{"paper_id":"3493ba8a-e852-4f79-8c30-3e28dc819b6b","body_text":"A novel in vitro root inoculation assay to screen potato genotypes for resistance to Common Scab | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article A novel in vitro root inoculation assay to screen potato genotypes for resistance to Common Scab Fatima Latif Azam, Dan Milbourne, Elise Delahaut, Herman J. van Eck, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9248130/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Common scab in potato is caused by multiple Streptomyces species that harbour various virulence factors. Varietal resistance is commonly evaluated with multi-year – multi-location field trials with known high infection potential or using the phytotoxin thaxtomin applied to in vitro mini tubers or potato tissue culture. In this study, we aimed to develop an efficient root inoculation assay to assess the resistance levels of potato genotypes and to evaluate whether the assay could identify resistant and susceptible genotypes, thus facilitating selection of scab resistant clones. We isolated 24 potential Streptomyces strains from fields in Ireland, of which 11 were identified as S. europaescabiei . All S. europaescabiei strains tested positive for txtAB gene but lacked n ec1 and t omA genes. The root inoculation assay resulted in plants exhibiting necrotic symptoms on roots and stunted root growth. Image analysis software was used to collect quantitative data from our assay. We observed a Spearman’s rank correlation of 0.61 between field data and our assay using a panel comprising 50 clones from the bi-parental cross Electra × Désirée and five control varieties. The root inoculation assay is rapid, as symptoms are observed within 6 to 10 days post-inoculation, and requires minimal manipulation since a bacterial suspension is applied instead of purified thaxtomin. Notably, this assay identifies resistant and susceptible progeny reliably, with some disparities between the resistance pattern in the field and the assay. This tool has potential to be useful for screening large numbers of genotypes and discarding the susceptible ones in a breeding program. Common Scab Streptomyces spp. potato Solanum tuberosum root inoculation assay Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Potato is susceptible to several bacterial, fungal and viral diseases. A major bacterial disease affecting this crop worldwide is common scab (CS) that can cause a huge marketable yield loss in severely affected fields. CS is caused by multiple Streptomyces species (spp.), which are a gram-positive actinobacteria that produce disease symptoms on the tuber surface, including superficial, raised or deep pitted lesions. Amongst the most known pathogenic scab-causing Streptomyces spp. are S. scabiei (the oldest known potato scab causing species), S. acidiscabiei (important for causing scab in low pH soils), S. turgidiscabiei (known for causing raised, rough and corky scab lesions) and S. europaeiscabiei (closely related to S. scabiei and mainly found in Europe) (Loria et al., 2006 ). Potato scab-causing Streptomyces spp. can also infect other crops like radish, beet, parsnip and turnip (Leiner et al., 1996 ; Santos-Cervantes et al., 2017 ). Streptomyces spp. are saprophytic bacteria that can survive in soil and infected plant debris for long periods, either in its vegetative mycelial form or in the form of spores (Sharma et al., 2014 ). Invasion of the host plants occurs by entering through wounds, lenticels or by direct contact with tubers in the early developmental stage and stimulates the growth of scab lesions. Lesions grow as the tubers expand, and it is where the pathogen produces spores. Susceptibility to scab infection increases from soil pH 5 to soil pH 8 and infection is supported by dry soil conditions and the optimal temperature for disease development is between 20 and 22 o C (Braun et al., 2017 ). The main virulence determinant of pathogenic Streptomyces spp. is the phytotoxin thaxtomin, a nitrated dipeptide toxin, which is known to inhibit cellulose biosynthesis in plant cells, and, consequently, this leads to plant cell death. Many strains also have other virulence-related genes such as nec1 which encodes for a necrogenic protein or tomA which encodes for a tomatinase (Dees et al., 2013 ). All the virulence-associated genes are found on the pathogenicity island (PAI) (Van der Wolf & Boer, 2007 ), which is acquired by Streptomyces spp. via horizontal gene transfer. The motivation for potato breeders to develop scab-resistant varieties depends on the relative importance of this trait among the many traits in the breeding programs. Phenotyping for scab resistance may be incidental, e.g. identification of susceptible clones during performance trials over years of selection, or more directed, with specific trials in fields with high disease pressure. However, there are several limitations to field test such as yearly variation in scab incidence due to environmental factors (such as weather conditions), variable disease pressure both within and between fields, the diversity of scab-causing species, limited access to suitable trial sites, and the resource-intensive nature of field trials, especially during the early stages of a breeding programme. Hence, more controlled and labour efficient phenotyping methods, such as in vitro testing, may provide breeders with a greater degree of reliability in trait measurement compared with variable field conditions. Several assays exist to evaluate common scab resistance, or to evaluate isolate pathogenicity. Pathogenicity assays may use tuber slices in a petri dish, in vitro grown seedlings or tubers (Faucher et al., 1992 ; Loria et al., 1995 ; Leiner et al., 1996 ; Bignell et al., 2010 ; Uysal et al., 2024 ). Strains that induced necrotic symptoms on potato tissue, hypertrophy and abnormal growth in the seedlings were considered pathogenic. Interestingly, Bignell et al. ( 2010 ) also studied the virulence of a reference pathogenic Streptomyces strain by applying a bacterial spore solution to tobacco plants in vitro and observed root browning and an overall stunting of the in vitro plants. Only a few studies have explored the potential of an in vitro assay to assess resistance levels of different potato clones. These studies used either purified thaxtomin (Khu et al., 2007 ; Hiltunen et al., 2011 ) or bacterial spores (Maharana et al., 2024 ). Khu et al. ( 2007 ) studied the effect of purified thaxtomin on potato shoots from 100 in vitro plants derived from a cross between varieties Atlantic and Superior. They observed reduced shoot growth and, with the highest concentration of thaxtomin, obtained a correlation coefficient of -0.656 between shoot height and tuber resistance, based on artificial inoculation of the same in vitro plants in a glasshouse trial. Likewise, Hiltunen et al. ( 2011 ) studied the effect of purified thaxtomin on potato in vitro plants’ shoots and roots and reported a correlation coefficient of -0.463 for 18 genotypes between the shoot height and scab index based on a trial in a naturally infected field. Lastly, Maharana et al. ( 2024 ) recently developed an in vitro assay where mini tubers were generated in liquid medium and later a bacterial spore suspension was added to the growing mini tubers for disease development and symptom assessment. In this study, we aimed to develop a novel in vitro assay for rapid assessment of scab resistance with minimal manipulation across different potato genotypes using pathogenic scab isolates collected in Ireland. Specifically, a root inoculation assay was chosen as it was demonstrated to be efficient in observing disease symptoms on roots by Bignell et al. ( 2010 ). Streptomyces is aerobic, needs a source of carbon to thrive and it is not reported to utilize the compounds of agar or MS salts (for growth). Meanwhile, in vitro grown plantlets need sucrose at an early stage, and this need is substituted by photosynthesis at a later stage. This suggested that a simple in vitro assay, where plantlets on nutrient-free medium are directly inoculated with the test strain, followed by the assessment of root lesions, might have diagnostic potential for resistance/susceptibility. The experiments and subsequent results described in this study followed a promising series of pilot experiments in which the validity of these initial ideas was at least partially validated, leading to the protocol used below. We subsequently validated the root inoculation assay by first testing it on a small set of varieties with well-characterized resistance phenotypes, allowing us to establish an assessment criterion associated with resistance. This assay and the derived criterion were then further evaluated by comparing the in vitro results with field performance data from a larger genotype panel derived from a cross between resistant and susceptible parents. Materials and methods Bacterial isolation and growth Infected tubers were collected from trial fields in Ireland during the 2022 and 2023 field seasons. Tubers were either used fresh or stored in a cold room at 4 o C for 2 to 7 months. These tubers mainly belonged to advanced breeding clones and were selected based on the surface symptoms resembling scab lesions. Each tuber was used for a single isolation (Fig. 1 ). The tubers were first washed under running water to remove any dirt. Next, cubes of 125 mm 3 were cut from the tubers, including the lesion surface. These cubes were surface sterilized with 1.4% of sodium hypochlorite solution (14% active chlorine) and 1 drop of tween for 5 minutes with continuous shaking. The cubes were then rinsed with sterile distilled water for 15 minutes, replacing the water every two minutes while continuing to shake. Then, the cubes were placed in a sterile petri dish, and the outer layers were aseptically removed, but not the lesioned skin. The remaining piece was macerated using a mortar and pestle under aseptic conditions. The macerate was transferred to sterile tubes and incubated in 1 to 2 ml of sterile distilled water at 55 o C for 30 minutes. Next, 100 µl of the macerate was plated onto water agar (1.2%), and the plates were incubated in the dark at 28 o C for 10 days. From each water agar plate, up to 2 single colonies with morphological characteristics resembling Streptomyces were streaked onto the yeast malt extract (YME) agar supplemented with 50 mg nystatin, 5 mg polymyxin B sulphate, 1 mg sodium penicillin G, and 50 mg cycloheximide (or NPPC antibiotics hereafter) per litre of medium (Faucher et al., 1992 ). Single bacterial colonies obtained were transferred to fresh medium to obtain pure cultures. After purification, the isolates were transferred to oatmeal (OM) agar plates and maintained on the same medium to promote spore production. Glycerol stocks of the bacteria were prepared at a final concentration of 15% (vol/vol) and stored at -80 o C. The reference strain “WUR” was provided by Wageningen University, and the CBF4521-T (Bouchek-Mechiche et al., 2000 ; Bouchek-Mechiche et al., 2001) was kindly provided by Dr. Karima Bouchek-Mechiche (INRAe, France). These strains were maintained by culturing on OM agar and stored as stock at -80 o C. They were included in the molecular identification collectively with the strains isolated in this study. DNA extraction The bacterial isolates were grown on oatmeal agar at 28 o C for 7–10 days in the dark. Cells and spores were then scraped from the plates and added into 2 ml Eppendorf tubes. The samples were freeze dried for 48 hours and subsequently ground in a shaker with two glass beads of 4 mm of diameter. DNA was extracted using the DNeasy Plant Mini Kit (cat. 69104, QIAGEN) following the manufacturer’s instructions, except that after the addition of the lysis buffer and RNase A, the samples were incubated for 1 hour at 65 o C. DNA was eluted in 50 µl of buffer AE. DNA concentration was determined using the Qubit kit according to the manufacturer’s instructions, and DNA quality was assessed by 0.9% agarose gel electrophoresis. PCR analysis Polymerase chain reactions (PCR) were carried out on a MiniAmp Thermal Cycler (Applied Biosystems) using the Multiplex PCR kit (cat. no. 206143, QIAGEN), following the manufacturer’s instructions with small modifications. PCR reactions were performed in a total volume of 10 µl, made of 2 µl of DNA (60-80ng/µl), 0.5 µl of each primer (10 µM), 5 µl of Qiagen Master Mix (2x concentration) and 2 µl of RNase-free H 2 O. The PCR protocol included an initial denaturation cycle at 95 o C for 5 min; followed by 35 cycles of denaturation at 95 o C for 30 s, annealing for 60 s and extension at 72 o C for 30s to 90s (depending on the fragment size), with a final extension at 72 o C for 5 min. For the amplicons for nucleotide sequencing, the final extension was performed at 68 o C for 30 min. PCR products were visualized by electrophoresis on 0.9% agarose gels. The primers used in this study, and their respective annealing temperatures are listed in Table 1 . The annealing temperatures were optimized to obtain specific bands. Table 1 Primer sequences and annealing temperatures used for detection of genes of isolated strains. Target Primer Sequence Annealing temperature (°C) Amplicon size (bp) Reference Universal bacterial primers 16S 1F CATTCACGGAGAGTTTGATCC 55 458 Wanner ( 2006 ) 16S 455-435R ACTTTCGCTTCTTCCCTGCT 16S rRNA-27F AGAGTTTGATCCTGGCTCAG 57 1568 Cui et al. ( 2021 ) 16S rRNA-1492R GGTTACCTTGTTACGACTT 16S rRNA-ITSLF GTCAAGTCATCATGCCCCTT 57 650 Song et al. ( 2004 ) 16S rRNA-ITSR AAACTTGGCCACAGATGCTC S. scabiei / S. europaeiscabiei ASE3 AACGGCCAGAGATGGTCGC 58 474 Wanner ( 2006 ) Scab2m TTCGACAGCTCCCTCCCTTAC txtAB Stx1a GTGGACCGTGGAGCATCT 55 400 Flores-González et al. (2008) Stx1b CAGTTCGGCGTAACTCAGC nec1 Nf ATGAGCGCGAACGGAAGCCCCGGA 62 700 Bukhalid et al. ( 1998 ) Nr GCAGGTCGTCACGAAGGATCG tomA Tom3 GAGGCGTTGGTGGAGTTCTA 55 392 Wanner ( 2006 ) Tom4 TTGGGGTTGTACTCCTCGTC Species identification Universal primers for 16S rRNA (16S 1F/16S 455-435R (Wanner, 2006 ), 16S rRNA-27F/16S rRNA-1492R (Cui et al., 2021 )) were used to verify whether all collected isolates are bacterial through PCR. The primer pair from Cui et al. ( 2021 ) was also used for Sanger Sequencing of the amplified product. The obtained sequences were analysed using the online Basic Local Alignment Tool (BLAST) against the Streptomyces gene database in NCBI to identify isolates belonging to the genus Streptomyces . Subsequently, all isolates were tested with the species-specific primer pair ASE3/Scab2m to identify S. scabiei / S. europeaiscabiei species. Differentiating between these two species with 16S rRNA genes is not possible, as these genes are nearly identical in both species. Hence, the primer pair 16S rRNA-ITSLF/16S rRNA-ITSR was used to amplify the intergenic transcribed spacer (ITS) region of the 16S operon. Subsequently, the resulting amplicons were digested with Hpy99I restriction enzyme (New England Biolabs) following the manufacturer’s instructions. S. scabiei has present the recognition site for this enzyme in the ITS region, whereas the site is absent in S. europeaiscabiei (Song et al., 2004 ; Flores-Gonzalez et al., 2008). Identification of genes on pathogenicity island (PAI) PCRs were also performed for genes on the PAI that are involved in the virulence of the isolates (Hudec at al., 2021). Primer pairs Stx1a/Stx1b (Flores-Gonzalez et al., 2008), Nf/Nr (Bukhalid et al., 1998 ) and Tom3/Tom4 (Wanner, 2006 ) were used to verify the presence of the txtAB , nec1 and tomA genes, respectively. Plant material and progeny selection for assay validation True seeds from a cross between varieties Electra and Désirée, germinated in vitro. Cuttings were used for in vitro assays and used to generate mini tubers for a field trial in 2024 in Oak Park field, Carlow (Latif Azam et al., 2026 ). The field trial was based on this cross together with another F1 population, arranged in a randomized complete block design with replicated controls. The scale used to score tubers for scab resistance ranged from 1 (susceptible) to 9 (resistant), corresponding to the percentage of surface area covered by scab lesions (Latif Azam et al., 2026 ). The broad-sense heritability of the field trial was 0.74. Hence, based on the best linear unbiased estimates (BLUEs) of resistance level in the field trial, 20 most resistant progeny, 20 most susceptible progeny, and 10 clones with intermediate resistance were selected from a population of 166 derived from the Electra × Désirée cross for in vitro