{"paper_id":"33ea2b34-6dc7-4774-9329-53c8d57789cb","body_text":"Inhibition of LOX-1 ameliorates coagulation and inflammation in sepsis by suppressing the JAK2/STAT3 pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Inhibition of LOX-1 ameliorates coagulation and inflammation in sepsis by suppressing the JAK2/STAT3 pathway Ying Wang, Rongrong Zhang, Chen Zhou, Yueyue Huang, Aiming Zhou, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5417565/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Lectin-like oxidised low-density lipoprotein receptor-1 (LOX-1) is a transmembrane protein that belongs to the C-type lectin family and plays a significant role in various diseases by promoting the release of inflammatory mediators and enhancing cellular responses to oxidative stress. Studies have demonstrated that in sepsis, activation of LOX-1 promotes a procoagulant phenotype in endothelial cells. The aim of this study was to investigate whether inhibition of LOX-1 could ameliorate coagulation dysfunction and the inflammatory response in sepsis by modulating the JAK2/STAT3 signaling pathway. We utilized LPS-induced C57BL/6 mice to establish an in vivo animal model and assessed the activity of the JAK2/STAT3 signaling pathway, along with coagulation-related factors and inflammatory factors.In the in vitro experiments, human umbilical vein endothelial cells (HUVECs) were exposed to LPS after either LOX-1 knockdown or no treatment. We subsequently measured the expression of tissue factor (TF) and inflammatory factors, as well as changes in the JAK2/STAT3 signaling pathway. The results indicated that LOX-1 blockade improved coagulation dysfunction and the inflammatory response, leading to enhanced survival in septic mice. In vitro, LOX-1 knockdown suppressed the expression of TF and inflammatory factors in LPS-induced HUVECs. Both in vivo and in vitro experiments confirmed that inhibition of LOX-1 ameliorated sepsis by suppressing the JAK2/STAT3 signaling pathway. LOX-1 sepsis coagulation inflammation JAK2/STAT3 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction In 2016, an international group of experts proposed the most recent definition of sepsis. According to this definition, sepsis is described as a life-threatening organ dysfunction resulting from a dysregulated host response to infection [1,2]. Sepsis poses a significant disease burden on society, being a global health concern with high morbidity and notable mortality rates. Sepsis continues to be a leading cause of death in the critical care unit, and its prevalence is increasing yearly [3]. Studies show that in 2017, there were over 48.9 million new instances of sepsis worldwide, and 11 million of those cases resulted in death, making up almost 20% of all fatalities worldwide [4]. Sepsis-associated coagulation dysfunction is a common complication in patients with sepsis and involves multiple aspects of procoagulant, anticoagulant, fibrinolytic system and endothelial dysfunction [5–8]. This coagulation dysfunction is closely associated with the development of multi-organ failure and death, and its pathogenesis is complex and has not been fully elucidated. In patients with sepsis, approximately 30–50% may develop DIC, and the morbidity and mortality rates of septic patients with comorbid DIC are significantly increased compared with those without comorbid DIC [9]. Therefore, improving coagulation dysfunction in sepsis is the key to reducing sepsis mortality. TF has an important role in the pathogenic phase of sepsis [10]. Under normal conditions, vascular endothelial cells express extremely low levels of TF. In sepsis, inflammatory factors such as IL-6、IL-1β and TNF-α activate endothelial cells, which leads to a marked elevation in TF expression [11]. When TF is exposed to the blood, it binds to blood coagulation factor VII (FVII) or its activated form, FVII a, a process that initiates the exogenous coagulation cascade, which in turn activates thrombin [12,13]. Moreover, coagulation disruption in sepsis may be caused by a number of causes, including endothelial cell injury, an increase in inflammatory responses, and TF overexpression [14,15]. Therefore, comprehensive assessment of these interactions is essential to ameliorate sepsis-associated coagulation dysfunction and prevent the progression to DIC and multi-organ failure. LOX-1 is a transmembrane protein predominantly found in vascular endothelial cells[16]. It selectively binds oxidised low-density lipoprotein (ox-LDL), and it is crucial for atherosclerosis and inflammatory reactions [17–19]. Recent studies have demonstrated that LOX-1 also plays a critical role in acute inflammatory diseases, particularly sepsis [20,21]. LOX-1 activation in sepsis promotes an endothelial procoagulant phenotype by modifying the expression of a number of important components, such as TF, t-PA, TFPI, and v WF [22]. A comprehensive understanding of LOX-1's involvement in these processes is vital for exploring potential therapeutic targets for sepsis. The JAK2/STAT3 signaling pathway is a key player in the pathogenic processes of sepsis [23,24]. Studies have shown that LPS stimulation activates STAT3, which in turn promotes endothelial cells to express tissue factor (TF), especially the phosphorylation of the Tyr705 site of STAT3, leading to coagulation dysfunction and inflammatory responses [25]. Additionally, it has been shown that LOX-1 can activate the JAK2/STAT3 signaling pathway. We investigated this further using both in vitro and ex vivo experimental models: in vitro, we stimulated HUVECs with LPS, and in vivo, we injected LPS intraperitoneally to create a mouse model of sepsis. We used these two models to examine if LOX-1 inhibition may improve coagulation dysfunction brought on by sepsis and to learn more about how the JAK2/STAT3 signaling pathway functions in this process. 2. Materials and Methods 2.1. Reagents and antibodies LPS (L2630) was purchased from Sigma, USA.HE staining kit (C0105S), RIPA lysate (P0013B), PMSF (ST506) and BCA protein quantification kit (P0009) were purchased from Beyotime, China. DAB reagent (ZLI-9018) was purchased from ZSGB-BIO, China. Endothelial Cell Medium (ECM) cell culture medium (1001 − 500 ml) was purchased from ScienCell, USA. RNA simple whole RNA extraction kit (DP419) was purchased from Tian Gen, China. TORO Blue® All-in-One qRT Mix with ds DNase (RTQ-204) and TORO Green® 5G qPCR Premix 2.0 (QST-200P) were purchased from TOROIVD, China. Phosphatase inhibitor (04906837001) was purchased from Roche, Switzerland. Protease inhibitor (DI111-01) was purchased from Trans Gen Biotech, China. PVDF membrane (ISEQ00010) was purchased from Merck millipore, USA. TBS (T1082) and PBS (P1010-2L) were purchased from Solarbio, China. ECL assay reagent (34580) and Lipofectamine 3000 Transfection Reagent (L3000015) were purchased from Thermo Fisher, USA. Antithrombin (ab92621) and anti-tissue factor antibody (ab228968) were purchased from Abcam, UK. Anti-tissue factor antibody (DF6400) and anti-OLR1 antibody (DF6522) were purchased from Affinity, China. Anti-phosphorylated JAK2 antibody (3776S), anti-JAK2 antibody (3230T), anti-phosphorylated STAT3 antibody (9145T), and anti-STAT3 antibody (9139T) were purchased from CST, USA. DAPI Fluoromount-G™ (36308ES20) was purchased from Yeasen, China. 2.2. Animals The supplier of the six-week-old male C57BL/6 mice was Shanghai SLAC Laboratory Animal Company (Shanghai, China). Mice were kept at temperature of 21°C ཞ26°C with a 12-hour light-dark cycle and unrestricted access to normal food and water. Every animal experiment was conducted in accordance with Wenzhou Medical University's Animal Ethics Committee's guidelines. 2.3. Septic mice model The experimental mice were divided into control, LPS, LPS + IgG and LPS + Anti LOX-1 groups. Experiments were conducted using 8-week-old male C57BL/6 mice to establish an animal model of sepsis. Mice were intraperitoneally injected with 0.4 mg/kg of LPS and stimulated for 7 hours. Subsequently, another intraperitoneal injection of LPS at a dose of 10 mg/kg was administered and stimulation was continued for 12 hours. These two injections induced a sepsis response in the mice by simulating bacterial infection, thus establishing a sepsis model. The LPS solvent used for the injections was endotoxin-free sterile phosphate buffer solution (PBS). Control mice were injected with an equal amount of PBS solution without LPS. In the LPS + Anti LOX-1 group, mice were injected with anti-LOX-1 blocking antibody in the tail vein 2 hours before the first LPS injection. In the LPS + IgG group mice were injected with An equal amount of IgG in the tail vein of mice 2 hours before the first LPS injection. 2.4. Enzyme linked immunosorbent assay (ELISA) The concentrations of PAI-1 (DY3828-05, Cloud-clone, China),D-Dimer (CSB-E13584m, Cloud-clone, China), TAT (SEA831Mu, Cloud-clone, China), Fbg (CSB-E08202m, Cloud-clone, China), TF (SP14626, Spbio, China), IL-6 (SP13755, Spbio, China), IL-1β (SP12667, Spbio, China), and TNF-α (SP13726, Spbio, China) were measured using an ELISA kit. The experimental methodology was conducted in compliance with the instructions included in the manual for the corresponding ELISA kit. 2.5. H&E Staining After being fixed at room temperature in 4% paraformaldehyde, tissue samples were dehydrated and embedded. Using a microtome, the paraffin-embedded tissues were divided into slices that were 5 µm thick. They were then put on glass slides to dry for at least half an hour. After being deparaffinized in xylene, the sections were progressively rehydrated using varying ethanol concentrations. A staining kit was used to perform H&E staining, which was followed by rinsing. Following ethanol and xylene dehydration, the pieces were mounted using a permanent mounting medium. A light microscope was used to examine the stained slices, and pictures were taken to analyze. 2.6. Immunohistochemistry Tissue sections were first deparaffinised in xylene and then progressively rehydrated, passed through different concentrations of ethanol and antigenically repaired in citrate buffer. After sealing the non-specific binding sites with 5% BSA, the primary antibody was incubated overnight, followed by incubation with biotin-labelled secondary antibody. DAB was used for colour development and finally the sections were contrast stained with hematoxylin. Sections were dehydrated and sealed with sealer, observed under a light microscope and photographed for analysis. 2.7. Immunofluorescence Cells were cultured in medium containing coverslips until reaching 70–80% confluency, then fixed in 4% paraformaldehyde for 10–15 minutes and washed with PBS. After 10 minutes of permeabilization with 0.1% Triton X-100, the cells were again washed with PBS. Following an hour of blocking with 5% BSA, the cells were treated with the primary antibody for the entire night at 4°C. Subsequently, a fluorophore-conjugated secondary antibody was added and incubated in the dark at room temperature for 1 hour, followed by another PBS wash. DAPI staining for nuclei was optionally performed, and finally, the cells were mounted with a fluorescence mounting medium for observation and imaging under a fluorescence microscope. 2.8. Western Blot Mouse lung tissue and HUVECs were lysed in RIPA buffer containing 10% phosphatase inhibitor, 1% protease inhibitor and PMSF. The supernatant was collected by centrifugation at 1200 rpm for 10 minutes at 4°C. The protein content of mouse lung tissue and cells was then measured using a BCA assay kit. Protein samples were separated on 10% SDS-PAGE gels and transferred to PVDF membranes. The membranes were blocked with 5% skim milk for 2 hours at room temperature, followed by overnight incubation with the primary antibody at 4°C. The membranes were then incubated with the appropriate secondary antibody for 1 hour at room temperature. Finally, signal detection was performed by exposure, and the bands were quantified using ImageJ software. 