/j.aquaculture.2019.734336\\u003c/li\\u003e\\n\\u003cli\\u003eKishimoto K, Washio Y, Yoshiura Y, et al (2018) Production of a breed of red sea bream Pagrus major with an increase of skeletal muscle mass and reduced body length by genome editing with CRISPR/Cas9. Aquaculture 495:415\\u0026ndash;427. https://doi.org/10.1016/j.aquaculture.2018.05.055\\u003c/li\\u003e\\n\\u003cli\\u003eLatres E, Mastaitis J, Fury W, et al (2017) Activin A more prominently regulates muscle mass in primates than does GDF8. Nat Commun 8:15153. https://doi.org/10.1038/ncomms15153\\u003c/li\\u003e\\n\\u003cli\\u003eLee S-J, Lehar A, Liu Y, et al (2020) Functional redundancy of type I and type II receptors in the regulation of skeletal muscle growth by myostatin and activin A. Proceedings of the National Academy of Sciences 117:30907\\u0026ndash;30917. https://doi.org/10.1073/pnas.2019263117\\u003c/li\\u003e\\n\\u003cli\\u003eLien S, Koop BF, Sandve SR, et al (2016) The Atlantic salmon genome provides insights into rediploidization. Nature 533:200\\u0026ndash;205. https://doi.org/10.1038/nature17164\\u003c/li\\u003e\\n\\u003cli\\u003eLuo J, Song Z, Yu S, et al (2014) Efficient Generation of Myostatin (MSTN) Biallelic Mutations in Cattle Using Zinc Finger Nucleases. PLOS ONE 9:e95225. https://doi.org/10.1371/journal.pone.0095225\\u003c/li\\u003e\\n\\u003cli\\u003eMassagu\\u0026eacute; J (2012) TGF\\u0026beta; signalling in context. Nat Rev Mol Cell Biol 13:616\\u0026ndash;630. https://doi.org/10.1038/nrm3434\\u003c/li\\u003e\\n\\u003cli\\u003eMatzuk MM, Kumar TR, Bradley A (1995a) Different phenotypes for mice deficient in either activins or activin receptor type II. Nature 374:356\\u0026ndash;360. https://doi.org/10.1038/374356a0\\u003c/li\\u003e\\n\\u003cli\\u003eMatzuk MM, Kumar TR, Vassalli A, et al (1995b) Functional analysis of activins during mammalian development. Nature 374:354\\u0026ndash;356. https://doi.org/10.1038/374354a0\\u003c/li\\u003e\\n\\u003cli\\u003eMcPherron AC, Lawler AM, Lee S-J (1997) Regulation of skeletal muscle mass in mice by a new TGF-p superfamily member. Nature 387:83\\u0026ndash;90. https://doi.org/10.1038/387083a0\\u003c/li\\u003e\\n\\u003cli\\u003eMedeiros EF, Phelps MP, Fuentes FD, Bradley TM (2009) Overexpression of follistatin in trout stimulates increased muscling. American Journal of Physiology - Regulatory, Integrative and Comparative Physiology 297:R235\\u0026ndash;R242. https://doi.org/10.1152/ajpregu.91020.2008\\u003c/li\\u003e\\n\\u003cli\\u003eMontague TG, Cruz JM, Gagnon JA, et al (2014) CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Research 42:W401\\u0026ndash;W407. https://doi.org/10.1093/nar/gku410\\u003c/li\\u003e\\n\\u003cli\\u003eOhama M, Washio Y, Kishimoto K, et al (2020) Growth performance of myostatin knockout red sea bream Pagrus major juveniles produced by genome editing with CRISPR/Cas9. Aquaculture 529:735672. https://doi.org/10.1016/j.aquaculture.2020.735672\\u003c/li\\u003e\\n\\u003cli\\u003eOnichtchouk D, Chen Y-G, Dosch R, et al (1999) Silencing of TGF-\\u0026beta; signalling by the pseudoreceptor BAMBI. Nature 401:480\\u0026ndash;485. https://doi.org/10.1038/46794\\u003c/li\\u003e\\n\\u003cli\\u003eOue Y, Kanatani H, Kiyoki M, et al (1994) Effect of local injection of activin A on bone formation in newborn rats. Bone 15:361\\u0026ndash;366. https://doi.org/10.1016/8756-3282(94)90301-8\\u003c/li\\u003e\\n\\u003cli\\u003ePhelps MP, Jaffe IM, Bradley TM (2013) Muscle growth in teleost fish is regulated by factors utilizing the activin II B receptor. J Exp Biol 216:3742\\u0026ndash;3750. https://doi.org/10.1242/jeb.086660\\u003c/li\\u003e\\n\\u003cli\\u003eReichert S, Randall RA, Hill CS (2013) A BMP regulatory network controls ectodermal cell fate decisions at the neural plate border. Development 140:4435\\u0026ndash;4444. https://doi.org/10.1242/dev.098707\\u003c/li\\u003e\\n\\u003cli\\u003eRescan PY, Jutel I, Ralli\\u0026egrave;re C (2001) Two myostatin genes are differentially expressed in myotomal muscles of the trout (Oncorhynchus mykiss). J Exp Biol 204:3523\\u0026ndash;3529\\u003c/li\\u003e\\n\\u003cli\\u003eSakai R, Eto Y (2001) Involvement of activin in the regulation of bone metabolism. Molecular and Cellular Endocrinology 180:183\\u0026ndash;188. https://doi.org/10.1016/S0303-7207(01)00496-8\\u003c/li\\u003e\\n\\u003cli\\u003eVassalli A, Matzuk MM, Gardner HA, et al (1994) Activin/inhibin beta B subunit gene disruption leads to defects in eyelid development and female reproduction. Genes Dev 8:414\\u0026ndash;427. https://doi.org/10.1101/gad.8.4.414\\u003c/li\\u003e\\n\\u003cli\\u003eWu DD, Lai M, Hughes PE, et al (1999) Expression of the activin axis and neuronal rescue effects of recombinant activin A following hypoxic-ischemic brain injury in the infant rat. Brain Research 835:369\\u0026ndash;378. https://doi.org/10.1016/S0006-8993(99)01638-8\\u003c/li\\u003e\\n\\u003cli\\u003eWu