{"paper_id":"3332870f-1a12-4aac-afb0-da47ceb95e17","body_text":"Human population exposure to residual malaria transmission by the main vector, Anopheles s.l. in the city of Bobo-Dioulasso, Burkina Faso | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Human population exposure to residual malaria transmission by the main vector, Anopheles s.l. in the city of Bobo-Dioulasso, Burkina Faso Miriam Félicité AMARA, Hamadou KONATE, Kouamé Wilfred Ulrich KOUADIO, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7048284/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 13 You are reading this latest preprint version Abstract Background Urban malaria poses a significant public health challenge in many African countries, driven by rapid urbanization and accelerating population growth. Malaria transmission among non-immune urban populations has the potential to emerge as a critical public health concern. To address this threat, a more comprehensive understanding of the biological and ecological factors of urban malaria transmission is essential for set up an updated vector control strategies. Methods This study aimed to investigate key biological aspects of the Anopheles vector and their implications for residual malaria transmission in order to guide vector control strategies tailored to vulnerable populations in Bobo-Dioulasso, Burkina Faso. For this purpose, mosquito sampling was conducted in 2023 and 2024, using both fauna residual capture and human landing catch techniques in areas located close and distant from riverbanks. Collected specimens were morphologically identified, and molecular analyses (PCR) were performed to i) determine species composition within the Anopheles gambiae complex, ii) detect Plasmodium infections, and iii) assess host feeding preferences. Results These data were used to evaluate levels of malaria exposure in urban settings. As results, three mosquito genera were identified: Culex spp. (72.63%), Anopheles spp. (22.68%), and Aedes spp. (4.68%). All Anopheles specimens belonged to the An. gambiae complex, comprising 90.82% An. arabiensis , 6.00% An. gambiae s.s., and 3.22% An. coluzzii . Among these, both endophilic and exophilic populations were observed, with 58.84% of females being gravid. Molecular diagnostics revealed that 27.03% of the Anopheles specimens were infected with Plasmodium falciparum , while 0.16% carried a dual infection ( P. falciparum and P. malariae ). Blood meal analysis indicated a predominance of mixed blood meals (56.65%), followed by zoophilic (22.44%) and anthropophilic (20.91%) feedings. Conclusions These findings confirm the presence of active, indigenous malaria transmission hotspots within the urban environment of Bobo-Dioulasso. The observed vector behaviors and infection rates underscore the importance of context-specific interventions aimed at mitigating malaria transmission in urban African settings. Malaria Anopheles s.l. Plasmodium human exposure Bobo-Dioulasso Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Background Malaria is a parasitic disease of global concern, transmitted through the bites of infected female mosquitoes of the genus Anopheles . Despite progress in vector control, it remains a major public health threat, particularly in intertropical endemic regions, but also may threat non-endemic areas ( 1 ). The disease is primarily caused by five species of Plasmodium : P. falciparum , P. vivax , P. ovale , P. malariae , and P. knowlesi , which together are responsible for significant morbidity and mortality worldwide ( 2 ). According to the latest World Health Organization (WHO) malaria report, an estimated of 263 million malaria cases and 597,000 related deaths occurred globally in 2023, with an increase of closely 11 million cases and a rise in mortality compared to 2022. Approximately 95% of malaria-related deaths occurred in Africa, where access to essential preventive, diagnostic, and therapeutic services remains limited for many at-risk populations ( 3 ). Burkina Faso remains heavily burdened by malaria. In 2022, it ranked among the ten countries with the highest malaria case counts and fatalities, contributing to 3.2% of global cases and 2.7% of global malaria-related deaths. In 2023, over ten million malaria cases were reported by national health services, accounting for approximately 3.1% of global cases and 2.7% of global deaths ( 4 ). The country experiences endemic transmission year-round, with prevalence rates ranging from 21–24%. A marked seasonal increase in cases occurs during the rainy season (from May to October), with the transmission peak lasting up to three months in the north, six months in the center, and as long as nine months in the southern regions ( 5 ). The predominantly endophagic and endophilic behavior of primary malaria vectors has led to widespread implementation of indoor-targeted control measures, such as Long-Lasting Insecticidal Nets (LLINs) and Indoor Residual Spraying (IRS) ( 6 , 7 ). While these interventions have contributed to a reduction in transmission in many areas, they have also induced notable shifts in mosquito species composition and behavior ( 8 – 10 ). In some settings, such interventions have facilitated the emergence or predominance of more exophilic species such as An. arabiensis , and behavioral adaptations in species such as An. gambiae and An. funestus , resulting in increased outdoor biting activity ( 11 – 13 ). Notably, changes in biting behavior have been observed in An. gambiae s.s., including shifts to earlier feeding times and increased zoophilic and mixed blood meal patterns ( 6 , 8 , 14 ). Despite the widespread deployment of LLINs and IRS, malaria transmission persists in many regions of Burkina Faso, particularly in urban settings ( 15 ).This persistence is attributed partly to a range of sociodemographic and environmental factors. Rapid and often unplanned urbanization, coupled with poor drainage, stagnant water, and inadequate waste management, creates favorable breeding conditions for malaria vectors ( 16 ). Mosquito larvae develop in a variety of aquatic habitats, both permanent and temporary, including marshes, rivers, puddles, and artificial containers. While Anopheles s.s mosquitoes generally prefer clean and unpolluted water, An. arabiensis favors sunlit, open habitats ( 17 , 18 ). Urban density further exacerbates transmission risk and is often accompanied by presumptive treatment practices, which can lead to misdiagnoses, inappropriate antimalarial use, and the emergence of drug resistance ( 19 , 20 ). Moreover, in urban areas traditionally classified as low-endemic zones ( 21 ), both children and adults tend to acquire partial immunity more slowly, rendering them more vulnerable to severe malaria than their rural counterparts ( 22 ). These epidemiological dynamics underscore the need for revised and context-specific approaches to malaria diagnosis, treatment, and vector control in urban environments. A critical step toward this goal is the identification of local environmental factors driving malaria transmission. This study aimed to evaluate ecological determinants influencing human exposure to malaria vector bites in selected urban areas of Bobo-Dioulasso, Burkina Faso. By examining Anopheles infection rates, blood meal sources, and clinical malaria incidence, the research seeks to improve the understanding of urban malaria transmission dynamics and contribute to the development of more effective and context-adapted control strategies. Methods Study Area This study was conducted in the city of Bobo-Dioulasso, the capital of the Haut-Bassin region. Bobo-Dioulasso is the economic capital of Burkina Faso and is in the southwest of the country; its coordinates are latitude 11°10′37″ North, longitude 4°17′52″ West, and an altitude of 423 meters above sea level. The study was carried out transversally in several neighborhoods, including Sarfalao, Kua, Sabaribougou, Kodeni, Farakan, and Dogona (Fig. 1). These neighborhoods were selected based on the presence of a watercourse, permanent breeding sites, and temporary breeding sites created by human activities. Agriculture and artisanal activities being the main activities in these neighborhoods have resulted in the development of numerous sites in favor for mosquito reproduction. This is due, on one hand, to stagnant irrigation water on cultivated plots, and on the other, to the improper management of waste and materials related to these activities. These neighborhoods are densely populated, thus classified as popular or high-density areas. Therefore, it is important to focus on these areas to determine the impact of the environment on the persistence and transmission of malaria. Human-Bait Capture Human-bait capture was carried out following the standard WHO protocol (2016). It required eight individuals (collectors) per neighborhood, with two collectors per house. They were divided into two groups: the first group captured mosquitoes from 6 p.m to 1 a.m, and the second group from 1 a.m to 9 a.m. The individuals themselves served as bait to attract mosquitoes. Seated on a chair and equipped with a flashlight, they captured mosquitoes that landed on their bare legs using hemolysis tubes, without waiting for the mosquitoes to become engorged. To reduce biases related to differences in attractiveness to mosquitoes among individuals, the collectors rotated between indoor and outdoor locations every hour. The supervision was conducted by a technician from IRSS/MURAZ and a local agent. The captured mosquitoes were identified based on their genus and species (for Anopheles ) using taxonomic identification keys and were preserved on silica gel. Residual Fauna Capture Residual fauna capture was conducted according to the WHO protocol (2014) and involved collecting mosquitoes randomly in houses for this study. The collection was performed in bedrooms between 6 a.m and 8 a.m using a pyrethroid-type insecticide (Kaltox), which kills or immobilizes mosquitoes. Before spraying, houses were cleared of all food and pets. White sheets were then spread across the entire floor of each room. Finally, all openings (windows, doors, and holes) were carefully sealed to prevent mosquitoes inside from escaping and those outside from entering, during or after spraying. Once these preparations were made, the insecticide was sprayed toward the roof in a clockwise direction, continuing until the entire house was covered with the product. The opening hours remained closed for 10 to 15 minutes. After the allocated time, the sheets were carefully removed and taken outside. Dead or stunned mosquitoes were sorted from other insects and placed into labeled petri dishes (with date, house number, and neighborhood) to be transported to the laboratory of IRSS/Centre MURAZ and preserved at -20°C. Molecular Identification The captured mosquitoes were first identified at the genus level using a binocular magnifying glass (AmScope; United Scope LLC) and based on the morphological identification key described by Gillies et De Meillon ( 23 ) for anophelines. Subsequently, these species were differentiated through allele-specific PCR amplification following the protocol of Santolamazza et al ., ( 24 ). This protocol utilizes the insertion polymorphisms of SINE200 retrotransposable elements to examine the genetic differentiation between An. gambiae and An. coluzzii species, the primary malaria vector in Africa. The primers used were as follows: S200X 6.1F: TCG-CCT-TAG-ACC-TTG-CGT-TA and S200X 6.1R: CGC-TTC-AAG-AAT-TCG-AGA-TAC. For amplification, 18 µL of PCR reaction mix (5x FIREPol® Master Mix Ready to Load with 7.5 mM MgCl2) were added to 2 µL of extracted genomic DNA. The PCR began with an initial Taq polymerase activation at 94°C for 10 minutes, followed by 35 