{"paper_id":"34ee3c87-c7ea-4d49-b958-958f90fa3d85","body_text":"Halomonas sp. for sustainable agriculture: a potential halo-bio-fertilizer for tomato plants with bio-control activity against Fusarium wilt under saline environments. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Halomonas sp. for sustainable agriculture: a potential halo-bio-fertilizer for tomato plants with bio-control activity against Fusarium wilt under saline environments. Ahmed Ahmed Abdelmonaem Mousa, Wafaa Hanafy Mahmoud, Hosam Easa Elsaied, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5653815/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Halophilic bacteria are remarkable microorganisms that excel in hypersaline environments. Their significant potential in various fields, such as industry and agriculture, positions them as vital players in advancing our technological and ecological efforts. In this study, three bacterial strains were successfully isolated (QSLA1, QSLA2, and QSLA3) from solar saltern ponds using nutrient agar (NA) culture medium derived from pond water. Morphological and physiological characterization revealed that these isolates are rod-shaped, gram-negative, catalase-positive, and motile. Notably, QSLA1 and QSLA2 do not form spores, while QSLA3 is identified as a spore-forming bacterium. The halo tolerance assay demonstrated that QSLA1 and QSLA2 are extremely halophilic, whereas QSLA3 is classified as moderately halophilic. Through 16S rRNA sequence analysis, it was determined that QSLA1 shares 91.26% similarity with Halomonas sp. RS-17, while QSLA2 exhibits 96.6% similarity with Halomonas sp. strain LR2-3. QSLA3 shows even greater similarity at 97.33% to Halomonas sp. GQ30. All isolates are capable of producing indole-3-acetic acid (IAA), but only QSLA2 has the ability to fix atmospheric nitrogen and solubilize insoluble phosphate. Additionally, QSLA1 demonstrates antifungal activity against Fusarium oxysporium f.sp. lycopersici in vitro under saline environment. Given these promising traits, we explored the potential of QSLA1 as a bio-control agent under greenhouse conditions at 1.5% salinity. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Introduction Hypersaline ecosystems are dynamic and diverse habitats that include various terrestrial lakes and deep-sea basins, exhibiting salt concentrations that exceed three times that of seawater, reaching saturation levels. These habitats are effectively categorized into two main types: thalassohaline and athalassohaline waters ( Naghoni et al., 2017 ). Solar salterns, widely distributed across arid and semi-arid regions, can be found at sea level, either as natural formations or as human-made innovations (Ventosa and Arahal, 2011) . Qarun Lake, strategically located in the northern region of Fayoum Governorate, is characterized by its saline, turbid waters and lack of surface outflow (Edbeib et al., 2016) . The solar salterns surrounding Qarun Lake feature a well-structured multi-pond system that is interconnected. These ponds are actively utilized by local companies for the efficient production of salt and minerals. Halophiles, the remarkable salt-loving microorganisms that thrive in saline environments, are integral components of hypersaline ecosystems. They span all three domains of life: Archaea, Bacteria, and Eukarya (Edbeib et al., 2016) . These halophilic bacteria present significant opportunities in agriculture, where they can be employed for bio-control of phytopathogens, the solubilization of essential nutrients, and the stimulation of plant growth through the production of beneficial growth factors (Mohammadipanah et al., 2015) . Tomato fruits ( Lycopersicon esculentum ) rank among the most popular and widely consumed vegetables globally, especially in Egypt ( Amer et al., 2014 ). However, tomato plants face challenges from various fungal diseases, with Fusarium wilt being one of the most critical. Caused by the soil-borne fungus Fusarium oxysporum f.sp. lycopersici (Fol), this disease can lead to significant yield losses in both greenhouse and field conditions ( Srinivas et al., 2019 ). In Egypt, Fusarium wilt can reduce yields by as much as 25% (Abdel-Monaim, 2012) . The pathogen infiltrates the plant through the roots, colonizes the vascular tissues, clogs the xylem, and induces water stress, which manifests as wilt-like symptoms ( Srinivas et al., 2019 ). Research by Zouaoui et al. (2007) has demonstrated the effectiveness of moderately halophilic bacteria, particularly Bacillus subtilis J9 and Halomonas sp. K2-5, in managing stem canker in greenhouse tomatoes. Halomonas sp., isolated from a saline habitat in northeastern Algeria, has shown a broad spectrum of antifungal activity against pathogens such as Fusarium oxysporum, Botrytis cinerea, Phytophthora capsici , and F. verticillioides ( Menasria et al., 2019 ). In this study, halophilic bacterial strains were isolated from the solar saltern ponds of a local salt and mineral company. The strains were rigorously tested for their potential to enhance plant growth and exhibit antimicrobial activities against plant pathogens. We meticulously assessed the impact of the isolate QSLA1 on Fusarium wilt disease as well as its effects on the growth of tomato seedlings under saline conditions in controlled greenhouse environments. Materials and Methods Bacterial isolates In September 2019, water samples were collected from solar saltern ponds, ensuring a comprehensive analysis of their properties. After filtering to remove impurities, the salt concentration was accurately assessed using a refractometer and pH levels were determined with precision using a pH meter. Ten liters of water were gathered from each pond in sterile plastic jars, which were meticulously placed in ice packs for transportation to the biotechnology laboratory in the Botany Department at Menoufia University. To isolate bacteria, we employed a sterilized Nutrient Agar (NA) medium. A 100 µl aliquot of each water sample was streaked onto NA plates and incubated at 30°C for periods ranging from 7 to 30 days, following the established methodology by Benito et al. ( 2004 ). Subsequent streaking and sub-culturing were conducted on NA culture medium prepared from the pond water, successfully purifying the isolates, which were then preserved in 30% glycerol and stored in a freezer for future analysis. Morphological and Physiological Characterization of the Isolates The colonies that developed on the plates underwent thorough morphological examination, focusing on their shape, pigmentation, elevation, and optical properties. Additional parameters, including shape analysis, gram staining, endospore formation ( Hucker & Conn 1923 ) were rigorously tested, motility using the hanging drop method ( Goszczynska et al. 2000 ), and catalase activity ( Whittenbury 1964 ) . Salinity Tolerance of the Isolates The bacterial isolates were effectively screened for salt tolerance by using a NA culture medium supplemented with varying concentrations of NaCl (0%, 7%, 12.5%, 20%, and 22%). The plates were incubated for 7 days at 30°C, and the growth results were meticulously recorded ( Ramadoss et al. 2013 ). Molecular Identification of the Isolates via 16S rDNA DNA Extraction and Polymerase Chain Reaction (PCR) Genomic DNA was extracted from bacterial cells cultured aerobically in nutrient broth, following the proven protocol of Broderick et al. ( 2004 ). The extracted DNA was purified, visualized under UV light with ethidium bromide staining ( Sambrook et al. 1989 ), and securely stored at -20°C until needed ( Mwirichia et al. 2010 ). Utilizing bacterial primers 27F and 1492R, as specified in Table 1 , the 16S rRNA gene sequence was successfully amplified using a model PTC-100 thermal cycler (MJ Research Inc., USA) according to Roux ( 1995 ) . The presence of amplified products was confirmed by applying 7 µl of the PCR product onto a 1% agarose gel in 1X TAE buffer containing ethidium bromide, and visualized the results with a gel documentation system (Bio-Rad Laboratories) ( Sambrook et al. 1989 ). The PCR products were purified using the QIA quick PCR purification kit protocol (Qiagen) and promptly sent for sequencing. Table (1): Used primers for PCR 16S rRNA sequencing analysis ( van der Lelie et al 2011 ). Primer name Orientation Priming site Sequence (5´- 3´) 27F Forward 8–27 AGAGTTTGATCCTGGCTCAG 1492R Reverse 1492–1513 GGTTACCTTGTTACGACTT 16S rRNA sequencing The sequencing was expertly conducted by Colors Laboratories at El-Etihad Square in Maadi, Cairo, Egypt, following rigorous laboratory protocols. The sequences were thoroughly edited using the Complete Deletion option to eliminate all gaps, utilizing CHROMAS PRO software, version 1.5. Evolutionary Relationships of Taxa The resultant 16S rRNA gene sequences were successfully compared with those available in the GenBank databases using the highly effective Basic Local Alignment Search Tool (BLAST) on the National Center for Biotechnology Information (NCBI) website ( http://www.ncbi.nih.gov ). For alignment, CLUSTAL W 1.6 software was employed ( Altschul et al., 1997 ), ensuring precise and reliable results. The evolutionary history was robustly inferred using the Neighbor-Joining method ( Saitou and Nei, 1987 ). Evolutionary analyses were carried out with confidence using MEGA X ( Kumar et al., 2018 ). The sequences were meticulously aligned using the embedded MUSCLE algorithm, and the resulting output was leveraged to construct a phylogenetic tree by calculating distance matrices for Neighbor-Joining (NJ) analysis. Evaluation of Plant Growth under Laboratory Conditions The isolates were rigorously evaluated for their growth-promoting properties, with all analyses conducted in duplicate to ensure accuracy. The inoculum for screening was expertly prepared by cultivating halo-bacteria in 20 ml of nutrient broth culture medium, enriched with a 12.5% salt concentration, and subjected to shaking at 120 rpm for three days. Nitrogen Fixation Test The capability of bacterial isolates to fix free nitrogen was thoroughly tested using Ashby-free N-agar medium, following the established protocol by Kizilkaya ( 2009 ). Bacteria that successfully grew in this medium are unequivocally identified as nitrogen-fixing organisms, confirming findings by Kesaulya et al. ( 2021 ). Phosphate Solubilization Assay The potential of isolates to solubilize inorganic phosphate was determined using the disk diffusion method on a modified Pikovskaya agar culture medium, in accordance with the methodology outlined by Widawati ( 2005 ). Colonies of phosphate-solubilizing bacteria (PSB) were clearly identified by the distinct diffusion zones surrounding them, as highlighted by Kesaulya et al. ( 2021 ). Indole Acetic Acid (IAA) Production Assay Isolates were confidently screened for IAA production utilizing a refined quantification method pioneered by Gordon and Weber ( 1950 ). The production of IAA by bacterial isolates was clearly indicated by a distinct pink color change upon the addition of Salkowski's reagent, as illustrated in Fig. (3). The IAA concentration was accurately estimated against a well-prepared standard curve derived from various concentrations of IAA (Sigma-Aldrich, Germany), following the methodology established by Sarker and Al-Rashid ( 2013 ). Antagonistic Activity of the isolates against Plant Pathogens The antifungal activity of bacterial isolates was rigorously assessed through co-cultivation of macro-colonies against key pathogens, including Fusarium oxysporum f.sp. lycopersici , a well-known cause of tomato vascular wilt disease ( Srinivas et al., 2019 ); Alternaria solani , responsible for early blight in tomato and potato plants ( Gulzar et al., 2021 ); and Botryodiplodia theobromae , which leads to die-back and stem-end rot in mango fruits ( Meah et al., 1991 ). For this assessment, the pathogens were strategically inoculated onto NA culture medium (with a concentration of 12.5% NaCl) at the center of the plate, while the halophilic bacteria inoculated around the fungus. The antagonistic properties of the bacteria were determined by measuring the zones of inhibited fungal growth, while NA plates inoculated solely with the pathogens served as an effective negative control. All cultures were incubated at a consistent temperature of 25°C for 7 days, as outlined by Puchkova et al. ( 2020 ). Also an impactful evaluation of the antibacterial activity of the isolates against Ralstonia solanacearum NRRL B-3211, a notorious cause of bacterial wilt affecting a broad spectrum of host plants ( Peeters et al., 2013 ), was conducted using the well-established disc diffusion method described by Rani and Kalaiselvam ( 2013 ). Determination of Bioactive Chemical Constituents Produced by QSLA1 Isolate Using GC–MS Analysis The chemical compounds produced by the selected isolate QSLA1 were thoroughly evaluated and analyzed using Gas Chromatography-Mass Spectrometry (GC-MS). A precise liquid-liquid extraction of bioactive compounds was executed following the protocol of Farajzadeh et al. ( 2011 ). The comprehensive chemical composition of metabolites extracted was detected using a GC-TSQ mass spectrometer (Thermo Scientific, Austin, TX, USA) with a direct capillary column TG–5MS (30 m × 0.25 mm × 0.25 µm film thickness), as detailed by Boussada et al. ( 2008 ). The percentage composition of each compound was diligently calculated as the ratio of the peak area to the total chromatographic area, with GC-MS peaks confidently assigned through comparison with established data, achieving similarity percentages from the Wiley 275 libraries, as reported by Managamuri et al. ( 2017 ). Controlling Tomato Fusarium Wilt Pathogen Using QSLA1 ( Halomonas sp.) under Greenhouse Conditions Preparation of Fungal Inoculum Tomato seedlings (halophyte strain 023) that were 35 days old were utilized for the study. The fungal inoculum was prepared following the method established by Gomaa et al. ( 2022 ). The fungal strain Fusarium oxysporum subsp. lycopersici was cultivated on sterilized barley grain medium, consisting of 100 g of washed, dried barley grains mixed with 65 ml of tap water per bottle. Inoculation of the barley was performed with uniform 5 mm agar discs of Fusarium oxysporum , which had been grown on a PDA medium with 3.5% salt for a period of 4 days. The bottles were incubated at 28°C for two weeks, allowing ample growth of the fungal isolates. Pots Preparation and Inoculation Fertile soil was sourced from the surface layer of the experimental farm at the Faculty of Agriculture, Menoufia University, and was sterilized using a 5% formalin solution. The preparation of pots and inoculation was executed as per the protocol outlined by Gomaa et al. ( 2022 ) as follows: The formalin-disinfected clay pots (30 cm in diameter) were filled with a mixture of sterilized soil and compost (at a 1:3 ratio) to a weight of 3 kg per pot. The potted soil was artificially infested with the inoculum at 3% (w/w) and was watered twice a week with saline water (1.5%) for seven days prior to planting. Control pots containing soil and compost (1:3) without inoculation were also prepared. Tomato seedlings of cultivar 023, which had been grown for 35 days in seed boxes filled with a peat-moss vermiculite mixture (1:1 w/w), were uprooted and transplanted into the pots at a rate of 2 seedlings per pot. Each treatment included three replicates. Immediately after transplanting, the pots were irrigated and subsequently, each seedling received 20 ml of saline water (1.5%) daily. The treatments implemented were as follows: Treatment S = Tomato pots irrigated with salt water (1.5%); Treatment H = Tomato seedlings treated with QSLA1 isolate (10 − 2 ); Treatment F = Tomato seedlings infected with 3% (w/w) of Fusarium oxysporum subsp. lycopersici ; Treatment HF = Tomato seedlings infected with 3% (w/w) of Fusarium oxysporum subsp. lycopersici and inoculated with QSLA1 (10 − 2 ). All treatments were irrigated with salt water (1.5%). The wilt disease incidence percentage (WDI%) and severity percentage (WDS%) were determined and calculated after 28 days of transplanting, based on a 0–4 scale as described by Gomaa et al. ( 2022 ), where: 0 = No infection, 1 = Slight infection (approximately 25% of the total), characterized by one or two yellowed leaves, 2 = Moderate infection (two or three yellowed leaves, 50% wilted), 3 = Extensive infection (all leaves yellowed, 75% wilted, growth inhibited), and 4 = Complete infection (the entire plant yellowed, 100% wilted, leading to plant death). Disease severity was calculated accordingly. % Disease severity = [Σ (a × b) / N × K] × 100 Where (a) represents the number of infected plants in each category, (b) is the numerical value of that category, (N) is the total number of examined plants, and (K) signifies the highest degree of infection category. We recorded disease incidence for each individual treatment using the appropriate formula. To evaluate the effectiveness of QSLA1 in controlling Fusarium wilt under salinity stress, root length, shoot height, and shoot infected length were measured with precision. The shoot infected length was defined as the length of the browned area at the bottom of the shoot, conclusively indicating the presence of the pathogen ( Segarra et al., 2009 ). Statistical Analysis The data underwent rigorous statistical analysis using analysis of variance (ANOVA). Differences between means were firmly evaluated using a high-range statistical domain with Tukey’s post hoc analysis, enabling us to distinguish between homogeneous and heterogeneous groups across various variables. We established significance for multiple comparisons of means at a probability level of \\( p = 0.05 \\). The results are presented as average means ± standard deviations (SD) from triplicate measurements, ensuring robust and reliable findings. Results and Discussion Isolation and Purification of Halophilic Bacteria from Solar Saltern Water Bacterial Isolates Bacterial isolates, QSLA1 and QSLA3, were successfully obtained from the second pond with an 8.2% salt concentration, while the QSLA2 strain was isolated from the third pond, exhibiting a salinity of 17.2%. These isolates were effectively cultured on nutrient agar (NA) culture medium prepared with saline water sourced directly from the pond samples, rather than distilled water. Cultural, Morphological, and Biochemical Characterization of the Isolates Cultural, morphological, and biochemical characterizations, which play a critical role in the partial identification of microorganisms ( Suthar et al., 2017 ) were comprehensively conducted. It was confirmed that all three isolates were gram-negative, motile, catalase-positive, and rod-shaped. Notably, QSLA2 demonstrated spore formation, while the other two isolates did not exhibit this characteristic, as documented in Tables 2 and 3 . These findings reinforce our understanding of the isolates' properties and their potential applications. Table (2): Colony morphology of isolates on nutrient agar plates (12.5% NaCl). Tested characters Isolate Colony shape Colony edge Opacity Elevation Size Pigmentation Appearance QSLA1 Round Lobate Translucent Flat Pin point Creamy Shinny QSLA2 Round Lobate Opaque Raised Small White Shinny