testing. Susceptible progeny had field scores between 2.61 and 4.44, intermediate resistance progeny had scores between 4.64 and 6.16, and resistant progeny had scores between 6.71 and 8.03. In addition, six control varieties were tested, including Jubel, Picasso, Electra, Mayan Gold (all resistant; R), Désirée and Maris Piper (both susceptible; S) according to the Potato Variety Database ( https://potatoes.agricrops.org/ ). The selected progeny, and controls were maintained in vitro on MS20 supplemented with 30 grams/Liter of D-sorbitol to promote slow growth of the cuttings. In vitro screening method for scab resistance Selected clones and varieties were grown in vitro on MS25 (g/L of sucrose) for 3 weeks. Apical and nodal cuttings were transferred to MS25 until the beginning of root development, approximately for 6 days. Simultaneously, a pathogenic isolate was transferred to fresh oatmeal agar and incubated to grow for the same amount of time. Cells and spores were scraped off in 3 ml sterile water, and the suspension was transferred to a tube. A 1:10 dilution of the inoculum suspension was made to count cells using a Kova Glasstic slide. Six-day old in vitro cuttings and 1 ml suspension (~ 3.7 million cells) were transferred to 200 ml semi-solid medium before the medium was solidified (0.5x Agar, 1.0x MS, Duchefa Biochemie, without sucrose, Fig. S1). The cuttings were then left to further develop roots and grow. Root symptoms were assessed 10 days post-inoculation. For each potato genotype two experimental replicates and 1 uninoculated control were grown. Data collection and statistical analysis Images of roots were taken 10 days post-inoculation following the harvest of in vitro plants. The percentage of diseased/lesioned and clean root areas were calculated using ImageJ software (version 1.54g). All images of infected roots were first manually edited to standardize the background to a blue colour. Each image was then scaled, and its saturation and brightness were adjusted accordingly to enable selection of the total root area and the diseased area, respectively, aided by visual assessment. In addition, the hue was adjusted to prevent inclusion of green root tissues during diseased area selection, also guided by visual evaluation. Based on the results of pilot experiments (not shown), the percentage of clean root area was used as a measure of resistance to common scab. Additionally, the maximum root length was also measured for each plant using the same software. The relative root length of inoculated plants (in %) was calculated relative to the root length of uninoculated control plants. A linear model was developed in ASRemlR v4.2 (Butler et al., 2023 ) to estimate the best linear unbiased estimates (BLUEs) for both the percentage of clean root area and the relative root length of the tested progeny and varieties. These BLUEs were correlated with the tuber resistance BLUEs from the field trial in 2024 using Spearman’s rank correlation coefficient. Results Bacterial isolate collection Infected tubers were collected from seven different fields in Ireland, including one field in Donegal, one in Kilkenny and five in Carlow (Knockbeg, Lisnavagh, Tullow, Oak Park and White house). The collected tubers showed either superficial or raised scab symptoms. From one to three tubers per field a total of 16 isolations were performed, and a total of 24 potential strains were collected, one to two colonies per isolation. Species identification PCR amplification of 16S rRNA gene with universal primers identified all isolates as bacteria (Fig. S3a and Fig. S3b). Sequencing of the 16S rRNA PCR products amplified with 27F/1492R primers identified all 24 isolates as belonging to the genus Streptomyces (Fig. S3a). Among these, 11 isolates (46%) were found to be Streptomyces species known to be responsible for causing common scab in potato, while the remaining 13 isolates (54%) were identified as other soil Streptomyces species. PCR with ASE3/Scab2m primers showed the presence of scab-causing Streptomyces in the same 11 isolates identified by sequencing of 16S rRNA (Fig. S3c). To further distinguish between S. scabiei and S. europeaiscabiei among these 11 strains, Hpy99I digestion was performed on amplified ITS region of the 16S operon (Fig. S4a). None of the strains could be restricted with Hpy99I and, therefore, they were all assigned to S. europaeiscabiei (Fig. S4b). These 11 strains originated from eight isolations across three locations (Lisnavagh, Tullow and Oak Park) (Table 2 ), while collection of Streptomyces spp. from locations Donegal, Kilkenny, Knockbeg and White house failed. The reference strain “WUR” was also tested with ASE3/Scab2m primer and, after restriction with Hpy99I, was identified as S. europeaiscabiei . The reference strain CFBP4521T is known to be S. stelliscabiei based on the literature and was only tested with primers for PAI genes, as described below. Presence of pathogenicity genes All collected strains and the reference strains “WUR” and CFBP4521T were tested with primers for pathogenicity island genes (Table 2 ). Only the 11 strains of S. europeaiscabiei (Fig. S3d) and the reference strains tested positive for the txtAB gene. Notably, only a faint band for this gene was observed in the reference strain CFBP4521T (Fig. S5a). None of the newly collected strains were positive for the tomA gene; however, both reference strains were positive for this gene with the “WUR” strain showing only a faint band (Fig. S5c). Interestingly, only the reference strain CFBP4521T was positive for the nec1 gene (Fig. S5b), while none of the other isolates or the “WUR” reference strain showed a positive band. Table 2 Characteristics of the pathogenic Streptomyces strains. Origin Location Bacterial code Species txtAB nec1 tomA This study Lisnavagh Lis1 S. europaeiscabiei + - - Lis2 S. europaeiscabiei + - - Lis3 S. europaeiscabiei + - - Lis4 S. europaeiscabiei + - - Tullow Tul1 S. europaeiscabiei + - - Tul2 S. europaeiscabiei + - - Oak Park OP1 S. europaeiscabiei + - - OP2 S. europaeiscabiei + - - OP3 S. europaeiscabiei + - - OP4 S. europaeiscabiei + - - OP5 S. europaeiscabiei + - - Reference The Netherlands WUR S. europaeiscabiei + - + France CFBP 4521T S. stelliscabiei + + + Quantification of scab resistance level The bacterial strain for the root inoculation assay was isolated from the same location where the field trial was conducted using the bi-parental progeny. Specifically, we used the isolate OP5 from Oak Park field, a S. europaescabiei strain exhibiting the appropriate PCR amplicon indicating the presence of the txtAB gene (Table 2 ). Using this strain, the control varieties were tested first (Maris Piper (S), Désirée (S), Electra (R) and Jubel (R)). We assessed which disease symptoms could be observed compared to the control plants and which parts of the plantlet developed these symptoms. In addition, we evaluated whether these symptoms differed among genotypes known to have different levels of field resistance to common scab. We first observed browning of the roots, including root tips and auxiliary roots ends, and root stunting 6 days post-inoculation compared to the control plants with healthy and long roots (Fig. S2). Among different control genotypes, we observed more root browning on susceptible controls (Désirée and Maris Piper) compared to the resistant controls (Electra and Jubel). Root stunting was observed in both susceptible and resistant controls to different degrees compared to the uninoculated control plants. If the plants were left long enough in the inoculated medium, the shoots also developed necrotic symptoms, eventually resulting in whole plant death (Fig. S6). Plant death occurred faster in susceptible than in resistant genotypes. Based on these observations, we decided to take the percentage of the clean root area 10 days post-inoculation as a quantitative measure of resistance to scab. Subsequently, the assay was performed with 50 clones from the cross between varieties Electra (R) and Désirée (S), along with the previously tested controls and additional resistant varieties Picasso and Mayan Gold (Fig. 2 , panels A-F). Disease symptoms on roots became visible 6 days post-inoculation, as described previously, but the cuttings were left in the inoculated medium for 10 days before harvesting. BLUEs for the percentage of clean root area ranged from 32.1 to 93.0, and BLUEs for the percentage of relative root length ranged from 16.5 to 102.3 (Table 3 ). Broad-sense heritability, calculated on an entry-mean basis, was 0.75 and 0.63 for the percentage of clean root area and the percentage of relative root length, respectively (Table 3 ). Based on the quartiles of the data distribution for the percentage of clean root area, genotypes with 55% or less clean root area were considered as susceptible to scab, genotypes with 55–75% as moderately resistant, and genotypes with 75% or greater clean root as resistant. The response of disease symptoms of the progeny and control varieties in the root inoculation assay is shown in Fig. 2 . Table 3 Summary statistics for the root inoculation assay data. Trait Sample size Best linear unbiased estimates (%) Broad-sense heritability (H 2 ) Min. Q1 Median Mean Q3 Max. Clean root area (%) 56 32.08 54.99 63.85 64.60 77.07 92.94 0.75 Relative root length (%) 16.51 31.41 43.98 47.8 59.45 102.25 0.63 We observed differences in the relative root length of the inoculated progeny and controls compared to the uninoculated plants. The uninoculated plants had an average maximum root length of 10.9 cm, while the inoculated plants had an average of 4.98 cm (46% relative root length). Theoretically, we would expect the susceptible genotypes in the root inoculation assay to have shorter relative root length compared to the resistant genotypes. We observed that this was not always the case (Fig. 3 ). However, on average, genotypes with 55% or less clean root area had 35% of relative root length and the genotypes with 75% or greater clean root area had 55% of relative root length. Therefore, there is a trend of resistant genotypes to have greater relative root length compared to the susceptible genotypes. This trend is supported by the moderate Spearman’s rank correlation coefficient of 0.38 between the percentage of clean root area and the percentage of relative root length. The Spearman’s rank correlation coefficient between the tuber resistance score from the field trial and the percentage of clean root area for the selected progeny and five control varieties was 0.61 (Fig. 4 A). Excluding the control varieties, the correlation remained similar at 0.60. We attempted several different methods of incorporating the relative root length into a disease index, but no compound trait derived from both the percentage of clean root area and relative root length yielded a higher correlation with field trial results. Despite this strong correlation, variations in resistance to common scab were observed in the root inoculation assay compared to the field trial (Fig. 4 A). Some progeny exhibited a higher standard deviation in the field trial, others showed a higher standard deviation in the assay, while for some progeny the standard deviations were similar in both the field and the assay. The rank order for the resistant controls (for Picasso, Mayan Gold and Jubel) remained consistent across the root inoculation assay and OP2024 field trial and had on average 68% of clean root area. Electra was not included as control in the 2024 field trial but showed low resistance in the assay compared to the other resistant controls with a clean root area of 53%. Notably, the susceptible controls were more susceptible than the resistant controls with an average of 44% of clean root area. Désirée and Maris Piper showed reversed ranking in the assay compared to the field trial. Maris Piper showed less susceptibility in the assay, whereas Désirée was more susceptible (Fig. 4 A). Figure 4 B shows the resistance level of the tested progeny from the bi-parental cross in the root inoculation assay in an ascending order. In general, the concordance between resistance status in both experiments is good, especially at the extremes of the assay, whilst varieties exhibiting an intermediate phenotype in the field were generally intermediate in the assay. Several clones showed opposite resistance levels in the assay compared to the field, based on the previously mentioned thresholds for the assay. Overall, we observed that the root inoculation assay was able to distinguish highly resistant (e.g., ≥ 75% clean root area) and highly susceptible (e.g., ≤ 55% clean root area) progeny, in accordance with the field trial results. Specifically, progeny considered as very resistant or very susceptible by the assay showed corresponding high or low resistance values in the field trial. Discussion This paper describes a root inoculation assay to assess the resistance level of potato clones to common scab. The assay is not laborious or time consuming, can be performed on seedlings, and allows to shorten the breeding program. Resistance scores from the assay were validated with the tuber resistance scores obtained from field data. Root inoculation assay In this study, we hypothesised that scab-causing bacteria added to MS semi-solid medium without any source of sugar, and in the presence of the host plant, would need to infect the host roots by decomposing root polysaccharides. This process would eventually signal the production of thaxtomin (Francis et al., 2015 ), leading to necrotic symptoms across the roots (Bignell et al., 2010 ), as well as root stunting and overall reduced plant growth. Two main observations guided the design of our root inoculation assay. First, scab-causing species are known to possess versatile metabolisms, enabling them to utilize a wide range of sugars and other metabolites as carbon sources, as summarized in the Bacterial Diversity Metadatabase (Söhngen et al., 2016). However, there are no reports suggesting that MS salts and components of agar like agarose and amylopectin can be utilized for bacterial growth. This would ensure that bacteria must infect the host to allow them to grow. Second, the induction of the thaxtomin biosynthetic gene cluster is primarily triggered by cellobiose (Francis et al., 2015 ), a product of cellulose degradation. The presence of cellulose, a primary structural polysaccharide of plants roots and shoots, has been shown to stimulate the production of cellulases and activate secondary metabolic pathways, leading to the biosynthesis of the phytotoxin thaxtomin (Padilla-Reynaud et al., 2015 ). The results of the assay confirmed our hypothesis. Necrotic symptoms were observed on roots, and root stunting was evident from the reduced relative root length, both compared to the uninoculated control plants. When the plants were left for a long enough in the inoculated medium, whole plant death was observed (Fig. S6). Reduced plant growth in the presence of the pathogen or after application of thaxtomin has been reported in several studies (Leiner et al., 1996 ; Khu et al., 2007 ; Hiltunen et al., 2011 ). Interestingly, Bignell et al. ( 2010 ) also reported root browning of tobacco roots in vitro following inoculation with a bacterial suspension of a scab-causing species. Hence, our assay likely indicates thaxtomin production, induced by actively growing root regions (i.e., such as root tips and auxiliary roots) of the host plant. Nonetheless, further studies are required to validate and quantify the production of thaxtomin in the medium. Comparison of in vitro assays for potato scab resistance screening In vitro assays have been used to test resistance levels of potato genotypes to scab disease. Only one study has validated the in vitro assay with three field trials in different locations (Hiltunen et al., 2011 ). Hiltunen et al. ( 2011 ) mixed purified thaxtomin into the MS medium before adding potato in vitro cuttings. While applying purified thaxtomin is a reasonable approach for screening genotype resistance, it does not always accurately reflect a pathogen's virulence due to the influence of other isolate-specific factors (as discussed below). Therefore, applying a bacterial suspension is more accurate and reliable, as demonstrated in this study. Furthermore, since single isolate applications also allow us to understand the specific interactions between plants and pathogen strains. The strain used in our assay, positive only for the txtAB gene, was isolated from the same field where the field trial was conducted