H, Mezghenna K, Marmol P, et al (2014) Differential regulation of mouse pancreatic islet insulin secretion and Smad proteins by activin ligands. Diabetologia 57:148\\u0026ndash;156. https://doi.org/10.1007/s00125-013-3079-6\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"marine-biotechnology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"mbte\",\"sideBox\":\"Learn more about [Marine Biotechnology](http://link.springer.com/journal/10126)\",\"snPcode\":\"10126\",\"submissionUrl\":\"https://submission.nature.com/new-submission/10126/3\",\"title\":\"Marine Biotechnology\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"Activin, Myostatin, Rainbow Trout, CRISPR, Skeletal Muscle, Development\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3934487/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3934487/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eActivin signaling is essential for proper embryonic, skeletal muscle, and reproductive development. Duplication of the pathway in teleost fish has enabled diversification of gene function across the pathway but how gene duplication influences the function of activin signaling in non-mammalian species is poorly understood. Full characterization of activin receptor signaling pathway expression was performed across embryonic development and during early skeletal muscle growth in rainbow trout (RBT, \\u003cem\\u003eOncorhynhus mykiss\\u003c/em\\u003e). Rainbow trout are a model salmonid species that have undergone two additional rounds of whole genome duplication. There was limited expression of activin Ab in RBT embryos despite these genes exhibiting significantly elevated expression in post-hatch skeletal muscle. Divergent expression patterns were also observed for activin receptor type IIB ohnologs. CRISPR targeting of activin Aa2 and activin Ab2 did not identify any developmental or growth phenotypes in edited RBT, however, a high percentage of in-frame alleles were identified in activin Aa2 targeted fish. The research identifies mechanisms of specialization among the duplicated activin ohnologs across embryonic development and during periods of high muscle growth in larval and juvenile fish. The knowledge gained provides critical insights into viable gene-targeting approaches for engineering the activin receptor signaling pathway to improve physiological performance in salmonid species.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Activin signaling pathway specialization during embryonic and skeletal muscle development in rainbow trout (Oncorhynchus mykiss)\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-03-05 13:58:48\",\"doi\":\"10.21203/rs.3.rs-3934487/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2024-04-10T21:10:07+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2024-04-04T18:32:59+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2024-03-29T08:40:13+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"478b1d44-74c8-4d76-a8a4-fd297b40b521\",\"date\":\"2024-03-22T15:38:49+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"0f762830-ed79-49d3-a86e-a14dc5d218f2\",\"date\":\"2024-03-21T14:15:05+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"b9aca5c8-9836-4d56-8b1b-68be4882a6a0\",\"date\":\"2024-03-21T13:13:46+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2024-03-21T13:01:03+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2024-03-02T02:07:23+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2024-03-02T02:07:22+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Marine Biotechnology\",\"date\":\"2024-02-06T16:25:11+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"marine-biotechnology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"mbte\",\"sideBox\":\"Learn more about [Marine Biotechnology](http://link.springer.com/journal/10126)\",\"snPcode\":\"10126\",\"submissionUrl\":\"https://submission.nature.com/new-submission/10126/3\",\"title\":\"Marine Biotechnology\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"9005c21e-fb1f-4fe6-b986-dcd82bb17683\",\"owner\":[],\"postedDate\":\"March 5th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-08-01T17:05:17+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-3934487\",\"link\":\"https://doi.org/10.1007/s10126-024-10345-5\",\"journal\":{\"identity\":\"marine-biotechnology\",\"isVorOnly\":false,\"title\":\"Marine Biotechnology\"},\"publishedOn\":\"2024-07-25 16:16:06\",\"publishedOnDateReadable\":\"July 25th, 2024\"},\"versionCreatedAt\":\"2024-03-05 13:58:48\",\"video\":\"\",\"vorDoi\":\"10.1007/s10126-024-10345-5\",\"vorDoiUrl\":\"https://doi.org/10.1007/s10126-024-10345-5\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3934487\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3934487\",\"identity\":\"rs-3934487\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}