QSLA3 Irregular Ragged Translucent Flat Small Creamy Shinny Table (3): Morphological and biochemical characterization of the isolates. Tested characters Isolate Shape Concentration of the isolation pond(% NaCl) Gram stain Catalase test Motility Spore forming QSLA1 Rod shape 8.2 G − + + – QSLA2 Rod shape 17.2 G − + + + QSLA3 Rod shape 8.2 G − + + – Salinity Tolerance of the Isolates The salinity tolerance tests clearly demonstrated that none of the isolates could grow without salt (0% NaCl). In contrast, all isolates thrived on NA culture medium containing 7% and 12.5% NaCl. Notably, QSLA1 and QSLA2 exhibited remarkable growth on NA culture medium with 20% NaCl, with QSLA2 even thriving in medium with 22% NaCl (see Table 4). As established by Mohamedin et al. ( 2018 ), moderate halophiles typically prosper in environments with 0.5 to 2.5 M NaCl (approximately 3–15% NaCl), while extreme halophiles flourish in conditions with 2.5 to 5.2 M (saturated) NaCl (15–30% NaCl) and cannot survive without salt. Thus, the inability of these isolates to grow in the absence of NaCl decisively confirms their classification as halophilic bacteria. Among them, QSLA1 and QSLA3 are confidently identified as moderately halophilic, while QSLA2 is undoubtedly recognized as an extreme halophilic bacterium. Table (4): Salinity tolerance assay of the isolates (NaCl %). Isolates NaCl concentration (%) Zero 7 12.5 20 22 QSLA1 – + + + – QSLA2 – + + + + QSLA3 – + + – – Naghoni et al. ( 2017 ) successfully isolated halophilic bacterial strains from three distinct basins of Lake Meyghan, each characterized by varying salinity levels: a green brine with approximately 50 g/L salinity, a red brine with around 180 g/L salinity, and a white brine with about 300 g/L salinity. In a separate study, Ghozlan et al. ( 2006 ) isolated moderately halophilic bacteria from hypersaline environments, specifically solar salterns and salt lakes in Alexandria, Egypt. Notably, 85% of their isolates were Gram-negative, while the remaining 15% were Gram-positive. Paul et al. ( 2015 ) identified forty-six halo-bacterial isolates from soil and water samples at Sambhar Lake. Remarkably, all isolates demonstrated tolerance to 10% NaCl, with forty-four cultures exhibiting resilience to 15% NaCl, and three out of ten selected cultures tolerating as much as 25% salt. Molecular Identification of the Isolates via 16S rDNA In addition to performing cultural, morphological, and biochemical characterization, the 16S rDNA genes of the isolates were sequenced and analyzed for molecular identification. The resultant sequences were meticulously compared against those in the NCBI BLAST database. The analysis revealed that isolate QSLA1 is closely related to the Halomonas sp. strain RS-17, with a strong similarity of 91.26%. Isolate QSLA2 was identified as Halomonas sp. strain LR2-3, showing 96.6% similarity, while QSLA3 was confirmed as Halomonas sp. GQ30, exhibiting an impressive 97.33% similarity. Evolutionary Relationships of Taxa Using the Clustal W program, the sequences were aligned and the MEGA X program was employed to construct a phylogenetic tree. Results clearly demonstrate that these isolates belong to the class Gammaproteobacteria, as depicted in Fig. (1) . This robust phylogenetic affiliation underscores the significance of our research in understanding halophilic microbial diversity. Figure (1): Phylogenetic tree constructed using neighbor-joining analysis based on 16S rDNA sequences from the isolates and closely related sequences deposited in GenBank. The three isolates have been deposited in the NCBI GenBank under the accession numbers listed in Table 5. Table (5): Accession numbers of the sequences of submitted isolates deposited in NCBI GenBank.. Isolates Organisms Strains in Genebank Accession numbers QSLA1 Halomonas Halomonas sp. strain QSLA1 OP442496 QSLA2 Halomonas Halomonas sp. strain QSLA2 OP442497 QSLA3 Halomonas Halomonas sp. strain QSLA3 OP442498 Naghoni et al. ( 2017 ) successfully isolated 361 halobacterial strains from three distinct basins of Lake Meyghan, each exhibiting varying salinities. These strains are classified into several key classes, including Gammaproteobacteria, Alphaproteobacteria, Bacteroidetes, and Firmicutes, representing a diverse range of genera. Menasria et al. ( 2019 ) identified 74 halophilic bacteria from the saline ecosystems of Algeria's Sebkha and Chott lakes, which are located in arid and semi-arid ecoclimate zones. Notably, 16 of these isolates were closely related to the genus Halomonas . Chen and colleagues (2010) isolated moderate halophilic strains from solar salterns, and their phylogenetic analysis confirmed affiliations with five notable genera: Bacillus, Halobacillus, Planococcus, Salinicoccus , and Halomonas . In a study by Ghozlan et al. ( 2006 ), taxonomic analyses of moderately halophilic bacteria isolated from hypersaline habitats—specifically solar salterns and salt lakes in Alexandria, Egypt—revealed that a remarkable 85% of the isolates belonged to the γ-Proteobacteria. Five genera were precisely identified: Pseudoalteromonas, Flavobacterium, Chromohalobacter, Halomonas , and Salegentibacter . Romania's salt lakes, which have salinities exceeding 70 g/L, are home to bacteria from three predominant phyla: Firmicutes, Proteobacteria, and Actinobacteria, with Halomonas standing out as the most representative genus within the Proteobacteria phylum ( Ruginescu et al., 2020 ). Importantly, in vitro assessments of plant growth-promoting traits underscore the significant potential of halophilic and halotolerant bacteria to enhance plant growth. This approach is essential for the development of effective bio-inoculants for saline soils ( Paul et al., 2015 ). All isolates demonstrated robust plant growth-promoting activities, such as phosphorus solubilization, production of indole-3-acetic acid (IAA), and nitrogen fixation (Table 6). Table (6): plant growth promoting ability results of the isolates. Isolates Nitrogen fixation (Ashby medium) IAA production Phosphate solubilization QSLA1 – + – QSLA2 + + + QSLA3 – + – Nitrogen Fixation and Phosphate Solubilization Assay The results clearly demonstrate that the QSLA1 and QSLA3 isolates do not have the capability to fix nitrogen, as they failed to grow on Ashby N-free culture medium. Furthermore, they do not solubilize phosphate, as indicated by the lack of clear zones around their colonies on Pikovskaya (PVK) agar plates (Fig. 2) . In stark contrast, the QSLA2 isolate has proven to be effective in both solubilizing phosphate (Fig. 2) and fixing nitrogen. Figure (2): PVK agar plates distinctly exhibit clear zones around the positive bacterial isolates with a concentration of 12.5% NaCl. Indole Acetic Acid (IAA) Production Assay All isolates tested demonstrated the ability to produce Indole acetic acid (IAA) in NA culture medium enriched with L-tryptophan (see Table 7 and Fig. 3 ). Notably, the QSLA1 isolate achieved the highest IAA production at 15.45 µg/ml, followed closely by QSLA3 at 14.30 µg/ml (refer to Table 7 ). The differences in IAA production between the QSLA1 isolate and the other two isolates were statistically significant, while the QSLA2 and QSLA3 isolates showed no significant differences in their production levels ( see Table 7 and Fig. 4) . In their study, Ferreira et al. ( 2021 ) successfully isolated 120 salt-tolerant bacterial strains from various locations along Portugal's coastline. Among these, Halomonas titanicae was particularly noteworthy for its capacity to fix nitrogen, solubilize phosphate, and produce IAA at a concentration 12.22 µg/ml. Furthermore, Tiwari et al. ( 2011 ) isolated a salt-tolerant strain, Halomonas sp. that exhibited impressive plant growth-promoting traits including phosphate solubilization and nitrogen fixation in high-salinity habitats in India. Desale et al. ( 2014 ) underscored the exceptional growth-promoting potential of the moderate halophile Halomonas sp. MAN5, which not only produced 95.3 µg/ml of IAA but also solubilized 53 parts per million (ppm) of phosphates in the presence of 15% NaCl. Table (7): IAA Concentration Produced by the Isolates (Means + Standard Deviation). Isolates IAA concentration (µg/ml) ± S.D QSLA1 0.15 ± 0.09 a QSLA2 15.45 ± 0.91 b QSLA3 14.30 ± 0.97 b Values are means ± standard deviation of three replicates b = higher valuea = lower value Figure (3): demonstrates the vibrant color development resulting from the Indole-Salkowski reagent reaction in nutrient broth medium enriched with 1% L-tryptophan. Figure (4): Concentrations of IAA produced in NB medium supplemented with 1% l-tryptophan. The variation in IAA concentrations among the different bacterial isolates can be attributed to their distinct abilities to utilize tryptophan or to the diverse pathways involved in IAA biosynthesis, including Indole-3-Pyruvic Acid, Tryptamine, and Indole-3-Acetonitrile ( Kesaulya et al., 2021 ). In vitro Antagonistic Activity of the Isolates against Plant Pathogens Isolate QSLA1 exhibited notable antifungal activity against Fusarium oxysporum f.sp. lycopersici and Alternaria solani , effectively limiting mycelial growth in a co-cultivation plate assay. Additionally, it demonstrated significant antibacterial activity against Ralstonia solanacearum using the disc diffusion method at a 12.5% salt concentration. In contrast, isolates QSLA2 and QSLA3 displayed antibacterial activity exclusively against Ralstonia solanacearum (see Table 8 and Fig. 5 ). Consequently, isolate QSLA1 has been selected for further studies due to its impressive antagonistic activity against multiple pathogens. Table (8): results of antagonistic activity of the isolates against plant pathogens in vitro Isolate Fusarium oxysporium Alternaria solani Ralstonia solanacearum QSLA1 + + + QSLA2 – – + QSLA3 – – + Figure (5): the antagonistic effects of the isolates against Fusarium oxysporum (A), Alternaria solani (B), and Ralstonia solanacearum (C) were compellingly demonstrated at a 12.5% NaCl concentration. Determination of Bioactive Chemical Constituents Produced by QSLA1 Isolate Using GC–MS Analysis The bioactive chemical constituents produced by the QSLA1 isolate were successfully identified through comprehensive GC–MS analysis. Insights from unpublished bioinformatics data prompted a decisive investigation into the bioactive compounds released by halophilic isolates. As a result, the extract from QSLA1 underwent thorough GC–MS analysis (see Fig. 6), revealing its metabolic profile and identifying the specific chemical compounds present (refer to Table 9). Table (9): The chemical compounds detected in the culture supernatant of QSLA1 after centrifugation, as revealed by the GC–MS analysis, clearly underscore the remarkable bioactive potential of this isolate. No. Compound Name Rt (Min) Area % Molecular Formula Molecular Weight Function (PubMed) 1 Desulphosinigrin 13.70 0.23 C 10 H 17 NO 6 S 279 Antibacterial 2 Decanoic Acid, Ethyl Ester 15.29 0.04 C 12 H 24 O2 200 Antibcterial 3 Undeca-2,4,6,8,10-Pentaenal, 11-(2-Furyl)-, Oxime 16.35 0.10 C 12 H 26 O 5 S 282 Antibacterial/ Antifungal 4 Hexadecanoic Acid, Methyl Ester 23.11 33.22 C 17 H 34 O 2 270 Antimicrobial 5 Strychane, 1-acetyl-20à-hydroxy-16-methylene 23.97 .11 C 21 H 26 N 2 O 2 338 Antimicrobial 6 Curan-17-oic acid, 19,20-dihydroxy-, methyl ester, (19S) 24.94 1.39 C 20 H 26 N 2 O 4 358 Antimicrobial 7 Cyclopropaneoctanoic acid, 2-[[2-[(2-ethyl cyclopropyl) methyl] cyclopropyl]methyl]-, methyl ester 26.19 .071 C 22 H 38 O 2 334 Antimicrobial 8 Palmitic Acid 30.16 0.59 C 16 H 32 O 2 256 Antibacterial 9 cis-Vaccenic acid 30.63 0.10 C 18 H 34 O 2 282 Antimicrobial 10 Ethanimidothioic Acid, 2-(Dimethylamino)-N-[[(Methylamino)Carbonyl] Oxy]-2-Oxo-, Methyl Ester 34.26 0.27 C 7 H 13 N 3 O 3 S 219 Insecticide Figure (6): The GC-MS chromatogram from the supernatant of the QSLA1 isolate reveals a rich array of bioactive compounds. Notably, the main chemical constituents identified include Hexadecanoic Acid, Methyl Ester (33.22%), 9-Octadecenoic Acid, (2-Phenyl-1,3-Dioxolan-4-Yl)Methyl Ester, Cis (6%), and d-Lyxo-d-manno-nononic-1,4-lactone (2.94%). Other significant compounds are Curan-17-oic acid, 19,20-dihydroxy-, methyl ester, (19S) (1.39%), Cyclopropanedodecanoic acid, 2-octyl-, methyl ester (1.39%), and several others, including 13,16-Octadecadiynoic Acid, Methyl Ester (1.27%) and Palmitic Acid (0.59%). The majority of these constituents are fatty acids and fatty acid derivatives, recognized for their biosurfactant properties and antimicrobial activity ( Gayathiri et al., 2022 ; Darwesh et al., 2021 ). Additionally, compounds such as Reynosin (lactone) (0.25%) and Leukotriene F4 (0.19%) showcase notable bioactive potential, contributing to antifungal, antitumor, antibacterial, and antioxidant properties ( Krishnaveni, 2015 ). The dominant presence of fatty acids in the extract underscores their therapeutic significance. Research by Tanvir et al. ( 2018 ) emphasizes fatty acids and their derivatives as versatile agents against various health issues, including cancer and bacterial infections. Furthermore, Mao et al. ( 2020 ) demonstrate that acids like 3-hydroxydecanoic acid and decanoic acid, sourced from Lactobacillus plantarum , exhibit strong antibacterial properties. Fatty acids have also been shown to disrupt bacterial growth by altering membrane permeability and inhibiting fatty acid synthesis ( Teh et al., 2017 ). Moreover, Sari et al. ( 2020 ) highlight antibiotics and biosurfactants derived from Halomonas meridiana BK-AB4, reinforcing the importance of these compounds in combating pathogens. Controlling Tomato Fusarium Wilt Pathogen with QSLA1 ( Halomonas sp.) A pot experiment has successfully demonstrated the efficacy of QSLA1 against Fusarium oxysporum f.sp. lycopersici , showcasing its remarkable ability to control Fusarium wilt disease in tomatoes, particularly under saline conditions (1.5% salt water) (Fig. 7). Figure (7): A greenhouse experiment clearly demonstrated significant differences among treatments after 28 days. Throughout the 28-day experiment, notable differences in symptoms emerged between the seedlings inoculated solely with Fusarium (treatment F) and those treated with both QSLA1 isolate and Fusarium (treatment HF). After just 7 days post-transplanting, yellowing of the leaves was observed, often concentrated on one side of the plant, resulting from impaired lateral water translocation (Corden and Chambers, 1966 ). This symptom was evident in both treatment F and treatment HF. By the 21-day mark, seedlings treated with Fusarium alone (treatment F) displayed severe symptoms, including wilting, browning of the above-ground portion, and drooping of lower leaves. Figure (8) clearly demonstrates the progression of Fusarium wilt symptoms throughout the experiment. The results for the other treatments reveal that seedlings inoculated with QSLA1 alone (Treatment H) remained remarkably healthy, displaying vibrant green leaves. In stark contrast, the untreated control group (Treatment S) showed no symptoms in any of the plants, as illustrated in Fig. 9. Figure (9): Impact of inoculation with isolate QSLA1 on tomato seedlings after 28 days. Our findings clearly demonstrate that after 28 days of transplanting under greenhouse conditions, QSLA1 is highly effective in reducing the incidence of Fusarium wilt in tomatoes by an impressive 33.3% in seedlings treated with both QSLA1 isolate and Fusarium (treatment HF). In contrast, seedlings treated with Fusarium alone (treatment F) exhibited a 100% disease incidence (refer to Table 10 and Fig. 10). Moreover, the severity of Fusarium disease in seedlings treated with the QSLA1 isolate combined with Fusarium (treatment HF) was significantly reduced by 12.5% compared to those treated solely with Fusarium (treatment F), which showed an 83.3% disease severity, as confirmed by the equation established by Gomaa et al. ( 2022 ) (see Table 10 and Fig. 11) . Table (10): the effects of inoculation with isolate QSLA1 on tomato seedlings under various treatment conditions. Treatments Root length (cm) Shoot height (cm) Shoot infection length (cm) Disease incidence (%) Disease severity (%) Only fresh water 5.50 ± 0.50 a 15.97 ± 0.25 d ND ND ND Only salt water (1.5%) (S) 6.43 ± 0.25 b 12.80 ± 0.20 b ND ND ND QSLA1 only + Salt water (1.5%) (H) 8.73 ± 0.46 d 15.80 ± 0.20 d ND ND ND Salt water (1.5%) + Fusarium only (F) 5.07 ± 0.12 a 11.17 ± 0.15 a 3.63 ± 0.12 b 100 b 83.3 b QSLA1 + Salt water (1.5%) + Fusarium (HF) 7.50 ± 0.36 c 14.27 ± 0.25 c 1.60 ± 0.36 a 33.3 a 12.5 a Values are means ± standard deviation of three replicates d = higher value a = lower value ND = not detected Figure (10): Effect of inoculation with isolate QSLA1 on disease incidence of tomato seedlings infected with Fusarium oxysporium sub sp. lycopersci after 28 days. Figure (11) Effect of inoculation with isolate QSLA1 on disease severity percentage on tomato seedlings infected with Fusarium oxysporium sub sp. lycopersici after 28 days. Plants treated with the QSLA1 isolate in conjunction with Fusarium (treatment HF) and those treated with Fusarium alone (treatment F) exhibited a clear browning zone at the base of the seedling shoots, resulting from pathogen colonization of the tissues. This browning was quantitatively assessed as shoot infection length ( see Fig. 12). The results clearly demonstrated a significant difference in shoot infection length, with tomato seedlings treated with the QSLA1 isolate and Fusarium (treatment HF) showing a length of 1.6 cm, compared to 3.63 cm for those treated with Fusarium only (treatment F) (refer to Table 10 and Fig. 13 ). Moreover, inoculation with QSLA1 significantly stimulated both shoot height and root length. The treated tomato plants achieved a shoot height of 14.3 cm and a root length of 7.5 cm, whereas seedlings treated with Fusarium alone (treatment F) measured 11.1 cm in height and 5.1 cm in root length (see Table 10 ). These differences were statistically significant and underscored the beneficial effects of QSLA1 inoculation (refer to Figs. 14 and 15 ). These results underscore the significant effects of the QSLA1 isolate on plant growth and infection dynamics, also highlights the potential of isolate QSLA1 in promoting seedling growth even in the presence of this pathogen. Figure (12): the impact of the QSLA1 isolate on shoot height (1), root length (2), and shoot infection length (3) after 28 days. Figure (13): the significant impact of inoculation with isolate QSLA1 on the length of shoot infection in tomato seedlings infected with Fusarium oxysporum subsp. lycopersici after 28 days. Figure (14): the significant impact of inoculation with isolate QSLA1 on the shoot height of tomato seedlings infected with Fusarium oxysporum f. sp. lycopersici after 28 days. Figure (15): Impact of Inoculation with Isolate QSLA1 on Root Length of Tomato Seedlings Infected with Fusarium oxysporum f.sp. lycopersici after 28 Days. The infection process begins with fungal hyphae adhering to and penetrating the root surface. The mycelium invades the root cortical cells intercellularly, subsequently entering the vascular system through the xylem. This fungus exhibits a distinct infection pathway, effectively colonizing exclusively inside