and was tested with the same genotypes. However, in field conditions, each plant harbours a unique rhizosphere microbiome where multiple bacterial interactions occur. Hence, testing a single-isolate interaction represents a limitation, as it may not fully capture field dynamics unless a specific scab-causing species or isolate is highly abundant in the soil, but it is more representative than the response thaxtomin alone. Moderate correlations have been reported between in vitro assays and pot assays where purified Streptomyces strains are applied to autoclaved soil (Khu et al., 2007 ; Hiltunen et al., 2011 ). While pot assays are applicable and yield promising results, they do not fully represent the complex reality of field trials, which remain the primary focus of interest. In this study, we compared our assay results with field trial data. We obtained a high entry-mean broad-sense heritability (74%; Latif Azam et al., 2026 ), suggesting a highly reproducible resistance phenotype, while field trials reflect natural conditions and uncontrolled environmental variation. Furthermore, microbial communities vary between soils, including the presence and abundance of pathogenic Streptomyces . Some bacterial species in soil can exhibit antagonistically the activity to scab-causing species, therefore inhibiting symptom development on tubers (Wang et al., 2019 ). This may explain the non-reproducibility of results across different fields, as previously observed and reported by Hiltunen et al. ( 2011 ). Hiltunen et al. ( 2011 ) selected 18 potato clones based on their sensitivity to thaxtomin for comparison with field results. They measured both relative root number and relative shoot height, ultimately selecting the latter as the measure of scab resistance 4 weeks post-incubation. In our study, the 50 genotypes were chosen from a bi-parental cross between varieties Electra and Désirée, selected for their resistance in the field. We focused on the most obvious traits observed in earlier pilot experiments, such as root lesions and root stunting, which became apparent as early as 6 days post-inoculation. Traits directly influenced by the presence of inoculum and showing clear symptoms are generally reliable indicators of resistance to infection by that inoculum. Notably, Hiltunen et al. ( 2011 ) did not report necrotic symptoms on roots following the application of thaxtomin. This difference is likely due to pathogen activity, continuously producing thaxtomin, which may cause more extensive damage than a single dose of the phytotoxin. A limitation of our assay is that we did not quantify the amount of thaxtomin released into the medium. In this study, the Spearman’s correlation coefficient of 0.61 indicates a positive relationship between tuber resistance in the field and root resistance in the developed in vitro assay. Hiltunen et al. ( 2011 ) reported the best Spearman’s correlation of -0.463 between relative shoot height and tuber resistance in field, based on results from only one field trial, as field results were inconsistent across different trials. They also noted that some genotypes were resistant in the field but susceptible in the in vitro assay. We also observed that certain genotypes displayed contrasting resistance responses in both the field trial and the in vitro assay. Results from Hiltunen et al. ( 2011 ) suggest that while in vitro assays can capture some components of tuber resistance observed in the field, these assays do not fully reflect field resistance. This indicates that thaxtomin is likely an important factor, but additional factors also contribute to an isolate’s pathogenicity and plant resistance under field conditions compared to assay conditions. It is possible that multiple components are involved in host resistance, as indicated by the multiple small-effect QTLs detected by Latif Azam et al. ( 2026 ) and other peer-reviewed studies. Moreover, the discrepancies between field and assay results may be due to human error or differential responses of different plant tissues to thaxtomin, as suggested by Wilson et al. ( 2009 ). Another assay to test genotype resistance to scab is the in vitro mini-tuber generation assay. The application of purified bacterial spores directly to mini tubers in vitro, as demonstrated by Maharana et al. ( 2024 ), is a useful approach to assess the pathogenicity of an isolate on specific potato genotypes as well as the resistance level of the tested genotypes. Interestingly, after the application of bacterial suspension, symptoms began to appear within 3 to 5 days. Despite the rapid appearance of symptoms after inoculation, this assay takes 35 to 40 days and considerable manual handling for mini tuber generation. In contrast, our assay, from the day of in vitro cuttings until root symptoms are visible, takes only 11 to 16 days, making it significantly shorter, faster, and requiring less manual handling, as 5 to 6 days old in vitro plants (which have started developing roots) are transferred directly to the inoculated medium. Overall, we propose that in vitro assays are most suitable to screen cuttings from plants sown in vitro and to avoid the labour to start tissue culture from in vivo material. The breeders can set their own selection thresholds based on clean root area, reflecting the priority they give to breeding for scab resistant varieties. Scab-causing Streptomyces in Ireland Collection of Streptomyces isolates causing common scab is reported for the United States (Wanner, 2006 ), Europe (Bouchek-Mechiche et al., 2000 ; Flores-González et al., 2008; Dees et al., 2013 ), Canada (Hudec et al., 2021 ), China (Cui et al., 2021 ), Turkey (Uysal et al., 2024 ) and India (Maharana et al., 2024 ). These studies have identified well-known scab-causing species including S. scabiei and S. europaeiscabiei , as well as species such as S. stelliscabiei , S. turgidiscabiei , S. acidiscabiei , S. bottropensis and S. reticuliscabiei , among others. Our effort to sample Irish material near Carlow resulted in identification of eleven S. europaescabiei strains, confirming that this species is the predominant scab-causing species in Europe (Bouchek-Mechiche et al., 2000 ; Flores-González et al., 2008). All S. europaescabiei strains in this study were only positive for the txtAB gene. Peer-reviewed studies have reported that different strains do not necessarily harbour all three PAI genes (Wanner, 2006 ; Fyans et al., 2016 ; Uysal et al 2024 ). Some strains may only have one or a combination of two PAI genes (Dees et al., 2013 ). Although only one strain was tested in this study, Hudec et al. ( 2021 ) showed that strains sharing the same pathogenicity gene profile exhibit different levels of virulence and produce varying levels of thaxtomin. Moreover, additional research indicates that production of thaxtomin is not always essential for pathogenicity, as strains lacking it but producing other phytotoxins are pathogenic (Fyans et al., 2016 ; Li et al., 2019 ). This diversity in Streptomyces pathogenicity suggests that our findings on potato scab resistance from the root inoculation assay are context-dependent and specific to the tested strain. Therefore, validation of the assay using multiple strains is needed. Conclusion This is the first study describing the collection of plant pathogenic Streptomyces spp. in Ireland and further research is needed to test their pathogenicity and ability to cause damage to potato cropping. At least one S. europaescabiei strain with the txtAB gene was used to collect data using our newly designed root inoculation assay. Moreover, differential interaction between different potato genotypes and isolates from different locations should be assessed, as such variation has been reported previously (Clark et al., 2019). The assay developed in this study can be used to screen a large number of potato seedlings in the early stages of the breeding program to identify the most resistant and most susceptible progeny in a timely manner and with minimal manipulation. However, validation is required to ensure that the resistance data are sufficiently representative for field performance. Some of our genotypes that were highly resistant in the field were not as resistant with the root inoculation assay, and vice versa. Hence, this assay has value as an initial screening method within a breeding program. Consequently, only the selected progeny needs to be maintained and can be used for the assessment of other important traits in potato breeding, saving both resources and time. Declarations Author contribution statement FLA collected infected tubers. FLA and ED performed isolations. FLA performed molecular laboratory work, developed the in vitro assay, tested the assay, analysed the data, and wrote the original draft. DM supervised the research and edited the manuscript. DG and HJvE obtained funding, conceived and supervised the research, and edited the manuscript. Funding F.L.A. was supported by the Teagasc Walsh Scholarship programme. Conflict of interest The authors are not aware of any relevant financial or non-financial interests to disclose that could have influenced the message of this article. HJvE, DG and DM are members of the editorial board of Potato Research. Acknowledgements We thank Dr. Karima Bouchek-Mechiche for providing the reference strain CFBP4521T and Wageningen University for providing the “WUR” reference strain. Prof. Richard G.F. Visser is acknowledged for feedback on the manuscript. Data availability All data are disclosed in the manuscript and supplementary file S1. References Bignell DRD, Seipke RF, Huguet-Tapia JC, Chambers AH, Parry RJ, Loria R (2010) Streptomyces scabies 87 – 22 Contains a Coronafacic Acid-Like Biosynthetic Cluster That Contributes to Plant–Microbe Interactions. Mol Plant Microbe Interact 23:161–175. https://doi.org/10.1094/MPMI-23-2-0161 Bouchek-Mechiche K, Gardan L, Normand P, Jouan B (2000) DNA relatedness among strains of Streptomyces pathogenic to potato in France: description of three new species, S. europaeiscabiei sp. nov. and S. stelliscabiei sp. nov. associated with common scab, and S. reticuliscabiei sp. nov. associated with netted scab. International Journal of Systematic and Evolutionary Microbiology 50:91–99. https://doi.org/10.1099/00207713-50-1-91 Bouchek-Mechiche P, Andrivon J (2001) Differences in host range, pathogenicity to potato cultivars and response to soil temperature among Streptomyces species causing common and netted scab in France. Plant Pathol 49(1):3–10. https://doi.org/10.1046/j.1365-3059.2000.00419.x Braun S, Gevens A, Charkowski A, Allen C, Jansky S (2017) Potato Common Scab: a Review of the Causal Pathogens, Management Practices, Varietal Resistance Screening Methods, and Host Resistance. Am J Potato Res 94(4):283–296. https://doi.org/10.1007/s12230-017-9575-3 Bukhalid RA, Chung SY, Loria R (1998) nec1, a Gene Conferring a Necrogenic Phenotype, Is Conserved in Plant-Pathogenic Streptomyces spp. and Linked to a Transposase Pseudogene. Mol Plant Microbe Interact 11:960–967. https://doi.org/10.1094/MPMI.1998.11.10.960 Butler DG, Cullis BR, Gilmour AR, Gogel BJ, Thompson R (2023) ASReml-R Reference Manual Version 4.2. VSN International Ltd, https://asremlkbvsnicouk/ Clarke CR, Kramer CG, Kotha RR, Wanner LA, Luthria DL, Kramer M (2019) Cultivar Resistance to Common Scab Disease of Potato Is Dependent on the Pathogen Species. Phytopathology 109(9):1544–1554. https://doi.org/10.1094/PHYTO-09-18-0368-R Cui L, Yang C, Jin M, Wei L, Yang L, Zhou J (2021) Identification and biological characterization of a new pathogen that causes potato scab in Gansu Province, China. 105276 Microb Pathog 161 (Pt A):. https://doi.org/10.1016/j.micpath.2021.105276 Dees MW, Sletten A, Hermansen A (2013) Isolation and characterization of Streptomyces species from potato common scab lesions in Norway. Plant Pathol 62(1):217–225. https://doi.org/10.1111/j.1365-3059.2012.02619.x Dees MW, Wanner LA (2012) In Search of Better Management of Potato Common Scab. Potato Res 55(3–4):249–268. https://doi.org/10.1007/s11540-012-9206-9 Doumbou CLZ, Akimov V, Beaulieu C (1998) Selection and characterization of microorganisms utilizing thaxtomin A, a phytotoxin produced by Streptomyces scabies. Appl Environ Microbiol 64:4313–4316. https://doi.org/10.1128/AEM.64.11.4313-4316.1998 Faucher E, Savard T, Beaulieu C (1992) Characterization of actinomycetes isolated from common scab lesions on potato tubers. Can J Plant Pathol 14:197–202. https://doi.org/10.1080/07060669209500874 Flores-González R, Velasco I, Montes F (2007) Detection and characterization of Streptomyces causing potato common scab in Western Europe. Plant Pathol 57(1):162–169. https://doi.org/10.1111/j.1365-3059.2007.01734.x Francis IM, Jourdan S, Fanara S, Loria R, Rigali S (2015) The cellobiose sensor CebR is the gatekeeper of Streptomyces scabies pathogenicity. mBio 6(2):e02018. https://doi.org/10.1128/mbio.02018-14 Fyans JK, Bown L, Bignell DR (2016) Isolation and Characterization of Plant-Pathogenic Streptomyces Species Associated with Common Scab-Infected Potato Tubers in Newfoundland. Phytopathology 106(2):123–131. https://doi.org/10.1094/PHYTO-05-15-0125-R Henao L, Guevara M, Restrepo S, Husserl J (2021) Genotypic and phenotypic characterization of Streptomyces species associated with potato crops in the central part of Colombia. Plant Pathol 71(3):750–761. https://doi.org/10.1111/ppa.13485 Hiltunen LH, Alanen M, Laakso I, Kangas A, Virtanen E, Valkonen JPT (2011) Elimination of common scab sensitive progeny from a potato breeding population using thaxtomin A as a selective agent. Plant Pathol 60:426–435. https://doi.org/10.1111/j.1365-3059.2010.02386.x Hudec C, Biessy A, Novinscak A, St-Onge R, Lamarre S, Blom J, Filion M (2021) Comparative Genomics of Potato Common Scab-Causing Streptomyces spp. Displaying Varying Virulence Front Microbiol 12:716522. https://doi.org/10.3389/fmicb.2021.716522 Khu D-M, Love SL, Mo H-S, Li K-H, Lim H-T, Horticulture (2007) Environ Biotechnol 48:224–227 Latif Azam F, Endelman JB, Milbourne D, Griffin D, Van Eck HJ (2026) Composite interval mapping for potato common scab in connected F1 populations. https://www.researchsquare.com/article/rs-9173453/v1 Leiner RH, Fry BA, Carling DE, Loria R (1996) Probable Involvement of Thaxtomin A in Pathogenicity of Streptomyces scabies on Seedlings. Etiology 86:709–713 Li Y, Liu J, Diaz-Cruz G, Cheng Z, Bignell DRD (2019) Virulence mechanisms of plant-pathogenic Streptomyces species: an updated review. Microbiol (Reading) 165(10):1025–1040. https://doi.org/10.1099/mic.0.000818 Loria R, Bukhalid RA, Creath RA, Leiner RH, Olivier M, Steffens JC (1995) Differential Production of Thaxtomins of Pathogenic Steptomyces Species In Vitro. Biochem Cell Biol 85:537–541 Loria R, Kers J, Joshi M (2006) Evolution of plant pathogenicity in Streptomyces. Annu Rev Phytopathol 44:469–487. https://doi.org/10.1146/annurev.phyto.44.032905.091147 Maharana C, Sagar V, Sharma S, Buckseth T, Bairwa A, Naga K, Kumar V, Singh B (2024) Novel Rapid In Vitro Method for Screening of Potato Genotypes Against Streptomyces sp. Potato Res 68(2):1159–1169. https://doi.org/10.1007/s11540-024-09782-5 Padilla-Reynaud R, Simao-Beaunoir AM, Lerat S, Bernards MA, Beaulieu C (2015) Suberin Regulates the Production of Cellulolytic Enzymes in Streptomyces scabiei, the Causal Agent of Potato Common Scab. Microbes Environ 30(3):245–253. https://doi.org/10.1264/jsme2.ME15034 AHDB Potatoes (2007) Potato Variety Database (PVD). https://potatoes.agricrops.org/ . Accessed 8 March 2024 Santos-Cervantes ME, Felix-Gastelum R, Herrera-Rodríguez G, Espinoza-Mancillas MG, Mora-Romero AG, Leyva-López NE (2017) Characterization, Pathogenicity and Chemical Control of Streptomyces acidiscabies Associated to Potato Common Scab. Am J Potato Res 94(1):14–25. https://doi.org/10.1007/s12230-016-9541-5 Sharma A, Gautam S, Saxena S (2014) Streptomyces. In: Encyclopedia of Food Microbiology. pp 560–566. https://doi.org/10.1016/b978-0-12-384730-0.00326-8 Sohngen C, Podstawka A, Bunk B, Gleim D, Vetcininova A, Reimer LC, Ebeling C, Pendarovski C, Overmann J (2016) BacDive–The Bacterial Diversity Metadatabase in 2016. Nucleic Acids Res 44(D1):D581–585. https://doi.org/10.1093/nar/gkv983 Song J, Lee SC, Kang JW, Baek HJ, Suh JW (2004) Phylogenetic analysis of Streptomyces spp. isolated from potato scab lesions in Korea on the basis of 16S rRNA gene and 16S-23S rDNA internally transcribed spacer sequences. Int J Syst Evol Microbiol 54(Pt 1):203–209. https://doi.org/10.1099/ijs.0.02624-0 Uysal