cycles consisting of Denaturation at 94°C for 30 seconds, Primer annealing at 54°C for 30 seconds and Extension at 72°C for 1 minute. A final extension step was carried out at 72°C for 10 minutes to ensure complete synthesis of DNA strands. The amplified products were separated on a 2% agarose gel stained with ethidium bromide. The PCR product sizes were estimated using a molecular weight marker of 100 base pairs (bp). After migration for 30 to 45 minutes, the DNA bands were visualized under ultraviolet light. The expected band sizes were as follows: 479 bp for An. coluzzii , 249 bp for An. gambiae s.s and 223 bp for An. Arabiensis. Molecular analysis The Anopheles samples were subjected to DNA extraction following the 2% CTAB protocol established by Myriam and Cécile (2003). Each specimen was ground in 200 µL of 2% CTAB solution using a tissue homogenizer, promoting the lysis of cell membranes. The homogenates were then incubated in a water bath at 65°C for 10 minutes to inactivate thermolabile enzymes, followed by a step to separate the DNA from cellular debris using 200 µL of chloroform. The isolated DNA was precipitated with 200 µL of isopropanol, purified with 200 µL of 70% ethanol, and suspended in pure water for 24 hours. The purified DNA was subsequently used for various PCR analyses. Table 1 Primers used for identification of plasmodium species Species Primers Sequence 5′–3′ References Universal primer Fal F GTATCTGATCGTCTTCACTCCC ( 25 ) P. falciparum Fal R AACAGACGGGTAGTCATGATTGAG P. ovale Fal R CTGTTCTTTGCATTCCTTATGC P. malariae Fal R CGTTAAGATAAACGCCAAGC The amplification begun with an incubation at 95°C for 5 minutes, followed by cycles that include denaturation at 95°C for 30 seconds, primer annealing at 58°C for 45 seconds, and DNA strand elongation at 72°C for 1 minute. This cycle was repeated 35 times. Finally, a final elongation step was performed at 72°C for 5 minutes to complete the process. The PCR products obtained were separated on a 2% agarose gel stained with ethidium bromide. The size of the PCR products was estimated using a 100 bp molecular weight marker. The expected band sizes are as follows: 276 bp for P. falciparum , 376 bp for P. ovale , 411 bp for P. malariae. Origin of the Blood Meal The origin of the blood meal in engorged and semi-gravid Anopheles mosquitoes was determined using the protocol described by Kent and Norris (2005). This protocol was modified and divided into two multiplex PCRs (PCR1 and PCR2) based on the use of specific primers to identify the blood meals of An. gambiae s.l., such as (Table 2 and Table 3 ): Table 2 Primers used for identification trophic preference in An. gambiae s.l., (PCR 1) Species Primers Sequence 5′–3′ References Universal primer Fal F GGTTGTCCTCCAATTCATGTTA ( 26 ) sheep Fal R CTATCCTACTAATCCTCATCCTCATG donkey Fal R CTGGTAATCGTCCATCTAC Chicken Fal R ACACACCCTAGTAGAGTGAGG Goat Fal R CCTAATCTTAGTACTTGTACCCTTCCTC Table 3 Primers used for identification trophic preference in An. gambiae s.l., (PCR 2) Species Primers Sequence 5′–3′ References Universal primer Fal F GGTTGTCCTCCAATTCATGTTA ( 26 ) pig Fal R CCTCGCAGCCGTACATCTC Human Fal R GGCTTACTTCTCTTCATTCTCTCCT Dog Fal R GGAATTGTACTATTATTCGCAACCAT Beef Fal R CATCGGCACAAATTTAGTCG The amplification started with an incubation at 95°C for 3 minutes and 30 seconds, followed by 40 successive cycles comprising: denaturation at 95°C for 30 seconds, primer annealing at 60°C for 50 seconds, and DNA strand elongation at 72°C for 40 seconds. Finally, a final incubation step at 72°C for 5 minutes completes the amplification. The resulting PCR products were separated on a 2% agarose gel stained with ethidium bromide. A 100 bp molecular weight marker was used to estimate the sizes. The expected PCR product sizes are as follows: 340 bp (sheep), 150 bp (goat), 290 bp (chicken), 460 bp (donkey), 500 bp (pig), 350 bp (human), 750 bp (dog), 600 bp (beef). Collection of Clinical Data The clinical data based on malaria infected cases were collected from the monthly records of the various Health Centers “Centre de Santé et de Promotion Sociale (CSPS)” in the six neighborhoods through the head nurses of these health centers. This was made possible by authorization granted by the Direction Régionale de la Santé (DRS) and the head nurses of the Dafra and Do health districts. Data Analysis The data were analyzed using RSTUDIO software version 4.4.2. The relationships between the mean abundance and the number of positive cases were assessed using Pearson's correlation coefficient. Subsequently, ANOVA or Kruskal-Wallis tests were performed, depending on whether the distribution followed the normal distribution or not, with a significance level set at 0.05. P-values below 0.05 were considered significant in the analysis. Results Density of Residual Fauna Capture Overall, the analysis of the resting mosquito fauna revealed a predominance of Culex spp. with a total number of 10,203 corresponding to 72.63%. Also, an effectif of 3,186 of Anopheles spp. individuals was collected prevailing to a rate of 22.68% followed by Aedes . with a total number of 658 individuals corresponding to 4.68%. Density of Anopheles species The analysis of species distribution collected by humain-bait and residual fauna capture reveals that An. arabiensis is the predominant species across most sampling sites, regardless of proximity to water bodies both proximal (close) and distal (far). However, notable spatial variations were observed in certain localities. For instance, in Farakan, An. arabiensis accounted for 97% of specimens in distal areas, compared to 88% in proximal areas. A similar pattern was observed in Kua, where its prevalence was higher in distal sites (96%) than in proximal ones (84%). Conversely, greater species diversity was recorded in certain proximal areas. In Kodeni-close, for example, An. coluzzii and An. gambiae s.s. were more frequently encountered, representing 4% and 10% of the Anopheles population, respectively, whereas in Kodeni-far, only An. gambiae s.s. was present, at 10%. These differences may reflect microhabitat variations or ecological preferences influencing species distribution between proximal and distal zones. In other localities, such as Sabaribougou and Sarfalao, the differences between proximal and distal areas were less pronounced for An. arabiensis , suggesting a relatively homogeneous distribution of this species across spatial gradients. Notably, in Sarfalao-far, An. gambiae s.s. reached a higher proportion (13%) compared to only 3% in Sarfalao-close, indicating potential site-specific environmental factors favoring this species in distal zones. Additionally, An. coluzzii showed a relatively elevated presence in Kua-close (7%), potentially suggesting a preference for habitats closer to human settlements (Table 4 ). Table 4 Density of Anopheles species Sites An. arabiensis n (%) An. coluzzii n (%) An. gambiae n (%) Total n (%) Dogona-far 68 (11.93) 02 ( 10 ) 03 (08.57) 73 (11.64) Dogona-close 63 (11.05) 03 ( 15 ) 03 (08.57) 69 ( 11 ) Farakan-far 29 (05.09) ND 01 (02.86) 30 (04.80) Farakan-close 23 (04.03) 01 (05) 02 (05.71) 26 (04.14) Kodeni-far 56 (09.82) ND 05 (14.28) 61 (09.73) Kodeni-close 43 (07.54) 02 ( 10 ) 06 (17.14) 51 (08.13) Sabaribougou-far 51 (08.95) ND 02 (05.71) 53 (08.45) Sabaribougou-close 37 (06.50) 03 ( 15 ) 01 (02.86) 41 (06.54) Kua-far 51 (08.95) 02 ( 10 ) ND 53 (08.45) Kua-close 49 (08.60) 04 ( 20 ) 06 (17.14) 59 (09.41) Sarfalao-far 40 07.02) 01 (05) 06 (17.14) 47 (07.50) Sarfalao-close 60 (10.53) 02 ( 10 ) 02 (05.71) 64 (10.21) Total 570 (90.91) 20 (03.19) 37 (05.90) 627 (100) ND: No determined Seasonal Density of anopheline Species Overall, the analysis shows that An. arabiensis is the most widely distributed species during both the rainy season and the dry season. On the other hand, An. gambiae s.s. is less predominant during the dry season, while An. coluzzii stands out as the least abundant species during the rainy season (Fig. 2). This density does not show a significant difference (P = 0.38). Resting Behavior of Vectors The curve below illustrates the evolution of Anopheles abundance inside and outside houses over time. Globally, a gradual increase in the number of Anopheles was observed from 6 p.m to 5 a.m, with a peak from 10 p.m to 11 p.m indoors and from midnight to 1 a.m outdoors, followed by a decrease until their complete disappearance between 5 a.m and 9 a,m, both indoors and outdoors (Fig. 3). Infection Rate The analysis of Fig. 4 below shows the distribution of infection rates based on the position of the species relative to the houses. Outside, a widespread distribution of infections by P. falciparum was observed, along with the presence of dual infection by P. falciparum and P. malariae . This dual infection was absent indoors. These observations are consistent regardless of whether the houses are close to or far from the riverbanks. Clinical Data The clinical data revealed that, across all neighborhoods, the month of September records the highest number of positive malaria cases (Fig. 5). The number of tests conducted, and positive cases increases month by month in all neighborhoods. The proportion of positive cases relative to the number of tests remains significant in every neighborhood. Kua and Sabaribougou stand out with a higher number of tests conducted and positive cases, especially in August and September. For instance, in August, Kua conducted 2,869 tests resulting in 2,177 positive cases, and in September, approximately 4,000 tests with 2,500 positive cases. Similarly, in Sabaribougou, August recorded 1,551 positive cases out of 3,410 tests, and September showed 2,700 positive cases out of 5,000 tests. In contrast, Dogona and Kodeni experienced more moderate growth in positive cases. The analysis of the results shows a positive relationship between the two events: in other words, the more abundant the Anopheles mosquitoes, the higher the number of positive malaria cases (Fig. 6). This observation is supported by the correction test, which shows a positive sign (rho = 0.12). In other words, a greater abundance of these vectors was correlated with an increase in the transmission of the parasite responsible for the disease. Trophic Preferences of Vectors The results below highlighted the trophic preferences of species according to the months and the location of houses (Fig. 7). Mosquitoes with mixed blood meals dominate over several periods, particularly in April, July, and September, in houses close to the shores. During this same period, the proportion of zoophilic mosquitoes reached its peak. Androphilic mosquitoes were present but in smaller quantities compared to other groups, although their presence remains relatively stable throughout the months. Discussion This study aimed to assess the environmental and ecological factors influencing human exposure to malaria vectors in selected urban areas of Bobo-Dioulasso. Among these factors, variations in mosquito density, species composition, infection rates, and blood-feeding preferences remain very important. Here, the analysis of the resting mosquito fauna revealed a predominance of Culex spp. (72.63%), followed by Anopheles spp. (22.68%) and Aedes spp. (4.68%). The dominance of Culex is likely attributable to its high ecological plasticity and its capacity to breed in a wide range of habitats, particularly polluted and stagnant water bodies frequently encountered in urban environments. Urbanization, climate variability, agricultural runoff, and inefficient waste management create optimal conditions for their proliferation ( 27 ). These observations are consistent with those reported by Chahed et al in Algeria and by Fillinger et al ( 28 , 29 ) in Dar es Salaam, though they contrast with findings from Hamaidia and