the xylem vessels, allowing it to rapidly infiltrate the host. Within these vessels, the fungus produces microconidia, which ascend through the sap stream. The germination of these microconidia facilitates mycelial penetration of the upper vessels. Characteristic wilt symptoms arise from vessel blockage caused by accumulating fungal hyphae, compounded by host-pathogen interactions involving the release of toxins (such as fusaric acid and lycomarasmin), gums, gels, and the formation of tyloses. Symptoms including leaf drooping, vessel obstruction, wilting, and defoliation eventually lead to host plant death ( Srinivas et al., 2019 ). The management of tomato wilt disease caused by Fusarium oxysporum f.sp. lycopersici through chemical fungicides presents several challenges, including residual toxicity, environmental pollution, and the development of pathogen resistance to repeatedly used fungicides ( Bajpai et al., 2021 ). In contrast, employing biocontrol agents such as halophilic bacteria effectively mitigates these issues. Numerous microbes, recognized as biocontrol agents such as Bacillus spp., Pseudomonas spp ., Streptomyces spp ., and Trichoderma spp . have demonstrated significant efficacy against soil-borne pathogens ( Upadhyay et al., 2021 ). These agents compete for ecological substrates by producing antibiotics, hydrogen cyanide, releasing siderophores, and secreting enzymes that lyse fungal cell walls, thereby functioning as effective biocontrol agents ( Saravanakumar et al., 2007 ). Additionally, they activate induced systemic resistance (ISR) across various crops against multiple diseases, utilizing signaling pathways involving jasmonic acid (JA), ethylene (ET), and salicylic acid (SA) ( Bajpai et al., 2021 ). The antagonistic effect of isolate QSLA1 against Fusarium is likely attributed to one or more of these mechanisms. Isolate QSLA1 has been confirmed to produce IAA (0.15 µg/ml) and possesses nitrogen-fixing capabilities, contributing to improved plant growth, notably in shoot height and root length. Additionally, this strain can produce lipase, protease, and chitinase enzymes recognized for their antimicrobial (Li et al., 2015) and antifungal ( Essghaier, 2014 ) properties. GC-MS analysis indicates that strain QSLA1 can synthesize metabolites such as Desulphosinigrin, Undeca-2,4,6,8,10-pentaenal, 11-(2-furyl)-oxime, and Strychane, 1-acetyl-20α-hydroxy-16-methylene, all of which are acknowledged as potent antifungal and antimicrobial constituents ( Krishnaveni, 2015 ). Strains from the Bacillus, Virgibacillus , and Halomonas genera, isolated by Menasria et al. ( 2019 ) from saline habitats in northeastern Algeria, demonstrate remarkable activity against pathogenic fungi including Botrytis cinerea, Fusarium oxysporum, F. verticillioides , and Phytophthora capsici. Furthermore, tomato plants treated with moderately halophilic bacteria Halomonas sp. K2-5, isolated from various Tunisian Sebkhas (hypersaline soils), exhibited reduced stem canker lesions under greenhouse conditions (Zouaoui et al., 2007). Declarations Funding details : If the paper is accepted the publishing will be funded according to the Open Access Agreement for Egypt between Springer Nature and Science, Technology& Innovation Funding Authority (STDF) in cooperation with Egyptian Knowledge Bank (EKB) Author Contribution \"A.M. did and wrote the manuscript under supervision of other authors. All authors reviewed the manuscript.\" References Altschul, S. F.; Madden, T. L.; Schaffer, A. A.; Zhang, J.; Zhang, Z.; Miller, W. and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST a new generation of protein database search programs. Nucleic Acids Research, (25) 3389–3402. Amer, M. A., I. A. El-Samra, I. I. Abou-El-Seoud, Sawsan M. El-Abd and N. K. Shawertamimi (2014). Induced Systemic Resistance in Tomato Plants against Fusarium Wilt Disease using Biotic InducersMiddle East Journal of Agriculture Research, 3(4): 1090–1103, 2014. ISSN 2077–4605. Bajpai, R.; Teli, B.; Rashid, M.M.; Nanda, S.; Yadav, S.K. and Kumar, G. (2021). Biocontrol of Fusarium Wilt in Tomato An Eco-friendly and Cost Effective Approach. Biological Forum – An International Journal, 13 (2) 62–69. Benito, J. M.; Lovrich, G. A.; Siñeriz, F. and Abate, C. M. (2004). Isolation and Molecular Characterization of Seawater Bacteria. Environmental Microbiology, Methods and Protocols, 3 10. Boussada, O.; Ammar, A.; Saidana, D.; Chriaa, J.; Chraif, I.; Daami, M.; Helal, A.N. and Mighri, Z. (2008). Chemical composition and antimicrobial activity of volatile components from capitula and aerial parts of Rhaponticum acaule DC growing wild in Tunisia. Microbiol. Res., 163 87–95. Broderick, N. A.; Raffa, K. F.; Goodman, R. M. and Handelsman, J. (2004). Census of the bacterial community of the gypsy moth larval midgut by using culturing and cultureindependent methods. Applied and Environmental Microbiology, 70 (1) 293–300. Corden, M.E. and Chambers, H.L. (1966). Vascular Dysfunction in Fusarium Wilt of Tomato. Amer. J. Bot., 53 (3) 284–287. Darwesh, O.M.; Mahmoud, M.S.; Barakat, Kholoud M.; Abuellil, A.; Ahmad, M.E. (2021). Improving the bioremediumtion technology of contaminated wastewater using biosurfactants produced by novel Bacillus isolates. Heliyon, 7 e08616 Desale, P.; Patel, B.; Singh, S.; Malhotra, A.; Nawani, N (2014). Plant growth promoting properties of Halobacillus sp. and Halomonas sp. in presence of salinity and heavy metals. J. Basic Microbiol. 2014, 54, 781–791. Essghaier, B. (2014). Antimicrobial Behavior of Intracellular Proteins from Two Moderately Halophilic Bacteria Strain J31 of Terribacillus halophilus and Strain M3- 23 of Virgibacillus marismortui . J. Plant. Pathol. Microbiol, 5. https//doi.org/10.4172/2157‐7471.1000214 . Farajzadeh, M.A.; Bahram, M.; Vardast, M.R. and Bamorowat, M. (2011). Dispersive liquid-liquid microextraction for the analysis of three organophosphorus pesticides in real samples by high-performance liquid chromatography–ultraviolet detection and its optimization by experimental design. Microchim Acta, 172 465–470. https//doi.org/10.1007/s00604-010-0451-9 . Ferreira, M.J.; Cunha, A.; Figueiredo, S.; Faustino, P.; Patinha, C.; Silva, H.; Sierra-Garcia, I.N (2021). The Root Microbiome of Salicornia ramosissima as a Seedbank for Plant-Growth Promoting Halotolerant Bacteria. Appl. Sci. 2021, 11, 2233. https://doi.org/10.3390/app11052233 Gayathiri, E.; Prakash, P.; Karmegam, N.; Varjani, S.; Awasthi, M.K. and Ravindran, B. (2022). Biosurfactants Potential and Eco-Friendly Material for Sustainable Agriculture and Environmental Safety. A Review. Agronomy, 12 662. https//doi.org/10.3390/agronomy12030662 . Ghozlan, H.; Deif, H.; Kandil, R.A. and Sabry, S. (2006). Biodiversity of moderately halophilic bacteria in hypersaline habitats. J. Gen Appl. Microbiol., 52 63–72. Gomaa, Naeema A.; Mahdy, A.M.; Fawzy, R.N.; Mohamed, A.S. and Ahmed, G.A. (2022). Control of Tomato Fusarium wilt caused by Fusarium oxysporum f.sp. lycopersici by Grafting and Silver nanoparticles under greenhouse conditions. Benha Journal of Applied Sciences (BJAS), Vol. (7) Issue (5) (2022), (37–50). http//bjas.journals.ekb.eg . Gordon, S.A. and Weber, R.P. (1950). Colorimetric Estimation Of Indole acetic Acid. Plant Physiology, 26 (1) 192–195. Goszczynska, T.; Serfontein, J.J. and Serfontein, S. (2000). Introduction to Practical Phytobacteriology a Manual for Phytobacteriology, Safrinet, the Southern African (Sadc) Loop Of Bionet-International, 1112. Gulzar, Naveed; Kamili, Azra N. and Shah, M.A. (2021). Tomato early blight ( Alternaria solani ), pathogen, disease development and defense response phytohormone signaling. International Research Journal of Plant Science (ISSN 2141–5447), 12 (4) 1–10. Hopwood, D.A. (1960). The phase-contrast observations on Streptomyces coelicolor . Journal of General Microbiology, 22 295–302. Hucker, G. J. and Conn, H. J. (1923). Methods Of Gram Staining. New York Agricultural Experiment Station, Geneva,Technical Bulletin No. 93, p.3 38. Kesaulya, H.; Talahaturuson, A.; Kalay, A.M.; Matatula, E.; Lawalatta, I.J.; Hehanussa, M.L. and Nendissa, S.J. (2021). Characterization of plant growth promoting rhizobacteria of Maize. International Seminar on Agriculture, Biodiversity, Food Security and Health IOP Conf. Series Earth and Environmental Science, p. 883. Kizilkaya, R. (2009). Nitrogen fixation capacity of Azotobacter spp. strains isolated from soils in different ecosystems and relationship between them and the microbiological properties of soils. J. Environ. Biol., 30 (1) 73–82. Krishnaveni, M. (2015). Docking, Simulation Studies of Desulphosinigrin-Cyclin Dependent Kinase 2, an Anticancer Drug Target. Int. J. Pharm. Sci. Rev. Res., 30 (2); Article No. 19, Pages 115–118. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C. and Tamura, K. (2018). MEGA X molecular evolutionary genetics analysis across computing platforms. Molecular biology and evolution (35) 1547–1549. Li, X. and Yu, Y.H. (2015). Biodiversity and screening of halophilic bacteria with hydrolytic and antimicrobial activities from Yuncheng Salt Lake, China. Biologia, 70, 151–156. https//doi.org/10.1515/biolog-2015‐0033 . Managamuri, U.; Vijayalakshmi,M.; Ganduri V.S.R.K.; Rajulapati, S.B.; Bonigala, B.; Kalyani, B.S.; Poda, S. (2017). Isolation, identification, optimization and metabolite profiling of Streptomyces sparsus VSM-30. 3 Biotech., 7 217. DOI 10.1007/s13205-017-0835-1 . Mao, Y.; Zhang, X. and Xu, Z. (2020). Identification of antibacterial substances of Lactobacillus plantarum DY-6 for bacteriostatic action. Food Sci Nutr., 8 (6) 2854–2863. Meah, M.B.; Plumbley, R.A. and Jeger, M.J. (1991). Growth and infectivity of Botryodiplodia theobromae causingstem-end rot of mango. Mycol. Res., 9S (4) 405–408. Menasria, T.; Aguilerab, M.; Hocined, H.; Benammara, L.; Ayachie, A.; Bachirf, A.S.; Dekakc, A. and Monteoliva-Sánchez, M. (2018). Diversity and bioprospecting of extremely halophilic archaea isolated from Algerian arid and semi-arid wetland ecosystems for halophilic-activehydrolytic enzymes. Microbiological Research, 207 289–298. Menasria, T.; Monteoliva-Sánchez, M.; Benammar, L.; Benhadj, M.; Ayachi, A.; Hacène, H.; Gonzalez-Paredes, A. and Aguilera, M. (2019). Culturable halophilic bacteria inhabiting Algerian saline ecosystems A source of promising features and potentialities. World J. Microbiol. Biotechnol., 35 132. Mohamedin, A.H.; Mowafy, A.M; Elsayed, A.A. and Ghanim, S.O. (2018). Potential applications of some moderate halophilic bacteria. Egyptian Journal of Aquatic Biology & Fisheries., 22 (5) 537–550. Mwirichia, R.; Muigai, A.W.; Cousin, S.; Boga, H.I. and Stackebrandt, E. (2010) Bacterial Diversity in the Haloalkaline Lake Elmenteita in Kenya Curr Microbiol.; 62 (1) 209–21. Naghoni, A.; Emtiazi, Giti; Amoozegar, M.A.; Cretoiu, Mariana S.; Stal, L.J.; Etemadifar, Zahra; Shahzadeh Fazeli, S.A. and Bolhuis, H. (2017). Microbial diversity in the hypersaline Lake Meyghan, Iran. Scientific Reports | 7 11522 | DOI10.1038/s41598-017-11585-3. Paul, Chetana A.; Manjunatha, B.S.; Thakur, J.K.; Bandeppa, Rathi, M.S. and Saxena, A.K. (2015). Isolation and Characterization of Salt Tolerant Bacteria from Sambhar Lake for Plant Growth Promoting Activities Sangeeta. Environment & Ecology., 34 (1A) 365–371. Website www.environmentandecology.com. ISSN 0970 – 0420. Peeters, N.; Guidot, A.; Vailleau, F.; and Valls, M. (2013). Ralstonia Solanacearum , A Widespread Bacterial Plant Pathogen Inthe Post-Genomic Era. Molecular Plant Pathology, 14 (7) 651–662. Doi 10.1111/Mpp.12038 . Puchkova, E.P.; Gaas, M.V.; Khizhnyak, S.V.; Ivchenko, V.K. and Polosina, V.A. (2020). The occurrence of antagonists microorganisms to phytopathogenic fungi in consideration of various tillages. IOP Conf. Series Earth and Environmental Science, 421 062037. doi10.1088/1755 – 1315/421/6/062037. Ramadoss, D.; Lakkineni, V. K.; Bose, P.; Ali, S. and Annapurna, K. (2013). Mitigation of salt stress in wheat seedlings by halotolerant bacteria isolated from saline habitats. SpringerPlus 26. doi 10.1186/2193 – 1801 2–6. Rani, Helan S.M. and Kalaiselvam, M. (2013). Antibacterial Activity of Halophilic Fungi Isolated From Solar Saltern at Tuticorin. World Journal of Pharmacy And Pharmaceutical Sciences, 2 (Issue 2) 536–545. Roux, K. H. (1995). Optimization and trouble shooting in PCR, p. 53–62. In C. W. Ruginescu, R.; Gomoiu, I.; Popescu, O.; Cojoc, R.; Neagu, S.; Lucaci, I.; Batrinescu-Moteau, C. and Enache, Madalin (2020). Bioprospecting for Novel Halophilic and Halotolerant Sources of Hydrolytic Enzymes in Brackish, Saline and Hypersaline Lakes of Romania. Microorganisms, 8 1903. Sadfi-Zouaoui, N.; Essghaier, B.; Hannachi, I.; Hajlaoui, M.R. and Boudabous, A. (2007). First report on the use of moderately halophilic bacteria against stem canker of greenhouse tomatoes caused by Botrytis cinerea . Ann. Microbiol., 57 (3) 337–339. Saitou, N. and Nei, M. (1987). The neighbor-joining method A new method for reconstructing phylogenetic trees. Molecular biology and evolution, (4) 406–425. Sambrook, K. J.; Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY Cold Spring Harbor Laboratory. Saravanakumar, D.; Vijayakumar, C.; Kumar, N. and Samiyappan, R. (2007). PGPR-induced defense responses in the tea plant against blister blight disease. Crop Protection, 26 556–565. Sari, C.N.; Hertadi, R.; Harahap, A.F.P.; Ramadhan, M.Y.A. and Gozan, M. (2020). Process Optimization of Palm Oil Mill E-uent-Based Biosurfactant of Halomonas meridiana BK-AB4 Originated from Bledug Kuwu Mud Volcano in Central Java for Microbial Enhanced Oil Recovery. Processes 2020, 8 716. Sarker, A. and Al-Rashid, J. (2013). Analytical Protocol for Determination of Indole 3 Acetic Acid (IAA) Production by Plant Growth Promoting Bacteria (PGPB) Based on The Colorimetric Method of Gordon & Weber (1951). Segarra, Guillem; Casanova, Eva; Avilés, M. and Trillas, Isabel (2009). Trichoderma asperellum strain t34 controls Fusarium wilt disease in tomato plants in soilless culture through competition for iron. Microb Ecol., 59 141–149. DOI 10.1007/s00248-009-9545-5 . Srinivas, C.; Devi, D.N.; Murthy, K.N.; Mohan, C.D.; Lakshmeesha, T.R.; Singh, B.P.; Kalagatur, N.K.; Niranjana, S.R.; Hashem, Abeer; Alqarawi, A.A.; Tabassum, B.; Abd-Allah, E.F.; Nayaka, S.C. and Srivastava, R.K. (2019). Fusarium oxysporum f.sp. lycopersici causal agent of vascular wilt disease of tomato Biology to diversity. A review. Saudi Journal of Biological. Sciences, 26 1315–1324. Suthar, M.P.; Hajoori, M.A.; Chaudhari, R.R. and Desai, S.A. (2017). Isolation, Screening and Characterization of Potent Biosurfactant producing Bacteria from Oil Contaminated Site. Bioscience Discovery, 8 (3) 375–381. Tanvir, R.; Javeed, A. and Rehman, Y. (2018). Fatty acids and their amide derivatives from endophytes new therapeutic possibilities from a hidden source. FEMS Microbiol Lett., 365 (12) doi.org/10.1093/femsle/fny114 . Teh, C.H.; Nazni, W.A.; Norazah, A. and Lee, H.L. (2017). Determination of antibacterial activity and minimum inhibitory concentration of larval extract of fly via resazurin-based turbidometric assay. BMC Microbiol., 17 (1) 1–8. Tiwari, S.; Singh, P.; Tiwari, R.; Meena, K.K.; Yandigeri, M.; Singh, D.P.; Arora, D.K (2011). Salt-tolerant rhizobacteria-mediated induced tolerance in wheat (Triticum aestivum) and chemical diversity in rhizosphere enhance plant growth. Biol. Fertil. Soils 2011, 47, 907–916. Upadhyay, A.K.; Bandi, S.R. and Peddaguad, D.M. (2021). Bio-Control Agents-Antagonistic Magicians against Soil Borne Pathogens A Review. Biological Forum. An International Journal, 13 232–242. Van Der Lelie, D.; Lesaulnier, C.; Mccorkle, S., Geets J.; Taghavi, S.; Dunn, J. (2011). Use of single-point genome signature tags as a universal tagging method for microbial genome surveys. Applied and environmental microbiology, 72(3), 2092–2101. Whittenbury, R. (1964). Hydrogen Peroxide Formation and Catalase Activity in the Lactic Acid Bacteria. J. gen. Microbiol, 35, 13–26. Widawati, S.S. (2005). Isolation and Identification of Phosphate Solubilizing and Nitrogen Fixing Bacteria from Soil in Wamena Biological Garden, Jayawijaya, Papua. Biodiversitas, ISSN 6 (Nomor 5) 175–177. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-5653815\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":427630574,\"identity\":\"742fcb5d-40a5-45fb-aec0-8e0f41876116\",\"order_by\":0,\"name\":\"Ahmed Ahmed Abdelmonaem Mousa\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABPUlEQVRIie2RPUvDQBjHnxDQJSVrSjD5BMITCjfqV0kp6JJApUvBwU5mMG1nseBXMBTqmtKhy+l8EtFMdclQFwk1Be+w1uEsdRTMD+6FB37P/14ASkr+IgYf2udWSdfVNorZ3aqouK7SXyo7xrcCmxX96qKeZjCy7GAya+eLJ9gPuuM0bh6AvushzBdyyOPd0BlAUkN6RB66vRYQet/AGBtQDTNULntyDPNHpgZJ/QZcwiqhC4R5xJyjCsg8VCuhZNjMv30XynX/5e1kKZTnjBgxnsGhUJaygjxFFUqHN1e1XKRoQpkAGlyBXFIc5g+rA+R3YVnL3Ou4GqFejd9lqhl01hx3O5JiMT+aZ+3EsvvH0WtWuBaZUieNi1NLDxpRmhc/PjQ/3mpVzr/+aPVZMa9sQe65KaWkpKTkH/EBxkV0hQ+bTvIAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Menoufia University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Ahmed\",\"middleName\":\"Ahmed Abdelmonaem\",\"lastName\":\"Mousa\",\"suffix\":\"\"},{\"id\":427630575,\"identity\":\"1cea2722-de3f-42cf-96cd-1f456fc40da0\",\"order_by\":1,\"name\":\"Wafaa Hanafy Mahmoud\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Menoufia University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Wafaa\",\"middleName\":\"Hanafy\",\"lastName\":\"Mahmoud\",\"suffix\":\"\"},{\"id\":427630576,\"identity\":\"8d240d2a-0797-48be-9f5e-8773d449d0b2\",\"order_by\":2,\"name\":\"Hosam Easa Elsaied\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"National Institute of Oceanography and Fisheries\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hosam\",\"middleName\":\"Easa\",\"lastName\":\"Elsaied\",\"suffix\":\"\"},{\"id\":427630577,\"identity\":\"2104faed-de9a-4678-ae5c-7d973ff6112e\",\"order_by\":3,\"name\":\"Adel Elsayed Elbeltagy\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Menoufia University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Adel\",\"middleName\":\"Elsayed\",\"lastName\":\"Elbeltagy\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-12-16 12:38:12\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-5653815/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-5653815/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":78420977,\"identity\":\"e6b076b8-fd33-4b70-9f6c-5daf6a780110\",\"added_by\":\"auto\",\"created_at\":\"2025-03-13 05:42:14\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":3284453,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePhylogenetic tree constructed using neighbor-joining analysis based on 16S rDNA sequences from the isolates and closely related sequences deposited in GenBank.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5653815/v1/460acdb298590cfaaa816a78.png\"},{\"id\":78420980,\"identity\":\"cdd03b3c-a582-4973-8b46-3d5a8719fe07\",\"added_by\":\"auto\",\"created_at\":\"2025-03-13 05:42:14\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1381356,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePVK agar plates distinctly exhibit clear zones around the positive bacterial isolates with a concentration of 12.5% NaCl.