N, Bozkurt A, Elçi E (2024) Isolation and characterization of plant-pathogenic Streptomyces species associated with potato common scab disease in Türkiye. Plant Pathol 74(1):101–122. https://doi.org/10.1111/ppa.14001 n der Wolf JM, Boer SHD (2007) Bacterial Pathogens of Potato. In: Potato Biology and Biotechnology. Elsevier Sci B V 595–617. https://doi.org/10.1016/B978-044451018-1/50069-5 Wang Z, Li Y, Zhuang L, Yu Y, Liu J, Zhang L, Gao Z, Wu Y, Gao W, Ding GC, Wang Q (2019) A Rhizosphere-Derived Consortium of Bacillus subtilis and Trichoderma harzianum Suppresses Common Scab of Potato and Increases Yield. Comput Struct Biotechnol J 17:645–653. https://doi.org/10.1016/j.csbj.2019.05.003 Wanner LA (2006) A Survey of Genetic Variation in Streptomyces Isolates Causing Potato Common Scab in the United States. Bacteriology 96:1363–1371. https://doi.org/10.1094/PHYTO-96-1363 Wilson CR, Luckman GA, Tegg RS, Yuan ZQ, Wilson AJ, Eyles A, Conner AJ (2009) Enhanced resistance to common scab of potato through somatic cell selection in cv. Iwa with the phytotoxin thaxtomin A. Plant Pathol 58(1):137–144. https://doi.org/10.1111/j.1365-3059.2008.01903.x Supplementary Files FileS1.SupplementalFigures.pdf Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 01 Apr, 2026 Reviewers invited by journal 01 Apr, 2026 Editor assigned by journal 31 Mar, 2026 First submitted to journal 27 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-9248130\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":615684975,\"identity\":\"8a801b7e-70d1-4200-a253-2bc8c6c06a6d\",\"order_by\":0,\"name\":\"Fatima Latif Azam\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"TEAGASC\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Fatima\",\"middleName\":\"Latif\",\"lastName\":\"Azam\",\"suffix\":\"\"},{\"id\":615684976,\"identity\":\"0e28d598-d8be-441c-82ca-b67cbe28af49\",\"order_by\":1,\"name\":\"Dan Milbourne\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"TEAGASC\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dan\",\"middleName\":\"\",\"lastName\":\"Milbourne\",\"suffix\":\"\"},{\"id\":615684977,\"identity\":\"466ec1b9-ff31-47a0-9edd-03cd8cc1b16b\",\"order_by\":2,\"name\":\"Elise Delahaut\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"TEAGASC\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Elise\",\"middleName\":\"\",\"lastName\":\"Delahaut\",\"suffix\":\"\"},{\"id\":615684978,\"identity\":\"3dfbdecd-6f9c-4e0c-8c12-516f2da47334\",\"order_by\":3,\"name\":\"Herman J. van Eck\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIiWNgGAWjYBACA2QOY0MFhD5AgpYzEAYJWhrbiNBizt77dMPPHQyJ/bObD36cOe9w4vYG3gN4tVj2HDe72XuGIXHGnWPJkhu3HU6cc4AvAb/DbqSx3eBtYzBmuJFjxvhw2+3EGQw8Bvi13H/GdvMvUIv8jfxvjA/nEKPlBhvbbaAtcgY3ctgYNzYQo+VMGttt2TYJOcMbacaSM479N57BTEjL8WNsN9+22fDI3Uh++LGnJk12BnuP4QN8WqBAAonNTIT6UTAKRsEoGAX4AQBltU/W2Pxi7QAAAABJRU5ErkJggg==\",\"orcid\":\"https://orcid.org/0000-0002-6530-0616\",\"institution\":\"Wageningen University \\u0026 Research\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Herman\",\"middleName\":\"J. van\",\"lastName\":\"Eck\",\"suffix\":\"\"},{\"id\":615684979,\"identity\":\"248699d8-2ccb-45b4-9a4f-ec6d4134cab5\",\"order_by\":4,\"name\":\"Denis Griffin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"TEAGASC\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Denis\",\"middleName\":\"\",\"lastName\":\"Griffin\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2026-03-27 20:27:17\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-9248130/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-9248130/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":106307401,\"identity\":\"e0e632d9-3b50-4748-8b1f-8905bd6f413e\",\"added_by\":\"auto\",\"created_at\":\"2026-04-07 10:04:59\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":348578,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eProcess illustrating the isolation of \\u003cem\\u003eStreptomyces\\u003c/em\\u003e strains from infected tubers. The macerate from each isolation was first plated onto water agar; then, single colonies were transferred to yeast malt extract (YME) agar supplemented with NPPC antibiotics; finally, the isolates were maintained on oatmeal agar.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Slide1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9248130/v1/b8f8f9aff507c706ae827253.png\"},{\"id\":106307403,\"identity\":\"d397efa6-cdf7-4b6d-9320-4f70a3ee892a\",\"added_by\":\"auto\",\"created_at\":\"2026-04-07 10:04:59\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":175328,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe range of scab resistance response in the control varieties (A-F) and the progeny from the Electra × Désirée cross (G-L) according to the root inoculation assay 10 days post-inoculation. The percentage of clean root area is shown in brackets. All images are to the same scale.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Slide2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9248130/v1/8c79d514819b7d0c1abcf53e.png\"},{\"id\":106307404,\"identity\":\"a8d3b915-0364-4272-b2a2-a3f2ad615a40\",\"added_by\":\"auto\",\"created_at\":\"2026-04-07 10:04:59\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":101014,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eBarplot presenting the percentage of clean root area and the relative root length of the tested progeny and the control varieties from the root inoculation assay. The colour key indicates the trait: percentage of clean root area in salmon pink and percentage of relative root length in blue.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Slide3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9248130/v1/fa40ae97feb04c59e228166a.png\"},{\"id\":106307405,\"identity\":\"9763d472-f215-44f2-83a5-202cc5dde30f\",\"added_by\":\"auto\",\"created_at\":\"2026-04-07 10:04:59\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":150209,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003e(A)\\u003c/strong\\u003e Scatter plot of tuber resistance score (BLUEs) from the field trial OP2024 (x-axis) and percentage of clean root area from the root inoculation assay (y-axis). Each point is shown with two error bars: the horizontal error bar represents the standard deviation of residuals for the field resistance score, and the vertical error bar represents the standard deviation of residuals for the assay score. Colours indicate whether the point represents progeny (black) or controls: Maris Piper (pink), Désirée (yellow olive), Picasso (green), Mayan Gold (light blue), and Jubel (blue). \\u003cstrong\\u003e(B) \\u003c/strong\\u003eBarplot presenting the percentage of clean root area of the tested progeny from the root inoculation assay. The colour key indicates the selected offspring based on tuber resistance in the field: Susceptible progeny in salmon pink, medium resistance progeny in green and resistant progeny in blue.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Slide4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9248130/v1/a00d7762b1d6cee6fc3cc0e7.png\"},{\"id\":106404748,\"identity\":\"42f910ba-2bd3-4d33-8b3a-0ca6d6641eb5\",\"added_by\":\"auto\",\"created_at\":\"2026-04-08 09:16:53\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1391389,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9248130/v1/508007db-9de8-44f4-9199-0db4ad8ff6ef.pdf\"},{\"id\":106307402,\"identity\":\"02ec8fb2-20d1-4a86-aedc-220d2d36d97b\",\"added_by\":\"auto\",\"created_at\":\"2026-04-07 10:04:59\",\"extension\":\"pdf\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":810615,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FileS1.SupplementalFigures.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9248130/v1/fae1da848dc625f1423190ac.pdf\"}],\"financialInterests\":\"\",\"formattedTitle\":\"A novel in vitro root inoculation assay to screen potato genotypes for resistance to Common Scab\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003ePotato is susceptible to several bacterial, fungal and viral diseases. A major bacterial disease affecting this crop worldwide is common scab (CS) that can cause a huge marketable yield loss in severely affected fields. CS is caused by multiple \\u003cem\\u003eStreptomyces\\u003c/em\\u003e species (spp.), which are a gram-positive actinobacteria that produce disease symptoms on the tuber surface, including superficial, raised or deep pitted lesions. Amongst the most known pathogenic scab-causing \\u003cem\\u003eStreptomyces\\u003c/em\\u003e spp. are \\u003cem\\u003eS. scabiei\\u003c/em\\u003e (the oldest known potato scab causing species), \\u003cem\\u003eS. acidiscabiei\\u003c/em\\u003e (important for causing scab in low pH soils), \\u003cem\\u003eS. turgidiscabiei\\u003c/em\\u003e (known for causing raised, rough and corky scab lesions) and \\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e (closely related to \\u003cem\\u003eS. scabiei\\u003c/em\\u003e and mainly found in Europe) (Loria et al., \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e). Potato scab-causing \\u003cem\\u003eStreptomyces\\u003c/em\\u003e spp. can also infect other crops like radish, beet, parsnip and turnip (Leiner et al., \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e1996\\u003c/span\\u003e; Santos-Cervantes et al., \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eStreptomyces\\u003c/em\\u003e spp. are saprophytic bacteria that can survive in soil and infected plant debris for long periods, either in its vegetative mycelial form or in the form of spores (Sharma et al., \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). Invasion of the host plants occurs by entering through wounds, lenticels or by direct contact with tubers in the early developmental stage and stimulates the growth of scab lesions. Lesions grow as the tubers expand, and it is where the pathogen produces spores. Susceptibility to scab infection increases from soil pH 5 to soil pH 8 and infection is supported by dry soil conditions and the optimal temperature for disease development is between 20 and 22\\u003csup\\u003eo\\u003c/sup\\u003eC (Braun et al., \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThe main virulence determinant of pathogenic \\u003cem\\u003eStreptomyces\\u003c/em\\u003e spp. is the phytotoxin thaxtomin, a nitrated dipeptide toxin, which is known to inhibit cellulose biosynthesis in plant cells, and, consequently, this leads to plant cell death. Many strains also have other virulence-related genes such as \\u003cem\\u003enec1\\u003c/em\\u003e which encodes for a necrogenic protein or \\u003cem\\u003etomA\\u003c/em\\u003e which encodes for a tomatinase (Dees et al., \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). All the virulence-associated genes are found on the pathogenicity island (PAI) (Van der Wolf \\u0026amp; Boer, \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e2007\\u003c/span\\u003e), which is acquired by \\u003cem\\u003eStreptomyces\\u003c/em\\u003e spp. via horizontal gene transfer.\\u003c/p\\u003e \\u003cp\\u003eThe motivation for potato breeders to develop scab-resistant varieties depends on the relative importance of this trait among the many traits in the breeding programs. Phenotyping for scab resistance may be incidental, e.g. identification of susceptible clones during performance trials over years of selection, or more directed, with specific trials in fields with high disease pressure. However, there are several limitations to field test such as yearly variation in scab incidence due to environmental factors (such as weather conditions), variable disease pressure both within and between fields, the diversity of scab-causing species, limited access to suitable trial sites, and the resource-intensive nature of field trials, especially during the early stages of a breeding programme. Hence, more controlled and labour efficient phenotyping methods, such as in vitro testing, may provide breeders with a greater degree of reliability in trait measurement compared with variable field conditions.\\u003c/p\\u003e \\u003cp\\u003eSeveral assays exist to evaluate common scab resistance, or to evaluate isolate pathogenicity. Pathogenicity assays may use tuber slices in a petri dish, in vitro grown seedlings or tubers (Faucher et al., \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e1992\\u003c/span\\u003e; Loria et al., \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e1995\\u003c/span\\u003e; Leiner et al., \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e1996\\u003c/span\\u003e; Bignell et al., \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e; Uysal et al., \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). Strains that induced necrotic symptoms on potato tissue, hypertrophy and abnormal growth in the seedlings were considered pathogenic. Interestingly, Bignell et al. (\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e) also studied the virulence of a reference pathogenic \\u003cem\\u003eStreptomyces\\u003c/em\\u003e strain by applying a bacterial spore solution to tobacco plants in vitro and observed root browning and an overall stunting of the in vitro plants.\\u003c/p\\u003e \\u003cp\\u003eOnly a few studies have explored the potential of an in vitro assay to assess resistance levels of different potato clones. These studies used either purified thaxtomin (Khu et al., \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2007\\u003c/span\\u003e; Hiltunen et al., \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e) or bacterial spores (Maharana et al., \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). Khu et al. (\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2007\\u003c/span\\u003e) studied the effect of purified thaxtomin on potato shoots from 100 in vitro plants derived from a cross between varieties Atlantic and Superior. They observed reduced shoot growth and, with the highest concentration of thaxtomin, obtained a correlation coefficient of -0.656 between shoot height and tuber resistance, based on artificial inoculation of the same in vitro plants in a glasshouse trial. Likewise, Hiltunen et al. (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e) studied the effect of purified thaxtomin on potato in vitro plants\\u0026rsquo; shoots and roots and reported a correlation coefficient of -0.463 for 18 genotypes between the shoot height and scab index based on a trial in a naturally infected field. Lastly, Maharana et al. (\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e) recently developed an in vitro assay where mini tubers were generated in liquid medium and later a bacterial spore suspension was added to the growing mini tubers for disease development and symptom assessment.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we aimed to develop a novel in vitro assay for rapid assessment of scab resistance with minimal manipulation across different potato genotypes using pathogenic scab isolates collected in Ireland. Specifically, a root inoculation assay was chosen as it was demonstrated to be efficient in observing disease symptoms on roots by Bignell et al. (\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e). \\u003cem\\u003eStreptomyces\\u003c/em\\u003e is aerobic, needs a source of carbon to thrive and it is not reported to utilize the compounds of agar or MS salts (for growth). Meanwhile, in vitro grown plantlets need sucrose at an early stage, and this need is substituted by photosynthesis at a later stage. This suggested that a simple in vitro assay, where plantlets on nutrient-free medium are directly inoculated with the test strain, followed by the assessment of root lesions, might have diagnostic potential for resistance/susceptibility. The experiments and subsequent results described in this study followed a promising series of pilot experiments in which the validity of these initial ideas was at least partially validated, leading to the protocol used below. We subsequently validated the root inoculation assay by first testing it on a small set of varieties with well-characterized resistance phenotypes, allowing us to establish an assessment criterion associated with resistance. This assay and the derived criterion were then further evaluated by comparing the in vitro results with field performance data from a larger genotype panel derived from a cross between resistant and susceptible parents.