Berchi in Souk-Ahras, Algeria, and Namountougou et al ( 30 , 31 ) in Burkina Faso, where Anopheles spp. were more prevalent. Molecular analyses of the An. gambiae sensu lato (s.l.) complex revealed the presence of three sibling species: An. arabiensis (90.91%), An. gambiae s.s. (5.90%), and An. coluzzii (3.19%). The predominance of An. arabiensis is likely due to its exceptional adaptability, including its tolerance to arid conditions and its ability to reproduce in urban and even polluted environments ( 32 ). These findings align with recent works done by ( 33 ), who also reported high frequencies of An. arabiensis in urban areas of Bamako, Mali. Temporal variations in female Anopheles abundance revealed that exophilic behavior was more pronounced between 12 a.m. and 5 a.m., whereas endophilic activity peaked between 7 p.m. and 1 a.m. This suggests a behavioral adaptation to ambient temperature and host availability, with mosquitoes preferring cooler outdoor environments during the early morning hours. Similar trends were observed in Uganda ( 34 ) and Sudan, where An. arabiensis exhibited flexible resting behavior depending on seasonal conditions ( 35 ). From 6 a.m. to 9 a.m., mosquito abundance declined significantly, likely due to the cessation of host-seeking activity and a shift toward resting behavior, a pattern corroborated by studies from Nigeria ( 36 ). Notably, exophilic An. gambiae s.l. populations exhibited higher Plasmodium infection rates compared to their endophilic counterparts, regardless of proximity to riverbanks. This elevated infection rate may result from increased host diversity and accessibility outdoors, where vector control tools such as LLINs and IRS are ineffective. Indoors, the presence of insecticides limits mosquito feeding success, whereas exophilic mosquitoes benefit from unrestricted access to blood meals, increasing their likelihood of acquiring and transmitting Plasmodium spp. This observation is consistent with findings from Burkina Faso, where IRS with DDT significantly reduced indoor biting rates but led to a fivefold increase in exophagic behavior due to the excito-repellent properties of the insecticide ( 37 ). Clinical surveillance data revealed malaria cases across all sampled neighborhoods, aligning with the confirmed presence of Plasmodium falciparum and P. malariae in mosquito vectors. A positive correlation (ρ = 0.11595) was observed between infection rates and vector density, supporting WHO’s findings on vector–pathogen–host interactions ( 3 ). Blood meal analysis indicated a dominant mixed feeding preference in Anopheles mosquitoes, particularly in April, July, and September, in areas adjacent to riverbanks. This mixed trophic behavior may reflect host availability, including the presence of humans, livestock, and domestic animals, as well as mosquito adaptability. The proximity of animal reservoirs to human dwellings increases the likelihood of opportunistic feeding ( 38 ). Species such as An. arabiensis and An. gambiae are known to modulate their host preferences according to environmental and seasonal cues ( 39 ), and insecticide resistance may further influence host-seeking behavior ( 40 ). Interestingly, the peak in zoophilic behavior overlapped with the period of heightened mixed feeding, notably in August, likely due to the increased availability of animal hosts. The pronounced seasonal variation in trophic behavior and the concurrent increase in zoophilic and endophilic mosquito densities during April, August, and September suggest these months represent critical periods for malaria transmission risk. As such, targeted vector control efforts and more granular ecological assessments during these months may enhance the effectiveness of malaria prevention strategies. Conclusion This study identified three genera of culicid mosquitoes within the study area: Anopheles , Culex , and Aedes . Within the Anopheles genus, three sibling species were detected An. gambiae s.l., An. coluzzii , and An. Arabiensis considered as the predominant species. These mosquitoes exhibited both endophilic and exophilic behaviors and demonstrated a broad host range, feeding on humans as well as domestic animals including cattle, goats, and poultry. Blood meal analysis confirmed a mixed trophic preference, though a high degree of anthropophily was consistently observed. This strong human-biting behavior significantly elevates the risk of vector-borne disease transmission, particularly malaria, among the inhabitants of Bobo-Dioulasso. The entomological findings reported here are consistent with the elevated number of malaria cases recorded across the various primary healthcare centers (CSPS) in the region. These results underscore the urgent need for targeted and context-specific vector control strategies to reduce human–vector contact and mitigate the burden of malaria in urban and peri-urban settings. Abbreviations s.l. sensu lato s.s. sensu stricto PCR Polymerase Chain Reaction WHO World Health Organization LLINs Long-Lasting Insecticidal Nets IRS Indoor Residual Spraying IRSS Institut de Recherche en Sciences de la Santé DNA Desoxyribonucleic acid CTAB Cetyltrimethylamonium bromide CSPS Centre de Santé et de Promotion Sociale DRS Direction régionale de la santé Declarations Ethics approval and consent to participate This study was approved by the Ethical Research Committee of the Institut de Recherche en Sciences de la Santé (IRSS) under reference number 008-2022/CEIRES, dated 20 January 2022. In accordance with national and institutional guidelines, informed consent was not required, as the study did not involve human participants or the collection of any personal or identifiable information. Only mosquito populations were collected for entomological analysis. Consent for publication Not applicable Availability of data and materials Not applicable Competing interests The authors declare that they have no competing interests Funding This study was supported by projet d’innovation n°AAP3 FONRID_SGCI2-collaboratif-02 and CEA/ITECH-MTV, grant ref/letter acceptation CEA/ITECH-MTV du 04/02/2021 à AMARA Miriam Félicité Authors' contributions MN, OG and MFA designed the study, MFA, KWUK and KA contributed to the implementation of the study. MFA, RKY, and KLN performed laboratory and fieldwork. MFA and RKY analysed the data. AMF, NM, and OG interpreted the results and drafted the manuscript, which was critically revised by coauthors. All authors read and approved the final manuscript. Acknowledgement The authors are grateful to the technicians at IRSS/Centre Muraz for their key work especially Mr Ouari Ali. We also thank the District Medical team and local authorities for their participation in the study. Our sincere appreciation to the communities from all selected sentinel sites for the support and cooperation during experiments. References Argy N, Houzé S. Épidémiologie et cycle parasitaire d’un fléau mondial, le paludisme. Actualités Pharmaceutiques. 2018 Mar;57(574):18–20. Kantele A, Jokiranta TS. Review of Cases With the Emerging Fifth Human Malaria Parasite, Plasmodium knowlesi. Clinical Infectious Diseases. 2011 Jun 1;52(11):1356–62. WHO. World Health Organization report [Internet]. 2023 [cited 2025 Feb 18]. Available from: https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2023 USAID. Le paludisme au Burkina Faso: statistiques | Severe Malaria Observatory [Internet]. 2023 [cited 2025 Feb 21]. Available from: https://www.severemalaria.org/fr/burkina-faso Oxborough RM, Chilito KLF, Tokponnon F, Messenger LA. Malaria vector control in sub-Saharan Africa: complex trade-offs to combat the growing threat of insecticide resistance. The Lancet Planetary Health. 2024 Oct 1;8(10):e804–12. Bayoh MN, Mathias DK, Odiere MR, Mutuku FM, Kamau L, Gimnig JE, et al. Anopheles gambiae: historical population decline associated with regional distribution of insecticide-treated bed nets in western Nyanza Province, Kenya. Malar J. 2010 Feb 26;9(1):62. Bhatt S, Weiss DJ, Cameron E, Bisanzio D, Mappin B, Dalrymple U, et al. The effect of malaria control on Plasmodium falciparum in Africa between 2000 and 2015. Nature. 2015 Oct;526(7572):207–11. Abong’o B, Gimnig JE, Torr SJ, Longman B, Omoke D, Muchoki M, et al. Impact of indoor residual spraying with pirimiphos-methyl (Actellic 300CS) on entomological indicators of transmission and malaria case burden in Migori County, western Kenya. Sci Rep. 2020 Mar 11;10(1):4518. McCann RS, Ochomo E, Bayoh MN, Vulule JM, Hamel MJ, Gimnig JE, et al. Reemergence of Anopheles funestus as a Vector of Plasmodium falciparum in Western Kenya after Long-Term Implementation of Insecticide-Treated Bed Nets. Am J Trop Med Hyg. 2014 Apr 2;90(4):597–604. Musiime AK, Smith DL, Kilama M, Rek J, Arinaitwe E, Nankabirwa JI, et al. Impact of vector control interventions on malaria transmission intensity, outdoor vector biting rates and Anopheles mosquito species composition in Tororo, Uganda. Malar J. 2019 Dec 27;18(1):445. Degefa T, Yewhalaw D, Zhou G, Lee M chieh, Atieli H, Githeko AK, et al. Indoor and outdoor malaria vector surveillance in western Kenya: implications for better understanding of residual transmission. Malar J. 2017 Nov 6;16(1):443. Killeen GF, Govella NJ, Lwetoijera DW, Okumu FO. Most outdoor malaria transmission by behaviourally-resistant Anopheles arabiensis is mediated by mosquitoes that have previously been inside houses. Malar J. 2016 Apr 19;15(1):225. Sougoufara S, Ottih EC, Tripet F. The need for new vector control approaches targeting outdoor biting anopheline malaria vector communities. Parasites Vectors. 2020 Jun 10;13(1):295. Ndenga BA, Mulaya NL, Musaki SK, Shiroko JN, Dongus S, Fillinger U. Malaria vectors and their blood-meal sources in an area of high bed net ownership in the western Kenya highlands. Malar J. 2016 Feb 9;15(1):76. Sangaré I, Ouattara CA, Soma DD, Soma D, Assogba BS, Namountougou M, et al. Spatial-temporal pattern of malaria in Burkina Faso from 2013 to 2020. Parasite Epidemiology and Control. 2022 Aug 1;18:e00261. Bationo C, Cissoko M, Katilé A, Sylla B, Ouédraogo A, Ouedraogo JB, et al. Malaria in Burkina Faso: A comprehensive analysis of spatiotemporal distribution of incidence and environmental drivers, and implications for control strategies. PLOS ONE. 2023 Sep 13;18(9):e0290233. Mullen GR, Durden LA. Medical and Veterinary Entomology. Academic Press; 2009. 646 p. Kenea O, Balkew M, Gebre-Michael T. Environmental factors associated with larval habitats of anopheline mosquitoes (Diptera: Culicidae) in irrigation and major drainage areas in the middle course of the Rift Valley, central Ethiopia. J Vector Borne Dis. 2011; Amexo M, Tolhurst R, Barnish G, Bates I. Malaria misdiagnosis: effects on the poor and vulnerable. The Lancet. 2004 Nov 20;364(9448):1896–8. Gardella F, Assi S, Simon F, Bogreau H, Eggelte T, Ba F, et al. Antimalarial drug use in general populations of tropical Africa. Malar J. 2008 Jul 8;7(1):124. Robert V, Macintyre K, Keating J, Trape JF, Duchemin JB, Warren M, et al. malaria transmission in urban sub-saharan africa. Am J Trop Med Hyg. 2003 Feb;68(2):169–76. Trape JF, Pison G, Spiegel A, Enel C, Rogier C. Combating malaria in Africa. Trends in Parasitology. 2002 May 1;18(5):224–30. Gillies MT, De Meillon B. Gillies, M.T. and De Meillon, B. (1968) The Anophelinae of Africa South of the Sahara. Publications of the South African Institute for Medical Research, Johannesburg. - References - Scientific Research Publishing [Internet]. 1968 [cited 2025 Feb 16]. Available from: https://www.scirp.org/reference/referencespapers?referenceid=3151913 Santolamazza F, Mancini E, Simard F, Qi Y, Tu Z, della Torre A. Insertion polymorphisms of SINE200 retrotransposons within speciation islands of Anopheles gambiae molecular forms. Malar J. 2008 Aug 25;7(1):163. Boonma P, Christensen PR, Suwanarusk R, Price RN, Russell B, Lek-Uthai U. Comparison of three molecular methods for the detection and speciation of Plasmodium vivax and Plasmodium falciparum. Malaria Journal. 