2.9. Cell Culture The HUVEC was obtained from Shanghai Bojun Biotechnology Co. Using ECM medium supplemented with 5% fetal bovine serum, 1% (v/v) penicillin-streptomycin and 1% endothelial cell growth factor was used. In cell culture plates, cells were introduced at an equal density. LPS induction treatments and further transfection procedures were carried out until the cell density had reached 70–80%. For the cell experiments, only second to sixth generation HUVEC cells were utilized, and 1 µg/mL of LPS was used. 2.10. Transfection of siRNA and LOX-1 overexpression plasmid HUVECs were inoculated in 6-well plates at appropriate density and cultured until 70–80% confluence for transfection. The LOX-1 siRNA or LOX-1 overexpression plasmid was diluted with Opti-MEM™ medium, and another appropriate amount of Lipofectamine 3000 reagent was diluted, the two were mixed, and left at room temperature for 15 minutes to form the complex. The complex was added to the cells with the old medium removed and replaced with new Opti-MEM™ medium, incubated at 37°C for 4–6 hours and then replaced with complete medium containing serum without antibiotics, and continued to incubate for 24–72 hours for subsequent experiments. The sequences of LOX-1 siRNA are provided in Table 1 . Table 1 LOX-1 SiRNA sense strand antisense strand LOX-1 -300 CGAACUCAAGGAAAUGAUATT UAUCAUUUCCUUGAGUUCGTT LOX-1 -183 CCAGGUGUCUGACCUCCUATT UAGGAGGUCAGACACCUGGTT LOX-1 -398 CACUGAAGAGAGUAGCAAATT UUUGCUACUCUCUUCAGUGTT 2.11. Reverse-transcribed quantitative PCR (RT-qPCR) Total RNA was extracted from HUVEC cells using RNAsimple total RNA kit, cDNA synthesis was performed using All-in-One qRT Mix with dsDNase according to the procedure, and mRNA expression was analysed using SYBR Green in CFX Opus 96 (BioRad, USA), and the sequence of primers are shown in Table 2 . Table 2 GENE Forward primer Reverse primer Human GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG Human TF CCAAACCCGTCAATCAAGTC TCTGCTTCACATCCTTCACAAT Human PAI-1 CTTCCACCCGTCTCTCTG CTACCAGGCACACAAAAGC Human TNF-α GGAAAGGACACCATGAGC CCACGATCAGGAAGGAGA Human IL-1β TGTGCTGAATGTGGACTCA ACAAAAGGGCTGGGGAT Human-IL-6 CAATAACCACCCCTGACC GCGCAGAATGAGATGAGTT 2.12. Statistical analysis The mean ± standard deviation, which is obtained from at least three separate experiments with replicates, is used to report measurement results. GraphPad Prism 9 software was used for statistical analyses, and a significance threshold of p < 0.05 was established. One-way analysis of variance (ANOVA) was used for comparisons between several groups, and independent sample t-tests were used for comparisons between two groups. The following symbols were used to indicate statistical significance of differences: *p < 0.05, **p < 0.01, ***p < 0.001, ***p < 0.001, or ****p < 0.0001. 3. Results 3.1. LOX-1 expression is elevated in LPS-induced sepsis mouse models By injecting LPS intraperitoneally, we created a model of sepsis in mice, and Western blot analysis revealed that the expression level of LOX-1 protein in the lung tissues of septic mice was significantly higher than that of healthy controls (Fig. 1 A, B). Furthermore, we also observed a significant increase in LOX-1 protein expression in the lung tissues of septic mice using immunohistochemical methods (Fig. 1 C). These findings suggest that LOX-1 might be crucial in the sepsis model in mice. Further analyses revealed that the protein expression levels of TF, plasminogen activator inhibitor-1 (PAI-1), and thrombin were increased in the lung tissues of septic mice (Fig. 1 D-G). These changes suggest that the organism may be in a hypercoagulable state, which could promote the formation of microthrombi and contribute to the pathological processes associated with sepsis. 3.2. Anti-LOX-1 Increases Survival and Improves Inflammation and Coagulation-Related factors in septic mice In the LPS-induced sepsis mouse model, we continuously monitored the survival rate of septic mice. The findings demonstrated that, in comparison to the control group, the survival rate of septic mice was considerably lower. In contrast, mice who received LOX-1 blocking antibody before to treatment had a noticeably higher survival rate (Fig. 2 A). The findings imply that LOX-1 blockade may have a protective effect on septic mice. We used ELISA to measure the levels of Inflammatory factors TNF-α, IL-1β, and IL-6 in the plasma of septic mice. The findings showed that septic mice had significantly higher levels of these Inflammatory factors, indicating an exacerbated inflammatory response (Fig. 2 B-D). Treatment with LOX-1 blocking antibodies markedly reduced the levels of these Inflammatory factors, suggesting that LOX-1 blockade effectively alleviates the inflammatory response in septic mice. In order to evaluate the coagulation state of septic mice, we used ELISA to examine several coagulation-related factors. The findings demonstrated that septic mice had significantly higher plasma levels of TF, PAI-1, TAT, Fib, and D-dimer, accompanied by a decrease in platelet counts. These findings indicate that coagulation abnormalities, including hypercoagulability and activation of the fibrinolytic system, occur in septic mice. Treatment with LOX-1 blocking antibodies significantly reversed the decline in platelet counts and markedly reduced plasma levels of TF, Fib, TAT, PAI-1, and D-dimer (Fig. 2 E-J). These results suggest that LOX-1 blockade can positively influence the pathological process of sepsis by ameliorating coagulation abnormalities in septic mice. 3.3. Anti-LOX-1 ameliorates lung injury and coagulation dysfunction in septic mice To learn more about how LOX-1 contributes to sepsis-related lung damage, we pretreated septic mice with LOX-1 blocking antibodies and assessed its protective effect on the lung tissues. Histopathological analysis revealed characteristic signs of damage in the lung tissues of septic mice, including tissue edema, inflammatory cell infiltration, congestion, and microvascular obstruction (Fig. 3 A). LOX-1 blockade significantly reduced these signs of damage. Using immunohistochemical analysis, we verified that fibrin deposition was present in the lung tissues of septic mice, and we discovered that LOX-1 inhibition considerably decreased this deposition (Fig. 3 B). Additionally, we measured the levels of TF, PAI-1, and thrombin protein expression in the lung tissues of septic mice. According to Western blot examination, septic mice had considerably higher levels of these proteins' expression, but LOX-1 blocking antibody therapy greatly decreased these levels (Fig. 3 C-F), indicating that LOX-1 is a major factor in causing coagulation dysfunction. 3.4. Anti-LOX-1 inhibits activation of JAK2/STAT3 signaling pathway in lung tissues of septic mice In our thorough investigation of LOX-1's role in sepsis, we found that LOX-1 blockade can inhibit the activation of the JAK2/STAT3 signaling pathway. We found that pJAK2 and pSTAT3, two important activation markers of the JAK2/STAT3 signaling pathway, were elevated in the mouse model of sepsis. By pretreating mice with a LOX-1 blocking antibody, we found a significant decrease in the phosphorylation levels of JAK2 and STAT3 (Fig. 4 A-C). Furthermore, immunofluorescence double staining results showed a significant increase in the co-localized expression of LOX-1 and pSTAT3 in the lung tissues of septic mice, while pretreatment with the LOX-1 blocking antibody led to a notable decrease in pSTAT3 phosphorylation levels (Fig. 4 . D-F). These results suggest that LOX-1 blockade may exert its effects by inhibiting the activation of the JAK2/STAT3 signaling pathway. 3.5. Inhibition of LOX-1 reduces the expression of TF and inflammatory factors in LPS-induced HUVECs by suppressing the phosphorylation of the JAK2/STAT3 signaling pathway In order to investigate the regulatory effects of LOX-1 on HUVECs, we were able to successfully lower LOX-1 expression in HUVECs using LOX-1 siRNA prior to stimulating them with LPS. LPS stimulation dramatically increased LOX-1 expression in comparison to untreated HUVECs, but LOX-1 siRNA therapy reduced it to a level that was comparable to controls (Fig. 5 A, B). western blot and cytofluorescence assays also showed that TF protein expression was increased under LPS-stimulated conditions and decreased in HUVECs after LOX − 1 siRNA treatment (Fig. 5 A, C-E). By RT-qPCR, we examined the mRNA levels of TF、PAI-1、IL-1β、IL-6 and TNF-α and discovered that LOX-1 siRNA treatment considerably reduced them, while LPS stimulation significantly enhanced them (Fig. 5 F-J). Further research revealed that in LPS-induced circumstances, HUVECs exhibited a markedly elevated level of JAK2/STAT3 signaling pathway phosphorylation. Following LOX-1 siRNA treatment, the Western Blot assay revealed a significant decrease in p-JAK2 and p-STAT3 expression levels (Fig. 6 A-C). These results demonstrate the crucial role of LOX-1 and the JAK2/STAT3 signaling pathway in controlling the LPS-induced inflammatory response and coagulation in HUVECs. 3.6. Overexpression of LOX-1 in HUVECs increases TF expression through the JAK2/STAT3 pathway To further explore the mechanism of action of LOX-1, we effectively overexpressed LOX-1 in HUVECs through plasmid transfection (Fig. 7 A). The expression levels of TF in HUVECs overexpressing LOX-1 and subsequently stimulated by LPS were higher than those in HUVECs stimulated by LPS alone (Fig. 7 B, C). The expression levels of p-JAK2 and p-STAT3 were also significantly elevated (Fig. 7 D-F). 4. Discussion In this study, we confirmed that LOX-1 inhibition significantly attenuated coagulation dysfunction and inflammatory responses, thereby improving survival in a mouse model of LPS-induced sepsis. Additionally, LOX-1 inhibition significantly reduced lung injury and fibrin deposition in septic mice. The results from both in vitro and in vivo experiments further support the idea that LOX-1 is a key procoagulant and proinflammatory target in sepsis. Specifically, LOX-1 inhibition led to significant suppression of the JAK2/STAT3 signaling pathway, accompanied by down-regulation of coagulation-related and inflammatory factors. This implies that by altering the JAK2/STAT3 signaling pathway, LOX-1 may contribute to the pathogenic processes of sepsis. A substantial body of evidence indicates a broad interaction between inflammation and coagulation [26–28]. The onset of sepsis triggers a systemic inflammatory response known as the systemic inflammatory response syndrome phase. The body experiences a strong systemic inflammatory response during this phase, which is marked by a substantial rise in tissue and circulating inflammatory factors. Among these, pro-inflammatory cytokines such as IL-1β, IL-6, and TNF-α are key inflammatory factors during sepsis and are believed to play a central immunopathological role in the development of cytokine storms [29]. IL-6 causes detrimental changes in hepatic sinusoidal endothelial cells and may promote blood coagulation, leading to liver injury [30]. By encouraging the expression of TF on endothelial cells, monocytes, macrophages, and T cells, pro-inflammatory cytokines such as IL-1β, IL-6, and TNF-α trigger the coagulation activation cascade and aid in blood clotting [31–34]. Elevated TF expression starts an exogenous coagulation cascade that produces thrombin, which causes platelet aggregation and microthrombosis [13]. Concurrently, thrombin stimulates endothelial cells and monocytes to release additional pro-inflammatory cytokines, thereby creating a vicious cycle [35,36]. PAI-1 also results in fibrinolytic inhibition, thereby reducing fibrinolytic activity in the bloodstream. This inhibition impedes the dissolution of already formed thrombi and exacerbates the coagulation state of the blood, ultimately leading to microthrombosis and tissue hypoxia [37–39]. This interaction between coagulation and inflammation exacerbates sepsis and increases the risk of organ dysfunction, highlighting the importance of in-depth studies on this mechanism for developing effective therapeutic strategies. our research found that inhibiting LOX-1 in mice and HUVECs can reduce the expression of coagulation-related factors and inflammatory factors. During sepsis, the lungs emerge as one of the primary target organs, characterized by an inflammatory response and interstitial edema as the main pathological features [40,41]. Autopsy findings in patients with COVID-19-induced sepsis revealed substantial fluid exudation from the lungs, resulting in the formation of hyaline membranes that cover the alveolar surfaces, along with numerous microthrombi in the microvessels [42]. These findings further confirm the central role of lung tissues in coagulopathies associated with sepsis. Our results demonstrate a significant protective effect of LOX-1 inhibition on lung tissues in the context of sepsis. The JAK2/STAT3 signaling pathway is crucial in sepsis. Activation of JAK2 results in its autophosphorylation, which subsequently pSTAT3, leading to STAT3 dimerization and translocation to the nucleus. This process regulates the expression of genes involved in inflammation and immune response, thereby playing a key role in the inflammatory response and immune regulation during sepsis. Several studies have shown that the JAK2/STAT3 signaling pathway can modulate LPS-induced acute inflammation [43–45]. Additionally, pSTAT3 induces TF expression in sepsis, contributing to coagulation dysfunction [25]. Inhibiting the activation of the JAK2/STAT3 pathway can ameliorate the inflammatory response and coagulation dysfunction in septic mice [46,47]. Our study found that the phosphorylation level of the JAK2/STAT3 pathway was significantly reduced in septic mice following LOX-1 blockade in vivo. In LPS-induced HUVECs, knockdown of