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5653815/v1/8aca0af0b294dbbb95028a78.png\"},{\"id\":78423405,\"identity\":\"1fd4fe88-e4d0-4bc0-acff-a3c377ae99ce\",\"added_by\":\"auto\",\"created_at\":\"2025-03-13 06:06:14\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1211662,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003edemonstrates the vibrant color development resulting from the Indole-Salkowski reagent reaction in nutrient broth medium enriched with 1% L-tryptophan.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5653815/v1/ba358f8430edff41b9fea882.png\"},{\"id\":78420979,\"identity\":\"fdc66652-ea46-4525-96c1-f4116cbc38a8\",\"added_by\":\"auto\",\"created_at\":\"2025-03-13 05:42:14\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":10233,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eConcentrations of IAA produced in NB medium supplemented with 1% l-tryptophan.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5653815/v1/9744aed2940b4db2681248a9.png\"},{\"id\":78424465,\"identity\":\"e6bbdb15-7b1c-4b8b-98c9-1dfcb5059d4f\",\"added_by\":\"auto\",\"created_at\":\"2025-03-13 06:14:14\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":824050,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ethe antagonistic effects of the isolates against \\u003cem\\u003eFusarium oxysporum\\u003c/em\\u003e (A), \\u003cem\\u003eAlternaria solani\\u003c/em\\u003e (B), and \\u003cem\\u003eRalstonia solanacearum\\u003c/em\\u003e(C) were compellingly demonstrated at a 12.5% NaCl concentration.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5653815/v1/0b16f4708096e7eadbf204b5.png\"},{\"id\":78421044,\"identity\":\"3b76306e-5abb-4bd7-8072-ce92f76a3bc8\",\"added_by\":\"auto\",\"created_at\":\"2025-03-13 05:42:21\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":179317,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe GC-MS chromatogram from the supernatant of the QSLA1 isolate reveals a rich array of bioactive compounds.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5653815/v1/623b3952f176c91e95f599d1.png\"},{\"id\":78420983,\"identity\":\"fca14860-ac21-49ed-bd49-5a3fed20a55c\",\"added_by\":\"auto\",\"created_at\":\"2025-03-13 05:42:14\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2676793,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eA greenhouse experiment clearly demonstrated significant differences among treatments after 28 days.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5653815/v1/9d7485333b8bc475ab72c41f.png\"},{\"id\":78423406,\"identity\":\"adaa517b-578a-480a-8e53-4927302a854e\",\"added_by\":\"auto\",\"created_at\":\"2025-03-13 06:06:14\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":4299535,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eclearly demonstrates the progression of Fusarium wilt symptoms throughout the experiment.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5653815/v1/dc4d094a988d756b46fd20f7.png\"},{\"id\":78421003,\"identity\":\"3f7c3ba2-53ba-4a1b-a00a-4b36151c1c10\",\"added_by\":\"auto\",\"created_at\":\"2025-03-13 05:42:15\",\"extension\":\"png\",\"order_by\":9,\"title\":\"Figure 9\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2980616,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eImpact of inoculation with isolate QSLA1 on tomato seedlings after 28 days.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image9.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5653815/v1/ac8f1fc3becf7415a6610475.png\"},{\"id\":78423408,\"identity\":\"d25c8a4f-672a-4d85-ba5d-8633167da6b3\",\"added_by\":\"auto\",\"created_at\":\"2025-03-13 06:06:14\",\"extension\":\"png\",\"order_by\":11,\"title\":\"Figure 11\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":905086,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffect of inoculation with isolate QSLA1 on disease severity percentage on tomato seedlings infected with \\u003cem\\u003eFusarium oxysporium\\u003c/em\\u003e sub sp. \\u003cem\\u003elycopersici\\u003c/em\\u003e\\u003cstrong\\u003e \\u003c/strong\\u003eafter 28 days.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image11.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5653815/v1/9b299c58c84dd372dd1a4507.png\"},{\"id\":78420995,\"identity\":\"53469b9f-048b-4c8a-af23-00eda9eaac4b\",\"added_by\":\"auto\",\"created_at\":\"2025-03-13 05:42:15\",\"extension\":\"png\",\"order_by\":12,\"title\":\"Figure 12\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2165785,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ethe impact of the QSLA1 isolate on shoot height (1), root length (2), and shoot infection length (3) after 28 days.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image12.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5653815/v1/9c7b9e3830b639f6d5983cea.png\"},{\"id\":78424467,\"identity\":\"09b60023-f310-4aef-92df-abb621356c9f\",\"added_by\":\"auto\",\"created_at\":\"2025-03-13 06:14:14\",\"extension\":\"png\",\"order_by\":13,\"title\":\"Figure 13\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":972226,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ethe significant impact of inoculation with isolate QSLA1 on the length of shoot infection in tomato seedlings infected with \\u003cem\\u003eFusarium oxysporum subsp. lycopersici\\u003c/em\\u003e after 28 days.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image13.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5653815/v1/bf5a3372a8d140bdcbbf7389.png\"},{\"id\":78420997,\"identity\":\"c898af84-c060-49c3-91ae-f0eca447f9e5\",\"added_by\":\"auto\",\"created_at\":\"2025-03-13 05:42:15\",\"extension\":\"png\",\"order_by\":14,\"title\":\"Figure 14\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":16088,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ethe significant impact of inoculation with isolate QSLA1 on the shoot height of tomato seedlings infected with \\u003cem\\u003eFusarium oxysporum f. sp. lycopersici\\u003c/em\\u003e after 28 days.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image14.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5653815/v1/7771da728d4ca20acf984796.png\"},{\"id\":78420999,\"identity\":\"4ded19cb-1529-42dd-a610-aca233597577\",\"added_by\":\"auto\",\"created_at\":\"2025-03-13 05:42:15\",\"extension\":\"png\",\"order_by\":15,\"title\":\"Figure 15\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":11976,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eImpact of Inoculation with Isolate QSLA1 on Root Length of Tomato Seedlings Infected with \\u003cem\\u003eFusarium oxysporum f.sp. lycopersici\\u003c/em\\u003e after 28 Days.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image15.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5653815/v1/3f7df5eff52385462b6e86f7.png\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Halomonas sp. for sustainable agriculture: a potential halo-bio-fertilizer for tomato plants with bio-control activity against Fusarium wilt under saline environments. \",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eHypersaline ecosystems are dynamic and diverse habitats that include various terrestrial lakes and deep-sea basins, exhibiting salt concentrations that exceed three times that of seawater, reaching saturation levels. These habitats are effectively categorized into two main types: thalassohaline and athalassohaline waters \\u003cb\\u003e(\\u003c/b\\u003eNaghoni et al., \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Solar salterns, widely distributed across arid and semi-arid regions, can be found at sea level, either as natural formations or as human-made innovations \\u003cb\\u003e(Ventosa and Arahal, 2011)\\u003c/b\\u003e.\\u003c/p\\u003e \\u003cp\\u003eQarun Lake, strategically located in the northern region of Fayoum Governorate, is characterized by its saline, turbid waters and lack of surface outflow \\u003cb\\u003e(Edbeib et al., 2016)\\u003c/b\\u003e. The solar salterns surrounding Qarun Lake feature a well-structured multi-pond system that is interconnected. These ponds are actively utilized by local companies for the efficient production of salt and minerals.\\u003c/p\\u003e \\u003cp\\u003eHalophiles, the remarkable salt-loving microorganisms that thrive in saline environments, are integral components of hypersaline ecosystems. They span all three domains of life: Archaea, Bacteria, and Eukarya \\u003cb\\u003e(Edbeib et al., 2016)\\u003c/b\\u003e. These halophilic bacteria present significant opportunities in agriculture, where they can be employed for bio-control of phytopathogens, the solubilization of essential nutrients, and the stimulation of plant growth through the production of beneficial growth factors \\u003cb\\u003e(Mohammadipanah et al., 2015)\\u003c/b\\u003e.\\u003c/p\\u003e \\u003cp\\u003eTomato fruits (\\u003cem\\u003eLycopersicon esculentum\\u003c/em\\u003e) rank among the most popular and widely consumed vegetables globally, especially in Egypt \\u003cb\\u003e(\\u003c/b\\u003eAmer et al., \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). However, tomato plants face challenges from various fungal diseases, with \\u003cem\\u003eFusarium\\u003c/em\\u003e wilt being one of the most critical. Caused by the soil-borne fungus \\u003cem\\u003eFusarium oxysporum f.sp. lycopersici\\u003c/em\\u003e (Fol), this disease can lead to significant yield losses in both greenhouse and field conditions \\u003cb\\u003e(\\u003c/b\\u003eSrinivas et al., \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). In Egypt, \\u003cem\\u003eFusarium\\u003c/em\\u003e wilt can reduce yields by as much as 25% \\u003cb\\u003e(Abdel-Monaim, 2012)\\u003c/b\\u003e. The pathogen infiltrates the plant through the roots, colonizes the vascular tissues, clogs the xylem, and induces water stress, which manifests as wilt-like symptoms \\u003cb\\u003e(\\u003c/b\\u003eSrinivas et al., \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eResearch by \\u003cb\\u003eZouaoui et al. (2007)\\u003c/b\\u003e has demonstrated the effectiveness of moderately halophilic bacteria, particularly \\u003cem\\u003eBacillus subtilis\\u003c/em\\u003e J9 and \\u003cem\\u003eHalomonas\\u003c/em\\u003e sp. K2-5, in managing stem canker in greenhouse tomatoes. \\u003cem\\u003eHalomonas\\u003c/em\\u003e sp., isolated from a saline habitat in northeastern Algeria, has shown a broad spectrum of antifungal activity against pathogens such as \\u003cem\\u003eFusarium oxysporum, Botrytis cinerea, Phytophthora capsici\\u003c/em\\u003e, and \\u003cem\\u003eF. verticillioides\\u003c/em\\u003e \\u003cb\\u003e(\\u003c/b\\u003eMenasria et al., \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eIn this study, halophilic bacterial strains were isolated from the solar saltern ponds of a local salt and mineral company. The strains were rigorously tested for their potential to enhance plant growth and exhibit antimicrobial activities against plant pathogens. We meticulously assessed the impact of the isolate QSLA1 on Fusarium wilt disease as well as its effects on the growth of tomato seedlings under saline conditions in controlled greenhouse environments.\\u003c/p\\u003e\"},{\"header\":\"Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eBacterial isolates\\u003c/h2\\u003e \\u003cp\\u003eIn September 2019, water samples were collected from solar saltern ponds, ensuring a comprehensive analysis of their properties. After filtering to remove impurities, the salt concentration was accurately assessed using a refractometer and pH levels were determined with precision using a pH meter. Ten liters of water were gathered from each pond in sterile plastic jars, which were meticulously placed in ice packs for transportation to the biotechnology laboratory in the Botany Department at Menoufia University.\\u003c/p\\u003e \\u003cp\\u003eTo isolate bacteria, we employed a sterilized Nutrient Agar (NA) medium. A 100 \\u0026micro;l aliquot of each water sample was streaked onto NA plates and incubated at 30\\u0026deg;C for periods ranging from 7 to 30 days, following the established methodology by Benito et al. (\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2004\\u003c/span\\u003e). Subsequent streaking and sub-culturing were conducted on NA culture medium prepared from the pond water, successfully purifying the isolates, which were then preserved in 30% glycerol and stored in a freezer for future analysis.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eMorphological and Physiological Characterization of the Isolates\\u003c/h3\\u003e\\n\\u003cp\\u003eThe colonies that developed on the plates underwent thorough morphological examination, focusing on their shape, pigmentation, elevation, and optical properties. Additional parameters, including shape analysis, gram staining, endospore formation \\u003cb\\u003e(\\u003c/b\\u003eHucker \\u0026amp; Conn \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e1923\\u003c/span\\u003e\\u003cb\\u003e)\\u003c/b\\u003e were rigorously tested, motility using the hanging drop method \\u003cb\\u003e(\\u003c/b\\u003eGoszczynska et al. \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e), and catalase activity \\u003cb\\u003e(\\u003c/b\\u003eWhittenbury \\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e1964\\u003c/span\\u003e\\u003cb\\u003e)\\u003c/b\\u003e.\\u003c/p\\u003e\\n\\u003ch3\\u003eSalinity Tolerance of the Isolates\\u003c/h3\\u003e\\n\\u003cp\\u003eThe bacterial isolates were effectively screened for salt tolerance by using a NA culture medium supplemented with varying concentrations of NaCl (0%, 7%, 12.5%, 20%, and 22%). The plates were incubated for 7 days at 30\\u0026deg;C, and the growth results were meticulously recorded \\u003cb\\u003e(\\u003c/b\\u003eRamadoss et al. \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e).\\u003c/p\\u003e\\n\\u003ch3\\u003eMolecular Identification of the Isolates via 16S rDNA\\u003c/h3\\u003e\\n\\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDNA Extraction and Polymerase Chain Reaction (PCR)\\u003c/h2\\u003e \\u003cp\\u003eGenomic DNA was extracted from bacterial cells cultured aerobically in nutrient broth, following the proven protocol of Broderick et al. (\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2004\\u003c/span\\u003e). The extracted DNA was purified, visualized under UV light with ethidium bromide staining \\u003cb\\u003e(\\u003c/b\\u003eSambrook et al. \\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e1989\\u003c/span\\u003e), and securely stored at -20\\u0026deg;C until needed \\u003cb\\u003e(\\u003c/b\\u003eMwirichia et al. \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). Utilizing bacterial primers 27F and 1492R, as specified in \\u003cb\\u003eTable\\u0026nbsp;1\\u003c/b\\u003e, the 16S rRNA gene sequence was successfully amplified using a model PTC-100 thermal cycler (MJ Research Inc., USA) according to Roux (\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e1995\\u003c/span\\u003e\\u003cb\\u003e)\\u003c/b\\u003e. The presence of amplified products was confirmed by applying 7 \\u0026micro;l of the PCR product onto a 1% agarose gel in 1X TAE buffer containing ethidium bromide, and visualized the results with a gel documentation system (Bio-Rad Laboratories) \\u003cb\\u003e(\\u003c/b\\u003eSambrook et al. \\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e1989\\u003c/span\\u003e). The PCR products were purified using the QIA quick PCR purification kit protocol (Qiagen) and promptly sent for sequencing.\\u003c/p\\u003e \\u003cp\\u003eTable\\u0026nbsp;(1): Used primers for PCR 16S rRNA sequencing analysis \\u003cb\\u003e(\\u003c/b\\u003evan der Lelie et al \\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Taba\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer name\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eOrientation\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003ePriming site\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eSequence (5\\u0026acute;- 3\\u0026acute;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e27F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e8\\u0026ndash;27\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eAGAGTTTGATCCTGGCTCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e1492R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eReverse\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1492\\u0026ndash;1513\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eGGTTACCTTGTTACGACTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e16S rRNA sequencing\\u003c/h2\\u003e \\u003cp\\u003eThe sequencing was expertly conducted by Colors Laboratories at El-Etihad Square in Maadi, Cairo, Egypt, following rigorous laboratory protocols. The sequences were thoroughly edited using the Complete Deletion option to eliminate all gaps, utilizing CHROMAS PRO software, version 1.5.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eEvolutionary Relationships of Taxa\\u003c/h3\\u003e\\n\\u003cp\\u003eThe resultant 16S rRNA gene sequences were successfully compared with those available in the GenBank databases using the highly effective Basic Local Alignment Search Tool (BLAST) on the National Center for Biotechnology Information (NCBI) website (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.ncbi.nih.gov\\u003c/span\\u003e\\u003cspan address=\\\"http://www.ncbi.nih.gov\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). For alignment, CLUSTAL W 1.6 software was employed \\u003cb\\u003e(\\u003c/b\\u003eAltschul et al., \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1997\\u003c/span\\u003e), ensuring precise and reliable results. The evolutionary history was robustly inferred using the Neighbor-Joining method \\u003cb\\u003e(\\u003c/b\\u003eSaitou and Nei, \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e1987\\u003c/span\\u003e\\u003cb\\u003e).\\u003c/b\\u003e Evolutionary analyses were carried out with confidence using MEGA X \\u003cb\\u003e(\\u003c/b\\u003eKumar et al., \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). The sequences were meticulously aligned using the embedded MUSCLE algorithm, and the resulting output was leveraged to construct a phylogenetic tree by calculating distance matrices for Neighbor-Joining (NJ) analysis.\\u003c/p\\u003e\\n\\u003ch3\\u003eEvaluation of Plant Growth under Laboratory Conditions\\u003c/h3\\u003e\\n\\u003cp\\u003eThe isolates were rigorously evaluated for their growth-promoting properties, with all analyses conducted in duplicate to ensure accuracy. The inoculum for screening was expertly prepared by cultivating halo-bacteria in 20 ml of nutrient broth culture medium, enriched with a 12.5% salt concentration, and subjected to shaking at 120 rpm for three days.