2007 Sep 15;6(1):124. Kent RJ, Norris de. identification of mammalian blood meals in mosquitoes by a multiplexed polymerase chain reaction targeting cytochrome B. Am J Trop Med Hyg. 2005 Aug;73(2):336–42. Djimde B, F Keit M, Seydou Yaro A, Maiga M, Sodio B. Susceptibilité D’adaptation d’Anopheles Coluzzii Aux Conditions Écologiques De Ponte Et De Développements Larvaires Des Culex Et Aedes. ESJ. 2022 Apr 30;18(14):195. Chahed S, Djouaher T, Brahmi K. Étude sur la faune Culicidienne (Diptera: Culicidae) de la région de Tizi-Ouzou (Nord d Algérie) : Biodiversité, abondance et répartition [Internet]. 2021 [cited 2025 Feb 17]. Available from: https://123dok.net/document/z1dw39mp-%C3%A9tude-culicidienne-diptera-culicidae-alg%C3%A9rie-biodiversit%C3%A9-abondance-r%C3%A9partition.html Fillinger U, Kannady K, William G, Vanek MJ, Dongus S, Nyika D, et al. A tool box for operational mosquito larval control: preliminary results and early lessons from the Urban Malaria Control Programme in Dar es Salaam, Tanzania. Malar J. 2008 Jan 25;7:20. Hamaidia H, Berchi S. Etude systématique et écologique des Moustiques (Diptera: Culicidae) dans la région de Souk-Ahras (Algérie). 2018; Namountougou M, Soma DD, Kientega M, Balboné M, Kaboré DPA, Drabo SF, et al. Insecticide resistance mechanisms in Anopheles gambiae complex populations from Burkina Faso, West Africa. Acta Tropica. 2019 Sep 1;197:105054. Drake JM, Beier JC. Ecological niche and potential distribution of Anopheles arabiensis in Africa in 2050. Malar J. 2014 Jun 3;13(1):213. Tapily A, Sagara I, Machault V, Niare S, Konate S, Diarra M, et al. Variation spatio-temporelle de la population Culicidae et de la transmission du paludisme en milieu urbain du district de Bamako au Mali. International Journal of Biological and Chemical Sciences. 2024 Dec 3;18(4):1522–40. Isaac O. Relative abundance of adult female anopheline mosquitoes in Ugah, Nasarawa State, Nigeria. 2009 Jun 15;Vol. 1 (1):005-008,. Atia MA, Bashir NH, Azrag RS, Hassan MM. Resting behaviors and seasonal variation of Anopheles arabiensis in River Nile State, Sudan. Int J Mosq Res. 2022 Jan 1;9(1):99–104. Lamidi T, Babatunde, Alo E, Babatope, Naphtali R, Lamidi T. distribution and abundance of anopheles mosquito species in three selected areas of taraba state, north-eastern nigeria. Animal Research International. 2017 Apr 1;14:2730–40. Carnevale P, Fouque F, Gay F, Manguin S. Les Leçons du Programme de Lutte Contre les Vecteurs du Paludisme Par Aspersions Intradomiciliaires de DDT ou de Dieldrine dans la Zone Pilote de Bobo-Dioulasso: Échec ou Succès? Med Trop Sante Int. 2021 Mar 6;1(1):mtsibulletin.V9I9.66. Bouafou L. Ecologie des populations selvatiques d’Anopheles gambiae, vecteur du paludisme [Internet] [phdthesis]. Université de Montpellier; 2024 [cited 2025 Feb 16]. Available from: https://hal.science/tel-04607278 Dahoui M. Evaluation de l’impact des mises en valeur agricole sur la transmission du paludisme à Bouaké, Côte d’Ivoire [Internet] [phdthesis]. Université de Montpellier; 2023 [cited 2025 Feb 18]. Available from: https://theses.hal.science/tel-04908551 Dossou-Yovo J, Doannio JMC, Diarrassouba S. Préférences trophiques des vecteurs du paludisme dans la ville de Bouaké et dans les villages environnants de Côte d’Ivoire. 1998; Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 23 Mar, 2026 Reviews received at journal 23 Mar, 2026 Reviewers agreed at journal 23 Mar, 2026 Reviews received at journal 05 Sep, 2025 Reviews received at journal 22 Aug, 2025 Reviewers agreed at journal 12 Aug, 2025 Reviewers agreed at journal 12 Aug, 2025 Reviewers agreed at journal 11 Aug, 2025 Reviewers agreed at journal 09 Aug, 2025 Reviewers invited by journal 09 Aug, 2025 Editor assigned by journal 08 Jul, 2025 Submission checks completed at journal 08 Jul, 2025 First submitted to journal 04 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-7048284\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":499291078,\"identity\":\"344c703d-aebb-4f47-8c8f-3bba2abb9015\",\"order_by\":0,\"name\":\"Miriam Félicité AMARA\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABJUlEQVRIie2PwUoDMRCGEwLTS9y9ptSaV0gJSL3oq1SE7WUXhV4UobYs9KR4k/oYixAfYEEPvoCQi7XQ28IWUVpQMBuvKaw3kXyHyQTm459ByOP5uzAEppboxDb4xXxoUEPBUyRMA4iISoEaUZViHkDAkH3dhDf5olzH3eOg8XQ4KkWXBzx9OHuP97dN2uz12bGRjuTtlWJ7E5pk46lgnQlApNvqyCwGUsaOGN2TaEsxASi5n1PBegB0VzcVMQqFlkPhuv+GvyolLLL00yrhx6CpLjYqQseS2BSWZCn6SQG8VPlGpaPjAWlbpcjGl/aWSLaweqRA3Lfs6P4dLtRQ8OskG61Oh5yn+Wy5VucHYSOdzV3nOyHU1rrjFXj1m2mPx+P573wDVVVWm8wiNqcAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Université Nazi Boni\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Miriam\",\"middleName\":\"Félicité\",\"lastName\":\"AMARA\",\"suffix\":\"\"},{\"id\":499291079,\"identity\":\"1170373b-5612-4a49-9ad4-065f54567cc3\",\"order_by\":1,\"name\":\"Hamadou KONATE\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Université Nazi Boni\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hamadou\",\"middleName\":\"\",\"lastName\":\"KONATE\",\"suffix\":\"\"},{\"id\":499291080,\"identity\":\"0ccc1446-a603-4658-9ad2-07b8d4192855\",\"order_by\":2,\"name\":\"Kouamé Wilfred Ulrich KOUADIO\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Université Nazi Boni\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Kouamé\",\"middleName\":\"Wilfred Ulrich\",\"lastName\":\"KOUADIO\",\"suffix\":\"\"},{\"id\":499291081,\"identity\":\"41cc073f-1c91-432c-a45f-9e349a297022\",\"order_by\":3,\"name\":\"Raymond Karlhis YAO\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Université Nazi Boni\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Raymond\",\"middleName\":\"Karlhis\",\"lastName\":\"YAO\",\"suffix\":\"\"},{\"id\":499291082,\"identity\":\"0ae196ea-9c6e-40d0-9d61-3b8371901998\",\"order_by\":4,\"name\":\"Kelly Lionelle NGAFFO\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Université Nazi Boni\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Kelly\",\"middleName\":\"Lionelle\",\"lastName\":\"NGAFFO\",\"suffix\":\"\"},{\"id\":499291084,\"identity\":\"e5622048-00de-436b-a1ab-16d72c4f8342\",\"order_by\":5,\"name\":\"Abdoulaye DIABATE\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Université Nazi Boni\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Abdoulaye\",\"middleName\":\"\",\"lastName\":\"DIABATE\",\"suffix\":\"\"},{\"id\":499291086,\"identity\":\"9c146d6e-9b9e-42ad-ab5b-bfa59d336076\",\"order_by\":6,\"name\":\"Olivier GNANKINE\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Université Joseph KI-ZERBO\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Olivier\",\"middleName\":\"\",\"lastName\":\"GNANKINE\",\"suffix\":\"\"},{\"id\":499291087,\"identity\":\"0ccde601-0c9a-4cd5-a73b-32f0f4c1c020\",\"order_by\":7,\"name\":\"Moussa NAMOUNTOUGOU\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Université Nazi Boni\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Moussa\",\"middleName\":\"\",\"lastName\":\"NAMOUNTOUGOU\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-07-04 15:53:14\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-7048284/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-7048284/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":89074207,\"identity\":\"ecd4ddc2-f2d6-46d6-8f5a-0f920175eb7d\",\"added_by\":\"auto\",\"created_at\":\"2025-08-14 11:51:20\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":755300,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eStudy Areas located in Bobo-Dioulasso, western Burkina Faso\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.1StudyAreaslocatedinBoboDioulassowesternBurkinaFaso.1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7048284/v1/557ee0821eecb82f419c26f6.png\"},{\"id\":89072910,\"identity\":\"cae621a3-1538-4141-a2c3-72ca31a46449\",\"added_by\":\"auto\",\"created_at\":\"2025-08-14 11:35:20\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":155034,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eDistribution of \\u003cem\\u003eAnopheline\\u003c/em\\u003e Species According to Seasons\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.2DistributionofAnophelineSpeciesAccordingtoSeasons1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7048284/v1/f5adc762a94dfd8de6dbbba4.png\"},{\"id\":89072908,\"identity\":\"51c1cedc-53b7-4893-9b38-138b36b11ad8\",\"added_by\":\"auto\",\"created_at\":\"2025-08-14 11:35:20\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":164729,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCurve Showing the Evolution of anopheles Abundance Inside and Outside Houses Over Time\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.3CurveShowingtheEvolutionofanophelesAbundanceInsideandOutsideHousesOverTime.1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7048284/v1/655e56103573da050fbe9664.png\"},{\"id\":89072621,\"identity\":\"fb20f431-3d58-432c-8f16-90a53838f48c\",\"added_by\":\"auto\",\"created_at\":\"2025-08-14 11:27:19\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":139551,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eDistribution of Different \\u003cem\\u003ePlasmodium\\u003c/em\\u003eSpecies Based on the Environment\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.4DistributionofDifferentPlasmodiumSpeciesBasedontheEnvironment1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7048284/v1/55d1843ec9e2ff192fd22429.png\"},{\"id\":89072623,\"identity\":\"d8d1c5d9-da47-4328-9283-f09959464c88\",\"added_by\":\"auto\",\"created_at\":\"2025-08-14 11:27:20\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":111274,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eClinical data of the different nighborhoods based on the months\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.5Clinicaldataofthedifferentnighborhoodsbasedonthemonths1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7048284/v1/16bdc925011f2f5f680a0c59.png\"},{\"id\":89072627,\"identity\":\"ccca0139-f8dc-44a9-8be3-6035532ea056\",\"added_by\":\"auto\",\"created_at\":\"2025-08-14 11:27:20\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":90814,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCorrelation between \\u003cem\\u003eAnopheles\\u003c/em\\u003e mosquito abundance and malaria incidence\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.6CorrelationbetweenAnophelesmosquitoabundanceandmalariaincidence1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7048284/v1/1b9cd658d99f9d995d2a7a4d.png\"},{\"id\":89073846,\"identity\":\"376f4c8a-573c-4777-a4a5-3363dfb091dc\",\"added_by\":\"auto\",\"created_at\":\"2025-08-14 11:43:20\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":13526,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eDistribution of trophic preferences according to the month and the positioning of the house (far or close)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Fig.7Distributionoftrophicpreferencesaccordingtothemonthandthepositioningofthehousefarorclose1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7048284/v1/66aaf0d217bd3fcf89fc582d.png\"},{\"id\":89075030,\"identity\":\"49c57078-39fb-4ad1-8b7a-d3c309f943de\",\"added_by\":\"auto\",\"created_at\":\"2025-08-14 11:59:21\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2171632,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7048284/v1/df9c5856-b7dc-45b4-8433-ef07fbe6b5d6.