LOX-1 expression resulted in a significant decrease in the phosphorylation level of JAK2/STAT3, while overexpression of LOX-1 led to a significant increase in the phosphorylation level of JAK2/STAT3. LOX-1 has garnered significant attention as a receptor for oxLDL in the context of atherosclerosis [48]. In the pathological setting of atherosclerosis, LOX-1 enhances TF expression by promoting oxidative stress and inflammatory responses, thereby facilitating thrombus formation [49,50]. Studies have shown that under conditions of high oxLDL, LOX-1 activates the pro-thrombotic ERK1/2 pathway, leading to increased tissue factor activity and enhanced thrombosis[51]. Additionally, in sepsis patients, LOX-1 expression is significantly elevated, and sepsis-associated acute lung injury could be ameliorated by inhibiting LOX-1 [52,53]. Our findings show that by altering the JAK2/STAT3 signaling pathway, LOX-1 inhibition lowers the inflammatory response and coagulation malfunction in both cellular and animal models. However, LOX-1 may also be involved in other mechanisms. Further investigation is needed to determine whether these pathways play a role in regulating inflammation and coagulation in sepsis. Although the results of this study are encouraging, there are still some limitations that need to be discussed. Firstly, the present study is mainly based on the C57B mouse model and in vitro HUVECs experiments; the real pathophysiological processes in humans may be more complex and therefore need to be verified in further human experiments. Furthermore, LOX-1 contributes significantly to oxidative stress, which has not been studied in the studies, in addition to its procoagulant and proinflammatory functions in sepsis. Conclusion Our study's findings shown that in HUVECs and sepsis mice models, LOX-1 inhibition decreased the production of coagulation factors and inflammatory factors. In septic mice, it also reduced lung damage and increased survival. Inhibition of the JAK2/STAT3 signaling pathway's phosphorylation, which controls coagulation factors and inflammatory factors, may be the mechanism. Furthermore, more research is required to determine the possible mechanisms and impacts of LOX-1 on additional organs in sepsis. Declarations Author Contributions Ying Wang contributed to study design, experiment operation, data analysis, and manuscript writing. Rongrong Zhang and Chen Zhou contributed to experiment operation and data analysis. Yueyue Huang and Aiming Zhou contributed to data statistical analysis and manuscript writing. Luo Shuang and Chenglong Liang participated in manuscript writing. Jinye Pan contributed to experimental design and manuscript review. Funding This work was supported by grants from National Natural Science Foundation of China (Grant No.82272204), National Natural Science Foundation of China (Grant No.82472188), Key Clinical Specialty of Zhejiang Province (Critical Care Medicine，Y2022), “Pioneer”and“Leading Goose”R&D Program of Zhejiang（2023C03084）, Wenzhou major science and technology innovation project（ZY2023005）. Data Availability No datasets were generated or analysed during the current study. Ethics Approval: Animal experiments were approved by the Experimental Animal Ethics Committee of the First Affiliated Hospital of Wenzhou Medical University. (WYYY-IACUC-AEC-2024-100) Competing Interests The authors declare no competing interests. References Singer, M., Deutschman, C. S., Seymour, C. W., Shankar-Hari, M., Annane, D., Bauer, M. et al. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). Jama 315 (2016). https://doi.org/10.1001/jama.2016.0287 Seymour, C. W., Liu, V. X., Iwashyna, T. J., Brunkhorst, F. M., Rea, T. D., Scherag, A. et al. Assessment of Clinical Criteria for Sepsis: For the Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA 315, 762-774 (2016). https://doi.org/10.1001/jama.2016.0288 Rhee, C. & Klompas, M. Sepsis trends: increasing incidence and decreasing mortality, or changing denominator? J Thorac Dis 12, S89-S100 (2020). https://doi.org/10.21037/jtd.2019.12.51 Rudd, K. E., Johnson, S. C., Agesa, K. M., Shackelford, K. A., Tsoi, D., Kievlan, D. R. et al. Global, regional, and national sepsis incidence and mortality, 1990–2017: analysis for the Global Burden of Disease Study. The Lancet 395, 200-211 (2020). https://doi.org/10.1016/s0140-6736(19)32989-7 McDonald, B., Davis, R. P., Kim, S. J., Tse, M., Esmon, C. T., Kolaczkowska, E. et al. Platelets and neutrophil extracellular traps collaborate to promote intravascular coagulation during sepsis in mice. Blood 129, 1357-1367 (2017). https://doi.org/10.1182/blood-2016-09-741298 Lorente, L., Martin, M. M., Borreguero-Leon, J. M., Sole-Violan, J., Ferreres, J., Labarta, L. et al. Sustained high plasma plasminogen activator inhibitor-1 levels are associated with severity and mortality in septic patients. Thromb Res 134, 182-186 (2014). https://doi.org/10.1016/j.thromres.2014.04.013 Mavrommatis, A. C., Theodoridis, T., Economou, M., Kotanidou, A., El Ali, M., Christopoulou-Kokkinou, V. et al. Activation of the fibrinolytic system and utilization of the coagulation inhibitors in sepsis: comparison with severe sepsis and septic shock. Intensive Care Med 27, 1853-1859 (2001). https://doi.org/10.1007/s00134-001-1139-8 Iba, T. & Levy, J. H. Derangement of the endothelial glycocalyx in sepsis. J Thromb Haemost 17, 283-294 (2019). https://doi.org/10.1111/jth.14371 Gando, S., Levi, M. & Toh, C. H. Disseminated intravascular coagulation. Nat Rev Dis Primers 2, 16037 (2016). https://doi.org/10.1038/nrdp.2016.37 Iba, T., Gando, S. & Thachil, J. Anticoagulant therapy for sepsis-associated disseminated intravascular coagulation: the view from Japan. J Thromb Haemost 12, 1010-1019 (2014). https://doi.org/10.1111/jth.12596 Subramaniam, S., Kothari, H. & Bosmann, M. Tissue factor in COVID-19-associated coagulopathy. Thromb Res 220, 35-47 (2022). https://doi.org/10.1016/j.thromres.2022.09.025 Mackman, N., Tilley, R. E. & Key, N. S. Role of the extrinsic pathway of blood coagulation in hemostasis and thrombosis. Arterioscler Thromb Vasc Biol 27, 1687-1693 (2007). https://doi.org/10.1161/ATVBAHA.107.141911 Rao, L. V. & Pendurthi, U. R. Regulation of tissue factor coagulant activity on cell surfaces. J Thromb Haemost 10, 2242-2253 (2012). https://doi.org/10.1111/jth.12003 Iba, T. & Levy, J. H. Inflammation and thrombosis: roles of neutrophils, platelets and endothelial cells and their interactions in thrombus formation during sepsis. J Thromb Haemost 16, 231-241 (2018). https://doi.org/10.1111/jth.13911 Vassiliou, A. G., Maniatis, N. A., Kotanidou, A., Kallergi, M., Karystinaki, F. S., Letsiou, E. et al. Endothelial protein C receptor polymorphisms and risk of severe sepsis in critically ill patients. Intensive Care Med 39, 1752-1759 (2013). https://doi.org/10.1007/s00134-013-3018-5 Kume, N., Murase, T., Moriwaki, H., Aoyama, T., Sawamura, T., Masaki, T. et al. Inducible expression of lectin-like oxidized LDL receptor-1 in vascular endothelial cells. Circ Res 83, 322-327 (1998). https://doi.org/10.1161/01.res.83.3.322 Adachi, H. & Tsujimoto, M. Endothelial scavenger receptors. Prog Lipid Res 45, 379-404 (2006). https://doi.org/10.1016/j.plipres.2006.03.002 Pothineni, N. V. K., Karathanasis, S. K., Ding, Z., Arulandu, A., Varughese, K. I. & Mehta, J. L. LOX-1 in Atherosclerosis and Myocardial Ischemia: Biology, Genetics, and Modulation. J Am Coll Cardiol 69, 2759-2768 (2017). https://doi.org/10.1016/j.jacc.2017.04.010 Yan, M., Mehta, J. L., Zhang, W. & Hu, C. LOX-1, oxidative stress and inflammation: a novel mechanism for diabetic cardiovascular complications. Cardiovasc Drugs Ther 25, 451-459 (2011). https://doi.org/10.1007/s10557-011-6342-4 Ying, W., Meiyan, S., Wen, C., Kaizu, X., Meifang, W. & Liming, L. Liraglutide ameliorates oxidized LDL-induced endothelial dysfunction by GLP-1R-dependent downregulation of LOX-1-mediated oxidative stress and inflammation. Redox Rep 28, 2218684 (2023). https://doi.org/10.1080/13510002.2023.2218684 Landsberger, M., Zhou, J., Wilk, S., Thaumuller, C., Pavlovic, D., Otto, M. et al. Inhibition of lectin-like oxidized low-density lipoprotein receptor-1 reduces leukocyte adhesion within the intestinal microcirculation in experimental endotoxemia in rats. Crit Care 14, R223 (2010). https://doi.org/10.1186/cc9367 Prado, Y., Tapia, P., Eltit, F., Reyes-Martinez, C., Feijoo, C. G., Llancalahuen, F. M. et al. Sepsis-Induced Coagulopathy Phenotype Induced by Oxidized High-Density Lipoprotein Associated with Increased Mortality in Septic-Shock Patients. Antioxidants (Basel) 12 (2023). https://doi.org/10.3390/antiox12030543 Zanders, L., Kny, M., Hahn, A., Schmidt, S., Wundersitz, S., Todiras, M. et al. Sepsis induces interleukin 6, gp130/JAK2/STAT3, and muscle wasting. J Cachexia Sarcopenia Muscle 13, 713-727 (2022). https://doi.org/10.1002/jcsm.12867 Zhou, Y., Xu, W. & Zhu, H. CXCL8((3-72)) K11R/G31P protects against sepsis-induced acute kidney injury via NF-kappaB and JAK2/STAT3 pathway. Biol Res 52, 29 (2019). https://doi.org/10.1186/s40659-019-0236-5 Xu, S., Pan, X., Mao, L., Pan, H., Xu, W., Hu, Y. et al. Phospho-Tyr705 of STAT3 is a therapeutic target for sepsis through regulating inflammation and coagulation. Cell Commun Signal 18, 104 (2020). https://doi.org/10.1186/s12964-020-00603-z Levi, M. & van der Poll, T. Coagulation and sepsis. Thromb Res 149, 38-44 (2017). https://doi.org/10.1016/j.thromres.2016.11.007 Levi, M., van der Poll, T. & Buller, H. R. Bidirectional relation between inflammation and coagulation. Circulation 109, 2698-2704 (2004). https://doi.org/10.1161/01.CIR.0000131660.51520.9A Wang, Y., Braun, O. O., Zhang, S., Norstrom, E. & Thorlacius, H. Monocytes regulate systemic coagulation and inflammation in abdominal sepsis. Am J Physiol Heart Circ Physiol 308, H540-547 (2015). https://doi.org/10.1152/ajpheart.00336.2014 Fajgenbaum, D. C. & June, C. H. Cytokine Storm. N Engl J Med 383, 2255-2273 (2020). https://doi.org/10.1056/NEJMra2026131 McConnell, M. J., Kawaguchi, N., Kondo, R., Sonzogni, A., Licini, L., Valle, C. et al. Liver injury in COVID-19 and IL-6 trans-signaling-induced endotheliopathy. J Hepatol 75, 647-658 (2021). https://doi.org/10.1016/j.jhep.2021.04.050 Szotowski, B., Antoniak, S., Poller, W., Schultheiss, H. P. & Rauch, U. Procoagulant soluble tissue factor is released from endothelial cells in response to inflammatory cytokines. Circ Res 96, 1233-1239 (2005). https://doi.org/10.1161/01.RES.0000171805.24799.fa Nawroth, P. P., Handley, D. A., Esmon, C. T. & Stern, D. M. Interleukin 1 induces endothelial cell procoagulant while suppressing cell-surface anticoagulant activity. Proc Natl Acad Sci U S A 83, 3460-3464 (1986). https://doi.org/10.1073/pnas.83.10.3460 Nawroth, P. P. & Stern, D. M. Modulation of endothelial cell hemostatic properties by tumor necrosis factor. J Exp Med 163, 740-745 (1986). https://doi.org/10.1084/jem.163.3.740 Herbert, J. M., Savi, P., Laplace, M. C. & Lale, A. IL-4 inhibits LPS-, IL-1 beta- and TNF alpha-induced expression of tissue factor in endothelial cells and monocytes. FEBS Lett 310, 31-33 (1992). https://doi.org/10.1016/0014-5793(92)81139-d Posma, J. J., Posthuma, J. J. & Spronk, H. M. Coagulation and non-coagulation effects of thrombin. J Thromb Haemost 14, 1908-1916 (2016). https://doi.org/10.1111/jth.13441 Fang, X., Li, M., Zhang, W., Li, J. & Zhu, T. Thrombin induces pro-inflammatory and anti-inflammatory cytokines secretion from human mast cell line (HMC-1) via protease-activated receptors. Mol Immunol 141, 60-69 (2022). https://doi.org/10.1016/j.molimm.2021.11.012 Hermans, P. W. & Hazelzet, J. A. Plasminogen activator inhibitor type 1 gene polymorphism and sepsis. Clin Infect Dis 41 Suppl 7, S453-458 (2005). https://doi.org/10.1086/431996 Madách, K., Aladzsity, I., Szilágyi, A., Fust, G., Gál, J., Pénzes, I. et al. 4G/5G polymorphism of PAI-1 gene is associated with multiple organ dysfunction and septic shock in pneumonia induced severe sepsis: prospective, observational, genetic study. Crit Care 14, R79 (2010). https://doi.org/10.1186/cc8992 Dawson, S. & Henney, A. The status of PAI-1 as a risk factor for arterial and thrombotic disease: a review. Atherosclerosis 95, 105-117 (1992). https://doi.org/10.1016/0021-9150(92)90014-8 Martin, G. S. & Bernard, G. R. Airway and lung in sepsis. Intensive Care Med 27 Suppl 1, S63-79 (2001). https://doi.org/10.1007/pl00003798 Matthay, M. A., Zemans, R. L., Zimmerman, G. A., Arabi, Y. M., Beitler, J. R., Mercat, A. et al. Acute respiratory distress syndrome. Nat Rev Dis Primers 5, 18 (2019). https://doi.org/10.1038/s41572-019-0069-0 Borczuk, A. C., Salvatore, S. P., Seshan, S. V., Patel, S. S., Bussel, J. B., Mostyka, M. et al. COVID-19 pulmonary pathology: a multi-institutional autopsy cohort from Italy and New York City. Mod Pathol 33, 2156-2168 (2020). https://doi.org/10.1038/s41379-020-00661-1 