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eNitrogen Fixation Test\\u003c/h2\\u003e \\u003cp\\u003eThe capability of bacterial isolates to fix free nitrogen was thoroughly tested using Ashby-free N-agar medium, following the established protocol by Kizilkaya (\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2009\\u003c/span\\u003e). Bacteria that successfully grew in this medium are unequivocally identified as nitrogen-fixing organisms, confirming findings by Kesaulya et al. (\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003ePhosphate Solubilization Assay\\u003c/p\\u003e \\u003cp\\u003eThe potential of isolates to solubilize inorganic phosphate was determined using the disk diffusion method on a modified Pikovskaya agar culture medium, in accordance with the methodology outlined by Widawati (\\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e). Colonies of phosphate-solubilizing bacteria (PSB) were clearly identified by the distinct diffusion zones surrounding them, as highlighted by Kesaulya et al. (\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eIndole Acetic Acid (IAA) Production Assay\\u003c/h2\\u003e \\u003cp\\u003eIsolates were confidently screened for IAA production utilizing a refined quantification method pioneered by Gordon and Weber (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e1950\\u003c/span\\u003e\\u003cb\\u003e).\\u003c/b\\u003e The production of IAA by bacterial isolates was clearly indicated by a distinct pink color change upon the addition of Salkowski's reagent, as illustrated in \\u003cb\\u003eFig.\\u0026nbsp;(3).\\u003c/b\\u003e The IAA concentration was accurately estimated against a well-prepared standard curve derived from various concentrations of IAA (Sigma-Aldrich, Germany), following the methodology established by Sarker and Al-Rashid (\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e\\u003cb\\u003e).\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAntagonistic Activity of the isolates against Plant Pathogens\\u003c/h2\\u003e \\u003cp\\u003eThe antifungal activity of bacterial isolates was rigorously assessed through co-cultivation of macro-colonies against key pathogens, including \\u003cem\\u003eFusarium oxysporum f.sp. lycopersici\\u003c/em\\u003e, a well-known cause of tomato vascular wilt disease \\u003cb\\u003e(\\u003c/b\\u003eSrinivas et al., \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e); \\u003cem\\u003eAlternaria solani\\u003c/em\\u003e, responsible for early blight in tomato and potato plants \\u003cb\\u003e(\\u003c/b\\u003eGulzar et al., \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e); and \\u003cem\\u003eBotryodiplodia theobromae\\u003c/em\\u003e, which leads to die-back and stem-end rot in mango fruits \\u003cb\\u003e(\\u003c/b\\u003eMeah et al., \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e1991\\u003c/span\\u003e). For this assessment, the pathogens were strategically inoculated onto NA culture medium (with a concentration of 12.5% NaCl) at the center of the plate, while the halophilic bacteria inoculated around the fungus. The antagonistic properties of the bacteria were determined by measuring the zones of inhibited fungal growth, while NA plates inoculated solely with the pathogens served as an effective negative control. All cultures were incubated at a consistent temperature of 25\\u0026deg;C for 7 days, as outlined by Puchkova et al. (\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eAlso an impactful evaluation of the antibacterial activity of the isolates against \\u003cem\\u003eRalstonia solanacearum\\u003c/em\\u003e NRRL B-3211, a notorious cause of bacterial wilt affecting a broad spectrum of host plants \\u003cb\\u003e(\\u003c/b\\u003ePeeters et al., \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e), was conducted using the well-established disc diffusion method described by Rani and Kalaiselvam (\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e\\u003cb\\u003e).\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDetermination of Bioactive Chemical Constituents Produced by QSLA1 Isolate Using GC\\u0026ndash;MS Analysis\\u003c/h2\\u003e \\u003cp\\u003eThe chemical compounds produced by the selected isolate QSLA1 were thoroughly evaluated and analyzed using Gas Chromatography-Mass Spectrometry (GC-MS). A precise liquid-liquid extraction of bioactive compounds was executed following the protocol of Farajzadeh et al. (\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e). The comprehensive chemical composition of metabolites extracted was detected using a GC-TSQ mass spectrometer (Thermo Scientific, Austin, TX, USA) with a direct capillary column TG\\u0026ndash;5MS (30 m \\u0026times; 0.25 mm \\u0026times; 0.25 \\u0026micro;m film thickness), as detailed by Boussada et al. (\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e2008\\u003c/span\\u003e). The percentage composition of each compound was diligently calculated as the ratio of the peak area to the total chromatographic area, with GC-MS peaks confidently assigned through comparison with established data, achieving similarity percentages from the Wiley 275 libraries, as reported by Managamuri et al. (\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eControlling Tomato\\u003c/b\\u003e \\u003cb\\u003eFusarium\\u003c/b\\u003e \\u003cb\\u003eWilt Pathogen Using QSLA1 (\\u003c/b\\u003e\\u003cb\\u003eHalomonas\\u003c/b\\u003e \\u003cb\\u003esp.) under Greenhouse Conditions\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePreparation of Fungal Inoculum\\u003c/h2\\u003e \\u003cp\\u003eTomato seedlings (halophyte strain 023) that were 35 days old were utilized for the study. The fungal inoculum was prepared following the method established by Gomaa et al. (\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). The fungal strain \\u003cem\\u003eFusarium oxysporum subsp. lycopersici\\u003c/em\\u003e was cultivated on sterilized barley grain medium, consisting of 100 g of washed, dried barley grains mixed with 65 ml of tap water per bottle. Inoculation of the barley was performed with uniform 5 mm agar discs of \\u003cem\\u003eFusarium oxysporum\\u003c/em\\u003e, which had been grown on a PDA medium with 3.5% salt for a period of 4 days. The bottles were incubated at 28\\u0026deg;C for two weeks, allowing ample growth of the fungal isolates.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePots Preparation and Inoculation\\u003c/h2\\u003e \\u003cp\\u003eFertile soil was sourced from the surface layer of the experimental farm at the Faculty of Agriculture, Menoufia University, and was sterilized using a 5% formalin solution. The preparation of pots and inoculation was executed as per the protocol outlined by Gomaa et al. (\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e) as follows: The formalin-disinfected clay pots (30 cm in diameter) were filled with a mixture of sterilized soil and compost (at a 1:3 ratio) to a weight of 3 kg per pot. The potted soil was artificially infested with the inoculum at 3% (w/w) and was watered twice a week with saline water (1.5%) for seven days prior to planting. Control pots containing soil and compost (1:3) without inoculation were also prepared.\\u003c/p\\u003e \\u003cp\\u003eTomato seedlings of cultivar 023, which had been grown for 35 days in seed boxes filled with a peat-moss vermiculite mixture (1:1 w/w), were uprooted and transplanted into the pots at a rate of 2 seedlings per pot. Each treatment included three replicates. Immediately after transplanting, the pots were irrigated and subsequently, each seedling received 20 ml of saline water (1.5%) daily.\\u003c/p\\u003e \\u003cp\\u003eThe treatments implemented were as follows: Treatment S\\u0026thinsp;=\\u0026thinsp;Tomato pots irrigated with salt water (1.5%); Treatment H\\u0026thinsp;=\\u0026thinsp;Tomato seedlings treated with QSLA1 isolate (10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;2\\u003c/sup\\u003e); Treatment F\\u0026thinsp;=\\u0026thinsp;Tomato seedlings infected with 3% (w/w) of \\u003cem\\u003eFusarium oxysporum subsp. lycopersici\\u003c/em\\u003e; Treatment HF\\u0026thinsp;=\\u0026thinsp;Tomato seedlings infected with 3% (w/w) of Fusarium oxysporum subsp. lycopersici and inoculated with QSLA1 (10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;2\\u003c/sup\\u003e). All treatments were irrigated with salt water (1.5%).\\u003c/p\\u003e \\u003cp\\u003eThe wilt disease incidence percentage (WDI%) and severity percentage (WDS%) were determined and calculated after 28 days of transplanting, based on a 0\\u0026ndash;4 scale as described by Gomaa et al. (\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e), where: 0\\u0026thinsp;=\\u0026thinsp;No infection, 1\\u0026thinsp;=\\u0026thinsp;Slight infection (approximately 25% of the total), characterized by one or two yellowed leaves, 2\\u0026thinsp;=\\u0026thinsp;Moderate infection (two or three yellowed leaves, 50% wilted), 3\\u0026thinsp;=\\u0026thinsp;Extensive infection (all leaves yellowed, 75% wilted, growth inhibited), and 4\\u0026thinsp;=\\u0026thinsp;Complete infection (the entire plant yellowed, 100% wilted, leading to plant death). Disease severity was calculated accordingly.\\u003c/p\\u003e \\u003cp\\u003e% Disease severity = [Σ (a \\u0026times; b) / N \\u0026times; K] \\u0026times; 100\\u003c/p\\u003e \\u003cp\\u003eWhere (a) represents the number of infected plants in each category, (b) is the numerical value of that category, (N) is the total number of examined plants, and (K) signifies the highest degree of infection category. We recorded disease incidence for each individual treatment using the appropriate formula.\\u003c/p\\u003e \\u003cp\\u003eTo evaluate the effectiveness of QSLA1 in controlling \\u003cem\\u003eFusarium\\u003c/em\\u003e wilt under salinity stress, root length, shoot height, and shoot infected length were measured with precision. The shoot infected length was defined as the length of the browned area at the bottom of the shoot, conclusively indicating the presence of the pathogen \\u003cb\\u003e(\\u003c/b\\u003eSegarra et al., \\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e2009\\u003c/span\\u003e).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical Analysis\\u003c/h2\\u003e \\u003cp\\u003eThe data underwent rigorous statistical analysis using analysis of variance (ANOVA). Differences between means were firmly evaluated using a high-range statistical domain with Tukey\\u0026rsquo;s post hoc analysis, enabling us to distinguish between homogeneous and heterogeneous groups across various variables. We established significance for multiple comparisons of means at a probability level of \\\\( p\\u0026thinsp;=\\u0026thinsp;0.05 \\\\). The results are presented as average means\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviations (SD) from triplicate measurements, ensuring robust and reliable findings.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results and Discussion\",\"content\":\"\\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eIsolation and Purification of Halophilic Bacteria from Solar Saltern Water\\u003c/h2\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003eBacterial Isolates\\u003c/h2\\u003e \\u003cp\\u003eBacterial isolates, QSLA1 and QSLA3, were successfully obtained from the second pond with an 8.2% salt concentration, while the QSLA2 strain was isolated from the third pond, exhibiting a salinity of 17.2%. These isolates were effectively cultured on nutrient agar (NA) culture medium prepared with saline water sourced directly from the pond samples, rather than distilled water.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCultural, Morphological, and Biochemical Characterization of the Isolates\\u003c/h2\\u003e \\u003cp\\u003eCultural, morphological, and biochemical characterizations, which play a critical role in the partial identification of microorganisms \\u003cb\\u003e(\\u003c/b\\u003eSuthar et al., \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e) were comprehensively conducted. It was confirmed that all three isolates were gram-negative, motile, catalase-positive, and rod-shaped. Notably, QSLA2 demonstrated spore formation, while the other two isolates did not exhibit this characteristic, as documented in \\u003cb\\u003eTables\\u0026nbsp;2 and 3\\u003c/b\\u003e. These findings reinforce our understanding of the isolates' properties and their potential applications.\\u003c/p\\u003e \\u003cp\\u003eTable\\u0026nbsp;(2): Colony morphology of isolates on nutrient agar plates (12.5% NaCl).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Tabb\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"8\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c8\\\" colnum=\\\"8\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTested\\u003c/p\\u003e \\u003cp\\u003echaracters\\u003c/p\\u003e \\u003cp\\u003eIsolate\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eColony shape\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eColony edge\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eOpacity\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eElevation\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eSize\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003ePigmentation\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003eAppearance\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRound\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eLobate\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eTranslucent\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eFlat\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003ePin point\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eCreamy\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003eShinny\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRound\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eLobate\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eOpaque\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eRaised\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eSmall\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eWhite\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003eShinny\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eIrregular\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eRagged\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eTranslucent\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eFlat\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eSmall\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eCreamy\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003eShinny\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eTable\\u0026nbsp;(3): Morphological and biochemical characterization of the isolates.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Tabc\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"7\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTested\\u003c/p\\u003e \\u003cp\\u003echaracters\\u003c/p\\u003e \\u003cp\\u003eIsolate\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eShape\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eConcentration of the isolation pond(% NaCl)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eGram stain\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eCatalase test\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eMotility\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eSpore forming\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRod shape\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e8.2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eG\\u003csup\\u003e\\u0026minus;\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRod shape\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e17.2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eG\\u003csup\\u003e\\u0026minus;\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRod shape\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e8.2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eG\\u003csup\\u003e\\u0026minus;\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec22\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSalinity Tolerance of the Isolates\\u003c/h2\\u003e \\u003cp\\u003eThe salinity tolerance tests clearly demonstrated that none of the isolates could grow without salt (0% NaCl). In contrast, all isolates thrived on NA culture medium containing 7% and 12.5% NaCl. Notably, QSLA1 and QSLA2 exhibited remarkable growth on NA culture medium with 20% NaCl, with QSLA2 even thriving in medium with 22% NaCl (see Table\\u0026nbsp;4).\\u003c/p\\u003e \\u003cp\\u003eAs established by Mohamedin et al. (\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e), moderate halophiles typically prosper in environments with 0.5 to 2.5 M NaCl (approximately 3\\u0026ndash;15% NaCl), while extreme halophiles flourish in conditions with 2.5 to 5.2 M (saturated) NaCl (15\\u0026ndash;30% NaCl) and cannot survive without salt. Thus, the inability of these isolates to grow in the absence of NaCl decisively confirms their classification as halophilic bacteria. Among them, QSLA1 and QSLA3 are confidently identified as moderately halophilic, while QSLA2 is undoubtedly recognized as an extreme halophilic bacterium.\\u003c/p\\u003e \\u003cp\\u003eTable\\u0026nbsp;(4): Salinity tolerance assay of the isolates (NaCl %).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Tabd\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"6\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eIsolates\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colspan=\\\"5\\\" nameend=\\\"c6\\\" namest=\\\"c2\\\"\\u003e \\u003cp\\u003eNaCl concentration (%)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eZero\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e7\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e12.5\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e20\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e22\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eNaghoni et al. (\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e) successfully isolated halophilic bacterial strains from three distinct basins of Lake Meyghan, each characterized by varying salinity levels: a green brine with approximately 50 g/L salinity, a red brine with around 180 g/L salinity, and a white brine with about 300 g/L salinity. In a separate study, Ghozlan et al. (\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e) isolated moderately halophilic bacteria from hypersaline environments, specifically solar salterns and salt lakes in Alexandria, Egypt. Notably, 85% of their isolates were Gram-negative, while the remaining 15% were Gram-positive. Paul et al. (\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e) identified forty-six halo-bacterial isolates from soil and water samples at Sambhar Lake. Remarkably, all isolates demonstrated tolerance to 10% NaCl, with forty-four cultures exhibiting resilience to 15% NaCl, and three out of ten selected cultures tolerating as much as 25% salt.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec23\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003eMolecular Identification of the Isolates via 16S rDNA\\u003c/h2\\u003e \\u003cp\\u003eIn addition to performing cultural, morphological, and biochemical characterization, the 16S rDNA genes of the isolates were sequenced and analyzed for molecular identification. The resultant sequences were meticulously compared against those in the NCBI BLAST database. The analysis revealed that isolate QSLA1 is closely related to the \\u003cem\\u003eHalomonas\\u003c/em\\u003e sp. strain RS-17, with a strong similarity of 91.26%. Isolate QSLA2 was identified as \\u003cem\\u003eHalomonas\\u003c/em\\u003e sp. strain LR2-3, showing 96.6% similarity, while QSLA3 was confirmed as \\u003cem\\u003eHalomonas\\u003c/em\\u003e sp. GQ30, exhibiting an impressive 97.33% similarity.