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Human population exposure to residual malaria transmission by the main vector, Anopheles s.l. in the city of Bobo-Dioulasso, Burkina Faso\",\"fulltext\":[{\"header\":\"Background\",\"content\":\"\\u003cp\\u003eMalaria is a parasitic disease of global concern, transmitted through the bites of infected female mosquitoes of the genus \\u003cem\\u003eAnopheles\\u003c/em\\u003e. Despite progress in vector control, it remains a major public health threat, particularly in intertropical endemic regions, but also may threat non-endemic areas (\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e). The disease is primarily caused by five species of \\u003cem\\u003ePlasmodium\\u003c/em\\u003e: \\u003cem\\u003eP. falciparum\\u003c/em\\u003e, \\u003cem\\u003eP. vivax\\u003c/em\\u003e, \\u003cem\\u003eP. ovale\\u003c/em\\u003e, \\u003cem\\u003eP. malariae\\u003c/em\\u003e, and \\u003cem\\u003eP. knowlesi\\u003c/em\\u003e, which together are responsible for significant morbidity and mortality worldwide (\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e). According to the latest World Health Organization (WHO) malaria report, an estimated of 263\\u0026nbsp;million malaria cases and 597,000 related deaths occurred globally in 2023, with an increase of closely 11\\u0026nbsp;million cases and a rise in mortality compared to 2022. Approximately 95% of malaria-related deaths occurred in Africa, where access to essential preventive, diagnostic, and therapeutic services remains limited for many at-risk populations (\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e). Burkina Faso remains heavily burdened by malaria. In 2022, it ranked among the ten countries with the highest malaria case counts and fatalities, contributing to 3.2% of global cases and 2.7% of global malaria-related deaths. In 2023, over ten million malaria cases were reported by national health services, accounting for approximately 3.1% of global cases and 2.7% of global deaths (\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e). The country experiences endemic transmission year-round, with prevalence rates ranging from 21–24%. A marked seasonal increase in cases occurs during the rainy season (from May to October), with the transmission peak lasting up to three months in the north, six months in the center, and as long as nine months in the southern regions (\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eThe predominantly endophagic and endophilic behavior of primary malaria vectors has led to widespread implementation of indoor-targeted control measures, such as Long-Lasting Insecticidal Nets (LLINs) and Indoor Residual Spraying (IRS) (\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e). While these interventions have contributed to a reduction in transmission in many areas, they have also induced notable shifts in mosquito species composition and behavior (\\u003cspan additionalcitationids=\\\"CR9\\\" citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e–\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e). In some settings, such interventions have facilitated the emergence or predominance of more exophilic species such as \\u003cem\\u003eAn. arabiensis\\u003c/em\\u003e, and behavioral adaptations in species such as \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e and \\u003cem\\u003eAn. funestus\\u003c/em\\u003e, resulting in increased outdoor biting activity (\\u003cspan additionalcitationids=\\\"CR12\\\" citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e–\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e). Notably, changes in biting behavior have been observed in \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e s.s., including shifts to earlier feeding times and increased zoophilic and mixed blood meal patterns (\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eDespite the widespread deployment of LLINs and IRS, malaria transmission persists in many regions of Burkina Faso, particularly in urban settings (\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e).This persistence is attributed partly to a range of sociodemographic and environmental factors. Rapid and often unplanned urbanization, coupled with poor drainage, stagnant water, and inadequate waste management, creates favorable breeding conditions for malaria vectors (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e). Mosquito larvae develop in a variety of aquatic habitats, both permanent and temporary, including marshes, rivers, puddles, and artificial containers. While \\u003cem\\u003eAnopheles\\u003c/em\\u003e s.s mosquitoes generally prefer clean and unpolluted water, \\u003cem\\u003eAn. arabiensis\\u003c/em\\u003e favors sunlit, open habitats (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e). Urban density further exacerbates transmission risk and is often accompanied by presumptive treatment practices, which can lead to misdiagnoses, inappropriate antimalarial use, and the emergence of drug resistance (\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eMoreover, in urban areas traditionally classified as low-endemic zones (\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e), both children and adults tend to acquire partial immunity more slowly, rendering them more vulnerable to severe malaria than their rural counterparts (\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e). These epidemiological dynamics underscore the need for revised and context-specific approaches to malaria diagnosis, treatment, and vector control in urban environments. A critical step toward this goal is the identification of local environmental factors driving malaria transmission.\\u003c/p\\u003e\\u003cp\\u003eThis study aimed to evaluate ecological determinants influencing human exposure to malaria vector bites in selected urban areas of Bobo-Dioulasso, Burkina Faso. By examining \\u003cem\\u003eAnopheles\\u003c/em\\u003e infection rates, blood meal sources, and clinical malaria incidence, the research seeks to improve the understanding of urban malaria transmission dynamics and contribute to the development of more effective and context-adapted control strategies.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cp\\u003e\\u003cb\\u003eStudy Area\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThis study was conducted in the city of Bobo-Dioulasso, the capital of the Haut-Bassin region. Bobo-Dioulasso is the economic capital of Burkina Faso and is in the southwest of the country; its coordinates are latitude 11°10′37″ North, longitude 4°17′52″ West, and an altitude of 423 meters above sea level. The study was carried out transversally in several neighborhoods, including Sarfalao, Kua, Sabaribougou, Kodeni, Farakan, and Dogona (Fig.\\u0026nbsp;1). These neighborhoods were selected based on the presence of a watercourse, permanent breeding sites, and temporary breeding sites created by human activities. Agriculture and artisanal activities being the main activities in these neighborhoods have resulted in the development of numerous sites in favor for mosquito reproduction. This is due, on one hand, to stagnant irrigation water on cultivated plots, and on the other, to the improper management of waste and materials related to these activities. These neighborhoods are densely populated, thus classified as popular or high-density areas. Therefore, it is important to focus on these areas to determine the impact of the environment on the persistence and transmission of malaria.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eHuman-Bait Capture\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eHuman-bait capture was carried out following the standard WHO protocol (2016). It required eight individuals (collectors) per neighborhood, with two collectors per house. They were divided into two groups: the first group captured mosquitoes from 6 p.m to 1 a.m, and the second group from 1 a.m to 9 a.m. The individuals themselves served as bait to attract mosquitoes. Seated on a chair and equipped with a flashlight, they captured mosquitoes that landed on their bare legs using hemolysis tubes, without waiting for the mosquitoes to become engorged. To reduce biases related to differences in attractiveness to mosquitoes among individuals, the collectors rotated between indoor and outdoor locations every hour. The supervision was conducted by a technician from IRSS/MURAZ and a local agent. The captured mosquitoes were identified based on their genus and species (for \\u003cem\\u003eAnopheles\\u003c/em\\u003e) using taxonomic identification keys and were preserved on silica gel.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eResidual Fauna Capture\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eResidual fauna capture was conducted according to the WHO protocol (2014) and involved collecting mosquitoes randomly in houses for this study. The collection was performed in bedrooms between 6 a.m and 8 a.m using a pyrethroid-type insecticide (Kaltox), which kills or immobilizes mosquitoes. Before spraying, houses were cleared of all food and pets. White sheets were then spread across the entire floor of each room. Finally, all openings (windows, doors, and holes) were carefully sealed to prevent mosquitoes inside from escaping and those outside from entering, during or after spraying. Once these preparations were made, the insecticide was sprayed toward the roof in a clockwise direction, continuing until the entire house was covered with the product. The opening hours remained closed for 10 to 15 minutes. After the allocated time, the sheets were carefully removed and taken outside. Dead or stunned mosquitoes were sorted from other insects and placed into labeled petri dishes (with date, house number, and neighborhood) to be transported to the laboratory of IRSS/Centre MURAZ and preserved at -20°C.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eMolecular Identification\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe captured mosquitoes were first identified at the genus level using a binocular magnifying glass (AmScope; United Scope LLC) and based on the morphological identification key described by Gillies et De Meillon (\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e) for anophelines. Subsequently, these species were differentiated through allele-specific PCR amplification following the protocol of Santolamazza et \\u003cem\\u003eal\\u003c/em\\u003e., (\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e). This protocol utilizes the insertion polymorphisms of SINE200 retrotransposable elements to examine the genetic differentiation between \\u003cem\\u003eAn. gambiae and An. coluzzii\\u003c/em\\u003e species, the primary malaria vector in Africa. The primers used were as follows: S200X 6.1F: TCG-CCT-TAG-ACC-TTG-CGT-TA and S200X 6.1R: CGC-TTC-AAG-AAT-TCG-AGA-TAC. For amplification, 18 µL of PCR reaction mix (5x FIREPol® Master Mix Ready to Load with 7.5 mM MgCl2) were added to 2 µL of extracted genomic DNA. The PCR began with an initial Taq polymerase activation at 94°C for 10 minutes, followed by 35 cycles consisting of Denaturation at 94°C for 30 seconds, Primer annealing at 54°C for 30 seconds and Extension at 72°C for 1 minute. A final extension step was carried out at 72°C for 10 minutes to ensure complete synthesis of DNA strands.\\u003c/p\\u003e\\u003cp\\u003eThe amplified products were separated on a 2% agarose gel stained with ethidium bromide. The PCR product sizes were estimated using a molecular weight marker of 100 base pairs (bp). After migration for 30 to 45 minutes, the DNA bands were visualized under ultraviolet light. The expected band sizes were as follows: 479 bp for \\u003cem\\u003eAn. coluzzii\\u003c/em\\u003e, 249 bp for \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e s.s and 223 bp for \\u003cem\\u003eAn. Arabiensis.