Kong, F., Sun, Y., Song, W., Zhou, Y. & Zhu, S. MiR-216a alleviates LPS-induced acute lung injury via regulating JAK2/STAT3 and NF-κB signaling. Hum Cell 33, 67-78 (2020). https://doi.org/10.1007/s13577-019-00289-7 Tan, Z., Liu, Q., Chen, H., Zhang, Z., Wang, Q., Mu, Y. et al. Pectolinarigenin alleviated septic acute kidney injury via inhibiting Jak2/Stat3 signaling and mitochondria dysfunction. Biomed Pharmacother 159, 114286 (2023). https://doi.org/10.1016/j.biopha.2023.114286 Yang, Y., Li, R., Hui, J., Li, L. & Zheng, X. β-Carotene attenuates LPS-induced rat intestinal inflammation via modulating autophagy and regulating the JAK2/STAT3 and JNK/p38 MAPK signaling pathways. J Food Biochem 45, e13544 (2021). https://doi.org/10.1111/jfbc.13544 Lu, Y., Li, D., Huang, Y., Sun, Y., Zhou, H., Ye, F. et al. Pretreatment with Eupatilin Attenuates Inflammation and Coagulation in Sepsis by Suppressing JAK2/STAT3 Signaling Pathway. J Inflamm Res 16, 1027-1042 (2023). https://doi.org/10.2147/jir.S393850 Bi, J., Wang, Y., Wang, K., Sun, Y., Ye, F., Wang, X. et al. FGF1 attenuates sepsis-induced coagulation dysfunction and hepatic injury via IL6/STAT3 pathway inhibition. Biochim Biophys Acta Mol Basis Dis 1870, 167281 (2024). https://doi.org/10.1016/j.bbadis.2024.167281 Akhmedov, A., Sawamura, T., Chen, C. H., Kraler, S., Vdovenko, D. & Luscher, T. F. Lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1): a crucial driver of atherosclerotic cardiovascular disease. Eur Heart J 42, 1797-1807 (2021). https://doi.org/10.1093/eurheartj/ehaa770 Holy, E. W., Akhmedov, A., Speer, T., Camici, G. G., Zewinger, S., Bonetti, N. et al. Carbamylated Low-Density Lipoproteins Induce a Prothrombotic State Via LOX-1: Impact on Arterial Thrombus Formation In Vivo. J Am Coll Cardiol 68, 1664-1676 (2016). https://doi.org/10.1016/j.jacc.2016.07.755 Cimmino, G., Cirillo, P., Conte, S., Pellegrino, G., Barra, G., Maresca, L. et al. Oxidized low-density lipoproteins induce tissue factor expression in T-lymphocytes via activation of lectin-like oxidized low-density lipoprotein receptor-1. Cardiovasc Res 116, 1125-1135 (2020). https://doi.org/10.1093/cvr/cvz230 Akhmedov, A., Camici, G. G., Reiner, M. F., Bonetti, N. R., Costantino, S., Holy, E. W. et al. Endothelial LOX-1 activation differentially regulates arterial thrombus formation depending on oxLDL levels: role of the Oct-1/SIRT1 and ERK1/2 pathways. Cardiovasc Res 113, 498-507 (2017). https://doi.org/10.1093/cvr/cvx015 Al-Banna, N. & Lehmann, C. Oxidized LDL and LOX-1 in experimental sepsis. Mediators Inflamm 2013, 761789 (2013). https://doi.org/10.1155/2013/761789 Zhang, P., Liu, M. C., Cheng, L., Liang, M., Ji, H. L. & Fu, J. Blockade of LOX-1 prevents endotoxin-induced acute lung inflammation and injury in mice. J Innate Immun 1, 358-365 (2009). https://doi.org/10.1159/000161070 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-5417565\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":379165495,\"identity\":\"5bb7360d-1585-4402-96a2-9d459c76e137\",\"order_by\":0,\"name\":\"Ying Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Cixi Biomedical Research Institute\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ying\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":379165496,\"identity\":\"79acc53e-2582-431c-ae7c-5f863961fe19\",\"order_by\":1,\"name\":\"Rongrong Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Cixi Biomedical Research Institute\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Rongrong\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":379165497,\"identity\":\"f8ec545b-42b8-46f7-99b0-ac4d84454017\",\"order_by\":2,\"name\":\"Chen Zhou\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Wenzhou Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chen\",\"middleName\":\"\",\"lastName\":\"Zhou\",\"suffix\":\"\"},{\"id\":379165498,\"identity\":\"c765c42c-fae8-4b15-ad3c-fdc2a78421e0\",\"order_by\":3,\"name\":\"Yueyue Huang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Wenzhou Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yueyue\",\"middleName\":\"\",\"lastName\":\"Huang\",\"suffix\":\"\"},{\"id\":379165499,\"identity\":\"bc2da545-e1fc-4f5f-b2a8-063a121cf820\",\"order_by\":4,\"name\":\"Aiming Zhou\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Wenzhou Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Aiming\",\"middleName\":\"\",\"lastName\":\"Zhou\",\"suffix\":\"\"},{\"id\":379165500,\"identity\":\"3ccc13ec-0933-4ffa-8ef5-a70185a3c297\",\"order_by\":5,\"name\":\"Shuang Luo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Wenzhou Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shuang\",\"middleName\":\"\",\"lastName\":\"Luo\",\"suffix\":\"\"},{\"id\":379165501,\"identity\":\"5dca8978-fe1d-4db5-829f-bb4eb0b6005c\",\"order_by\":6,\"name\":\"Chenglong Liang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Wenzhou Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chenglong\",\"middleName\":\"\",\"lastName\":\"Liang\",\"suffix\":\"\"},{\"id\":379165502,\"identity\":\"d570f439-5a23-47f4-a5be-20186eeeb824\",\"order_by\":7,\"name\":\"Jingye Pan\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3ElEQVRIiWNgGAWjYPACNh4w9cHARo40LYwzCtKMSbOLmefD4USCqgyunTF78HMHn4w5/xrDxzYGzAkM7IePbsCr5XaOuWHvGTYeyxlvjI1zDNjyGHjS0m7g02J2O8dMgreNjcfgxhkz6RwDnmIGCR4zglok/0K0mP+2MJBIbCBGizTYlvM9ZswMBgaEtdjfTis3lgXbwlYs2WOQYMxGyC+Ss5O3PXzbdsze4PzhjR9+/Pkvx89++BheLUDABsTHGBgkMgzgXEIApKaGgYH/+AMiFI+CUTAKRsFIBADvFUc3UzuZmQAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"The First Affiliated Hospital of Wenzhou Medical University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Jingye\",\"middleName\":\"\",\"lastName\":\"Pan\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-11-08 15:23:18\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-5417565/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-5417565/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":70082128,\"identity\":\"ac766e1f-91de-446d-9f99-6e3eb541a1a7\",\"added_by\":\"auto\",\"created_at\":\"2024-11-28 07:26:27\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":222708,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eLPS-induced sepsis mouse model. a-f. Protein expression of LOX-1, TF, PAI-1, and Thrombin was detected by Western blot in lung tissues of healthy control and septic mice (n=6/group). A-F. Protein expression of LOX-1, TF, PAI-1, and Thrombin was detected by Western blot in lung tissues of healthy control and septic mice (n=6/group). G. Immunohistochemical staining was performed to detect LOX-1 protein in lung tissues of healthy control and sepsis model mice (n=4/group). *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, ****P \\u0026lt; 0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5417565/v1/35bbde37394b1e17d7fcb71c.png\"},{\"id\":70082127,\"identity\":\"542d65c1-9fe3-4723-8789-024cbcb695e5\",\"added_by\":\"auto\",\"created_at\":\"2024-11-28 07:26:27\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":122549,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eLOX-1 blockade improves survival, inflammatory factors and coagulation-related factors in LPS-induced sepsis mice. A. Survival curves for each group of mice (n = 10/group). B-D. Blood levels of inflammatory factors measured by ELISA in each group, including (B) IL-6, (C) IL-1β, and (D) TNF-α (n = 4/group). E-I. Blood levels of coagulation-related factors measured by ELISA in each group, including (E) TF, (F) PAI-1, (G) TAT, (H) D-dimer, and (I) Fib (n = 4/group). J. Platelet counts in each group of mice (n = 4/group). *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, ****P \\u0026lt; 0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5417565/v1/909dbe6b0dafba2426627b04.png\"},{\"id\":70082226,\"identity\":\"26a2dc36-9c64-4200-8d4a-c9750e96a77b\",\"added_by\":\"auto\",\"created_at\":\"2024-11-28 07:34:27\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":581900,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eLOX-1 blockade ameliorates lung injury and coagulation dysfunction in septic mice. A. H\\u0026amp;E staining was performed to assess lung tissue damage in each group of mice (n = 4/group). B. Immunohistochemical staining was conducted to visualize fibrin deposition in lung tissue of each group (n = 4/group). C-F. Protein expression levels of (D)TF, (E)PAI-1, and (F)Thrombin were detected by Western blot in lung tissue of each group (n = 4/group). *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, ****P \\u0026lt; 0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5417565/v1/22d55553315ab7929e286d8b.png\"},{\"id\":70082132,\"identity\":\"41a911dc-521d-4a2e-8400-3bfa0b79fa51\",\"added_by\":\"auto\",\"created_at\":\"2024-11-28 07:26:27\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":326002,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffect of LOX-1 blockade on the JAK2/STAT3 signaling pathway in lung tissue of septic mice. A-C. Phosphorylation levels of (B)JAK2 and (C)STAT3 were detected by Western blot in the lung tissues in each group of mice. The relative expression levels of phosphorylated JAK2 and STAT3 were normalised to JAK2 and STAT3, respectively (n=3/group). D-F. Confocal laser microscopy images showing Pstat3 (red) and LOX-1 (green) fluorescence in lung tissues of each group (n=4/group). *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, ****P \\u0026lt; 0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5417565/v1/453daaf5c0f7707072d5b7f6.png\"},{\"id\":70083452,\"identity\":\"e0f560cf-a5c7-49c3-a254-d8d7d3c813a9\",\"added_by\":\"auto\",\"created_at\":\"2024-11-28 07:42:27\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":166142,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffects of LOX-1 knockdown on inflammation and coagulation in HUVECs. A-C. Protein expression of (B)LOX-1 and (C)TF in HUVEC cells of each group detected by Western blot (n=3/group). D-E. Confocal laser microscopy images showing TF (green) fluorescence in HUVECs of each group (n=3/group). F-J. The mRNA expression of (F)TF, (G)PAI-1, (H)IL-6, (I)IL-1βand (J)TNF-αwas detected by RT-qPCR in HUVECs of each group (n=3/group). *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, ****P \\u0026lt; 0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5417565/v1/3e269f1883ddae20937f3652.png\"},{\"id\":70082130,\"identity\":\"bd42e801-99ef-4989-806f-b7040ee82ed0\",\"added_by\":\"auto\",\"created_at\":\"2024-11-28 07:26:27\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":81459,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffect of LOX-1 knockdown on JAK2/STAT3 signaling pathway in HUVECs. A-C. Phosphorylation level of (B)JAK2 and (C)STAT3 was detected by Western blot in HUVECs of each group (n=3/group). *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, ****P \\u0026lt; 0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5417565/v1/96ff22aa2a6a1e4d081bf4a7.png\"},{\"id\":70082225,\"identity\":\"7afac5a2-7f31-4915-a22d-f522a7f9028c\",\"added_by\":\"auto\",\"created_at\":\"2024-11-28 07:34:27\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":108646,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffect of LOX-1 overexpression on the JAK2/STAT3 signaling pathway in HUVECs. A. The mRNA expression of LOX-1 detected by RT-qPCR in HUVECs of each group. B-C. Protein expression of TF in HUVECs of each group detected by Western blot (n=3/group). D-F. Phosphorylation level of (E)JAK2 and (F)STAT3 was detected by Western blot in HUVECs of each group (n=3/group). *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, ****P \\u0026lt; 0.0001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5417565/v1/4bebfdd016d6009727e682a9.png\"},{\"id\":72453463,\"identity\":\"b81a3335-774f-4620-9a88-4596e724f3ae\",\"added_by\":\"auto\",\"created_at\":\"2024-12-27 09:08:42\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2224943,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5417565/v1/61bfdfd6-8910-4a90-8dcd-4bd533cf6337.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Inhibition of LOX-1 ameliorates coagulation and inflammation in sepsis by suppressing the JAK2/STAT3 pathway\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eIn 2016, an international group of experts proposed the most recent definition of sepsis. According to this definition, sepsis is described as a life-threatening organ dysfunction resulting from a dysregulated host response to infection [1,2]. Sepsis poses a significant disease burden on society, being a global health concern with high morbidity and notable mortality rates. Sepsis continues to be a leading cause of death in the critical care unit, and its prevalence is increasing yearly [3]. Studies show that in 2017, there were over 48.9\\u0026nbsp;million new instances of sepsis worldwide, and 11\\u0026nbsp;million of those cases resulted in death, making up almost 20% of all fatalities worldwide [4].