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec24\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEvolutionary Relationships of Taxa\\u003c/h2\\u003e \\u003cp\\u003eUsing the Clustal W program, the sequences were aligned and the MEGA X program was employed to construct a phylogenetic tree. Results clearly demonstrate that these isolates belong to the class Gammaproteobacteria, as depicted in \\u003cb\\u003eFig.\\u0026nbsp;(1)\\u003c/b\\u003e. This robust phylogenetic affiliation underscores the significance of our research in understanding halophilic microbial diversity.\\u003c/p\\u003e \\u003cp\\u003e Figure\\u0026nbsp;(1): Phylogenetic tree constructed using neighbor-joining analysis based on 16S rDNA sequences from the isolates and closely related sequences deposited in GenBank.\\u003c/p\\u003e \\u003cp\\u003eThe three isolates have been deposited in the NCBI GenBank under the accession numbers listed in Table\\u0026nbsp;5.\\u003c/p\\u003e \\u003cp\\u003eTable\\u0026nbsp;(5): Accession numbers of the sequences of submitted isolates deposited in NCBI GenBank..\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Tabe\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIsolates\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eOrganisms\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eStrains in Genebank\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eAccession numbers\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eHalomonas\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eHalomonas\\u003c/em\\u003e sp. strain QSLA1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eOP442496\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eHalomonas\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eHalomonas\\u003c/em\\u003e sp. strain QSLA2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eOP442497\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eHalomonas\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eHalomonas\\u003c/em\\u003e sp. strain QSLA3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eOP442498\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eNaghoni et al. (\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e) successfully isolated 361 halobacterial strains from three distinct basins of Lake Meyghan, each exhibiting varying salinities. These strains are classified into several key classes, including Gammaproteobacteria, Alphaproteobacteria, Bacteroidetes, and Firmicutes, representing a diverse range of genera.\\u003c/p\\u003e \\u003cp\\u003eMenasria et al. (\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e) identified 74 halophilic bacteria from the saline ecosystems of Algeria's Sebkha and Chott lakes, which are located in arid and semi-arid ecoclimate zones. Notably, 16 of these isolates were closely related to the genus \\u003cem\\u003eHalomonas\\u003c/em\\u003e. \\u003cb\\u003eChen and colleagues (2010)\\u003c/b\\u003e isolated moderate halophilic strains from solar salterns, and their phylogenetic analysis confirmed affiliations with five notable genera: \\u003cem\\u003eBacillus, Halobacillus, Planococcus, Salinicoccus\\u003c/em\\u003e, and \\u003cem\\u003eHalomonas\\u003c/em\\u003e.\\u003c/p\\u003e \\u003cp\\u003eIn a study by Ghozlan et al. (\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e), taxonomic analyses of moderately halophilic bacteria isolated from hypersaline habitats\\u0026mdash;specifically solar salterns and salt lakes in Alexandria, Egypt\\u0026mdash;revealed that a remarkable 85% of the isolates belonged to the γ-Proteobacteria. Five genera were precisely identified: \\u003cem\\u003ePseudoalteromonas, Flavobacterium, Chromohalobacter, Halomonas\\u003c/em\\u003e, and \\u003cem\\u003eSalegentibacter\\u003c/em\\u003e.\\u003c/p\\u003e \\u003cp\\u003eRomania's salt lakes, which have salinities exceeding 70 g/L, are home to bacteria from three predominant phyla: Firmicutes, Proteobacteria, and Actinobacteria, with \\u003cem\\u003eHalomonas\\u003c/em\\u003e standing out as the most representative genus within the Proteobacteria phylum \\u003cb\\u003e(\\u003c/b\\u003eRuginescu et al., \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eImportantly, in vitro assessments of plant growth-promoting traits underscore the significant potential of halophilic and halotolerant bacteria to enhance plant growth. This approach is essential for the development of effective bio-inoculants for saline soils \\u003cb\\u003e(\\u003c/b\\u003ePaul et al., \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e). All isolates demonstrated robust plant growth-promoting activities, such as phosphorus solubilization, production of indole-3-acetic acid (IAA), and nitrogen fixation (Table\\u0026nbsp;6).\\u003c/p\\u003e \\u003cp\\u003eTable\\u0026nbsp;(6): plant growth promoting ability results of the isolates.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Tabf\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIsolates\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eNitrogen fixation (Ashby medium)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eIAA production\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003ePhosphate solubilization\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cdiv id=\\\"Sec25\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003eNitrogen Fixation and Phosphate Solubilization Assay\\u003c/h2\\u003e \\u003cp\\u003eThe results clearly demonstrate that the QSLA1 and QSLA3 isolates do not have the capability to fix nitrogen, as they failed to grow on Ashby N-free culture medium. Furthermore, they do not solubilize phosphate, as indicated by the lack of clear zones around their colonies on Pikovskaya (PVK) agar plates \\u003cb\\u003e(Fig.\\u0026nbsp;2)\\u003c/b\\u003e. In stark contrast, the QSLA2 isolate has proven to be effective in both solubilizing phosphate \\u003cb\\u003e(Fig.\\u0026nbsp;2)\\u003c/b\\u003e and fixing nitrogen.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eFigure\\u0026nbsp;(2): PVK agar plates distinctly exhibit clear zones around the positive bacterial isolates with a concentration of 12.5% NaCl.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec26\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003eIndole Acetic Acid (IAA) Production Assay\\u003c/h2\\u003e \\u003cp\\u003eAll isolates tested demonstrated the ability to produce Indole acetic acid (IAA) in NA culture medium enriched with L-tryptophan (see \\u003cb\\u003eTable\\u0026nbsp;7\\u003c/b\\u003e and \\u003cb\\u003eFig.\\u0026nbsp;3\\u003c/b\\u003e). Notably, the QSLA1 isolate achieved the highest IAA production at 15.45 \\u0026micro;g/ml, followed closely by QSLA3 at 14.30 \\u0026micro;g/ml (refer to \\u003cb\\u003eTable\\u0026nbsp;7\\u003c/b\\u003e). The differences in IAA production between the QSLA1 isolate and the other two isolates were statistically significant, while the QSLA2 and QSLA3 isolates showed no significant differences in their production levels \\u003cb\\u003e(\\u003c/b\\u003esee \\u003cb\\u003eTable\\u0026nbsp;7 and Fig.\\u0026nbsp;4)\\u003c/b\\u003e.\\u003c/p\\u003e \\u003cp\\u003eIn their study, Ferreira et al. (\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e) successfully isolated 120 salt-tolerant bacterial strains from various locations along Portugal's coastline. Among these, \\u003cem\\u003eHalomonas titanicae\\u003c/em\\u003e was particularly noteworthy for its capacity to fix nitrogen, solubilize phosphate, and produce IAA at a concentration 12.22 \\u0026micro;g/ml. Furthermore, Tiwari et al. (\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e) isolated a salt-tolerant strain, \\u003cem\\u003eHalomonas\\u003c/em\\u003e sp. that exhibited impressive plant growth-promoting traits including phosphate solubilization and nitrogen fixation in high-salinity habitats in India. Desale et al. (\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e) underscored the exceptional growth-promoting potential of the moderate halophile \\u003cem\\u003eHalomonas\\u003c/em\\u003e sp. MAN5, which not only produced 95.3 \\u0026micro;g/ml of IAA but also solubilized 53 parts per million (ppm) of phosphates in the presence of 15% NaCl.\\u003c/p\\u003e \\u003cp\\u003eTable\\u0026nbsp;(7): IAA Concentration Produced by the Isolates (Means\\u0026thinsp;+\\u0026thinsp;Standard Deviation).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Tabg\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIsolates\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eIAA concentration (\\u0026micro;g/ml)\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;S.D\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.15\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.09\\u003csup\\u003e\\u003cb\\u003ea\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e15.45\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.91\\u003csup\\u003e\\u003cb\\u003eb\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e14.30\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.97\\u003csup\\u003e\\u003cb\\u003eb\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003eValues are means\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;standard deviation of three replicates\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003eb\\u0026thinsp;=\\u0026thinsp;higher valuea\\u0026thinsp;=\\u0026thinsp;lower value\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e Figure\\u0026nbsp;(3): demonstrates the vibrant color development resulting from the Indole-Salkowski reagent reaction in nutrient broth medium enriched with 1% L-tryptophan.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eFigure\\u0026nbsp;(4): Concentrations of IAA produced in NB medium supplemented with 1% l-tryptophan.\\u003c/p\\u003e \\u003cp\\u003eThe variation in IAA concentrations among the different bacterial isolates can be attributed to their distinct abilities to utilize tryptophan or to the diverse pathways involved in IAA biosynthesis, including Indole-3-Pyruvic Acid, Tryptamine, and Indole-3-Acetonitrile \\u003cb\\u003e(\\u003c/b\\u003eKesaulya et al., \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eIn vitro\\u003c/b\\u003e \\u003cb\\u003eAntagonistic Activity of the Isolates against Plant Pathogens\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eIsolate QSLA1 exhibited notable antifungal activity against \\u003cem\\u003eFusarium oxysporum f.sp. lycopersici\\u003c/em\\u003e and \\u003cem\\u003eAlternaria solani\\u003c/em\\u003e, effectively limiting mycelial growth in a co-cultivation plate assay. Additionally, it demonstrated significant antibacterial activity against \\u003cem\\u003eRalstonia solanacearum\\u003c/em\\u003e using the disc diffusion method at a 12.5% salt concentration. In contrast, isolates QSLA2 and QSLA3 displayed antibacterial activity exclusively against \\u003cem\\u003eRalstonia solanacearum\\u003c/em\\u003e (see \\u003cb\\u003eTable\\u0026nbsp;8\\u003c/b\\u003e and \\u003cb\\u003eFig.\\u0026nbsp;5\\u003c/b\\u003e). Consequently, isolate QSLA1 has been selected for further studies due to its impressive antagonistic activity against multiple pathogens.\\u003c/p\\u003e \\u003cp\\u003eTable\\u0026nbsp;(8): results of antagonistic activity of the isolates against plant pathogens \\u003cem\\u003ein vitro\\u003c/em\\u003e\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Tabh\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"4\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIsolate\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eFusarium oxysporium\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eAlternaria solani\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eRalstonia solanacearum\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u0026ndash;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eFigure\\u0026nbsp;(5): the antagonistic effects of the isolates against \\u003cem\\u003eFusarium oxysporum\\u003c/em\\u003e (A), \\u003cem\\u003eAlternaria solani\\u003c/em\\u003e (B), and \\u003cem\\u003eRalstonia solanacearum\\u003c/em\\u003e (C) were compellingly demonstrated at a 12.5% NaCl concentration.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec27\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003eDetermination of Bioactive Chemical Constituents Produced by QSLA1 Isolate Using GC\\u0026ndash;MS Analysis\\u003c/h2\\u003e \\u003cp\\u003eThe bioactive chemical constituents produced by the QSLA1 isolate were successfully identified through comprehensive GC\\u0026ndash;MS analysis. Insights from unpublished bioinformatics data prompted a decisive investigation into the bioactive compounds released by halophilic isolates. As a result, the extract from QSLA1 underwent thorough GC\\u0026ndash;MS analysis (see Fig.\\u0026nbsp;6), revealing its metabolic profile and identifying the specific chemical compounds present (refer to Table\\u0026nbsp;9).\\u003c/p\\u003e \\u003cp\\u003eTable\\u0026nbsp;(9): The chemical compounds detected in the culture supernatant of QSLA1 after centrifugation, as revealed by the GC\\u0026ndash;MS analysis, clearly underscore the remarkable bioactive potential of this isolate.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Tabi\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"7\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eNo.\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCompound Name\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eRt (Min)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eArea %\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eMolecular Formula\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eMolecular Weight\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eFunction (PubMed)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eDesulphosinigrin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e13.70\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.23\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eC\\u003csub\\u003e10\\u003c/sub\\u003eH\\u003csub\\u003e17\\u003c/sub\\u003eNO\\u003csub\\u003e6\\u003c/sub\\u003eS\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e279\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eAntibacterial\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eDecanoic Acid, Ethyl Ester\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e15.29\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.04\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eC\\u003csub\\u003e12\\u003c/sub\\u003eH\\u003csub\\u003e24\\u003c/sub\\u003eO2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e200\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eAntibcterial\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eUndeca-2,4,6,8,10-Pentaenal, 11-(2-Furyl)-, Oxime\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e16.35\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eC\\u003csub\\u003e12\\u003c/sub\\u003eH\\u003csub\\u003e26\\u003c/sub\\u003eO\\u003csub\\u003e5\\u003c/sub\\u003eS\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e282\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eAntibacterial/ Antifungal\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eHexadecanoic Acid, Methyl Ester\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e23.11\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e33.22\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eC\\u003csub\\u003e17\\u003c/sub\\u003eH\\u003csub\\u003e34\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e270\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eAntimicrobial\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eStrychane, 1-acetyl-20\\u0026agrave;-hydroxy-16-methylene\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e23.97\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e.11\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eC\\u003csub\\u003e21\\u003c/sub\\u003eH\\u003csub\\u003e26\\u003c/sub\\u003eN\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e338\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eAntimicrobial\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCuran-17-oic acid, 19,20-dihydroxy-, methyl ester, (19S)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e24.94\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e1.39\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eC\\u003csub\\u003e20\\u003c/sub\\u003eH\\u003csub\\u003e26\\u003c/sub\\u003eN\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e4\\u003c/sub\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e358\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eAntimicrobial\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e7\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCyclopropaneoctanoic acid, 2-[[2-[(2-ethyl cyclopropyl) methyl] cyclopropyl]methyl]-, methyl ester\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e26.19\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e.071\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eC\\u003csub\\u003e22\\u003c/sub\\u003eH\\u003csub\\u003e38\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e334\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eAntimicrobial\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e8\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ePalmitic Acid\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e30.16\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.59\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eC\\u003csub\\u003e16\\u003c/sub\\u003eH\\u003csub\\u003e32\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e256\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eAntibacterial\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ecis-Vaccenic acid\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e30.63\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eC\\u003csub\\u003e18\\u003c/sub\\u003eH\\u003csub\\u003e34\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e282\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eAntimicrobial\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eEthanimidothioic Acid, 2-(Dimethylamino)-N-[[(Methylamino)Carbonyl] Oxy]-2-Oxo-, Methyl Ester\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e34.26\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.27\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eC\\u003csub\\u003e7\\u003c/sub\\u003eH\\u003csub\\u003e13\\u003c/sub\\u003eN\\u003csub\\u003e3\\u003c/sub\\u003eO\\u003csub\\u003e3\\u003c/sub\\u003eS\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e219\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eInsecticide\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eFigure\\u0026nbsp;(6): The GC-MS chromatogram from the supernatant of the QSLA1 isolate reveals a rich array of bioactive compounds.