\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eMolecular analysis\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe \\u003cem\\u003eAnopheles\\u003c/em\\u003e samples were subjected to DNA extraction following the 2% CTAB protocol established by Myriam and Cécile (2003). Each specimen was ground in 200 µL of 2% CTAB solution using a tissue homogenizer, promoting the lysis of cell membranes. The homogenates were then incubated in a water bath at 65°C for 10 minutes to inactivate thermolabile enzymes, followed by a step to separate the DNA from cellular debris using 200 µL of chloroform. The isolated DNA was precipitated with 200 µL of isopropanol, purified with 200 µL of 70% ethanol, and suspended in pure water for 24 hours. The purified DNA was subsequently used for various PCR analyses.\\u003c/p\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003ePrimers used for identification of plasmodium species\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"4\\\"\\u003e\\u003c/colgroup\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eSpecies\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003ePrimers\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eSequence 5′–3′\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eReferences\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eUniversal primer\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eFal F\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGTATCTGATCGTCTTCACTCCC\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\" morerows=\\\"3\\\" rowspan=\\\"4\\\"\\u003e\\u003cp\\u003e(\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eP. falciparum\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eFal R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eAACAGACGGGTAGTCATGATTGAG\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eP. ovale\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eFal R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCTGTTCTTTGCATTCCTTATGC\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eP. malariae\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eFal R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCGTTAAGATAAACGCCAAGC\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003cp\\u003eThe amplification begun with an incubation at 95°C for 5 minutes, followed by cycles that include denaturation at 95°C for 30 seconds, primer annealing at 58°C for 45 seconds, and DNA strand elongation at 72°C for 1 minute. This cycle was repeated 35 times. Finally, a final elongation step was performed at 72°C for 5 minutes to complete the process. The PCR products obtained were separated on a 2% agarose gel stained with ethidium bromide. The size of the PCR products was estimated using a 100 bp molecular weight marker. The expected band sizes are as follows: 276 bp for \\u003cem\\u003eP. falciparum\\u003c/em\\u003e, 376 bp for \\u003cem\\u003eP. ovale\\u003c/em\\u003e, 411 bp for \\u003cem\\u003eP. malariae.\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eOrigin of the Blood Meal\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe origin of the blood meal in engorged and semi-gravid \\u003cem\\u003eAnopheles\\u003c/em\\u003e mosquitoes was determined using the protocol described by Kent and Norris (2005). This protocol was modified and divided into two multiplex PCRs (PCR1 and PCR2) based on the use of specific primers to identify the blood meals of \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e s.l., such as (Table \\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e and Table \\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e):\\u003c/p\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003ePrimers used for identification trophic preference in \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e s.l., (PCR 1)\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"4\\\"\\u003e\\u003c/colgroup\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eSpecies\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003ePrimers\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eSequence 5′–3′\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eReferences\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eUniversal primer\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eFal F\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGGTTGTCCTCCAATTCATGTTA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\" morerows=\\\"4\\\" rowspan=\\\"5\\\"\\u003e\\u003cp\\u003e(\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003esheep\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eFal R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCTATCCTACTAATCCTCATCCTCATG\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003edonkey\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eFal R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCTGGTAATCGTCCATCTAC\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eChicken\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eFal R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eACACACCCTAGTAGAGTGAGG\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eGoat\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eFal R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCCTAATCTTAGTACTTGTACCCTTCCTC\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003ePrimers used for identification trophic preference in \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e s.l., (PCR 2)\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"4\\\"\\u003e\\u003c/colgroup\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eSpecies\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003ePrimers\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eSequence 5′–3′\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eReferences\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eUniversal primer\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eFal F\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGGTTGTCCTCCAATTCATGTTA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\" morerows=\\\"4\\\" rowspan=\\\"5\\\"\\u003e\\u003cp\\u003e(\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003epig\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eFal R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCCTCGCAGCCGTACATCTC\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eHuman\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eFal R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGGCTTACTTCTCTTCATTCTCTCCT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eDog\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eFal R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGGAATTGTACTATTATTCGCAACCAT\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eBeef\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eFal R\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eCATCGGCACAAATTTAGTCG\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003cp\\u003eThe amplification started with an incubation at 95°C for 3 minutes and 30 seconds, followed by 40 successive cycles comprising: denaturation at 95°C for 30 seconds, primer annealing at 60°C for 50 seconds, and DNA strand elongation at 72°C for 40 seconds. Finally, a final incubation step at 72°C for 5 minutes completes the amplification. The resulting PCR products were separated on a 2% agarose gel stained with ethidium bromide. A 100 bp molecular weight marker was used to estimate the sizes. The expected PCR product sizes are as follows: 340 bp (sheep), 150 bp (goat), 290 bp (chicken), 460 bp (donkey), 500 bp (pig), 350 bp (human), 750 bp (dog), 600 bp (beef).\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eCollection of Clinical Data\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe clinical data based on malaria infected cases were collected from the monthly records of the various Health Centers “Centre de Santé et de Promotion Sociale (CSPS)” in the six neighborhoods through the head nurses of these health centers. This was made possible by authorization granted by the Direction Régionale de la Santé (DRS) and the head nurses of the Dafra and Do health districts.\\u003c/p\\u003e\\u003ch2\\u003eData Analysis\\u003c/h2\\u003e\\u003cp\\u003eThe data were analyzed using RSTUDIO software version 4.4.2. The relationships between the mean abundance and the number of positive cases were assessed using Pearson's correlation coefficient. Subsequently, ANOVA or Kruskal-Wallis tests were performed, depending on whether the distribution followed the normal distribution or not, with a significance level set at 0.05. P-values below 0.05 were considered significant in the analysis.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cb\\u003eDensity of Residual Fauna Capture\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eOverall, the analysis of the resting mosquito fauna revealed a predominance of \\u003cem\\u003eCulex\\u003c/em\\u003e spp. with a total number of 10,203 corresponding to 72.63%. Also, an effectif of 3,186 of \\u003cem\\u003eAnopheles\\u003c/em\\u003e spp. individuals was collected prevailing to a rate of 22.68% followed by \\u003cem\\u003eAedes\\u003c/em\\u003e. with a total number of 658 individuals corresponding to 4.68%.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eDensity of\\u003c/b\\u003e \\u003cb\\u003eAnopheles\\u003c/b\\u003e \\u003cb\\u003especies\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe analysis of species distribution collected by humain-bait and residual fauna capture reveals that \\u003cem\\u003eAn. arabiensis\\u003c/em\\u003e is the predominant species across most sampling sites, regardless of proximity to water bodies both proximal (close) and distal (far). However, notable spatial variations were observed in certain localities. For instance, in Farakan, \\u003cem\\u003eAn. arabiensis\\u003c/em\\u003e accounted for 97% of specimens in distal areas, compared to 88% in proximal areas. A similar pattern was observed in Kua, where its prevalence was higher in distal sites (96%) than in proximal ones (84%). Conversely, greater species diversity was recorded in certain proximal areas. In Kodeni-close, for example, \\u003cem\\u003eAn. coluzzii\\u003c/em\\u003e and \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e s.s. were more frequently encountered, representing 4% and 10% of the \\u003cem\\u003eAnopheles\\u003c/em\\u003e population, respectively, whereas in Kodeni-far, only \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e s.s. was present, at 10%. These differences may reflect microhabitat variations or ecological preferences influencing species distribution between proximal and distal zones.