\\u003c/p\\u003e \\u003cp\\u003eSepsis-associated coagulation dysfunction is a common complication in patients with sepsis and involves multiple aspects of procoagulant, anticoagulant, fibrinolytic system and endothelial dysfunction [5\\u0026ndash;8]. This coagulation dysfunction is closely associated with the development of multi-organ failure and death, and its pathogenesis is complex and has not been fully elucidated. In patients with sepsis, approximately 30\\u0026ndash;50% may develop DIC, and the morbidity and mortality rates of septic patients with comorbid DIC are significantly increased compared with those without comorbid DIC [9]. Therefore, improving coagulation dysfunction in sepsis is the key to reducing sepsis mortality.\\u003c/p\\u003e \\u003cp\\u003eTF has an important role in the pathogenic phase of sepsis [10]. Under normal conditions, vascular endothelial cells express extremely low levels of TF. In sepsis, inflammatory factors such as IL-6、IL-1β and TNF-α activate endothelial cells, which leads to a marked elevation in TF expression [11]. When TF is exposed to the blood, it binds to blood coagulation factor VII (FVII) or its activated form, FVII a, a process that initiates the exogenous coagulation cascade, which in turn activates thrombin [12,13]. Moreover, coagulation disruption in sepsis may be caused by a number of causes, including endothelial cell injury, an increase in inflammatory responses, and TF overexpression [14,15]. Therefore, comprehensive assessment of these interactions is essential to ameliorate sepsis-associated coagulation dysfunction and prevent the progression to DIC and multi-organ failure.\\u003c/p\\u003e \\u003cp\\u003eLOX-1 is a transmembrane protein predominantly found in vascular endothelial cells[16]. It selectively binds oxidised low-density lipoprotein (ox-LDL), and it is crucial for atherosclerosis and inflammatory reactions [17\\u0026ndash;19]. Recent studies have demonstrated that LOX-1 also plays a critical role in acute inflammatory diseases, particularly sepsis [20,21]. LOX-1 activation in sepsis promotes an endothelial procoagulant phenotype by modifying the expression of a number of important components, such as TF, t-PA, TFPI, and v WF [22]. A comprehensive understanding of LOX-1's involvement in these processes is vital for exploring potential therapeutic targets for sepsis.\\u003c/p\\u003e \\u003cp\\u003eThe JAK2/STAT3 signaling pathway is a key player in the pathogenic processes of sepsis [23,24]. Studies have shown that LPS stimulation activates STAT3, which in turn promotes endothelial cells to express tissue factor (TF), especially the phosphorylation of the Tyr705 site of STAT3, leading to coagulation dysfunction and inflammatory responses [25]. Additionally, it has been shown that LOX-1 can activate the JAK2/STAT3 signaling pathway. We investigated this further using both in vitro and ex vivo experimental models: in vitro, we stimulated HUVECs with LPS, and in vivo, we injected LPS intraperitoneally to create a mouse model of sepsis. We used these two models to examine if LOX-1 inhibition may improve coagulation dysfunction brought on by sepsis and to learn more about how the JAK2/STAT3 signaling pathway functions in this process.\\u003c/p\\u003e\"},{\"header\":\"2. Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1. Reagents and antibodies\\u003c/h2\\u003e \\u003cp\\u003eLPS (L2630) was purchased from Sigma, USA.HE staining kit (C0105S), RIPA lysate (P0013B), PMSF (ST506) and BCA protein quantification kit (P0009) were purchased from Beyotime, China. DAB reagent (ZLI-9018) was purchased from ZSGB-BIO, China. Endothelial Cell Medium (ECM) cell culture medium (1001\\u0026thinsp;\\u0026minus;\\u0026thinsp;500 ml) was purchased from ScienCell, USA. RNA simple whole RNA extraction kit (DP419) was purchased from Tian Gen, China. TORO Blue\\u0026reg; All-in-One qRT Mix with ds DNase (RTQ-204) and TORO Green\\u0026reg; 5G qPCR Premix 2.0 (QST-200P) were purchased from TOROIVD, China. Phosphatase inhibitor (04906837001) was purchased from Roche, Switzerland. Protease inhibitor (DI111-01) was purchased from Trans Gen Biotech, China. PVDF membrane (ISEQ00010) was purchased from Merck millipore, USA. TBS (T1082) and PBS (P1010-2L) were purchased from Solarbio, China. ECL assay reagent (34580) and Lipofectamine 3000 Transfection Reagent (L3000015) were purchased from Thermo Fisher, USA. Antithrombin (ab92621) and anti-tissue factor antibody (ab228968) were purchased from Abcam, UK. Anti-tissue factor antibody (DF6400) and anti-OLR1 antibody (DF6522) were purchased from Affinity, China. Anti-phosphorylated JAK2 antibody (3776S), anti-JAK2 antibody (3230T), anti-phosphorylated STAT3 antibody (9145T), and anti-STAT3 antibody (9139T) were purchased from CST, USA. DAPI Fluoromount-G\\u0026trade; (36308ES20) was purchased from Yeasen, China.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2. Animals\\u003c/h2\\u003e \\u003cp\\u003eThe supplier of the six-week-old male C57BL/6 mice was Shanghai SLAC Laboratory Animal Company (Shanghai, China). Mice were kept at temperature of 21\\u0026deg;C ཞ26\\u0026deg;C with a 12-hour light-dark cycle and unrestricted access to normal food and water. Every animal experiment was conducted in accordance with Wenzhou Medical University's Animal Ethics Committee's guidelines.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3. Septic mice model\\u003c/h2\\u003e \\u003cp\\u003eThe experimental mice were divided into control, LPS, LPS\\u0026thinsp;+\\u0026thinsp;IgG and LPS\\u0026thinsp;+\\u0026thinsp;Anti LOX-1 groups. Experiments were conducted using 8-week-old male C57BL/6 mice to establish an animal model of sepsis. Mice were intraperitoneally injected with 0.4 mg/kg of LPS and stimulated for 7 hours. Subsequently, another intraperitoneal injection of LPS at a dose of 10 mg/kg was administered and stimulation was continued for 12 hours. These two injections induced a sepsis response in the mice by simulating bacterial infection, thus establishing a sepsis model. The LPS solvent used for the injections was endotoxin-free sterile phosphate buffer solution (PBS). Control mice were injected with an equal amount of PBS solution without LPS. In the LPS\\u0026thinsp;+\\u0026thinsp;Anti LOX-1 group, mice were injected with anti-LOX-1 blocking antibody in the tail vein 2 hours before the first LPS injection. In the LPS\\u0026thinsp;+\\u0026thinsp;IgG group mice were injected with An equal amount of IgG in the tail vein of mice 2 hours before the first LPS injection.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4. Enzyme linked immunosorbent assay (ELISA)\\u003c/h2\\u003e \\u003cp\\u003eThe concentrations of PAI-1 (DY3828-05, Cloud-clone, China),D-Dimer (CSB-E13584m, Cloud-clone, China), TAT (SEA831Mu, Cloud-clone, China), Fbg (CSB-E08202m, Cloud-clone, China), TF (SP14626, Spbio, China), IL-6 (SP13755, Spbio, China), IL-1β (SP12667, Spbio, China), and TNF-α (SP13726, Spbio, China) were measured using an ELISA kit. The experimental methodology was conducted in compliance with the instructions included in the manual for the corresponding ELISA kit.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5. H\\u0026amp;E Staining\\u003c/h2\\u003e \\u003cp\\u003eAfter being fixed at room temperature in 4% paraformaldehyde, tissue samples were dehydrated and embedded. Using a microtome, the paraffin-embedded tissues were divided into slices that were 5 \\u0026micro;m thick. They were then put on glass slides to dry for at least half an hour. After being deparaffinized in xylene, the sections were progressively rehydrated using varying ethanol concentrations. A staining kit was used to perform H\\u0026amp;E staining, which was followed by rinsing. Following ethanol and xylene dehydration, the pieces were mounted using a permanent mounting medium. A light microscope was used to examine the stained slices, and pictures were taken to analyze.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.6. Immunohistochemistry\\u003c/h2\\u003e \\u003cp\\u003eTissue sections were first deparaffinised in xylene and then progressively rehydrated, passed through different concentrations of ethanol and antigenically repaired in citrate buffer. After sealing the non-specific binding sites with 5% BSA, the primary antibody was incubated overnight, followed by incubation with biotin-labelled secondary antibody. DAB was used for colour development and finally the sections were contrast stained with hematoxylin. Sections were dehydrated and sealed with sealer, observed under a light microscope and photographed for analysis.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.7. Immunofluorescence\\u003c/h2\\u003e \\u003cp\\u003eCells were cultured in medium containing coverslips until reaching 70\\u0026ndash;80% confluency, then fixed in 4% paraformaldehyde for 10\\u0026ndash;15 minutes and washed with PBS. After 10 minutes of permeabilization with 0.1% Triton X-100, the cells were again washed with PBS. Following an hour of blocking with 5% BSA, the cells were treated with the primary antibody for the entire night at 4\\u0026deg;C. Subsequently, a fluorophore-conjugated secondary antibody was added and incubated in the dark at room temperature for 1 hour, followed by another PBS wash. DAPI staining for nuclei was optionally performed, and finally, the cells were mounted with a fluorescence mounting medium for observation and imaging under a fluorescence microscope.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.8. Western Blot\\u003c/h2\\u003e \\u003cp\\u003eMouse lung tissue and HUVECs were lysed in RIPA buffer containing 10% phosphatase inhibitor, 1% protease inhibitor and PMSF. The supernatant was collected by centrifugation at 1200 rpm for 10 minutes at 4\\u0026deg;C. The protein content of mouse lung tissue and cells was then measured using a BCA assay kit. Protein samples were separated on 10% SDS-PAGE gels and transferred to PVDF membranes. The membranes were blocked with 5% skim milk for 2 hours at room temperature, followed by overnight incubation with the primary antibody at 4\\u0026deg;C. The membranes were then incubated with the appropriate secondary antibody for 1 hour at room temperature. Finally, signal detection was performed by exposure, and the bands were quantified using ImageJ software.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.9. Cell Culture\\u003c/h2\\u003e \\u003cp\\u003eThe HUVEC was obtained from Shanghai Bojun Biotechnology Co. Using ECM medium supplemented with 5% fetal bovine serum, 1% (v/v) penicillin-streptomycin and 1% endothelial cell growth factor was used. In cell culture plates, cells were introduced at an equal density. LPS induction treatments and further transfection procedures were carried out until the cell density had reached 70\\u0026ndash;80%. For the cell experiments, only second to sixth generation HUVEC cells were utilized, and 1 \\u0026micro;g/mL of LPS was used.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.10. Transfection of siRNA and LOX-1 overexpression plasmid\\u003c/h2\\u003e \\u003cp\\u003eHUVECs were inoculated in 6-well plates at appropriate density and cultured until 70\\u0026ndash;80% confluence for transfection. The LOX-1 siRNA or LOX-1 overexpression plasmid was diluted with Opti-MEM\\u0026trade; medium, and another appropriate amount of Lipofectamine 3000 reagent was diluted, the two were mixed, and left at room temperature for 15 minutes to form the complex. The complex was added to the cells with the old medium removed and replaced with new Opti-MEM\\u0026trade; medium, incubated at 37\\u0026deg;C for 4\\u0026ndash;6 hours and then replaced with complete medium containing serum without antibiotics, and continued to incubate for 24\\u0026ndash;72 hours for subsequent experiments. The sequences of LOX-1 siRNA are provided in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLOX-1 SiRNA\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003esense strand\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eantisense strand\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLOX-1 -300\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCGAACUCAAGGAAAUGAUATT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eUAUCAUUUCCUUGAGUUCGTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLOX-1 -183\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCAGGUGUCUGACCUCCUATT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eUAGGAGGUCAGACACCUGGTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLOX-1 -398\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCACUGAAGAGAGUAGCAAATT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eUUUGCUACUCUCUUCAGUGTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.11. Reverse-transcribed quantitative PCR (RT-qPCR)\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA was extracted from HUVEC cells using RNAsimple total RNA kit, cDNA synthesis