\\u003c/p\\u003e \\u003cp\\u003eNotably, the main chemical constituents identified include Hexadecanoic Acid, Methyl Ester (33.22%), 9-Octadecenoic Acid, (2-Phenyl-1,3-Dioxolan-4-Yl)Methyl Ester, Cis (6%), and d-Lyxo-d-manno-nononic-1,4-lactone (2.94%). Other significant compounds are Curan-17-oic acid, 19,20-dihydroxy-, methyl ester, (19S) (1.39%), Cyclopropanedodecanoic acid, 2-octyl-, methyl ester (1.39%), and several others, including 13,16-Octadecadiynoic Acid, Methyl Ester (1.27%) and Palmitic Acid (0.59%). The majority of these constituents are fatty acids and fatty acid derivatives, recognized for their biosurfactant properties and antimicrobial activity \\u003cb\\u003e(\\u003c/b\\u003eGayathiri et al., \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e; Darwesh et al., \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). Additionally, compounds such as Reynosin (lactone) (0.25%) and Leukotriene F4 (0.19%) showcase notable bioactive potential, contributing to antifungal, antitumor, antibacterial, and antioxidant properties \\u003cb\\u003e(\\u003c/b\\u003eKrishnaveni, \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e\\u003cb\\u003e).\\u003c/b\\u003e The dominant presence of fatty acids in the extract underscores their therapeutic significance. Research by Tanvir et al. (\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e) emphasizes fatty acids and their derivatives as versatile agents against various health issues, including cancer and bacterial infections. Furthermore, Mao et al. (\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e) demonstrate that acids like 3-hydroxydecanoic acid and decanoic acid, sourced from \\u003cem\\u003eLactobacillus plantarum\\u003c/em\\u003e, exhibit strong antibacterial properties. Fatty acids have also been shown to disrupt bacterial growth by altering membrane permeability and inhibiting fatty acid synthesis \\u003cb\\u003e(\\u003c/b\\u003eTeh et al., \\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Moreover, Sari et al. (\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e) highlight antibiotics and biosurfactants derived from \\u003cem\\u003eHalomonas meridiana\\u003c/em\\u003e BK-AB4, reinforcing the importance of these compounds in combating pathogens.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eControlling Tomato Fusarium Wilt Pathogen with QSLA1 (\\u003c/b\\u003e \\u003cb\\u003eHalomonas\\u003c/b\\u003e \\u003cb\\u003esp.)\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eA pot experiment has successfully demonstrated the efficacy of QSLA1 against \\u003cem\\u003eFusarium oxysporum f.sp. lycopersici\\u003c/em\\u003e, showcasing its remarkable ability to control \\u003cem\\u003eFusarium\\u003c/em\\u003e wilt disease in tomatoes, particularly under saline conditions (1.5% salt water) \\u003cb\\u003e(Fig.\\u0026nbsp;7).\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eFigure\\u0026nbsp;(7): A greenhouse experiment clearly demonstrated significant differences among treatments after 28 days.\\u003c/p\\u003e \\u003cp\\u003eThroughout the 28-day experiment, notable differences in symptoms emerged between the seedlings inoculated solely with \\u003cem\\u003eFusarium\\u003c/em\\u003e (treatment F) and those treated with both QSLA1 isolate and \\u003cem\\u003eFusarium\\u003c/em\\u003e (treatment HF). After just 7 days post-transplanting, yellowing of the leaves was observed, often concentrated on one side of the plant, resulting from impaired lateral water translocation (Corden and Chambers, \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e1966\\u003c/span\\u003e\\u003cb\\u003e).\\u003c/b\\u003e This symptom was evident in both treatment F and treatment HF. By the 21-day mark, seedlings treated with \\u003cem\\u003eFusarium\\u003c/em\\u003e alone (treatment F) displayed severe symptoms, including wilting, browning of the above-ground portion, and drooping of lower leaves.\\u003c/p\\u003e \\u003cp\\u003e Figure\\u0026nbsp;(8) clearly demonstrates the progression of Fusarium wilt symptoms throughout the experiment.\\u003c/p\\u003e \\u003cp\\u003eThe results for the other treatments reveal that seedlings inoculated with QSLA1 alone (Treatment H) remained remarkably healthy, displaying vibrant green leaves. In stark contrast, the untreated control group (Treatment S) showed no symptoms in any of the plants, as illustrated in Fig.\\u0026nbsp;9.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eFigure\\u0026nbsp;(9): Impact of inoculation with isolate QSLA1 on tomato seedlings after 28 days.\\u003c/p\\u003e \\u003cp\\u003eOur findings clearly demonstrate that after 28 days of transplanting under greenhouse conditions, QSLA1 is highly effective in reducing the incidence of Fusarium wilt in tomatoes by an impressive 33.3% in seedlings treated with both QSLA1 isolate and Fusarium (treatment HF). In contrast, seedlings treated with Fusarium alone (treatment F) exhibited a 100% disease incidence (refer to Table\\u0026nbsp;10 and Fig.\\u0026nbsp;10). Moreover, the severity of Fusarium disease in seedlings treated with the QSLA1 isolate combined with Fusarium (treatment HF) was significantly reduced by 12.5% compared to those treated solely with Fusarium (treatment F), which showed an 83.3% disease severity, as confirmed by the equation established by Gomaa et al. (\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e) (see \\u003cb\\u003eTable\\u0026nbsp;10 and Fig.\\u0026nbsp;11)\\u003c/b\\u003e.\\u003c/p\\u003e \\u003cp\\u003eTable\\u0026nbsp;(10): the effects of inoculation with isolate QSLA1 on tomato seedlings under various treatment conditions.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Tabj\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"6\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTreatments\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eRoot\\u003c/p\\u003e \\u003cp\\u003elength (cm)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eShoot height (cm)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eShoot infection length (cm)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eDisease incidence (%)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eDisease severity (%)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eOnly fresh water\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5.50\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.50\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e15.97\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.25\\u003csup\\u003ed\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eND\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eND\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eND\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eOnly salt water (1.5%) (S)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e6.43\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.25\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e12.80\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.20\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eND\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eND\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eND\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA1 only\\u0026thinsp;+\\u0026thinsp;Salt water (1.5%) (H)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e8.73\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.46\\u003csup\\u003ed\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e15.80\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.20\\u003csup\\u003ed\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eND\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eND\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eND\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSalt water (1.5%)\\u0026thinsp;+\\u0026thinsp;\\u003cem\\u003eFusarium\\u003c/em\\u003e only (F)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5.07\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.12\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e11.17\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.15\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e3.63\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.12\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e100\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e83.3\\u003csup\\u003eb\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eQSLA1\\u0026thinsp;+\\u0026thinsp;Salt water (1.5%)\\u0026thinsp;+\\u0026thinsp;\\u003cem\\u003eFusarium\\u003c/em\\u003e (HF)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e7.50\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.36\\u003csup\\u003ec\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e14.27\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.25\\u003csup\\u003ec\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e1.60\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;0.36\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e33.3\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e12.5\\u003csup\\u003ea\\u003c/sup\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"6\\\" nameend=\\\"c6\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003eValues are means\\u0026thinsp;\\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003e\\u0026plusmn;\\u003c/span\\u003e\\u0026thinsp;standard deviation of three replicates\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"6\\\" nameend=\\\"c6\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003ed\\u0026thinsp;=\\u0026thinsp;higher value a\\u0026thinsp;=\\u0026thinsp;lower value\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003ctfoot\\u003e \\u003ctr\\u003e\\u003ctd colspan=\\\"6\\\"\\u003eND\\u0026thinsp;=\\u0026thinsp;not detected\\u003c/td\\u003e\\u003c/tr\\u003e \\u003c/tfoot\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e Figure\\u0026nbsp;(10): Effect of inoculation with isolate QSLA1 on disease incidence of tomato seedlings infected with \\u003cem\\u003eFusarium oxysporium\\u003c/em\\u003e sub sp. \\u003cem\\u003elycopersci\\u003c/em\\u003e after 28 days.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eFigure\\u0026nbsp;(11) Effect of inoculation with isolate QSLA1 on disease severity percentage on tomato seedlings infected with \\u003cem\\u003eFusarium oxysporium\\u003c/em\\u003e sub sp. \\u003cem\\u003elycopersici\\u003c/em\\u003e after 28 days.\\u003c/p\\u003e \\u003cp\\u003ePlants treated with the QSLA1 isolate in conjunction with \\u003cem\\u003eFusarium\\u003c/em\\u003e (treatment HF) and those treated with \\u003cem\\u003eFusarium\\u003c/em\\u003e alone (treatment F) exhibited a clear browning zone at the base of the seedling shoots, resulting from pathogen colonization of the tissues. This browning was quantitatively assessed as shoot infection length \\u003cb\\u003e(\\u003c/b\\u003esee \\u003cb\\u003eFig.\\u0026nbsp;12).\\u003c/b\\u003e The results clearly demonstrated a significant difference in shoot infection length, with tomato seedlings treated with the QSLA1 isolate and \\u003cem\\u003eFusarium\\u003c/em\\u003e (treatment HF) showing a length of 1.6 cm, compared to 3.63 cm for those treated with Fusarium only (treatment F) (refer to \\u003cb\\u003eTable\\u0026nbsp;10\\u003c/b\\u003e and \\u003cb\\u003eFig.\\u0026nbsp;13\\u003c/b\\u003e).\\u003c/p\\u003e \\u003cp\\u003eMoreover, inoculation with QSLA1 significantly stimulated both shoot height and root length. The treated tomato plants achieved a shoot height of 14.3 cm and a root length of 7.5 cm, whereas seedlings treated with \\u003cem\\u003eFusarium\\u003c/em\\u003e alone (treatment F) measured 11.1 cm in height and 5.1 cm in root length (see \\u003cb\\u003eTable\\u0026nbsp;10\\u003c/b\\u003e). These differences were statistically significant and underscored the beneficial effects of QSLA1 inoculation (refer to \\u003cb\\u003eFigs.\\u0026nbsp;14 and 15\\u003c/b\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThese results underscore the significant effects of the QSLA1 isolate on plant growth and infection dynamics, also highlights the potential of isolate QSLA1 in promoting seedling growth even in the presence of this pathogen.\\u003c/p\\u003e \\u003cp\\u003e Figure\\u0026nbsp;(12): the impact of the QSLA1 isolate on shoot height (1), root length (2), and shoot infection length (3) after 28 days.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eFigure\\u0026nbsp;(13): the significant impact of inoculation with isolate QSLA1 on the length of shoot infection in tomato seedlings infected with \\u003cem\\u003eFusarium oxysporum subsp. lycopersici\\u003c/em\\u003e after 28 days.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eFigure\\u0026nbsp;(14): the significant impact of inoculation with isolate QSLA1 on the shoot height of tomato seedlings infected with \\u003cem\\u003eFusarium oxysporum f. sp. lycopersici\\u003c/em\\u003e after 28 days.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eFigure\\u0026nbsp;(15): Impact of Inoculation with Isolate QSLA1 on Root Length of Tomato Seedlings Infected with \\u003cem\\u003eFusarium oxysporum f.sp. lycopersici\\u003c/em\\u003e after 28 Days.\\u003c/p\\u003e \\u003cp\\u003eThe infection process begins with fungal hyphae adhering to and penetrating the root surface. The mycelium invades the root cortical cells intercellularly, subsequently entering the vascular system through the xylem. This fungus exhibits a distinct infection pathway, effectively colonizing exclusively inside the xylem vessels, allowing it to rapidly infiltrate the host. Within these vessels, the fungus produces microconidia, which ascend through the sap stream. The germination of these microconidia facilitates mycelial penetration of the upper vessels. Characteristic wilt symptoms arise from vessel blockage caused by accumulating fungal hyphae, compounded by host-pathogen interactions involving the release of toxins (such as fusaric acid and lycomarasmin), gums, gels, and the formation of tyloses. Symptoms including leaf drooping, vessel obstruction, wilting, and defoliation eventually lead to host plant death \\u003cb\\u003e(\\u003c/b\\u003eSrinivas et al., \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThe management of tomato wilt disease caused by \\u003cem\\u003eFusarium oxysporum f.sp. lycopersici\\u003c/em\\u003e through chemical fungicides presents several challenges, including residual toxicity, environmental pollution, and the development of pathogen resistance to repeatedly used fungicides \\u003cb\\u003e(\\u003c/b\\u003eBajpai et al., \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). In contrast, employing biocontrol agents such as halophilic bacteria effectively mitigates these issues. Numerous microbes, recognized as biocontrol agents such as \\u003cem\\u003eBacillus spp., Pseudomonas spp\\u003c/em\\u003e., \\u003cem\\u003eStreptomyces spp\\u003c/em\\u003e., and \\u003cem\\u003eTrichoderma spp\\u003c/em\\u003e. have demonstrated significant efficacy against soil-borne pathogens \\u003cb\\u003e(\\u003c/b\\u003eUpadhyay et al., \\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). These agents compete for ecological substrates by producing antibiotics, hydrogen cyanide, releasing siderophores, and secreting enzymes that lyse fungal cell walls, thereby functioning as effective biocontrol agents \\u003cb\\u003e(\\u003c/b\\u003eSaravanakumar et al., \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e2007\\u003c/span\\u003e). Additionally, they activate induced systemic resistance (ISR) across various crops against multiple diseases, utilizing signaling pathways involving jasmonic acid (JA), ethylene (ET), and salicylic acid (SA) \\u003cb\\u003e(\\u003c/b\\u003eBajpai et al., \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). The antagonistic effect of isolate QSLA1 against Fusarium is likely attributed to one or more of these mechanisms.\\u003c/p\\u003e \\u003cp\\u003eIsolate QSLA1 has been confirmed to produce IAA (0.15 \\u0026micro;g/ml) and possesses nitrogen-fixing capabilities, contributing to improved plant growth, notably in shoot height and root length. Additionally, this strain can produce lipase, protease, and chitinase enzymes recognized for their antimicrobial \\u003cb\\u003e(Li et al., 2015)\\u003c/b\\u003e and antifungal \\u003cb\\u003e(\\u003c/b\\u003eEssghaier, \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e\\u003cb\\u003e)\\u003c/b\\u003e properties. GC-MS analysis indicates that strain QSLA1 can synthesize metabolites such as Desulphosinigrin, Undeca-2,4,6,8,10-pentaenal, 11-(2-furyl)-oxime, and Strychane, 1-acetyl-20α-hydroxy-16-methylene, all of which are acknowledged as potent antifungal and antimicrobial constituents \\u003cb\\u003e(\\u003c/b\\u003eKrishnaveni, \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e\\u003cb\\u003e).\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eStrains from the \\u003cem\\u003eBacillus, Virgibacillus\\u003c/em\\u003e, and \\u003cem\\u003eHalomonas\\u003c/em\\u003e genera, isolated by Menasria et al. (\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e) from saline habitats in northeastern Algeria, demonstrate remarkable activity against pathogenic fungi including \\u003cem\\u003eBotrytis cinerea, Fusarium oxysporum, F. verticillioides\\u003c/em\\u003e, and \\u003cem\\u003ePhytophthora capsici.\\u003c/em\\u003e Furthermore, tomato plants treated with moderately halophilic bacteria \\u003cem\\u003eHalomonas\\u003c/em\\u003e sp. K2-5, isolated from various Tunisian Sebkhas (hypersaline soils), exhibited reduced stem canker lesions under greenhouse conditions \\u003cb\\u003e(Zouaoui et al., 2007).\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cb\\u003eFunding details\\u003c/b\\u003e: If the paper is accepted the publishing will be funded according to the Open Access Agreement for Egypt between Springer Nature and Science, Technology\\u0026amp; Innovation Funding Authority (STDF) in cooperation with Egyptian Knowledge Bank (EKB)\\u003c/p\\u003e\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003e\\\"A.M. did and wrote the manuscript under supervision of other authors. All authors reviewed the manuscript.\\\"\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eAltschul, S. F.; Madden, T. L.; Schaffer, A. A.; Zhang, J.; Zhang, Z.; Miller, W. and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST a new generation of protein database search programs. Nucleic Acids Research, (25) 3389\\u0026ndash;3402.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAmer, M. A., I. A. El-Samra, I. I. Abou-El-Seoud, Sawsan M. El-Abd and N. K. Shawertamimi (2014). Induced Systemic Resistance in Tomato Plants against Fusarium Wilt Disease using Biotic InducersMiddle East Journal of Agriculture Research, 3(4): 1090\\u0026ndash;1103, 2014. ISSN 2077\\u0026ndash;4605.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBajpai, R.; Teli, B.; Rashid, M.M.; Nanda, S.; Yadav, S.K. and Kumar, G. (2021). Biocontrol of Fusarium Wilt in Tomato An Eco-friendly and Cost Effective Approach. Biological Forum \\u0026ndash; An International Journal, 13 (2) 62\\u0026ndash;69.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBenito, J. M.; Lovrich, G. A.; Si\\u0026ntilde;eriz, F. and Abate, C. M. (2004). Isolation and Molecular Characterization of Seawater Bacteria. Environmental Microbiology, Methods and Protocols, 3 10.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBoussada, O.; Ammar, A.; Saidana, D.; Chriaa, J.; Chraif, I.; Daami, M.; Helal, A.N. and Mighri, Z. (2008). Chemical composition and antimicrobial activity of volatile components from capitula and aerial parts of Rhaponticum acaule DC growing wild in Tunisia. Microbiol. Res., 163 87\\u0026ndash;95.