\\u003c/p\\u003e\\u003cp\\u003eIn other localities, such as Sabaribougou and Sarfalao, the differences between proximal and distal areas were less pronounced for \\u003cem\\u003eAn. arabiensis\\u003c/em\\u003e, suggesting a relatively homogeneous distribution of this species across spatial gradients. Notably, in Sarfalao-far, \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e s.s. reached a higher proportion (13%) compared to only 3% in Sarfalao-close, indicating potential site-specific environmental factors favoring this species in distal zones. Additionally, \\u003cem\\u003eAn. coluzzii\\u003c/em\\u003e showed a relatively elevated presence in Kua-close (7%), potentially suggesting a preference for habitats closer to human settlements (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab4\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 4\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eDensity of \\u003cem\\u003eAnopheles\\u003c/em\\u003e species\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"5\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eSites\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eAn. arabiensis\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003en (%)\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eAn. coluzzii\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003en (%)\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eAn. gambiae\\u003c/em\\u003e\\u003c/p\\u003e\\u003cp\\u003en (%)\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003eTotal n (%)\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eDogona-far\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e68 (11.93)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e02 (\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e03 (08.57)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e73 (11.64)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eDogona-close\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e63 (11.05)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e03 (\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e03 (08.57)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e69 (\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eFarakan-far\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e29 (05.09)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eND\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e01 (02.86)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e30 (04.80)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eFarakan-close\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e23 (04.03)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e01 (05)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e02 (05.71)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e26 (04.14)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eKodeni-far\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e56 (09.82)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eND\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e05 (14.28)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e61 (09.73)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eKodeni-close\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e43 (07.54)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e02 (\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e06 (17.14)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e51 (08.13)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eSabaribougou-far\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e51 (08.95)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eND\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e02 (05.71)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e53 (08.45)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eSabaribougou-close\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e37 (06.50)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e03 (\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e01 (02.86)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e41 (06.54)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eKua-far\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e51 (08.95)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e02 (\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eND\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e53 (08.45)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eKua-close\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e49 (08.60)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e04 (\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e06 (17.14)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e59 (09.41)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eSarfalao-far\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e40 07.02)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e01 (05)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e06 (17.14)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e47 (07.50)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eSarfalao-close\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e60 (10.53)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e02 (\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e02 (05.71)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e64 (10.21)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eTotal\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e570 (90.91)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e20 (03.19)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e37 (05.90)\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e627 (100)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003ctfoot\\u003e\\u003ctr\\u003e\\u003ctd colspan=\\\"5\\\"\\u003e\\u003cem\\u003eND: No determined\\u003c/em\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tfoot\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eSeasonal Density of anopheline Species\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eOverall, the analysis shows that \\u003cem\\u003eAn. arabiensis\\u003c/em\\u003e is the most widely distributed species during both the rainy season and the dry season. On the other hand, \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e s.s. is less predominant during the dry season, while \\u003cem\\u003eAn. coluzzii\\u003c/em\\u003e stands out as the least abundant species during the rainy season (Fig.\\u0026nbsp;2). This density does not show a significant difference (P\\u0026thinsp;=\\u0026thinsp;0.38).\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eResting Behavior of Vectors\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe curve below illustrates the evolution of Anopheles abundance inside and outside houses over time. Globally, a gradual increase in the number of Anopheles was observed from 6 p.m to 5 a.m, with a peak from 10 p.m to 11 p.m indoors and from midnight to 1 a.m outdoors, followed by a decrease until their complete disappearance between 5 a.m and 9 a,m, both indoors and outdoors (Fig.\\u0026nbsp;3).\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eInfection Rate\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe analysis of Fig.\\u0026nbsp;4 below shows the distribution of infection rates based on the position of the species relative to the houses. Outside, a widespread distribution of infections by \\u003cem\\u003eP. falciparum\\u003c/em\\u003e was observed, along with the presence of dual infection by \\u003cem\\u003eP. falciparum\\u003c/em\\u003e and \\u003cem\\u003eP. malariae\\u003c/em\\u003e. This dual infection was absent indoors. These observations are consistent regardless of whether the houses are close to or far from the riverbanks.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eClinical Data\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe clinical data revealed that, across all neighborhoods, the month of September records the highest number of positive malaria cases (Fig.\\u0026nbsp;5). The number of tests conducted, and positive cases increases month by month in all neighborhoods. The proportion of positive cases relative to the number of tests remains significant in every neighborhood. Kua and Sabaribougou stand out with a higher number of tests conducted and positive cases, especially in August and September. For instance, in August, Kua conducted 2,869 tests resulting in 2,177 positive cases, and in September, approximately 4,000 tests with 2,500 positive cases. Similarly, in Sabaribougou, August recorded 1,551 positive cases out of 3,410 tests, and September showed 2,700 positive cases out of 5,000 tests. In contrast, Dogona and Kodeni experienced more moderate growth in positive cases.\\u003c/p\\u003e\\u003cp\\u003eThe analysis of the results shows a positive relationship between the two events: in other words, the more abundant the Anopheles mosquitoes, the higher the number of positive malaria cases (Fig.\\u0026nbsp;6). This observation is supported by the correction test, which shows a positive sign (rho\\u0026thinsp;=\\u0026thinsp;0.12). In other words, a greater abundance of these vectors was correlated with an increase in the transmission of the parasite responsible for the disease.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003eTrophic Preferences of Vectors\\u003c/b\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe results below highlighted the trophic preferences of species according to the months and the location of houses (Fig.\\u0026nbsp;7). Mosquitoes with mixed blood meals dominate over several periods, particularly in April, July, and September, in houses close to the shores. During this same period, the proportion of zoophilic mosquitoes reached its peak. Androphilic mosquitoes were present but in smaller quantities compared to other groups, although their presence remains relatively stable throughout the months.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThis study aimed to assess the environmental and ecological factors influencing human exposure to malaria vectors in selected urban areas of Bobo-Dioulasso. Among these factors, variations in mosquito density, species composition, infection rates, and blood-feeding preferences remain very important. Here, the analysis of the resting mosquito fauna revealed a predominance of \\u003cem\\u003eCulex\\u003c/em\\u003e spp. (72.63%), followed by \\u003cem\\u003eAnopheles\\u003c/em\\u003e spp. (22.68%) and \\u003cem\\u003eAedes\\u003c/em\\u003e spp. (4.68%). The dominance of \\u003cem\\u003eCulex\\u003c/em\\u003e is likely attributable to its high ecological plasticity and its capacity to breed in a wide range of habitats, particularly polluted and stagnant water bodies frequently encountered in urban environments. Urbanization, climate variability, agricultural runoff, and inefficient waste management create optimal conditions for their proliferation (\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e). These observations are consistent with those reported by Chahed et al in Algeria and by Fillinger et al (\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e) in Dar es Salaam, though they contrast with findings from Hamaidia and Berchi in Souk-Ahras, Algeria, and Namountougou et al (\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e) in Burkina Faso, where \\u003cem\\u003eAnopheles\\u003c/em\\u003e spp. were more prevalent.\\u003c/p\\u003e\\u003cp\\u003eMolecular analyses of the \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e sensu lato (s.l.) complex revealed the presence of three sibling species: \\u003cem\\u003eAn. arabiensis\\u003c/em\\u003e (90.91%), \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e s.s. (5.90%), and \\u003cem\\u003eAn. coluzzii\\u003c/em\\u003e (3.19%). The predominance of \\u003cem\\u003eAn. arabiensis\\u003c/em\\u003e is likely due to its exceptional adaptability, including its tolerance to arid conditions and its ability to reproduce in urban and even polluted environments (\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e). These findings align with recent works done by (\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e), who also reported high frequencies of \\u003cem\\u003eAn. arabiensis\\u003c/em\\u003e in urban areas of Bamako, Mali.