was performed using All-in-One qRT Mix with dsDNase according to the procedure, and mRNA expression was analysed using SYBR Green in CFX Opus 96 (BioRad, USA), and the sequence of primers are shown in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGENE\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward primer\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eReverse primer\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHuman GAPDH\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGAGCGAGATCCCTCCAAAAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGGCTGTTGTCATACTTCTCATGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHuman TF\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCAAACCCGTCAATCAAGTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTCTGCTTCACATCCTTCACAAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHuman PAI-1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCTTCCACCCGTCTCTCTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCTACCAGGCACACAAAAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHuman TNF-α\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGAAAGGACACCATGAGC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCCACGATCAGGAAGGAGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHuman IL-1β\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTGTGCTGAATGTGGACTCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eACAAAAGGGCTGGGGAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHuman-IL-6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCAATAACCACCCCTGACC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGCGCAGAATGAGATGAGTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.12. Statistical analysis\\u003c/h2\\u003e \\u003cp\\u003eThe mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation, which is obtained from at least three separate experiments with replicates, is used to report measurement results. GraphPad Prism 9 software was used for statistical analyses, and a significance threshold of p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was established. One-way analysis of variance (ANOVA) was used for comparisons between several groups, and independent sample t-tests were used for comparisons between two groups. The following symbols were used to indicate statistical significance of differences: *p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, **p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, ***p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, ***p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, or ****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.1. LOX-1 expression is elevated in LPS-induced sepsis mouse models\\u003c/h2\\u003e \\u003cp\\u003eBy injecting LPS intraperitoneally, we created a model of sepsis in mice, and Western blot analysis revealed that the expression level of LOX-1 protein in the lung tissues of septic mice was significantly higher than that of healthy controls (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA, B). Furthermore, we also observed a significant increase in LOX-1 protein expression in the lung tissues of septic mice using immunohistochemical methods (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). These findings suggest that LOX-1 might be crucial in the sepsis model in mice.\\u003c/p\\u003e \\u003cp\\u003eFurther analyses revealed that the protein expression levels of TF, plasminogen activator inhibitor-1 (PAI-1), and thrombin were increased in the lung tissues of septic mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD-G). These changes suggest that the organism may be in a hypercoagulable state, which could promote the formation of microthrombi and contribute to the pathological processes associated with sepsis.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.2. Anti-LOX-1 Increases Survival and Improves Inflammation and Coagulation-Related factors in septic mice\\u003c/h2\\u003e \\u003cp\\u003eIn the LPS-induced sepsis mouse model, we continuously monitored the survival rate of septic mice. The findings demonstrated that, in comparison to the control group, the survival rate of septic mice was considerably lower. In contrast, mice who received LOX-1 blocking antibody before to treatment had a noticeably higher survival rate (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). The findings imply that LOX-1 blockade may have a protective effect on septic mice.\\u003c/p\\u003e \\u003cp\\u003eWe used ELISA to measure the levels of Inflammatory factors TNF-α, IL-1β, and IL-6 in the plasma of septic mice. The findings showed that septic mice had significantly higher levels of these Inflammatory factors, indicating an exacerbated inflammatory response (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB-D). Treatment with LOX-1 blocking antibodies markedly reduced the levels of these Inflammatory factors, suggesting that LOX-1 blockade effectively alleviates the inflammatory response in septic mice.\\u003c/p\\u003e \\u003cp\\u003eIn order to evaluate the coagulation state of septic mice, we used ELISA to examine several coagulation-related factors. The findings demonstrated that septic mice had significantly higher plasma levels of TF, PAI-1, TAT, Fib, and D-dimer, accompanied by a decrease in platelet counts. These findings indicate that coagulation abnormalities, including hypercoagulability and activation of the fibrinolytic system, occur in septic mice. Treatment with LOX-1 blocking antibodies significantly reversed the decline in platelet counts and markedly reduced plasma levels of TF, Fib, TAT, PAI-1, and D-dimer (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE-J). These results suggest that LOX-1 blockade can positively influence the pathological process of sepsis by ameliorating coagulation abnormalities in septic mice.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.3. Anti-LOX-1 ameliorates lung injury and coagulation dysfunction in septic mice\\u003c/h2\\u003e \\u003cp\\u003eTo learn more about how LOX-1 contributes to sepsis-related lung damage, we pretreated septic mice with LOX-1 blocking antibodies and assessed its protective effect on the lung tissues. Histopathological analysis revealed characteristic signs of damage in the lung tissues of septic mice, including tissue edema, inflammatory cell infiltration, congestion, and microvascular obstruction (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). LOX-1 blockade significantly reduced these signs of damage.\\u003c/p\\u003e \\u003cp\\u003eUsing immunohistochemical analysis, we verified that fibrin deposition was present in the lung tissues of septic mice, and we discovered that LOX-1 inhibition considerably decreased this deposition (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB). Additionally, we measured the levels of TF, PAI-1, and thrombin protein expression in the lung tissues of septic mice. According to Western blot examination, septic mice had considerably higher levels of these proteins' expression, but LOX-1 blocking antibody therapy greatly decreased these levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC-F), indicating that LOX-1 is a major factor in causing coagulation dysfunction.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.4. Anti-LOX-1 inhibits activation of JAK2/STAT3 signaling pathway in lung tissues of septic mice\\u003c/h2\\u003e \\u003cp\\u003eIn our thorough investigation of LOX-1's role in sepsis, we found that LOX-1 blockade can inhibit the activation of the JAK2/STAT3 signaling pathway. We found that pJAK2 and pSTAT3, two important activation markers of the JAK2/STAT3 signaling pathway, were elevated in the mouse model of sepsis. By pretreating mice with a LOX-1 blocking antibody, we found a significant decrease in the phosphorylation levels of JAK2 and STAT3 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA-C). Furthermore, immunofluorescence double staining results showed a significant increase in the co-localized expression of LOX-1 and pSTAT3 in the lung tissues of septic mice, while pretreatment with the LOX-1 blocking antibody led to a notable decrease in pSTAT3 phosphorylation levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e. D-F). These results suggest that LOX-1 blockade may exert its effects by inhibiting the activation of the JAK2/STAT3 signaling pathway.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003e3.5. Inhibition of LOX-1 reduces the expression of TF and inflammatory factors in LPS-induced HUVECs by suppressing the phosphorylation of the JAK2/STAT3 signaling pathway\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eIn order to investigate the regulatory effects of LOX-1 on HUVECs, we were able to successfully lower LOX-1 expression in HUVECs using LOX-1 siRNA prior to stimulating them with LPS. LPS stimulation dramatically increased LOX-1 expression in comparison to untreated HUVECs, but LOX-1 siRNA therapy reduced it to a level that was comparable to controls (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA, B).\\u003c/p\\u003e \\u003cp\\u003ewestern blot and cytofluorescence assays also showed that TF protein expression was increased under LPS-stimulated conditions and decreased in HUVECs after LOX \\u0026minus;\\u0026thinsp;1 siRNA treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA, C-E). By RT-qPCR, we examined the mRNA levels of TF、PAI-1、IL-1β、IL-6 and TNF-α and discovered that LOX-1 siRNA treatment considerably reduced them, while LPS stimulation significantly enhanced them (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eF-J).\\u003c/p\\u003e \\u003cp\\u003eFurther research revealed that in LPS-induced circumstances, HUVECs exhibited a markedly elevated level of JAK2/STAT3 signaling pathway phosphorylation. Following LOX-1 siRNA treatment, the Western Blot assay revealed a significant decrease in p-JAK2 and p-STAT3 expression levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA-C). These results demonstrate the crucial role of LOX-1 and the JAK2/STAT3 signaling pathway in controlling the LPS-induced inflammatory response and coagulation in HUVECs.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.6. Overexpression of LOX-1 in HUVECs increases TF expression through the JAK2/STAT3 pathway\\u003c/h2\\u003e \\u003cp\\u003eTo further explore the mechanism of action of LOX-1, we effectively overexpressed LOX-1 in HUVECs through plasmid transfection (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eA). The expression levels of TF in HUVECs overexpressing LOX-1 and subsequently stimulated by LPS were higher than those in HUVECs stimulated by LPS alone (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eB, C). The expression levels of p-JAK2 and p-STAT3 were also significantly elevated (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eD-F).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eIn this study, we confirmed that LOX-1 inhibition significantly attenuated coagulation dysfunction and inflammatory responses, thereby improving survival in a mouse model of LPS-induced sepsis. Additionally, LOX-1 inhibition significantly reduced lung injury and fibrin deposition in septic mice. The results from both in vitro and in vivo experiments further support the idea that LOX-1 is a key procoagulant and proinflammatory target in sepsis. Specifically, LOX-1 inhibition led to significant suppression of the JAK2/STAT3 signaling pathway, accompanied by down-regulation of coagulation-related and inflammatory factors. This implies that by altering the JAK2/STAT3 signaling pathway, LOX-1 may contribute to the pathogenic processes of sepsis.\\u003c/p\\u003e \\u003cp\\u003eA substantial body of evidence indicates a broad interaction between inflammation and coagulation [26–28]. The onset of sepsis triggers a systemic inflammatory response known as the systemic inflammatory response syndrome phase. The body experiences a strong systemic inflammatory response during this phase, which is marked by a substantial rise in tissue and circulating inflammatory factors. Among these, pro-inflammatory cytokines such as IL-1β, IL-6, and TNF-α are key inflammatory factors during sepsis and are believed to play a central immunopathological role in the development of cytokine storms [29]. IL-6 causes detrimental changes in hepatic sinusoidal endothelial cells and may promote blood coagulation, leading to liver injury [30]. By encouraging the expression of TF on endothelial cells, monocytes, macrophages, and T cells, pro-inflammatory cytokines such as IL-1β, IL-6, and TNF-α trigger the coagulation activation cascade and aid in blood clotting [31–34].