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cp\\u003eBacterial isolation and growth\\u003c/p\\u003e \\u003cp\\u003eInfected tubers were collected from trial fields in Ireland during the 2022 and 2023 field seasons. Tubers were either used fresh or stored in a cold room at 4\\u003csup\\u003eo\\u003c/sup\\u003eC for 2 to 7 months. These tubers mainly belonged to advanced breeding clones and were selected based on the surface symptoms resembling scab lesions. Each tuber was used for a single isolation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). The tubers were first washed under running water to remove any dirt. Next, cubes of 125 mm\\u003csup\\u003e3\\u003c/sup\\u003e were cut from the tubers, including the lesion surface. These cubes were surface sterilized with 1.4% of sodium hypochlorite solution (14% active chlorine) and 1 drop of tween for 5 minutes with continuous shaking. The cubes were then rinsed with sterile distilled water for 15 minutes, replacing the water every two minutes while continuing to shake. Then, the cubes were placed in a sterile petri dish, and the outer layers were aseptically removed, but not the lesioned skin. The remaining piece was macerated using a mortar and pestle under aseptic conditions. The macerate was transferred to sterile tubes and incubated in 1 to 2 ml of sterile distilled water at 55\\u003csup\\u003eo\\u003c/sup\\u003eC for 30 minutes. Next, 100 \\u0026micro;l of the macerate was plated onto water agar (1.2%), and the plates were incubated in the dark at 28\\u003csup\\u003eo\\u003c/sup\\u003eC for 10 days. From each water agar plate, up to 2 single colonies with morphological characteristics resembling \\u003cem\\u003eStreptomyces\\u003c/em\\u003e were streaked onto the yeast malt extract (YME) agar supplemented with 50 mg nystatin, 5 mg polymyxin B sulphate, 1 mg sodium penicillin G, and 50 mg cycloheximide (or NPPC antibiotics hereafter) per litre of medium (Faucher et al., \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e1992\\u003c/span\\u003e). Single bacterial colonies obtained were transferred to fresh medium to obtain pure cultures. After purification, the isolates were transferred to oatmeal (OM) agar plates and maintained on the same medium to promote spore production. Glycerol stocks of the bacteria were prepared at a final concentration of 15% (vol/vol) and stored at -80\\u003csup\\u003eo\\u003c/sup\\u003eC.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe reference strain \\u0026ldquo;WUR\\u0026rdquo; was provided by Wageningen University, and the CBF4521-T (Bouchek-Mechiche et al., \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e; Bouchek-Mechiche et al., 2001) was kindly provided by Dr. Karima Bouchek-Mechiche (INRAe, France). These strains were maintained by culturing on OM agar and stored as stock at -80\\u003csup\\u003eo\\u003c/sup\\u003eC. They were included in the molecular identification collectively with the strains isolated in this study.\\u003c/p\\u003e \\u003cp\\u003eDNA extraction\\u003c/p\\u003e \\u003cp\\u003eThe bacterial isolates were grown on oatmeal agar at 28\\u003csup\\u003eo\\u003c/sup\\u003eC for 7\\u0026ndash;10 days in the dark. Cells and spores were then scraped from the plates and added into 2 ml Eppendorf tubes. The samples were freeze dried for 48 hours and subsequently ground in a shaker with two glass beads of 4 mm of diameter. DNA was extracted using the DNeasy Plant Mini Kit (cat. 69104, QIAGEN) following the manufacturer\\u0026rsquo;s instructions, except that after the addition of the lysis buffer and RNase A, the samples were incubated for 1 hour at 65\\u003csup\\u003eo\\u003c/sup\\u003eC. DNA was eluted in 50 \\u0026micro;l of buffer AE. DNA concentration was determined using the Qubit kit according to the manufacturer\\u0026rsquo;s instructions, and DNA quality was assessed by 0.9% agarose gel electrophoresis.\\u003c/p\\u003e \\u003cp\\u003ePCR analysis\\u003c/p\\u003e \\u003cp\\u003ePolymerase chain reactions (PCR) were carried out on a MiniAmp Thermal Cycler (Applied Biosystems) using the Multiplex PCR kit (cat. no. 206143, QIAGEN), following the manufacturer\\u0026rsquo;s instructions with small modifications. PCR reactions were performed in a total volume of 10 \\u0026micro;l, made of 2 \\u0026micro;l of DNA (60-80ng/\\u0026micro;l), 0.5 \\u0026micro;l of each primer (10 \\u0026micro;M), 5 \\u0026micro;l of Qiagen Master Mix (2x concentration) and 2 \\u0026micro;l of RNase-free H\\u003csub\\u003e2\\u003c/sub\\u003eO. The PCR protocol included an initial denaturation cycle at 95\\u003csup\\u003eo\\u003c/sup\\u003eC for 5 min; followed by 35 cycles of denaturation at 95\\u003csup\\u003eo\\u003c/sup\\u003eC for 30 s, annealing for 60 s and extension at 72\\u003csup\\u003eo\\u003c/sup\\u003eC for 30s to 90s (depending on the fragment size), with a final extension at 72\\u003csup\\u003eo\\u003c/sup\\u003eC for 5 min. For the amplicons for nucleotide sequencing, the final extension was performed at 68\\u003csup\\u003eo\\u003c/sup\\u003eC for 30 min. PCR products were visualized by electrophoresis on 0.9% agarose gels. The primers used in this study, and their respective annealing temperatures are listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. The annealing temperatures were optimized to obtain specific bands.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimer sequences and annealing temperatures used for detection of genes of isolated strains.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"6\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTarget\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003ePrimer\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eSequence\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eAnnealing temperature (\\u0026deg;C)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eAmplicon size (bp)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eReference\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"5\\\" rowspan=\\\"6\\\"\\u003e \\u003cp\\u003eUniversal bacterial primers\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e16S 1F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCATTCACGGAGAGTTTGATCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e55\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e458\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eWanner (\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e16S 455-435R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eACTTTCGCTTCTTCCCTGCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e16S rRNA-27F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAGAGTTTGATCCTGGCTCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e57\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e1568\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eCui et al. (\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e16S rRNA-1492R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGGTTACCTTGTTACGACTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e16S rRNA-ITSLF\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGTCAAGTCATCATGCCCCTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e57\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e650\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eSong et al. (\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e2004\\u003c/span\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e16S rRNA-ITSR\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAAACTTGGCCACAGATGCTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. scabiei\\u003c/em\\u003e / \\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eASE3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAACGGCCAGAGATGGTCGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e58\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e474\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eWanner (\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eScab2m\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTTCGACAGCTCCCTCCCTTAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003etxtAB\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eStx1a\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGTGGACCGTGGAGCATCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e55\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e400\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eFlores-Gonz\\u0026aacute;lez et al. (2008)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eStx1b\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCAGTTCGGCGTAACTCAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003enec1\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eNf\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eATGAGCGCGAACGGAAGCCCCGGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e62\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e700\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eBukhalid et al. (\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e1998\\u003c/span\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eNr\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGCAGGTCGTCACGAAGGATCG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003etomA\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTom3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGAGGCGTTGGTGGAGTTCTA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e55\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c5\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e392\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eWanner (\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTom4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTTGGGGTTGTACTCCTCGTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eSpecies identification\\u003c/p\\u003e \\u003cp\\u003eUniversal primers for 16S rRNA (16S 1F/16S 455-435R (Wanner, \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e), 16S rRNA-27F/16S rRNA-1492R (Cui et al., \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e)) were used to verify whether all collected isolates are bacterial through PCR. The primer pair from Cui et al. (\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e) was also used for Sanger Sequencing of the amplified product. The obtained sequences were analysed using the online Basic Local Alignment Tool (BLAST) against the \\u003cem\\u003eStreptomyces\\u003c/em\\u003e gene database in NCBI to identify isolates belonging to the genus \\u003cem\\u003eStreptomyces\\u003c/em\\u003e. Subsequently, all isolates were tested with the species-specific primer pair ASE3/Scab2m to identify \\u003cem\\u003eS. scabiei\\u003c/em\\u003e/\\u003cem\\u003eS. europeaiscabiei\\u003c/em\\u003e species. Differentiating between these two species with 16S rRNA genes is not possible, as these genes are nearly identical in both species. Hence, the primer pair 16S rRNA-ITSLF/16S rRNA-ITSR was used to amplify the intergenic transcribed spacer (ITS) region of the 16S operon. Subsequently, the resulting amplicons were digested with Hpy99I restriction enzyme (New England Biolabs) following the manufacturer\\u0026rsquo;s instructions. \\u003cem\\u003eS. scabiei\\u003c/em\\u003e has present the recognition site for this enzyme in the ITS region, whereas the site is absent in \\u003cem\\u003eS. europeaiscabiei\\u003c/em\\u003e (Song et al., \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e2004\\u003c/span\\u003e; Flores-Gonzalez et al., 2008).\\u003c/p\\u003e \\u003cp\\u003eIdentification of genes on pathogenicity island (PAI)\\u003c/p\\u003e \\u003cp\\u003ePCRs were also performed for genes on the PAI that are involved in the virulence of the isolates (Hudec at al., 2021). Primer pairs Stx1a/Stx1b (Flores-Gonzalez et al., 2008), Nf/Nr (Bukhalid et al., \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e1998\\u003c/span\\u003e) and Tom3/Tom4 (Wanner, \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e) were used to verify the presence of the \\u003cem\\u003etxtAB\\u003c/em\\u003e, \\u003cem\\u003enec1\\u003c/em\\u003e and \\u003cem\\u003etomA\\u003c/em\\u003e genes, respectively.\\u003c/p\\u003e \\u003cp\\u003ePlant material and progeny selection for assay validation\\u003c/p\\u003e \\u003cp\\u003eTrue seeds from a cross between varieties Electra and D\\u0026eacute;sir\\u0026eacute;e, germinated in vitro. Cuttings were used for in vitro assays and used to generate mini tubers for a field trial in 2024 in Oak Park field, Carlow (Latif Azam et al., \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2026\\u003c/span\\u003e). The field trial was based on this cross together with another F1 population, arranged in a randomized complete block design with replicated controls. The scale used to score tubers for scab resistance ranged from 1 (susceptible) to 9 (resistant), corresponding to the percentage of surface area covered by scab lesions (Latif Azam et al., \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2026\\u003c/span\\u003e). The broad-sense heritability of the field trial was 0.74. Hence, based on the best linear unbiased estimates (BLUEs) of resistance level in the field trial, 20 most resistant progeny, 20 most susceptible progeny, and 10 clones with intermediate resistance were selected from a population of 166 derived from the Electra \\u0026times; D\\u0026eacute;sir\\u0026eacute;e cross for in vitro testing. Susceptible progeny had field scores between 2.61 and 4.44, intermediate resistance progeny had scores between 4.64 and 6.16, and resistant progeny had scores between 6.71 and 8.03. In addition, six control varieties were tested, including Jubel, Picasso, Electra, Mayan Gold (all resistant; R), D\\u0026eacute;sir\\u0026eacute;e and Maris Piper (both susceptible; S) according to the Potato Variety Database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://potatoes.agricrops.org/\\u003c/span\\u003e\\u003cspan address=\\\"https://potatoes.agricrops.org/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). The selected progeny, and controls were maintained in vitro on MS20 supplemented with 30 grams/Liter of D-sorbitol to promote slow growth of the cuttings.\\u003c/p\\u003e \\u003cp\\u003eIn vitro screening method for scab resistance\\u003c/p\\u003e \\u003cp\\u003eSelected clones and varieties were grown in vitro on MS25 (g/L of sucrose) for 3 weeks. Apical and nodal cuttings were transferred to MS25 until the beginning of root development, approximately for 6 days. Simultaneously, a pathogenic isolate was transferred to fresh oatmeal agar and incubated to grow for the same amount of time. Cells and spores were scraped off in 3 ml sterile water, and the suspension was transferred to a tube. A 1:10 dilution of the inoculum suspension was made to count cells using a Kova Glasstic slide. Six-day old in vitro cuttings and 1 ml suspension (~\\u0026thinsp;3.7\\u0026nbsp;million cells) were transferred to 200 ml semi-solid medium before the medium was solidified (0.5x Agar, 1.0x MS, Duchefa Biochemie, without sucrose, Fig. S1). The cuttings were then left to further develop roots and grow. Root symptoms were assessed 10 days post-inoculation. For each potato genotype two experimental replicates and 1 uninoculated control were grown.\\u003c/p\\u003e \\u003cp\\u003eData collection and statistical analysis\\u003c/p\\u003e \\u003cp\\u003eImages of roots were taken 10 days post-inoculation following the harvest of in vitro plants. The percentage of diseased/lesioned and clean root areas were calculated using ImageJ software (version 1.54g). All images of infected roots were first manually edited to standardize the background to a blue colour. Each image was then scaled, and its saturation and brightness were adjusted accordingly to enable selection of the total root area and the diseased area, respectively, aided by visual assessment. In addition, the hue was adjusted to prevent inclusion of green root tissues during diseased area selection, also guided by visual evaluation. Based on the results of pilot experiments (not shown), the percentage of clean root area was used as a measure of resistance to common scab. Additionally, the maximum root length was also measured for each plant using the same software. The relative root length of inoculated plants (in %) was calculated relative to the root length of uninoculated control plants.\\u003c/p\\u003e \\u003cp\\u003eA linear model was developed in ASRemlR v4.2 (Butler et al., \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e) to estimate the best linear unbiased estimates (BLUEs) for both the percentage of clean root area and the relative root length of the tested progeny and varieties. These BLUEs were correlated with the tuber resistance BLUEs from the field trial in 2024 using Spearman\\u0026rsquo;s rank correlation coefficient.