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBroderick, N. A.; Raffa, K. F.; Goodman, R. M. and Handelsman, J. (2004). Census of the bacterial community of the gypsy moth larval midgut by using culturing and cultureindependent methods. Applied and Environmental Microbiology, 70 (1) 293\\u0026ndash;300.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCorden, M.E. and Chambers, H.L. (1966). Vascular Dysfunction in \\u003cem\\u003eFusarium\\u003c/em\\u003e Wilt of Tomato. Amer. J. Bot., 53 (3) 284\\u0026ndash;287.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDarwesh, O.M.; Mahmoud, M.S.; Barakat, Kholoud M.; Abuellil, A.; Ahmad, M.E. (2021). Improving the bioremediumtion technology of contaminated wastewater using biosurfactants produced by novel \\u003cem\\u003eBacillus\\u003c/em\\u003e isolates. Heliyon, 7 e08616\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDesale, P.; Patel, B.; Singh, S.; Malhotra, A.; Nawani, N (2014). Plant growth promoting properties of Halobacillus sp. and Halomonas sp. in presence of salinity and heavy metals. J. Basic Microbiol. 2014, 54, 781\\u0026ndash;791.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEssghaier, B. (2014). Antimicrobial Behavior of Intracellular Proteins from Two Moderately Halophilic Bacteria Strain J31 of \\u003cem\\u003eTerribacillus halophilus\\u003c/em\\u003e and Strain M3- 23 of \\u003cem\\u003eVirgibacillus marismortui\\u003c/em\\u003e. J. Plant. Pathol. Microbiol, 5. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps//doi.org/10.4172/2157‐7471.1000214\\u003c/span\\u003e\\u003cspan address=\\\"10.4172/2157‐7471.1000214\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFarajzadeh, M.A.; Bahram, M.; Vardast, M.R. and Bamorowat, M. (2011). Dispersive liquid-liquid microextraction for the analysis of three organophosphorus pesticides in real samples by high-performance liquid chromatography\\u0026ndash;ultraviolet detection and its optimization by experimental design. Microchim Acta, 172 465\\u0026ndash;470. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps//doi.org/10.1007/s00604-010-0451-9\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00604-010-0451-9\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFerreira, M.J.; Cunha, A.; Figueiredo, S.; Faustino, P.; Patinha, C.; Silva, H.; Sierra-Garcia, I.N (2021). The Root Microbiome of Salicornia ramosissima as a Seedbank for Plant-Growth Promoting Halotolerant Bacteria. Appl. Sci. 2021, 11, 2233. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3390/app11052233\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/app11052233\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGayathiri, E.; Prakash, P.; Karmegam, N.; Varjani, S.; Awasthi, M.K. and Ravindran, B. (2022). Biosurfactants Potential and Eco-Friendly Material for Sustainable Agriculture and Environmental Safety. A Review. Agronomy, 12 662. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps//doi.org/10.3390/agronomy12030662\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/agronomy12030662\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGhozlan, H.; Deif, H.; Kandil, R.A. and Sabry, S. (2006). Biodiversity of moderately halophilic bacteria in hypersaline habitats. J. Gen Appl. Microbiol., 52 63\\u0026ndash;72.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGomaa, Naeema A.; Mahdy, A.M.; Fawzy, R.N.; Mohamed, A.S. and Ahmed, G.A. (2022). Control of Tomato Fusarium wilt caused by \\u003cem\\u003eFusarium oxysporum\\u003c/em\\u003e f.sp. \\u003cem\\u003elycopersici\\u003c/em\\u003e by Grafting and Silver nanoparticles under greenhouse conditions. Benha Journal of Applied Sciences (BJAS), Vol. (7) Issue (5) (2022), (37\\u0026ndash;50). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp//bjas.journals.ekb.eg\\u003c/span\\u003e\\u003cspan address=\\\"http://bjas.journals.ekb.eg\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGordon, S.A. and Weber, R.P. (1950). Colorimetric Estimation Of Indole acetic Acid. Plant Physiology, 26 (1) 192\\u0026ndash;195.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGoszczynska, T.; Serfontein, J.J. and Serfontein, S. (2000). Introduction to Practical Phytobacteriology a Manual for Phytobacteriology, Safrinet, the Southern African (Sadc) Loop Of Bionet-International, 1112.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGulzar, Naveed; Kamili, Azra N. and Shah, M.A. (2021). Tomato early blight (\\u003cem\\u003eAlternaria solani\\u003c/em\\u003e), pathogen, disease development and defense response phytohormone signaling. International Research Journal of Plant Science (ISSN 2141\\u0026ndash;5447), 12 (4) 1\\u0026ndash;10.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHopwood, D.A. (1960). The phase-contrast observations on \\u003cem\\u003eStreptomyces coelicolor\\u003c/em\\u003e. Journal of General Microbiology, 22 295\\u0026ndash;302.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHucker, G. J. and Conn, H. J. (1923). Methods Of Gram Staining. New York Agricultural Experiment Station, Geneva,Technical Bulletin No. 93, p.3 38.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKesaulya, H.; Talahaturuson, A.; Kalay, A.M.; Matatula, E.; Lawalatta, I.J.; Hehanussa, M.L. and Nendissa, S.J. (2021). Characterization of plant growth promoting rhizobacteria of Maize. International Seminar on Agriculture, Biodiversity, Food Security and Health IOP Conf. Series Earth and Environmental Science, p. 883.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKizilkaya, R. (2009). Nitrogen fixation capacity of Azotobacter spp. strains isolated from soils in different ecosystems and relationship between them and the microbiological properties of soils. J. Environ. Biol., 30 (1) 73\\u0026ndash;82.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKrishnaveni, M. (2015). Docking, Simulation Studies of Desulphosinigrin-Cyclin Dependent Kinase 2, an Anticancer Drug Target. Int. J. Pharm. Sci. Rev. Res., 30 (2); Article No. 19, Pages 115\\u0026ndash;118.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKumar, S.; Stecher, G.; Li, M.; Knyaz, C. and Tamura, K. (2018). MEGA X molecular evolutionary genetics analysis across computing platforms. Molecular biology and evolution (35) 1547\\u0026ndash;1549.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, X. and Yu, Y.H. (2015). Biodiversity and screening of halophilic bacteria with hydrolytic and antimicrobial activities from Yuncheng Salt Lake, China. Biologia, 70, 151\\u0026ndash;156. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps//doi.org/10.1515/biolog-2015‐0033\\u003c/span\\u003e\\u003cspan address=\\\"10.1515/biolog-2015‐0033\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eManagamuri, U.; Vijayalakshmi,M.; Ganduri V.S.R.K.; Rajulapati, S.B.; Bonigala, B.; Kalyani, B.S.; Poda, S. (2017). Isolation, identification, optimization and metabolite profiling of \\u003cem\\u003eStreptomyces sparsus\\u003c/em\\u003e VSM-30. 3 Biotech., 7 217. DOI \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s13205-017-0835-1\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s13205-017-0835-1\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMao, Y.; Zhang, X. and Xu, Z. (2020). Identification of antibacterial substances of \\u003cem\\u003eLactobacillus plantarum\\u003c/em\\u003e DY-6 for bacteriostatic action. Food Sci Nutr., 8 (6) 2854\\u0026ndash;2863.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMeah, M.B.; Plumbley, R.A. and Jeger, M.J. (1991). Growth and infectivity of \\u003cem\\u003eBotryodiplodia theobromae\\u003c/em\\u003e causingstem-end rot of mango. Mycol. Res., 9S (4) 405\\u0026ndash;408.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMenasria, T.; Aguilerab, M.; Hocined, H.; Benammara, L.; Ayachie, A.; Bachirf, A.S.; Dekakc, A. and Monteoliva-S\\u0026aacute;nchez, M. (2018). Diversity and bioprospecting of extremely halophilic archaea isolated from Algerian arid and semi-arid wetland ecosystems for halophilic-activehydrolytic enzymes. Microbiological Research, 207 289\\u0026ndash;298.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMenasria, T.; Monteoliva-S\\u0026aacute;nchez, M.; Benammar, L.; Benhadj, M.; Ayachi, A.; Hac\\u0026egrave;ne, H.; Gonzalez-Paredes, A. and Aguilera, M. (2019). Culturable halophilic bacteria inhabiting Algerian saline ecosystems A source of promising features and potentialities. World J. Microbiol. Biotechnol., 35 132.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMohamedin, A.H.; Mowafy, A.M; Elsayed, A.A. and Ghanim, S.O. (2018). Potential applications of some moderate halophilic bacteria. Egyptian Journal of Aquatic Biology \\u0026amp; Fisheries., 22 (5) 537\\u0026ndash;550.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMwirichia, R.; Muigai, A.W.; Cousin, S.; Boga, H.I. and Stackebrandt, E. (2010) Bacterial Diversity in the Haloalkaline Lake Elmenteita in Kenya Curr Microbiol.; 62 (1) 209\\u0026ndash;21.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNaghoni, A.; Emtiazi, Giti; Amoozegar, M.A.; Cretoiu, Mariana S.; Stal, L.J.; Etemadifar, Zahra; Shahzadeh Fazeli, S.A. and Bolhuis, H. (2017). Microbial diversity in the hypersaline Lake Meyghan, Iran. Scientific Reports | 7 \\u003cem\\u003e11522\\u003c/em\\u003e | DOI10.1038/s41598-017-11585-3.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePaul, Chetana A.; Manjunatha, B.S.; Thakur, J.K.; Bandeppa, Rathi, M.S. and Saxena, A.K. (2015). Isolation and Characterization of Salt Tolerant Bacteria from Sambhar Lake for Plant Growth Promoting Activities Sangeeta. Environment \\u0026amp; Ecology., 34 (1A) 365\\u0026ndash;371. Website www.environmentandecology.com. ISSN 0970\\u0026thinsp;\\u0026ndash;\\u0026thinsp;0420.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePeeters, N.; Guidot, A.; Vailleau, F.; and Valls, M. (2013). \\u003cem\\u003eRalstonia Solanacearum\\u003c/em\\u003e, A Widespread Bacterial Plant Pathogen Inthe Post-Genomic Era. Molecular Plant Pathology, 14 (7) 651\\u0026ndash;662. Doi \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/Mpp.12038\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/Mpp.12038\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePuchkova, E.P.; Gaas, M.V.; Khizhnyak, S.V.; Ivchenko, V.K. and Polosina, V.A. (2020). The occurrence of antagonists microorganisms to phytopathogenic fungi in consideration of various tillages. IOP Conf. Series Earth and Environmental Science, 421 062037. doi10.1088/1755\\u0026thinsp;\\u0026ndash;\\u0026thinsp;1315/421/6/062037.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRamadoss, D.; Lakkineni, V. K.; Bose, P.; Ali, S. and Annapurna, K. (2013). Mitigation of salt stress in wheat seedlings by halotolerant bacteria isolated from saline habitats. SpringerPlus 26. doi \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/2193\\u0026thinsp;\\u0026ndash;\\u0026thinsp;1801\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/2193\\u0026thinsp;\\u0026ndash;\\u0026thinsp;1801\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e 2\\u0026ndash;6.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRani, Helan S.M. and Kalaiselvam, M. (2013). Antibacterial Activity of Halophilic Fungi Isolated From Solar Saltern at Tuticorin. World Journal of Pharmacy And Pharmaceutical Sciences, 2 (Issue 2) 536\\u0026ndash;545.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRoux, K. H. (1995). Optimization and trouble shooting in PCR, p. 53\\u0026ndash;62. In C. W.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRuginescu, R.; Gomoiu, I.; Popescu, O.; Cojoc, R.; Neagu, S.; Lucaci, I.; Batrinescu-Moteau, C. and Enache, Madalin (2020). Bioprospecting for Novel Halophilic and Halotolerant Sources of Hydrolytic Enzymes in Brackish, Saline and Hypersaline Lakes of Romania. Microorganisms, 8 1903.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSadfi-Zouaoui, N.; Essghaier, B.; Hannachi, I.; Hajlaoui, M.R. and Boudabous, A. (2007). First report on the use of moderately halophilic bacteria against stem canker of greenhouse tomatoes caused by \\u003cem\\u003eBotrytis cinerea\\u003c/em\\u003e. Ann. Microbiol., 57 (3) 337\\u0026ndash;339.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSaitou, N. and Nei, M. (1987). The neighbor-joining method A new method for reconstructing phylogenetic trees. Molecular biology and evolution, (4) 406\\u0026ndash;425.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSambrook, K. J.; Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY Cold Spring Harbor Laboratory.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSaravanakumar, D.; Vijayakumar, C.; Kumar, N. and Samiyappan, R. (2007). PGPR-induced defense responses in the tea plant against blister blight disease. Crop Protection, 26 556\\u0026ndash;565.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSari, C.N.; Hertadi, R.; Harahap, A.F.P.; Ramadhan, M.Y.A. and Gozan, M. (2020). Process Optimization of Palm Oil Mill E-uent-Based Biosurfactant of Halomonas meridiana BK-AB4 Originated from Bledug Kuwu Mud Volcano in Central Java for Microbial Enhanced Oil Recovery. Processes 2020, 8 716.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSarker, A. and Al-Rashid, J. (2013). Analytical Protocol for Determination of Indole 3 Acetic Acid (IAA) Production by Plant Growth Promoting Bacteria (PGPB) Based on The Colorimetric Method of Gordon \\u0026amp; Weber (1951).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSegarra, Guillem; Casanova, Eva; Avil\\u0026eacute;s, M. and Trillas, Isabel (2009). \\u003cem\\u003eTrichoderma asperellum\\u003c/em\\u003e strain t34 controls \\u003cem\\u003eFusarium\\u003c/em\\u003e wilt disease in tomato plants in soilless culture through competition for iron. Microb Ecol., 59 141\\u0026ndash;149. DOI \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00248-009-9545-5\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00248-009-9545-5\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSrinivas, C.; Devi, D.N.; Murthy, K.N.; Mohan, C.D.; Lakshmeesha, T.R.; Singh, B.P.; Kalagatur, N.K.; Niranjana, S.R.; Hashem, Abeer; Alqarawi, A.A.; Tabassum, B.; Abd-Allah, E.F.; Nayaka, S.C. and Srivastava, R.K. (2019). \\u003cem\\u003eFusarium oxysporum\\u003c/em\\u003e f.sp. \\u003cem\\u003elycopersici\\u003c/em\\u003e causal agent of vascular wilt disease of tomato Biology to diversity. A review. Saudi Journal of Biological. Sciences, 26 1315\\u0026ndash;1324.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSuthar, M.P.; Hajoori, M.A.; Chaudhari, R.R. and Desai, S.A. (2017). Isolation, Screening and Characterization of Potent Biosurfactant producing Bacteria from Oil Contaminated Site. Bioscience Discovery, 8 (3) 375\\u0026ndash;381.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTanvir, R.; Javeed, A. and Rehman, Y. (2018). Fatty acids and their amide derivatives from endophytes new therapeutic possibilities from a hidden source. FEMS Microbiol Lett., 365 (12) \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003edoi.org/10.1093/femsle/fny114\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/femsle/fny114\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTeh, C.H.; Nazni, W.A.; Norazah, A. and Lee, H.L. (2017). Determination of antibacterial activity and minimum inhibitory concentration of larval extract of fly via resazurin-based turbidometric assay. BMC Microbiol., 17 (1) 1\\u0026ndash;8.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTiwari, S.; Singh, P.; Tiwari, R.; Meena, K.K.; Yandigeri, M.; Singh, D.P.; Arora, D.K (2011). Salt-tolerant rhizobacteria-mediated induced tolerance in wheat (Triticum aestivum) and chemical diversity in rhizosphere enhance plant growth. Biol. Fertil. Soils 2011, 47, 907\\u0026ndash;916.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eUpadhyay, A.K.; Bandi, S.R. and Peddaguad, D.M. (2021). Bio-Control Agents-Antagonistic Magicians against Soil Borne Pathogens A Review. Biological Forum. An International Journal, 13 232\\u0026ndash;242.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVan Der Lelie, D.; Lesaulnier, C.; Mccorkle, S., Geets J.; Taghavi, S.; Dunn, J. (2011). Use of single-point genome signature tags as a universal tagging method for microbial genome surveys. Applied and environmental microbiology, 72(3), 2092\\u0026ndash;2101.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWhittenbury, R. (1964). Hydrogen Peroxide Formation and Catalase Activity in the Lactic Acid Bacteria. J. gen. Microbiol, 35, 13\\u0026ndash;26.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWidawati, S.S. (2005). Isolation and Identification of Phosphate Solubilizing and Nitrogen Fixing Bacteria from Soil in Wamena Biological Garden, Jayawijaya, Papua. Biodiversitas, ISSN 6 (Nomor 5) 175\\u0026ndash;177.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-5653815/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-5653815/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eHalophilic bacteria are remarkable microorganisms that excel in hypersaline environments. Their significant potential in various fields, such as industry and agriculture, positions them as vital players in advancing our technological and ecological efforts. In this study, three bacterial strains were successfully isolated (QSLA1, QSLA2, and QSLA3) from solar saltern ponds using nutrient agar (NA) culture medium derived from pond water. Morphological and physiological characterization revealed that these isolates are rod-shaped, gram-negative, catalase-positive, and motile. Notably, QSLA1 and QSLA2 do not form spores, while QSLA3 is identified as a spore-forming bacterium. The halo tolerance assay demonstrated that QSLA1 and QSLA2 are extremely halophilic, whereas QSLA3 is classified as moderately halophilic. Through 16S rRNA sequence analysis, it was determined that QSLA1 shares 91.26% similarity with \\u003cem\\u003eHalomonas\\u003c/em\\u003e sp. RS-17, while QSLA2 exhibits 96.6% similarity with \\u003cem\\u003eHalomonas\\u003c/em\\u003e sp. strain LR2-3. QSLA3 shows even greater similarity at 97.33% to \\u003cem\\u003eHalomonas\\u003c/em\\u003e sp. GQ30. All isolates are capable of producing indole-3-acetic acid (IAA), but only QSLA2 has the ability to fix atmospheric nitrogen and solubilize insoluble phosphate. Additionally, QSLA1 demonstrates antifungal activity against \\u003cem\\u003eFusarium oxysporium f.sp. lycopersici\\u003c/em\\u003e in vitro under saline environment. Given these promising traits, we explored the potential of QSLA1 as a bio-control agent under greenhouse conditions at 1.5% salinity.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Halomonas sp. for sustainable agriculture: a potential halo-bio-fertilizer for tomato plants with bio-control activity against Fusarium wilt under saline environments. \",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-03-13 05:42:09\",\"doi\":\"10.21203/rs.3.rs-5653815/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"7d8559db-c2b7-4c29-ba06-984231360ed0\",\"owner\":[],\"postedDate\":\"March 13th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-03-19T06:38:30+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-03-13 05:42:09\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-5653815\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-5653815\",\"identity\":\"rs-5653815\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}