\\u003c/p\\u003e \\u003cp\\u003eElevated TF expression starts an exogenous coagulation cascade that produces thrombin, which causes platelet aggregation and microthrombosis [13]. Concurrently, thrombin stimulates endothelial cells and monocytes to release additional pro-inflammatory cytokines, thereby creating a vicious cycle [35,36]. PAI-1 also results in fibrinolytic inhibition, thereby reducing fibrinolytic activity in the bloodstream. This inhibition impedes the dissolution of already formed thrombi and exacerbates the coagulation state of the blood, ultimately leading to microthrombosis and tissue hypoxia [37–39]. This interaction between coagulation and inflammation exacerbates sepsis and increases the risk of organ dysfunction, highlighting the importance of in-depth studies on this mechanism for developing effective therapeutic strategies. our research found that inhibiting LOX-1 in mice and HUVECs can reduce the expression of coagulation-related factors and inflammatory factors.\\u003c/p\\u003e \\u003cp\\u003eDuring sepsis, the lungs emerge as one of the primary target organs, characterized by an inflammatory response and interstitial edema as the main pathological features [40,41]. Autopsy findings in patients with COVID-19-induced sepsis revealed substantial fluid exudation from the lungs, resulting in the formation of hyaline membranes that cover the alveolar surfaces, along with numerous microthrombi in the microvessels [42]. These findings further confirm the central role of lung tissues in coagulopathies associated with sepsis. Our results demonstrate a significant protective effect of LOX-1 inhibition on lung tissues in the context of sepsis.\\u003c/p\\u003e \\u003cp\\u003eThe JAK2/STAT3 signaling pathway is crucial in sepsis. Activation of JAK2 results in its autophosphorylation, which subsequently pSTAT3, leading to STAT3 dimerization and translocation to the nucleus. This process regulates the expression of genes involved in inflammation and immune response, thereby playing a key role in the inflammatory response and immune regulation during sepsis. Several studies have shown that the JAK2/STAT3 signaling pathway can modulate LPS-induced acute inflammation [43–45]. Additionally, pSTAT3 induces TF expression in sepsis, contributing to coagulation dysfunction [25]. Inhibiting the activation of the JAK2/STAT3 pathway can ameliorate the inflammatory response and coagulation dysfunction in septic mice [46,47]. Our study found that the phosphorylation level of the JAK2/STAT3 pathway was significantly reduced in septic mice following LOX-1 blockade in vivo. In LPS-induced HUVECs, knockdown of LOX-1 expression resulted in a significant decrease in the phosphorylation level of JAK2/STAT3, while overexpression of LOX-1 led to a significant increase in the phosphorylation level of JAK2/STAT3.\\u003c/p\\u003e \\u003cp\\u003eLOX-1 has garnered significant attention as a receptor for oxLDL in the context of atherosclerosis [48]. In the pathological setting of atherosclerosis, LOX-1 enhances TF expression by promoting oxidative stress and inflammatory responses, thereby facilitating thrombus formation [49,50]. Studies have shown that under conditions of high oxLDL, LOX-1 activates the pro-thrombotic ERK1/2 pathway, leading to increased tissue factor activity and enhanced thrombosis[51]. Additionally, in sepsis patients, LOX-1 expression is significantly elevated, and sepsis-associated acute lung injury could be ameliorated by inhibiting LOX-1 [52,53]. Our findings show that by altering the JAK2/STAT3 signaling pathway, LOX-1 inhibition lowers the inflammatory response and coagulation malfunction in both cellular and animal models. However, LOX-1 may also be involved in other mechanisms. Further investigation is needed to determine whether these pathways play a role in regulating inflammation and coagulation in sepsis.\\u003c/p\\u003e \\u003cp\\u003eAlthough the results of this study are encouraging, there are still some limitations that need to be discussed. Firstly, the present study is mainly based on the C57B mouse model and in vitro HUVECs experiments; the real pathophysiological processes in humans may be more complex and therefore need to be verified in further human experiments. Furthermore, LOX-1 contributes significantly to oxidative stress, which has not been studied in the studies, in addition to its procoagulant and proinflammatory functions in sepsis.\\u003c/p\\u003e \"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eOur study's findings shown that in HUVECs and sepsis mice models, LOX-1 inhibition decreased the production of coagulation factors and inflammatory factors. In septic mice, it also reduced lung damage and increased survival. Inhibition of the JAK2/STAT3 signaling pathway's phosphorylation, which controls coagulation factors and inflammatory factors, may be the mechanism. Furthermore, more research is required to determine the possible mechanisms and impacts of LOX-1 on additional organs in sepsis.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contributions\\u003c/strong\\u003e Ying Wang contributed to study design, experiment operation, data analysis, and manuscript writing. Rongrong Zhang and Chen Zhou contributed to experiment operation and data analysis. Yueyue Huang and Aiming Zhou contributed to data statistical analysis and manuscript writing. Luo Shuang and Chenglong Liang participated in manuscript writing. Jinye Pan contributed to experimental design and manuscript review.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e This work was supported by grants from National Natural Science Foundation of China (Grant No.82272204), National Natural Science Foundation of China (Grant No.82472188), Key Clinical Specialty of Zhejiang Province (Critical Care Medicine，Y2022), \\u0026ldquo;Pioneer\\u0026rdquo;and\\u0026ldquo;Leading Goose\\u0026rdquo;R\\u0026amp;D Program of Zhejiang（2023C03084）, Wenzhou major science and technology innovation project（ZY2023005）.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData Availability\\u003c/strong\\u003e No datasets were generated or analysed during the current study.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics Approval:\\u003c/strong\\u003e Animal experiments were approved by the Experimental Animal Ethics Committee of the First Affiliated Hospital of Wenzhou Medical University. (WYYY-IACUC-AEC-2024-100)\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting Interests\\u003c/strong\\u003e The authors declare no competing interests.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eSinger, M., Deutschman, C. S., Seymour, C. W., Shankar-Hari, M., Annane, D., Bauer, M.\\u003cem\\u003e et al.\\u003c/em\\u003e The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). \\u003cem\\u003eJama\\u003c/em\\u003e 315 (2016). https://doi.org/10.1001/jama.2016.0287\\u003c/li\\u003e\\n\\u003cli\\u003eSeymour, C. W., Liu, V. X., Iwashyna, T. J., Brunkhorst, F. M., Rea, T. D., Scherag, A.\\u003cem\\u003e et al.\\u003c/em\\u003e Assessment of Clinical Criteria for Sepsis: For the Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). \\u003cem\\u003eJAMA\\u003c/em\\u003e 315, 762-774 (2016). https://doi.org/10.1001/jama.2016.0288\\u003c/li\\u003e\\n\\u003cli\\u003eRhee, C. \\u0026amp; Klompas, M. Sepsis trends: increasing incidence and decreasing mortality, or changing denominator? \\u003cem\\u003eJ Thorac Dis\\u003c/em\\u003e 12, S89-S100 (2020). https://doi.org/10.21037/jtd.2019.12.51\\u003c/li\\u003e\\n\\u003cli\\u003eRudd, K. E., Johnson, S. C., Agesa, K. M., Shackelford, K. A., Tsoi, D., Kievlan, D. R.\\u003cem\\u003e et al.\\u003c/em\\u003e Global, regional, and national sepsis incidence and mortality, 1990\\u0026ndash;2017: analysis for the Global Burden of Disease Study. \\u003cem\\u003eThe Lancet\\u003c/em\\u003e 395, 200-211 (2020). https://doi.org/10.1016/s0140-6736(19)32989-7\\u003c/li\\u003e\\n\\u003cli\\u003eMcDonald, B., Davis, R. P., Kim, S. J., Tse, M., Esmon, C. T., Kolaczkowska, E.\\u003cem\\u003e et al.\\u003c/em\\u003e Platelets and neutrophil extracellular traps collaborate to promote intravascular coagulation during sepsis in mice. \\u003cem\\u003eBlood\\u003c/em\\u003e 129, 1357-1367 (2017). https://doi.org/10.1182/blood-2016-09-741298\\u003c/li\\u003e\\n\\u003cli\\u003eLorente, L., Martin, M. M., Borreguero-Leon, J. M., Sole-Violan, J., Ferreres, J., Labarta, L.\\u003cem\\u003e et al.\\u003c/em\\u003e Sustained high plasma plasminogen activator inhibitor-1 levels are associated with severity and mortality in septic patients. \\u003cem\\u003eThromb Res\\u003c/em\\u003e 134, 182-186 (2014). https://doi.org/10.1016/j.thromres.2014.04.013\\u003c/li\\u003e\\n\\u003cli\\u003eMavrommatis, A. C., Theodoridis, T., Economou, M., Kotanidou, A., El Ali, M., Christopoulou-Kokkinou, V.\\u003cem\\u003e et al.\\u003c/em\\u003e Activation of the fibrinolytic system and utilization of the coagulation inhibitors in sepsis: comparison with severe sepsis and septic shock. \\u003cem\\u003eIntensive Care Med\\u003c/em\\u003e 27, 1853-1859 (2001). https://doi.org/10.1007/s00134-001-1139-8\\u003c/li\\u003e\\n\\u003cli\\u003eIba, T. \\u0026amp; Levy, J. H. Derangement of the endothelial glycocalyx in sepsis. \\u003cem\\u003eJ Thromb Haemost\\u003c/em\\u003e 17, 283-294 (2019). https://doi.org/10.1111/jth.14371\\u003c/li\\u003e\\n\\u003cli\\u003eGando, S., Levi, M. \\u0026amp; Toh, C. H. Disseminated intravascular coagulation. \\u003cem\\u003eNat Rev Dis Primers\\u003c/em\\u003e 2, 16037 (2016). https://doi.org/10.1038/nrdp.2016.37\\u003c/li\\u003e\\n\\u003cli\\u003eIba, T., Gando, S. \\u0026amp; Thachil, J. Anticoagulant therapy for sepsis-associated disseminated intravascular coagulation: the view from Japan. \\u003cem\\u003eJ Thromb Haemost\\u003c/em\\u003e 12, 1010-1019 (2014). https://doi.org/10.1111/jth.12596\\u003c/li\\u003e\\n\\u003cli\\u003eSubramaniam, S., Kothari, H. \\u0026amp; Bosmann, M. Tissue factor in COVID-19-associated coagulopathy. \\u003cem\\u003eThromb Res\\u003c/em\\u003e 220, 35-47 (2022). https://doi.org/10.1016/j.thromres.2022.09.025\\u003c/li\\u003e\\n\\u003cli\\u003eMackman, N., Tilley, R. E. \\u0026amp; Key, N. S. Role of the extrinsic pathway of blood coagulation in hemostasis and thrombosis. \\u003cem\\u003eArterioscler Thromb Vasc Biol\\u003c/em\\u003e 27, 1687-1693 (2007). https://doi.org/10.1161/ATVBAHA.107.141911\\u003c/li\\u003e\\n\\u003cli\\u003eRao, L. V. \\u0026amp; Pendurthi, U. R. Regulation of tissue factor coagulant activity on cell surfaces. \\u003cem\\u003eJ Thromb Haemost\\u003c/em\\u003e 10, 2242-2253 (2012). https://doi.org/10.1111/jth.12003\\u003c/li\\u003e\\n\\u003cli\\u003eIba, T. \\u0026amp; Levy, J. H. Inflammation and thrombosis: roles of neutrophils, platelets and endothelial cells and their interactions in thrombus formation during sepsis. \\u003cem\\u003eJ Thromb Haemost\\u003c/em\\u003e 16, 231-241 (2018). https://doi.org/10.1111/jth.13911\\u003c/li\\u003e\\n\\u003cli\\u003eVassiliou, A. G., Maniatis, N. A., Kotanidou, A., Kallergi, M., Karystinaki, F. S., Letsiou, E.\\u003cem\\u003e et al.\\u003c/em\\u003e Endothelial protein C receptor polymorphisms and risk of severe sepsis in critically ill patients. \\u003cem\\u003eIntensive Care Med\\u003c/em\\u003e 39, 1752-1759 (2013). https://doi.org/10.1007/s00134-013-3018-5\\u003c/li\\u003e\\n\\u003cli\\u003eKume, N., Murase, T., Moriwaki, H., Aoyama, T., Sawamura, T., Masaki, T.\\u003cem\\u003e et al.\\u003c/em\\u003e Inducible expression of lectin-like oxidized LDL receptor-1 in vascular endothelial cells. \\u003cem\\u003eCirc Res\\u003c/em\\u003e 83, 322-327 (1998). https://doi.org/10.1161/01.res.83.3.322\\u003c/li\\u003e\\n\\u003cli\\u003eAdachi, H. \\u0026amp; Tsujimoto, M. Endothelial scavenger receptors. \\u003cem\\u003eProg Lipid Res\\u003c/em\\u003e 45, 379-404 (2006). https://doi.org/10.1016/j.plipres.2006.03.002\\u003c/li\\u003e\\n\\u003cli\\u003ePothineni, N. V. K., Karathanasis, S. K., Ding, Z., Arulandu, A., Varughese, K. I. \\u0026amp; Mehta, J. L. LOX-1 in Atherosclerosis and Myocardial Ischemia: Biology, Genetics, and Modulation. \\u003cem\\u003eJ Am Coll Cardiol\\u003c/em\\u003e 69, 2759-2768 (2017). https://doi.org/10.1016/j.jacc.2017.04.010\\u003c/li\\u003e\\n\\u003cli\\u003eYan, M., Mehta, J. L., Zhang, W. \\u0026amp; Hu, C. LOX-1, oxidative stress and inflammation: a novel mechanism for diabetic cardiovascular complications. \\u003cem\\u003eCardiovasc Drugs Ther\\u003c/em\\u003e 25, 451-459 (2011). https://doi.org/10.1007/s10557-011-6342-4\\u003c/li\\u003e\\n\\u003cli\\u003eYing, W., Meiyan, S., Wen, C., Kaizu, X., Meifang, W. \\u0026amp; Liming, L. Liraglutide ameliorates oxidized LDL-induced endothelial dysfunction by GLP-1R-dependent downregulation of LOX-1-mediated oxidative stress and inflammation. \\u003cem\\u003eRedox Rep\\u003c/em\\u003e 28, 2218684 (2023). https://doi.org/10.1080/13510002.2023.2218684\\u003c/li\\u003e\\n\\u003cli\\u003eLandsberger, M., Zhou, J., Wilk, S., Thaumuller, C., Pavlovic, D., Otto, M.\\u003cem\\u003e et al.