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003eBacterial isolate collection\\u003c/p\\u003e \\u003cp\\u003eInfected tubers were collected from seven different fields in Ireland, including one field in Donegal, one in Kilkenny and five in Carlow (Knockbeg, Lisnavagh, Tullow, Oak Park and White house). The collected tubers showed either superficial or raised scab symptoms. From one to three tubers per field a total of 16 isolations were performed, and a total of 24 potential strains were collected, one to two colonies per isolation.\\u003c/p\\u003e \\u003cp\\u003eSpecies identification\\u003c/p\\u003e \\u003cp\\u003ePCR amplification of 16S rRNA gene with universal primers identified all isolates as bacteria (Fig. S3a and Fig. S3b). Sequencing of the 16S rRNA PCR products amplified with 27F/1492R primers identified all 24 isolates as belonging to the genus \\u003cem\\u003eStreptomyces\\u003c/em\\u003e (Fig. S3a). Among these, 11 isolates (46%) were found to be \\u003cem\\u003eStreptomyces\\u003c/em\\u003e species known to be responsible for causing common scab in potato, while the remaining 13 isolates (54%) were identified as other soil \\u003cem\\u003eStreptomyces\\u003c/em\\u003e species. PCR with ASE3/Scab2m primers showed the presence of scab-causing \\u003cem\\u003eStreptomyces\\u003c/em\\u003e in the same 11 isolates identified by sequencing of 16S rRNA (Fig. S3c). To further distinguish between \\u003cem\\u003eS. scabiei\\u003c/em\\u003e and \\u003cem\\u003eS. europeaiscabiei\\u003c/em\\u003e among these 11 strains, Hpy99I digestion was performed on amplified ITS region of the 16S operon (Fig. S4a). None of the strains could be restricted with Hpy99I and, therefore, they were all assigned to \\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e (Fig. S4b). These 11 strains originated from eight isolations across three locations (Lisnavagh, Tullow and Oak Park) (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e), while collection of \\u003cem\\u003eStreptomyces\\u003c/em\\u003e spp. from locations Donegal, Kilkenny, Knockbeg and White house failed. The reference strain \\u0026ldquo;WUR\\u0026rdquo; was also tested with ASE3/Scab2m primer and, after restriction with Hpy99I, was identified as \\u003cem\\u003eS. europeaiscabiei\\u003c/em\\u003e. The reference strain CFBP4521T is known to be \\u003cem\\u003eS. stelliscabiei\\u003c/em\\u003e based on the literature and was only tested with primers for PAI genes, as described below.\\u003c/p\\u003e \\u003cp\\u003ePresence of pathogenicity genes\\u003c/p\\u003e \\u003cp\\u003eAll collected strains and the reference strains \\u0026ldquo;WUR\\u0026rdquo; and CFBP4521T were tested with primers for pathogenicity island genes (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). Only the 11 strains of \\u003cem\\u003eS. europeaiscabiei\\u003c/em\\u003e (Fig. S3d) and the reference strains tested positive for the \\u003cem\\u003etxtAB\\u003c/em\\u003e gene. Notably, only a faint band for this gene was observed in the reference strain CFBP4521T (Fig. S5a). None of the newly collected strains were positive for the \\u003cem\\u003etomA\\u003c/em\\u003e gene; however, both reference strains were positive for this gene with the \\u0026ldquo;WUR\\u0026rdquo; strain showing only a faint band (Fig. S5c). Interestingly, only the reference strain CFBP4521T was positive for the \\u003cem\\u003enec1\\u003c/em\\u003e gene (Fig. S5b), while none of the other isolates or the \\u0026ldquo;WUR\\u0026rdquo; reference strain showed a positive band.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eCharacteristics of the pathogenic \\u003cem\\u003eStreptomyces\\u003c/em\\u003e strains.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"7\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eOrigin\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eLocation\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eBacterial code\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eSpecies\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003etxtAB\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003enec1\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003etomA\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"10\\\" rowspan=\\\"11\\\"\\u003e \\u003cp\\u003eThis study\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\" morerows=\\\"3\\\" rowspan=\\\"4\\\"\\u003e \\u003cp\\u003eLisnavagh\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eLis1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eLis2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eLis3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eLis4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eTullow\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTul1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTul2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\" morerows=\\\"4\\\" rowspan=\\\"5\\\"\\u003e \\u003cp\\u003eOak Park\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eOP1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eOP2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eOP3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eOP4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eOP5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eReference\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eThe Netherlands\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eWUR\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eFrance\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCFBP 4521T\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS. stelliscabiei\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e+\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eQuantification of scab resistance level\\u003c/p\\u003e \\u003cp\\u003eThe bacterial strain for the root inoculation assay was isolated from the same location where the field trial was conducted using the bi-parental progeny. Specifically, we used the isolate OP5 from Oak Park field, a \\u003cem\\u003eS. europaescabiei\\u003c/em\\u003e strain exhibiting the appropriate PCR amplicon indicating the presence of the \\u003cem\\u003etxtAB\\u003c/em\\u003e gene (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eUsing this strain, the control varieties were tested first (Maris Piper (S), D\\u0026eacute;sir\\u0026eacute;e (S), Electra (R) and Jubel (R)). We assessed which disease symptoms could be observed compared to the control plants and which parts of the plantlet developed these symptoms. In addition, we evaluated whether these symptoms differed among genotypes known to have different levels of field resistance to common scab. We first observed browning of the roots, including root tips and auxiliary roots ends, and root stunting 6 days post-inoculation compared to the control plants with healthy and long roots (Fig. S2). Among different control genotypes, we observed more root browning on susceptible controls (D\\u0026eacute;sir\\u0026eacute;e and Maris Piper) compared to the resistant controls (Electra and Jubel). Root stunting was observed in both susceptible and resistant controls to different degrees compared to the uninoculated control plants. If the plants were left long enough in the inoculated medium, the shoots also developed necrotic symptoms, eventually resulting in whole plant death (Fig. S6). Plant death occurred faster in susceptible than in resistant genotypes. Based on these observations, we decided to take the percentage of the clean root area 10 days post-inoculation as a quantitative measure of resistance to scab. Subsequently, the assay was performed with 50 clones from the cross between varieties Electra (R) and D\\u0026eacute;sir\\u0026eacute;e (S), along with the previously tested controls and additional resistant varieties Picasso and Mayan Gold (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, panels A-F).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eDisease symptoms on roots became visible 6 days post-inoculation, as described previously, but the cuttings were left in the inoculated medium for 10 days before harvesting. BLUEs for the percentage of clean root area ranged from 32.1 to 93.0, and BLUEs for the percentage of relative root length ranged from 16.5 to 102.3 (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). Broad-sense heritability, calculated on an entry-mean basis, was 0.75 and 0.63 for the percentage of clean root area and the percentage of relative root length, respectively (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). Based on the quartiles of the data distribution for the percentage of clean root area, genotypes with 55% or less clean root area were considered as susceptible to scab, genotypes with 55\\u0026ndash;75% as moderately resistant, and genotypes with 75% or greater clean root as resistant. The response of disease symptoms of the progeny and control varieties in the root inoculation assay is shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eSummary statistics for the root inoculation assay data.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"9\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c8\\\" colnum=\\\"8\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c9\\\" colnum=\\\"9\\\"\\u003e\\u003c/div\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTrait\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eSample size\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"6\\\" nameend=\\\"c8\\\" namest=\\\"c3\\\"\\u003e \\u003cp\\u003eBest linear unbiased estimates (%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eBroad-sense heritability (H\\u003csup\\u003e2\\u003c/sup\\u003e)\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eMin.\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eQ1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eMedian\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eMean\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eQ3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003eMax.\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eClean root area (%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e56\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e32.08\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e54.99\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e63.85\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e64.60\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e77.07\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e92.94\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e0.75\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRelative root length (%)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e16.51\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e31.41\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e43.98\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e47.8\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e59.45\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e \\u003cp\\u003e102.25\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c9\\\"\\u003e \\u003cp\\u003e0.63\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eWe observed differences in the relative root length of the inoculated progeny and controls compared to the uninoculated plants. The uninoculated plants had an average maximum root length of 10.9 cm, while the inoculated plants had an average of 4.98 cm (46% relative root length). Theoretically, we would expect the susceptible genotypes in the root inoculation assay to have shorter relative root length compared to the resistant genotypes. We observed that this was not always the case (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). However, on average, genotypes with 55% or less clean root area had 35% of relative root length and the genotypes with 75% or greater clean root area had 55% of relative root length. Therefore, there is a trend of resistant genotypes to have greater relative root length compared to the susceptible genotypes. This trend is supported by the moderate Spearman\\u0026rsquo;s rank correlation coefficient of 0.38 between the percentage of clean root area and the percentage of relative root length.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe Spearman\\u0026rsquo;s rank correlation coefficient between the tuber resistance score from the field trial and the percentage of clean root area for the selected progeny and five control varieties was 0.61 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). Excluding the control varieties, the correlation remained similar at 0.60. We attempted several different methods of incorporating the relative root length into a disease index, but no compound trait derived from both the percentage of clean root area and relative root length yielded a higher correlation with field trial results. Despite this strong correlation, variations in resistance to common scab were observed in the root inoculation assay compared to the field trial (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). Some progeny exhibited a higher standard deviation in the field trial, others showed a higher standard deviation in the assay, while for some progeny the standard deviations were similar in both the field and the assay.\\u003c/p\\u003e \\u003cp\\u003eThe rank order for the resistant controls (for Picasso, Mayan Gold and Jubel) remained consistent across the root inoculation assay and OP2024 field trial and had on average 68% of clean root area. Electra was not included as control in the 2024 field trial but showed low resistance in the assay compared to the other resistant controls with a clean root area of 53%. Notably, the susceptible controls were more susceptible than the resistant controls with an average of 44% of clean root area. D\\u0026eacute;sir\\u0026eacute;e and Maris Piper showed reversed ranking in the assay compared to the field trial. Maris Piper showed less susceptibility in the assay, whereas D\\u0026eacute;sir\\u0026eacute;e was more susceptible (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA).\\u003c/p\\u003e \\u003cp\\u003eFigure \\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB shows the resistance level of the tested progeny from the bi-parental cross in the root inoculation assay in an ascending order. In general, the concordance between resistance status in both experiments is good, especially at the extremes of the assay, whilst varieties exhibiting an intermediate phenotype in the field were generally intermediate in the assay. Several clones showed opposite resistance levels in the assay compared to the field, based on the previously mentioned thresholds for the assay. Overall, we observed that the root inoculation assay was able to distinguish highly resistant (e.g., \\u0026ge;\\u0026thinsp;75% clean root area) and highly susceptible (e.g., \\u0026le;\\u0026thinsp;55% clean root area) progeny, in accordance with the field trial results. Specifically, progeny considered as very resistant or very susceptible by the assay showed corresponding high or low resistance values in the field trial.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThis paper describes a root inoculation assay to assess the resistance level of potato clones to common scab. The assay is not laborious or time consuming, can be performed on seedlings, and allows to shorten the breeding program. Resistance scores from the assay were validated with the tuber resistance scores obtained from field data.