\\u003c/em\\u003e Inhibition of lectin-like oxidized low-density lipoprotein receptor-1 reduces leukocyte adhesion within the intestinal microcirculation in experimental endotoxemia in rats. \\u003cem\\u003eCrit Care\\u003c/em\\u003e 14, R223 (2010). https://doi.org/10.1186/cc9367\\u003c/li\\u003e\\n\\u003cli\\u003ePrado, Y., Tapia, P., Eltit, F., Reyes-Martinez, C., Feijoo, C. G., Llancalahuen, F. M.\\u003cem\\u003e et al.\\u003c/em\\u003e Sepsis-Induced Coagulopathy Phenotype Induced by Oxidized High-Density Lipoprotein Associated with Increased Mortality in Septic-Shock Patients. \\u003cem\\u003eAntioxidants (Basel)\\u003c/em\\u003e 12 (2023). https://doi.org/10.3390/antiox12030543\\u003c/li\\u003e\\n\\u003cli\\u003eZanders, L., Kny, M., Hahn, A., Schmidt, S., Wundersitz, S., Todiras, M.\\u003cem\\u003e et al.\\u003c/em\\u003e Sepsis induces interleukin 6, gp130/JAK2/STAT3, and muscle wasting. \\u003cem\\u003eJ Cachexia Sarcopenia Muscle\\u003c/em\\u003e 13, 713-727 (2022). https://doi.org/10.1002/jcsm.12867\\u003c/li\\u003e\\n\\u003cli\\u003eZhou, Y., Xu, W. \\u0026amp; Zhu, H. CXCL8((3-72)) K11R/G31P protects against sepsis-induced acute kidney injury via NF-kappaB and JAK2/STAT3 pathway. \\u003cem\\u003eBiol Res\\u003c/em\\u003e 52, 29 (2019). https://doi.org/10.1186/s40659-019-0236-5\\u003c/li\\u003e\\n\\u003cli\\u003eXu, S., Pan, X., Mao, L., Pan, H., Xu, W., Hu, Y.\\u003cem\\u003e et al.\\u003c/em\\u003e Phospho-Tyr705 of STAT3 is a therapeutic target for sepsis through regulating inflammation and coagulation. \\u003cem\\u003eCell Commun Signal\\u003c/em\\u003e 18, 104 (2020). https://doi.org/10.1186/s12964-020-00603-z\\u003c/li\\u003e\\n\\u003cli\\u003eLevi, M. \\u0026amp; van der Poll, T. Coagulation and sepsis. \\u003cem\\u003eThromb Res\\u003c/em\\u003e 149, 38-44 (2017). https://doi.org/10.1016/j.thromres.2016.11.007\\u003c/li\\u003e\\n\\u003cli\\u003eLevi, M., van der Poll, T. \\u0026amp; Buller, H. R. Bidirectional relation between inflammation and coagulation. \\u003cem\\u003eCirculation\\u003c/em\\u003e 109, 2698-2704 (2004). https://doi.org/10.1161/01.CIR.0000131660.51520.9A\\u003c/li\\u003e\\n\\u003cli\\u003eWang, Y., Braun, O. O., Zhang, S., Norstrom, E. \\u0026amp; Thorlacius, H. Monocytes regulate systemic coagulation and inflammation in abdominal sepsis. \\u003cem\\u003eAm J Physiol Heart Circ Physiol\\u003c/em\\u003e 308, H540-547 (2015). https://doi.org/10.1152/ajpheart.00336.2014\\u003c/li\\u003e\\n\\u003cli\\u003eFajgenbaum, D. C. \\u0026amp; June, C. H. Cytokine Storm. \\u003cem\\u003eN Engl J Med\\u003c/em\\u003e 383, 2255-2273 (2020). https://doi.org/10.1056/NEJMra2026131\\u003c/li\\u003e\\n\\u003cli\\u003eMcConnell, M. J., Kawaguchi, N., Kondo, R., Sonzogni, A., Licini, L., Valle, C.\\u003cem\\u003e et al.\\u003c/em\\u003e Liver injury in COVID-19 and IL-6 trans-signaling-induced endotheliopathy. \\u003cem\\u003eJ Hepatol\\u003c/em\\u003e 75, 647-658 (2021). https://doi.org/10.1016/j.jhep.2021.04.050\\u003c/li\\u003e\\n\\u003cli\\u003eSzotowski, B., Antoniak, S., Poller, W., Schultheiss, H. P. \\u0026amp; Rauch, U. Procoagulant soluble tissue factor is released from endothelial cells in response to inflammatory cytokines. \\u003cem\\u003eCirc Res\\u003c/em\\u003e 96, 1233-1239 (2005). https://doi.org/10.1161/01.RES.0000171805.24799.fa\\u003c/li\\u003e\\n\\u003cli\\u003eNawroth, P. P., Handley, D. A., Esmon, C. T. \\u0026amp; Stern, D. M. Interleukin 1 induces endothelial cell procoagulant while suppressing cell-surface anticoagulant activity. \\u003cem\\u003eProc Natl Acad Sci U S A\\u003c/em\\u003e 83, 3460-3464 (1986). https://doi.org/10.1073/pnas.83.10.3460\\u003c/li\\u003e\\n\\u003cli\\u003eNawroth, P. P. \\u0026amp; Stern, D. M. Modulation of endothelial cell hemostatic properties by tumor necrosis factor. \\u003cem\\u003eJ Exp Med\\u003c/em\\u003e 163, 740-745 (1986). https://doi.org/10.1084/jem.163.3.740\\u003c/li\\u003e\\n\\u003cli\\u003eHerbert, J. M., Savi, P., Laplace, M. C. \\u0026amp; Lale, A. IL-4 inhibits LPS-, IL-1 beta- and TNF alpha-induced expression of tissue factor in endothelial cells and monocytes. \\u003cem\\u003eFEBS Lett\\u003c/em\\u003e 310, 31-33 (1992). https://doi.org/10.1016/0014-5793(92)81139-d\\u003c/li\\u003e\\n\\u003cli\\u003ePosma, J. J., Posthuma, J. J. \\u0026amp; Spronk, H. M. Coagulation and non-coagulation effects of thrombin. \\u003cem\\u003eJ Thromb Haemost\\u003c/em\\u003e 14, 1908-1916 (2016). https://doi.org/10.1111/jth.13441\\u003c/li\\u003e\\n\\u003cli\\u003eFang, X., Li, M., Zhang, W., Li, J. \\u0026amp; Zhu, T. Thrombin induces pro-inflammatory and anti-inflammatory cytokines secretion from human mast cell line (HMC-1) via protease-activated receptors. \\u003cem\\u003eMol Immunol\\u003c/em\\u003e 141, 60-69 (2022). https://doi.org/10.1016/j.molimm.2021.11.012\\u003c/li\\u003e\\n\\u003cli\\u003eHermans, P. W. \\u0026amp; Hazelzet, J. A. Plasminogen activator inhibitor type 1 gene polymorphism and sepsis. \\u003cem\\u003eClin Infect Dis\\u003c/em\\u003e 41 Suppl 7, S453-458 (2005). https://doi.org/10.1086/431996\\u003c/li\\u003e\\n\\u003cli\\u003eMad\\u0026aacute;ch, K., Aladzsity, I., Szil\\u0026aacute;gyi, A., Fust, G., G\\u0026aacute;l, J., P\\u0026eacute;nzes, I.\\u003cem\\u003e et al.\\u003c/em\\u003e 4G/5G polymorphism of PAI-1 gene is associated with multiple organ dysfunction and septic shock in pneumonia induced severe sepsis: prospective, observational, genetic study. \\u003cem\\u003eCrit Care\\u003c/em\\u003e 14, R79 (2010). https://doi.org/10.1186/cc8992\\u003c/li\\u003e\\n\\u003cli\\u003eDawson, S. \\u0026amp; Henney, A. The status of PAI-1 as a risk factor for arterial and thrombotic disease: a review. \\u003cem\\u003eAtherosclerosis\\u003c/em\\u003e 95, 105-117 (1992). https://doi.org/10.1016/0021-9150(92)90014-8\\u003c/li\\u003e\\n\\u003cli\\u003eMartin, G. S. \\u0026amp; Bernard, G. R. Airway and lung in sepsis. \\u003cem\\u003eIntensive Care Med\\u003c/em\\u003e 27 Suppl 1, S63-79 (2001). https://doi.org/10.1007/pl00003798\\u003c/li\\u003e\\n\\u003cli\\u003eMatthay, M. A., Zemans, R. L., Zimmerman, G. A., Arabi, Y. M., Beitler, J. R., Mercat, A.\\u003cem\\u003e et al.\\u003c/em\\u003e Acute respiratory distress syndrome. \\u003cem\\u003eNat Rev Dis Primers\\u003c/em\\u003e 5, 18 (2019). https://doi.org/10.1038/s41572-019-0069-0\\u003c/li\\u003e\\n\\u003cli\\u003eBorczuk, A. C., Salvatore, S. P., Seshan, S. V., Patel, S. S., Bussel, J. B., Mostyka, M.\\u003cem\\u003e et al.\\u003c/em\\u003e COVID-19 pulmonary pathology: a multi-institutional autopsy cohort from Italy and New York City. \\u003cem\\u003eMod Pathol\\u003c/em\\u003e 33, 2156-2168 (2020). https://doi.org/10.1038/s41379-020-00661-1\\u003c/li\\u003e\\n\\u003cli\\u003eKong, F., Sun, Y., Song, W., Zhou, Y. \\u0026amp; Zhu, S. MiR-216a alleviates LPS-induced acute lung injury via regulating JAK2/STAT3 and NF-\\u0026kappa;B signaling. \\u003cem\\u003eHum Cell\\u003c/em\\u003e 33, 67-78 (2020). https://doi.org/10.1007/s13577-019-00289-7\\u003c/li\\u003e\\n\\u003cli\\u003eTan, Z., Liu, Q., Chen, H., Zhang, Z., Wang, Q., Mu, Y.\\u003cem\\u003e et al.\\u003c/em\\u003e Pectolinarigenin alleviated septic acute kidney injury via inhibiting Jak2/Stat3 signaling and mitochondria dysfunction. \\u003cem\\u003eBiomed Pharmacother\\u003c/em\\u003e 159, 114286 (2023). https://doi.org/10.1016/j.biopha.2023.114286\\u003c/li\\u003e\\n\\u003cli\\u003eYang, Y., Li, R., Hui, J., Li, L. \\u0026amp; Zheng, X. \\u0026beta;-Carotene attenuates LPS-induced rat intestinal inflammation via modulating autophagy and regulating the JAK2/STAT3 and JNK/p38 MAPK signaling pathways. \\u003cem\\u003eJ Food Biochem\\u003c/em\\u003e 45, e13544 (2021). https://doi.org/10.1111/jfbc.13544\\u003c/li\\u003e\\n\\u003cli\\u003eLu, Y., Li, D., Huang, Y., Sun, Y., Zhou, H., Ye, F.\\u003cem\\u003e et al.\\u003c/em\\u003e Pretreatment with Eupatilin Attenuates Inflammation and Coagulation in Sepsis by Suppressing JAK2/STAT3 Signaling Pathway. \\u003cem\\u003eJ Inflamm Res\\u003c/em\\u003e 16, 1027-1042 (2023). https://doi.org/10.2147/jir.S393850\\u003c/li\\u003e\\n\\u003cli\\u003eBi, J., Wang, Y., Wang, K., Sun, Y., Ye, F., Wang, X.\\u003cem\\u003e et al.\\u003c/em\\u003e FGF1 attenuates sepsis-induced coagulation dysfunction and hepatic injury via IL6/STAT3 pathway inhibition. \\u003cem\\u003eBiochim Biophys Acta Mol Basis Dis\\u003c/em\\u003e 1870, 167281 (2024). https://doi.org/10.1016/j.bbadis.2024.167281\\u003c/li\\u003e\\n\\u003cli\\u003eAkhmedov, A., Sawamura, T., Chen, C. H., Kraler, S., Vdovenko, D. \\u0026amp; Luscher, T. F. Lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1): a crucial driver of atherosclerotic cardiovascular disease. \\u003cem\\u003eEur Heart J\\u003c/em\\u003e 42, 1797-1807 (2021). https://doi.org/10.1093/eurheartj/ehaa770\\u003c/li\\u003e\\n\\u003cli\\u003eHoly, E. W., Akhmedov, A., Speer, T., Camici, G. G., Zewinger, S., Bonetti, N.\\u003cem\\u003e et al.\\u003c/em\\u003e Carbamylated Low-Density Lipoproteins Induce a Prothrombotic State Via LOX-1: Impact on Arterial Thrombus Formation In Vivo. \\u003cem\\u003eJ Am Coll Cardiol\\u003c/em\\u003e 68, 1664-1676 (2016). https://doi.org/10.1016/j.jacc.2016.07.755\\u003c/li\\u003e\\n\\u003cli\\u003eCimmino, G., Cirillo, P., Conte, S., Pellegrino, G., Barra, G., Maresca, L.\\u003cem\\u003e et al.\\u003c/em\\u003e Oxidized low-density lipoproteins induce tissue factor expression in T-lymphocytes via activation of lectin-like oxidized low-density lipoprotein receptor-1. \\u003cem\\u003eCardiovasc Res\\u003c/em\\u003e 116, 1125-1135 (2020). https://doi.org/10.1093/cvr/cvz230\\u003c/li\\u003e\\n\\u003cli\\u003eAkhmedov, A., Camici, G. G., Reiner, M. F., Bonetti, N. R., Costantino, S., Holy, E. W.\\u003cem\\u003e et al.\\u003c/em\\u003e Endothelial LOX-1 activation differentially regulates arterial thrombus formation depending on oxLDL levels: role of the Oct-1/SIRT1 and ERK1/2 pathways. \\u003cem\\u003eCardiovasc Res\\u003c/em\\u003e 113, 498-507 (2017). https://doi.org/10.1093/cvr/cvx015\\u003c/li\\u003e\\n\\u003cli\\u003eAl-Banna, N. \\u0026amp; Lehmann, C. Oxidized LDL and LOX-1 in experimental sepsis. \\u003cem\\u003eMediators Inflamm\\u003c/em\\u003e 2013, 761789 (2013). https://doi.org/10.1155/2013/761789\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, P., Liu, M. C., Cheng, L., Liang, M., Ji, H. L. \\u0026amp; Fu, J. Blockade of LOX-1 prevents endotoxin-induced acute lung inflammation and injury in mice. \\u003cem\\u003eJ Innate Immun\\u003c/em\\u003e 1, 358-365 (2009). https://doi.org/10.1159/000161070\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"LOX-1, sepsis, coagulation, inflammation, JAK2/STAT3\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-5417565/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-5417565/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eLectin-like oxidised low-density lipoprotein receptor-1 (LOX-1) is a transmembrane protein that belongs to the C-type lectin family and plays a significant role in various diseases by promoting the release of inflammatory mediators and enhancing cellular responses to oxidative stress. Studies have demonstrated that in sepsis, activation of LOX-1 promotes a procoagulant phenotype in endothelial cells. The aim of this study was to investigate whether inhibition of LOX-1 could ameliorate coagulation dysfunction and the inflammatory response in sepsis by modulating the JAK2/STAT3 signaling pathway. We utilized LPS-induced C57BL/6 mice to establish an in vivo animal model and assessed the activity of the JAK2/STAT3 signaling pathway, along with coagulation-related factors and inflammatory factors.In the in vitro experiments, human umbilical vein endothelial cells (HUVECs) were exposed to LPS after either LOX-1 knockdown or no treatment. We subsequently measured the expression of tissue factor (TF) and inflammatory factors, as well as changes in the JAK2/STAT3 signaling pathway. The results indicated that LOX-1 blockade improved coagulation dysfunction and the inflammatory response, leading to enhanced survival in septic mice. In vitro, LOX-1 knockdown suppressed the expression of TF and inflammatory factors in LPS-induced HUVECs. Both in vivo and in vitro experiments confirmed that inhibition of LOX-1 ameliorated sepsis by suppressing the JAK2/STAT3 signaling pathway.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Inhibition of LOX-1 ameliorates coagulation and inflammation in sepsis by suppressing the JAK2/STAT3 pathway\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-11-28 07:26:22\",\"doi\":\"10.21203/rs.3.rs-5417565/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"162ffc9e-5162-4876-883e-1cc5269d008b\",\"owner\":[],\"postedDate\":\"November 28th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-12-27T09:08:09+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-11-28 07:26:22\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-5417565\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-5417565\",\"identity\":\"rs-5417565\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}