\\u003c/p\\u003e \\u003cp\\u003eRoot inoculation assay\\u003c/p\\u003e \\u003cp\\u003eIn this study, we hypothesised that scab-causing bacteria added to MS semi-solid medium without any source of sugar, and in the presence of the host plant, would need to infect the host roots by decomposing root polysaccharides. This process would eventually signal the production of thaxtomin (Francis et al., \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e), leading to necrotic symptoms across the roots (Bignell et al., \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e), as well as root stunting and overall reduced plant growth. Two main observations guided the design of our root inoculation assay. First, scab-causing species are known to possess versatile metabolisms, enabling them to utilize a wide range of sugars and other metabolites as carbon sources, as summarized in the Bacterial Diversity Metadatabase (S\\u0026ouml;hngen et al., 2016). However, there are no reports suggesting that MS salts and components of agar like agarose and amylopectin can be utilized for bacterial growth. This would ensure that bacteria must infect the host to allow them to grow. Second, the induction of the thaxtomin biosynthetic gene cluster is primarily triggered by cellobiose (Francis et al., \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e), a product of cellulose degradation. The presence of cellulose, a primary structural polysaccharide of plants roots and shoots, has been shown to stimulate the production of cellulases and activate secondary metabolic pathways, leading to the biosynthesis of the phytotoxin thaxtomin (Padilla-Reynaud et al., \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThe results of the assay confirmed our hypothesis. Necrotic symptoms were observed on roots, and root stunting was evident from the reduced relative root length, both compared to the uninoculated control plants. When the plants were left for a long enough in the inoculated medium, whole plant death was observed (Fig. S6). Reduced plant growth in the presence of the pathogen or after application of thaxtomin has been reported in several studies (Leiner et al., \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e1996\\u003c/span\\u003e; Khu et al., \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2007\\u003c/span\\u003e; Hiltunen et al., \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e). Interestingly, Bignell et al. (\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e) also reported root browning of tobacco roots in vitro following inoculation with a bacterial suspension of a scab-causing species. Hence, our assay likely indicates thaxtomin production, induced by actively growing root regions (i.e., such as root tips and auxiliary roots) of the host plant. Nonetheless, further studies are required to validate and quantify the production of thaxtomin in the medium.\\u003c/p\\u003e \\u003cp\\u003eComparison of in vitro assays for potato scab resistance screening\\u003c/p\\u003e \\u003cp\\u003eIn vitro assays have been used to test resistance levels of potato genotypes to scab disease. Only one study has validated the in vitro assay with three field trials in different locations (Hiltunen et al., \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e). Hiltunen et al. (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e) mixed purified thaxtomin into the MS medium before adding potato in vitro cuttings. While applying purified thaxtomin is a reasonable approach for screening genotype resistance, it does not always accurately reflect a pathogen's virulence due to the influence of other isolate-specific factors (as discussed below). Therefore, applying a bacterial suspension is more accurate and reliable, as demonstrated in this study. Furthermore, since single isolate applications also allow us to understand the specific interactions between plants and pathogen strains. The strain used in our assay, positive only for the \\u003cem\\u003etxtAB\\u003c/em\\u003e gene, was isolated from the same field where the field trial was conducted and was tested with the same genotypes. However, in field conditions, each plant harbours a unique rhizosphere microbiome where multiple bacterial interactions occur. Hence, testing a single-isolate interaction represents a limitation, as it may not fully capture field dynamics unless a specific scab-causing species or isolate is highly abundant in the soil, but it is more representative than the response thaxtomin alone.\\u003c/p\\u003e \\u003cp\\u003eModerate correlations have been reported between in vitro assays and pot assays where purified \\u003cem\\u003eStreptomyces\\u003c/em\\u003e strains are applied to autoclaved soil (Khu et al., \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2007\\u003c/span\\u003e; Hiltunen et al., \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e). While pot assays are applicable and yield promising results, they do not fully represent the complex reality of field trials, which remain the primary focus of interest. In this study, we compared our assay results with field trial data. We obtained a high entry-mean broad-sense heritability (74%; Latif Azam et al., \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2026\\u003c/span\\u003e), suggesting a highly reproducible resistance phenotype, while field trials reflect natural conditions and uncontrolled environmental variation. Furthermore, microbial communities vary between soils, including the presence and abundance of pathogenic \\u003cem\\u003eStreptomyces\\u003c/em\\u003e. Some bacterial species in soil can exhibit antagonistically the activity to scab-causing species, therefore inhibiting symptom development on tubers (Wang et al., \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). This may explain the non-reproducibility of results across different fields, as previously observed and reported by Hiltunen et al. (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eHiltunen et al. (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e) selected 18 potato clones based on their sensitivity to thaxtomin for comparison with field results. They measured both relative root number and relative shoot height, ultimately selecting the latter as the measure of scab resistance 4 weeks post-incubation. In our study, the 50 genotypes were chosen from a bi-parental cross between varieties Electra and D\\u0026eacute;sir\\u0026eacute;e, selected for their resistance in the field. We focused on the most obvious traits observed in earlier pilot experiments, such as root lesions and root stunting, which became apparent as early as 6 days post-inoculation. Traits directly influenced by the presence of inoculum and showing clear symptoms are generally reliable indicators of resistance to infection by that inoculum. Notably, Hiltunen et al. (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e) did not report necrotic symptoms on roots following the application of thaxtomin. This difference is likely due to pathogen activity, continuously producing thaxtomin, which may cause more extensive damage than a single dose of the phytotoxin. A limitation of our assay is that we did not quantify the amount of thaxtomin released into the medium.\\u003c/p\\u003e \\u003cp\\u003eIn this study, the Spearman\\u0026rsquo;s correlation coefficient of 0.61 indicates a positive relationship between tuber resistance in the field and root resistance in the developed in vitro assay. Hiltunen et al. (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e) reported the best Spearman\\u0026rsquo;s correlation of -0.463 between relative shoot height and tuber resistance in field, based on results from only one field trial, as field results were inconsistent across different trials. They also noted that some genotypes were resistant in the field but susceptible in the in vitro assay. We also observed that certain genotypes displayed contrasting resistance responses in both the field trial and the in vitro assay. Results from Hiltunen et al. (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e) suggest that while in vitro assays can capture some components of tuber resistance observed in the field, these assays do not fully reflect field resistance. This indicates that thaxtomin is likely an important factor, but additional factors also contribute to an isolate\\u0026rsquo;s pathogenicity and plant resistance under field conditions compared to assay conditions. It is possible that multiple components are involved in host resistance, as indicated by the multiple small-effect QTLs detected by Latif Azam et al. (\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2026\\u003c/span\\u003e) and other peer-reviewed studies. Moreover, the discrepancies between field and assay results may be due to human error or differential responses of different plant tissues to thaxtomin, as suggested by Wilson et al. (\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e2009\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eAnother assay to test genotype resistance to scab is the in vitro mini-tuber generation assay. The application of purified bacterial spores directly to mini tubers in vitro, as demonstrated by Maharana et al. (\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e), is a useful approach to assess the pathogenicity of an isolate on specific potato genotypes as well as the resistance level of the tested genotypes. Interestingly, after the application of bacterial suspension, symptoms began to appear within 3 to 5 days. Despite the rapid appearance of symptoms after inoculation, this assay takes 35 to 40 days and considerable manual handling for mini tuber generation. In contrast, our assay, from the day of in vitro cuttings until root symptoms are visible, takes only 11 to 16 days, making it significantly shorter, faster, and requiring less manual handling, as 5 to 6 days old in vitro plants (which have started developing roots) are transferred directly to the inoculated medium.\\u003c/p\\u003e \\u003cp\\u003eOverall, we propose that in vitro assays are most suitable to screen cuttings from plants sown in vitro and to avoid the labour to start tissue culture from in vivo material. The breeders can set their own selection thresholds based on clean root area, reflecting the priority they give to breeding for scab resistant varieties.\\u003c/p\\u003e \\u003cp\\u003eScab-causing \\u003cem\\u003eStreptomyces\\u003c/em\\u003e in Ireland\\u003c/p\\u003e \\u003cp\\u003eCollection of \\u003cem\\u003eStreptomyces\\u003c/em\\u003e isolates causing common scab is reported for the United States (Wanner, \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e), Europe (Bouchek-Mechiche et al., \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e; Flores-Gonz\\u0026aacute;lez et al., 2008; Dees et al., \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e), Canada (Hudec et al., \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e), China (Cui et al., \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e), Turkey (Uysal et al., \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e) and India (Maharana et al., \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). These studies have identified well-known scab-causing species including \\u003cem\\u003eS. scabiei\\u003c/em\\u003e and \\u003cem\\u003eS. europaeiscabiei\\u003c/em\\u003e, as well as species such as \\u003cem\\u003eS. stelliscabiei\\u003c/em\\u003e, \\u003cem\\u003eS. turgidiscabiei\\u003c/em\\u003e, \\u003cem\\u003eS. acidiscabiei\\u003c/em\\u003e, \\u003cem\\u003eS. bottropensis\\u003c/em\\u003e and \\u003cem\\u003eS. reticuliscabiei\\u003c/em\\u003e, among others. Our effort to sample Irish material near Carlow resulted in identification of eleven \\u003cem\\u003eS. europaescabiei\\u003c/em\\u003e strains, confirming that this species is the predominant scab-causing species in Europe (Bouchek-Mechiche et al., \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e; Flores-Gonz\\u0026aacute;lez et al., 2008).\\u003c/p\\u003e \\u003cp\\u003eAll \\u003cem\\u003eS. europaescabiei\\u003c/em\\u003e strains in this study were only positive for the \\u003cem\\u003etxtAB\\u003c/em\\u003e gene. Peer-reviewed studies have reported that different strains do not necessarily harbour all three PAI genes (Wanner, \\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e; Fyans et al., \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e; Uysal et al \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). Some strains may only have one or a combination of two PAI genes (Dees et al., \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). Although only one strain was tested in this study, Hudec et al. (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e) showed that strains sharing the same pathogenicity gene profile exhibit different levels of virulence and produce varying levels of thaxtomin. Moreover, additional research indicates that production of thaxtomin is not always essential for pathogenicity, as strains lacking it but producing other phytotoxins are pathogenic (Fyans et al., \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e; Li et al., \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). This diversity in \\u003cem\\u003eStreptomyces\\u003c/em\\u003e pathogenicity suggests that our findings on potato scab resistance from the root inoculation assay are context-dependent and specific to the tested strain. Therefore, validation of the assay using multiple strains is needed.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eThis is the first study describing the collection of plant pathogenic \\u003cem\\u003eStreptomyces\\u003c/em\\u003e spp. in Ireland and further research is needed to test their pathogenicity and ability to cause damage to potato cropping. At least one \\u003cem\\u003eS. europaescabiei\\u003c/em\\u003e strain with the \\u003cem\\u003etxtAB\\u003c/em\\u003e gene was used to collect data using our newly designed root inoculation assay. Moreover, differential interaction between different potato genotypes and isolates from different locations should be assessed, as such variation has been reported previously (Clark et al., 2019). The assay developed in this study can be used to screen a large number of potato seedlings in the early stages of the breeding program to identify the most resistant and most susceptible progeny in a timely manner and with minimal manipulation. However, validation is required to ensure that the resistance data are sufficiently representative for field performance. Some of our genotypes that were highly resistant in the field were not as resistant with the root inoculation assay, and vice versa. Hence, this assay has value as an initial screening method within a breeding program. Consequently, only the selected progeny needs to be maintained and can be used for the assessment of other important traits in potato breeding, saving both resources and time.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\" \\u003cp\\u003eAuthor contribution statement\\u003c/p\\u003e \\u003cp\\u003eFLA collected infected tubers. FLA and ED performed isolations. FLA performed molecular laboratory work, developed the in vitro assay, tested the assay, analysed the data, and wrote the original draft. DM supervised the research and edited the manuscript. DG and HJvE obtained funding, conceived and supervised the research, and edited the manuscript.\\u003c/p\\u003e\\u003ch2\\u003eFunding\\u003c/h2\\u003e \\u003cp\\u003eF.L.A. was supported by the Teagasc Walsh Scholarship programme.\\u003c/p\\u003e \\u003cp\\u003eConflict of interest\\u003c/p\\u003e \\u003cp\\u003eThe authors are not aware of any relevant financial or non-financial interests to disclose that could have influenced the message of this article. HJvE, DG and DM are members of the editorial board of Potato Research.\\u003c/p\\u003e \\u003ch2\\u003eAcknowledgements\\u003c/h2\\u003e \\u003cp\\u003eWe thank Dr. Karima Bouchek-Mechiche for providing the reference strain CFBP4521T and Wageningen University for providing the \\u0026ldquo;WUR\\u0026rdquo; reference strain. Prof. Richard G.F. Visser is acknowledged for feedback on the manuscript.\\u003c/p\\u003e\\u003ch2\\u003eData availability\\u003c/h2\\u003e \\u003cp\\u003eAll data are disclosed in the manuscript and supplementary file S1.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eBignell DRD, Seipke RF, Huguet-Tapia JC, Chambers AH, Parry RJ, Loria R (2010) Streptomyces scabies 87\\u0026thinsp;\\u0026ndash;\\u0026thinsp;22 Contains a Coronafacic Acid-Like Biosynthetic Cluster That Contributes to Plant\\u0026ndash;Microbe Interactions. Mol Plant Microbe Interact 23:161\\u0026ndash;175. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1094/MPMI-23-2-0161\\u003c/span\\u003e\\u003cspan address=\\\"10.1094/MPMI-23-2-0161\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBouchek-Mechiche K, Gardan L, Normand P, Jouan B (2000) DNA relatedness among strains of Streptomyces pathogenic to potato in France: description of three new species, S. europaeiscabiei sp. nov. and S. stelliscabiei sp. nov. associated with common scab, and S. reticuliscabiei sp. nov. associated with netted scab. International Journal of Systematic and Evolutionary Microbiology 50:91\\u0026ndash;99. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1099/00207713-50-1-91\\u003c/span\\u003e\\u003cspan address=\\\"10.1099/00207713-50-1-91\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBouchek-Mechiche P, Andrivon J (2001) Differences in host range, pathogenicity to potato cultivars and response to soil temperature among Streptomyces species causing common and netted scab in France. Plant Pathol 49(1):3\\u0026ndash;10. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1046/j.1365-3059.2000.00419.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1046/j.1365-3059.2000.00419.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBraun S, Gevens A, Charkowski A, Allen C, Jansky S (2017) Potato Common Scab: a Review of the Causal Pathogens, Management Practices, Varietal Resistance Screening Methods, and Host Resistance. Am J Potato Res 94(4):283\\u0026ndash;296. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s12230-017-9575-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s12230-017-9575-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBukhalid RA, Chung SY, Loria R (1998) nec1, a Gene Conferring a Necrogenic Phenotype, Is Conserved in Plant-Pathogenic Streptomyces spp. and Linked to a Transposase Pseudogene. Mol Plant Microbe Interact 11:960\\u0026ndash;967. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1094/MPMI.1998.11.10.960\\u003c/span\\u003e\\u003cspan address=\\\"10.1094/MPMI.1998.11.10.960\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eButler DG, Cullis BR, Gilmour AR, Gogel BJ, Thompson R (2023) ASReml-R Reference Manual Version 4.2. VSN International Ltd, https://asremlkbvsnicouk/\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eClarke CR, Kramer CG, Kotha RR, Wanner LA, Luthria DL, Kramer M (2019) Cultivar Resistance to Common Scab Disease of Potato Is Dependent on the Pathogen Species. Phytopathology 109(9):1544\\u0026ndash;1554. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1094/PHYTO-09-18-0368-R\\u003c/span\\u003e\\u003cspan address=\\\"10.1094/PHYTO-09-18-0368-R\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCui L, Yang C, Jin M, Wei L, Yang L, Zhou J (2021) Identification and biological characterization of a new pathogen that causes potato scab in Gansu Province, China. 105276 Microb Pathog 161 (Pt A):. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.micpath.2021.105276\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.micpath.2021.105276\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDees MW, Sletten A, Hermansen A (2013) Isolation and characterization of Streptomyces species from potato common scab lesions in Norway. Plant Pathol 62(1):217\\u0026ndash;225. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/j.1365-3059.2012.02619.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1365-3059.2012.02619.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDees MW, Wanner LA (2012) In Search of Better Management of Potato Common Scab. Potato Res 55(3\\u0026ndash;4):249\\u0026ndash;268. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s11540-012-9206-9\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s11540-012-9206-9\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDoumbou CLZ, Akimov V, Beaulieu C (1998) Selection and characterization of microorganisms utilizing thaxtomin A, a phytotoxin produced by Streptomyces scabies. Appl Environ Microbiol 64:4313\\u0026ndash;4316. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1128/AEM.64.11.4313-4316.1998\\u003c/span\\u003e\\u003cspan address=\\\"10.1128/AEM.64.11.4313-4316.1998\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFaucher E, Savard T, Beaulieu C (1992) Characterization of actinomycetes isolated from common scab lesions on potato tubers. Can J Plant Pathol 14:197\\u0026ndash;202. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1080/07060669209500874\\u003c/span\\u003e\\u003cspan address=\\\"10.1080/07060669209500874\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFlores-Gonz\\u0026aacute;lez R, Velasco I, Montes F (2007) Detection and characterization of Streptomyces causing potato common scab in Western Europe. Plant Pathol 57(1):162\\u0026ndash;169. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/j.1365-3059.2007.01734.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1365-3059.2007.01734.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFrancis IM, Jourdan S, Fanara S, Loria R, Rigali S (2015) The cellobiose sensor CebR is the gatekeeper of Streptomyces scabies pathogenicity. mBio 6(2):e02018. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1128/mbio.02018-14\\u003c/span\\u003e\\u003cspan address=\\\"10.1128/mbio.02018-14\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFyans JK, Bown L, Bignell DR (2016) Isolation and Characterization of Plant-Pathogenic Streptomyces Species Associated with Common Scab-Infected Potato Tubers in Newfoundland. Phytopathology 106(2):123\\u0026ndash;131. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1094/PHYTO-05-15-0125-R\\u003c/span\\u003e\\u003cspan address=\\\"10.1094/PHYTO-05-15-0125-R\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHenao L, Guevara M, Restrepo S, Husserl J (2021) Genotypic and phenotypic characterization of Streptomyces species associated with potato crops in the central part of Colombia. Plant Pathol 71(3):750\\u0026ndash;761. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/ppa.13485\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/ppa.13485\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHiltunen LH, Alanen M, Laakso I, Kangas A, Virtanen E, Valkonen JPT (2011) Elimination of common scab sensitive progeny from a potato breeding population using thaxtomin A as a selective agent. Plant Pathol 60:426\\u0026ndash;435. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/j.1365-3059.2010.02386.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1365-3059.2010.02386.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHudec C, Biessy A, Novinscak A, St-Onge R, Lamarre S, Blom J, Filion M (2021) Comparative Genomics of Potato Common Scab-Causing Streptomyces spp. Displaying Varying Virulence Front Microbiol 12:716522. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fmicb.2021.716522\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fmicb.2021.716522\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKhu D-M, Love SL, Mo H-S, Li K-H, Lim H-T, Horticulture (2007) Environ Biotechnol 48:224\\u0026ndash;227\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLatif Azam F, Endelman JB, Milbourne D, Griffin D, Van Eck HJ (2026) Composite interval mapping for potato common scab in connected F1 populations. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.researchsquare.com/article/rs-9173453/v1\\u003c/span\\u003e\\u003cspan address=\\\"https://www.researchsquare.com/article/rs-9173453/v1\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLeiner RH, Fry BA, Carling DE, Loria R (1996) Probable Involvement of Thaxtomin A in Pathogenicity of Streptomyces scabies on Seedlings. Etiology 86:709\\u0026ndash;713\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi Y, Liu J, Diaz-Cruz G, Cheng Z, Bignell DRD (2019) Virulence mechanisms of plant-pathogenic Streptomyces species: an updated review. Microbiol (Reading) 165(10):1025\\u0026ndash;1040. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1099/mic.0.000818\\u003c/span\\u003e\\u003cspan address=\\\"10.1099/mic.0.000818\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLoria R, Bukhalid RA, Creath RA, Leiner RH, Olivier M, Steffens JC (1995) Differential Production of Thaxtomins of Pathogenic Steptomyces Species In Vitro. Biochem Cell Biol 85:537\\u0026ndash;541\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLoria R, Kers J, Joshi M (2006) Evolution of plant pathogenicity in Streptomyces. Annu Rev Phytopathol 44:469\\u0026ndash;487. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1146/annurev.phyto.44.032905.091147\\u003c/span\\u003e\\u003cspan address=\\\"10.1146/annurev.phyto.44.032905.091147\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMaharana C, Sagar V, Sharma S, Buckseth T, Bairwa A, Naga K, Kumar V, Singh B (2024) Novel Rapid In Vitro Method for Screening of Potato Genotypes Against Streptomyces sp. Potato Res 68(2):1159\\u0026ndash;1169. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s11540-024-09782-5\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s11540-024-09782-5\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePadilla-Reynaud R, Simao-Beaunoir AM, Lerat S, Bernards MA, Beaulieu C (2015) Suberin Regulates the Production of Cellulolytic Enzymes in Streptomyces scabiei, the Causal Agent of Potato Common Scab. Microbes Environ 30(3):245\\u0026ndash;253. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1264/jsme2.ME15034\\u003c/span\\u003e\\u003cspan address=\\\"10.1264/jsme2.ME15034\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAHDB Potatoes (2007) Potato Variety Database (PVD). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://potatoes.agricrops.org/\\u003c/span\\u003e\\u003cspan address=\\\"https://potatoes.agricrops.org/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e. Accessed 8 March 2024\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSantos-Cervantes ME, Felix-Gastelum R, Herrera-Rodr\\u0026iacute;guez G, Espinoza-Mancillas MG, Mora-Romero AG, Leyva-L\\u0026oacute;pez NE (2017) Characterization, Pathogenicity and Chemical Control of Streptomyces acidiscabies Associated to Potato Common Scab. Am J Potato Res 94(1):14\\u0026ndash;25. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s12230-016-9541-5\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s12230-016-9541-5\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSharma A, Gautam S, Saxena S (2014) Streptomyces. In: Encyclopedia of Food Microbiology. pp 560\\u0026ndash;566. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/b978-0-12-384730-0.00326-8\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/b978-0-12-384730-0.00326-8\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSohngen C, Podstawka A, Bunk B, Gleim D, Vetcininova A, Reimer LC, Ebeling C, Pendarovski C, Overmann J (2016) BacDive\\u0026ndash;The Bacterial Diversity Metadatabase in 2016. Nucleic Acids Res 44(D1):D581\\u0026ndash;585. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1093/nar/gkv983\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/nar/gkv983\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSong J, Lee SC, Kang JW, Baek HJ, Suh JW (2004) Phylogenetic analysis of Streptomyces spp. isolated from potato scab lesions in Korea on the basis of 16S rRNA gene and 16S-23S rDNA internally transcribed spacer sequences. Int J Syst Evol Microbiol 54(Pt 1):203\\u0026ndash;209. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1099/ijs.0.02624-0\\u003c/span\\u003e\\u003cspan address=\\\"10.1099/ijs.0.02624-0\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eUysal N, Bozkurt A, El\\u0026ccedil;i E (2024) Isolation and characterization of plant-pathogenic Streptomyces species associated with potato common scab disease in T\\u0026uuml;rkiye. Plant Pathol 74(1):101\\u0026ndash;122. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/ppa.14001\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/ppa.14001\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003en der Wolf JM, Boer SHD (2007) Bacterial Pathogens of Potato. In: Potato Biology and Biotechnology. Elsevier Sci B V 595\\u0026ndash;617. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/B978-044451018-1/50069-5\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/B978-044451018-1/50069-5\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang Z, Li Y, Zhuang L, Yu Y, Liu J, Zhang L, Gao Z, Wu Y, Gao W, Ding GC, Wang Q (2019) A Rhizosphere-Derived Consortium of Bacillus subtilis and Trichoderma harzianum Suppresses Common Scab of Potato and Increases Yield. Comput Struct Biotechnol J 17:645\\u0026ndash;653. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.csbj.2019.05.003\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.csbj.2019.05.003\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWanner LA (2006) A Survey of Genetic Variation in Streptomyces Isolates Causing Potato Common Scab in the United States. Bacteriology 96:1363\\u0026ndash;1371. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1094/PHYTO-96-1363\\u003c/span\\u003e\\u003cspan address=\\\"10.1094/PHYTO-96-1363\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWilson CR, Luckman GA, Tegg RS, Yuan ZQ, Wilson AJ, Eyles A, Conner AJ (2009) Enhanced resistance to common scab of potato through somatic cell selection in cv. Iwa with the phytotoxin thaxtomin A. Plant Pathol 58(1):137\\u0026ndash;144. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/j.1365-3059.2008.01903.x\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/j.1365-3059.2008.01903.x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"potato-research\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"potr\",\"sideBox\":\"Learn more about [Potato Research](http://link.springer.com/journal/11540)\",\"snPcode\":\"11540\",\"submissionUrl\":\"https://www.editorialmanager.com/potr/default2.aspx\",\"title\":\"Potato Research\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"Common Scab, Streptomyces spp., potato, Solanum tuberosum, root inoculation assay\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-9248130/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-9248130/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eCommon scab in potato is caused by multiple \\u003cem\\u003eStreptomyces\\u003c/em\\u003e species that harbour various virulence factors. Varietal resistance is commonly evaluated with multi-year \\u0026ndash; multi-location field trials with known high infection potential or using the phytotoxin thaxtomin applied to in vitro mini tubers or potato tissue culture. In this study, we aimed to develop an efficient root inoculation assay to assess the resistance levels of potato genotypes and to evaluate whether the assay could identify resistant and susceptible genotypes, thus facilitating selection of scab resistant clones. We isolated 24 potential \\u003cem\\u003eStreptomyces\\u003c/em\\u003e strains from fields in Ireland, of which 11 were identified as \\u003cem\\u003eS. europaescabiei\\u003c/em\\u003e. All \\u003cem\\u003eS. europaescabiei\\u003c/em\\u003e strains tested positive for \\u003cem\\u003etxtAB\\u003c/em\\u003e gene but lacked n\\u003cem\\u003eec1\\u003c/em\\u003e and t\\u003cem\\u003eomA\\u003c/em\\u003e genes. The root inoculation assay resulted in plants exhibiting necrotic symptoms on roots and stunted root growth. Image analysis software was used to collect quantitative data from our assay. We observed a Spearman\\u0026rsquo;s rank correlation of 0.61 between field data and our assay using a panel comprising 50 clones from the bi-parental cross Electra \\u0026times; D\\u0026eacute;sir\\u0026eacute;e and five control varieties. The root inoculation assay is rapid, as symptoms are observed within 6 to 10 days post-inoculation, and requires minimal manipulation since a bacterial suspension is applied instead of purified thaxtomin. Notably, this assay identifies resistant and susceptible progeny reliably, with some disparities between the resistance pattern in the field and the assay. This tool has potential to be useful for screening large numbers of genotypes and discarding the susceptible ones in a breeding program.\\u003c/p\\u003e\",\"manuscriptTitle\":\"A novel in vitro root inoculation assay to screen potato genotypes for resistance to Common Scab\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-04-07 10:04:55\",\"doi\":\"10.21203/rs.3.rs-9248130/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"reviewerAgreed\",\"content\":\"\",\"date\":\"2026-04-01T13:08:50+00:00\",\"index\":0,\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2026-04-01T06:19:06+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2026-03-31T22:33:38+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Potato Research\",\"date\":\"2026-03-27T16:26:04+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"potato-research\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"potr\",\"sideBox\":\"Learn more about [Potato Research](http://link.springer.com/journal/11540)\",\"snPcode\":\"11540\",\"submissionUrl\":\"https://www.editorialmanager.com/potr/default2.aspx\",\"title\":\"Potato Research\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"467b24a4-9bf6-49b5-9396-2217535b76b8\",\"owner\":[],\"postedDate\":\"April 7th, 2026\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-04-07T10:04:55+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-04-07 10:04:55\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-9248130\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-9248130\",\"identity\":\"rs-9248130\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}