\\u003c/p\\u003e\\u003cp\\u003eTemporal variations in female \\u003cem\\u003eAnopheles\\u003c/em\\u003e abundance revealed that exophilic behavior was more pronounced between 12 a.m. and 5 a.m., whereas endophilic activity peaked between 7 p.m. and 1 a.m. This suggests a behavioral adaptation to ambient temperature and host availability, with mosquitoes preferring cooler outdoor environments during the early morning hours. Similar trends were observed in Uganda (\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e) and Sudan, where \\u003cem\\u003eAn. arabiensis\\u003c/em\\u003e exhibited flexible resting behavior depending on seasonal conditions (\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e). From 6 a.m. to 9 a.m., mosquito abundance declined significantly, likely due to the cessation of host-seeking activity and a shift toward resting behavior, a pattern corroborated by studies from Nigeria (\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eNotably, exophilic \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e s.l. populations exhibited higher \\u003cem\\u003ePlasmodium\\u003c/em\\u003e infection rates compared to their endophilic counterparts, regardless of proximity to riverbanks. This elevated infection rate may result from increased host diversity and accessibility outdoors, where vector control tools such as LLINs and IRS are ineffective. Indoors, the presence of insecticides limits mosquito feeding success, whereas exophilic mosquitoes benefit from unrestricted access to blood meals, increasing their likelihood of acquiring and transmitting \\u003cem\\u003ePlasmodium\\u003c/em\\u003e spp. This observation is consistent with findings from Burkina Faso, where IRS with DDT significantly reduced indoor biting rates but led to a fivefold increase in exophagic behavior due to the excito-repellent properties of the insecticide (\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eClinical surveillance data revealed malaria cases across all sampled neighborhoods, aligning with the confirmed presence of \\u003cem\\u003ePlasmodium falciparum\\u003c/em\\u003e and \\u003cem\\u003eP. malariae\\u003c/em\\u003e in mosquito vectors. A positive correlation (ρ\\u0026thinsp;=\\u0026thinsp;0.11595) was observed between infection rates and vector density, supporting WHO\\u0026rsquo;s findings on vector\\u0026ndash;pathogen\\u0026ndash;host interactions (\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eBlood meal analysis indicated a dominant mixed feeding preference in \\u003cem\\u003eAnopheles\\u003c/em\\u003e mosquitoes, particularly in April, July, and September, in areas adjacent to riverbanks. This mixed trophic behavior may reflect host availability, including the presence of humans, livestock, and domestic animals, as well as mosquito adaptability. The proximity of animal reservoirs to human dwellings increases the likelihood of opportunistic feeding (\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e). Species such as \\u003cem\\u003eAn. arabiensis\\u003c/em\\u003e and \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e are known to modulate their host preferences according to environmental and seasonal cues (\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e), and insecticide resistance may further influence host-seeking behavior (\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eInterestingly, the peak in zoophilic behavior overlapped with the period of heightened mixed feeding, notably in August, likely due to the increased availability of animal hosts. The pronounced seasonal variation in trophic behavior and the concurrent increase in zoophilic and endophilic mosquito densities during April, August, and September suggest these months represent critical periods for malaria transmission risk. As such, targeted vector control efforts and more granular ecological assessments during these months may enhance the effectiveness of malaria prevention strategies.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eThis study identified three genera of culicid mosquitoes within the study area: \\u003cem\\u003eAnopheles\\u003c/em\\u003e, \\u003cem\\u003eCulex\\u003c/em\\u003e, and \\u003cem\\u003eAedes\\u003c/em\\u003e. Within the \\u003cem\\u003eAnopheles\\u003c/em\\u003e genus, three sibling species were detected \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e s.l., \\u003cem\\u003eAn. coluzzii\\u003c/em\\u003e, and \\u003cem\\u003eAn. Arabiensis\\u003c/em\\u003e considered as the predominant species. These mosquitoes exhibited both endophilic and exophilic behaviors and demonstrated a broad host range, feeding on humans as well as domestic animals including cattle, goats, and poultry. Blood meal analysis confirmed a mixed trophic preference, though a high degree of anthropophily was consistently observed. This strong human-biting behavior significantly elevates the risk of vector-borne disease transmission, particularly malaria, among the inhabitants of Bobo-Dioulasso. The entomological findings reported here are consistent with the elevated number of malaria cases recorded across the various primary healthcare centers (CSPS) in the region. These results underscore the urgent need for targeted and context-specific vector control strategies to reduce human\\u0026ndash;vector contact and mitigate the burden of malaria in urban and peri-urban settings.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cdiv class=\\\"DefinitionList\\\"\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003es.l.\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003esensu lato\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003es.s.\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003esensu stricto\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003ePCR\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003ePolymerase Chain Reaction\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eWHO\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eWorld Health Organization\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eLLINs\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eLong-Lasting Insecticidal Nets\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eIRS\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eIndoor Residual Spraying\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eIRSS\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eInstitut de Recherche en Sciences de la Sant\\u0026eacute;\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eDNA\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eDesoxyribonucleic acid\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCTAB\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eCetyltrimethylamonium bromide\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCSPS\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eCentre de Sant\\u0026eacute; et de Promotion Sociale\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eDRS\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eDirection r\\u0026eacute;gionale de la sant\\u0026eacute;\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study was approved by the Ethical Research Committee of the Institut de Recherche en Sciences de la Sant\\u0026eacute; (IRSS) under reference number 008-2022/CEIRES, dated 20 January 2022. In accordance with national and institutional guidelines, informed consent was not required, as the study did not involve human participants or the collection of any personal or identifiable information. Only mosquito populations were collected for entomological analysis.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study was supported by projet d\\u0026rsquo;innovation n\\u0026deg;AAP3 FONRID_SGCI2-collaboratif-02 and CEA/ITECH-MTV, grant ref/letter acceptation CEA/ITECH-MTV du 04/02/2021 \\u0026agrave; AMARA\\u0026nbsp;Miriam\\u0026nbsp;F\\u0026eacute;licit\\u0026eacute;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors\\u0026apos; contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eMN, OG and MFA designed the study, MFA, KWUK and KA contributed to the implementation of the study. MFA, RKY, and KLN performed laboratory and fieldwork. MFA and RKY analysed the data. AMF, NM, and OG interpreted the results and drafted the manuscript, which was critically revised by coauthors. All authors read and approved the final manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors are grateful to the technicians at IRSS/Centre Muraz for their key work especially Mr Ouari Ali. We also thank the District Medical team and local authorities for their participation in the study. Our sincere appreciation to the communities from all selected sentinel sites for the support and cooperation during experiments.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eArgy N, Houz\\u0026eacute; S. \\u0026Eacute;pid\\u0026eacute;miologie et cycle parasitaire d\\u0026rsquo;un fl\\u0026eacute;au mondial, le paludisme. Actualit\\u0026eacute;s Pharmaceutiques. 2018 Mar;57(574):18\\u0026ndash;20. \\u003c/li\\u003e\\n\\u003cli\\u003eKantele A, Jokiranta TS. Review of Cases With the Emerging Fifth Human Malaria Parasite, Plasmodium knowlesi. Clinical Infectious Diseases. 2011 Jun 1;52(11):1356\\u0026ndash;62. \\u003c/li\\u003e\\n\\u003cli\\u003eWHO. World Health Organization report [Internet]. 2023 [cited 2025 Feb 18]. Available from: https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2023\\u003c/li\\u003e\\n\\u003cli\\u003eUSAID. Le paludisme au Burkina Faso: statistiques | Severe Malaria Observatory [Internet]. 2023 [cited 2025 Feb 21]. Available from: https://www.severemalaria.org/fr/burkina-faso\\u003c/li\\u003e\\n\\u003cli\\u003eOxborough RM, Chilito KLF, Tokponnon F, Messenger LA. Malaria vector control in sub-Saharan Africa: complex trade-offs to combat the growing threat of insecticide resistance. The Lancet Planetary Health. 2024 Oct 1;8(10):e804\\u0026ndash;12. \\u003c/li\\u003e\\n\\u003cli\\u003eBayoh MN, Mathias DK, Odiere MR, Mutuku FM, Kamau L, Gimnig JE, et al. Anopheles gambiae: historical population decline associated with regional distribution of insecticide-treated bed nets in western Nyanza Province, Kenya. Malar J. 2010 Feb 26;9(1):62. \\u003c/li\\u003e\\n\\u003cli\\u003eBhatt S, Weiss DJ, Cameron E, Bisanzio D, Mappin B, Dalrymple U, et al. The effect of malaria control on Plasmodium falciparum in Africa between 2000 and 2015. Nature. 2015 Oct;526(7572):207\\u0026ndash;11. \\u003c/li\\u003e\\n\\u003cli\\u003eAbong\\u0026rsquo;o B, Gimnig JE, Torr SJ, Longman B, Omoke D, Muchoki M, et al. Impact of indoor residual spraying with pirimiphos-methyl (Actellic 300CS) on entomological indicators of transmission and malaria case burden in Migori County, western Kenya. Sci Rep. 2020 Mar 11;10(1):4518. \\u003c/li\\u003e\\n\\u003cli\\u003eMcCann RS, Ochomo E, Bayoh MN, Vulule JM, Hamel MJ, Gimnig JE, et al. Reemergence of Anopheles funestus as a Vector of Plasmodium falciparum in Western Kenya after Long-Term Implementation of Insecticide-Treated Bed Nets. Am J Trop Med Hyg. 2014 Apr 2;90(4):597\\u0026ndash;604. \\u003c/li\\u003e\\n\\u003cli\\u003eMusiime AK, Smith DL, Kilama M, Rek J, Arinaitwe E, Nankabirwa JI, et al. Impact of vector control interventions on malaria transmission intensity, outdoor vector biting rates and Anopheles mosquito species composition in Tororo, Uganda. Malar J. 2019 Dec 27;18(1):445. \\u003c/li\\u003e\\n\\u003cli\\u003eDegefa T, Yewhalaw D, Zhou G, Lee M chieh, Atieli H, Githeko AK, et al. Indoor and outdoor malaria vector surveillance in western Kenya: implications for better understanding of residual transmission. Malar J. 2017 Nov 6;16(1):443. \\u003c/li\\u003e\\n\\u003cli\\u003eKilleen GF, Govella NJ, Lwetoijera DW, Okumu FO. Most outdoor malaria transmission by behaviourally-resistant Anopheles arabiensis is mediated by mosquitoes that have previously been inside houses. Malar J. 2016 Apr 19;15(1):225. \\u003c/li\\u003e\\n\\u003cli\\u003eSougoufara S, Ottih EC, Tripet F. The need for new vector control approaches targeting outdoor biting anopheline malaria vector communities. Parasites Vectors. 2020 Jun 10;13(1):295. \\u003c/li\\u003e\\n\\u003cli\\u003eNdenga BA, Mulaya NL, Musaki SK, Shiroko JN, Dongus S, Fillinger U. Malaria vectors and their blood-meal sources in an area of high bed net ownership in the western Kenya highlands. Malar J. 2016 Feb 9;15(1):76. \\u003c/li\\u003e\\n\\u003cli\\u003eSangar\\u0026eacute; I, Ouattara CA, Soma DD, Soma D, Assogba BS, Namountougou M, et al. Spatial-temporal pattern of malaria in Burkina Faso from 2013 to 2020. Parasite Epidemiology and Control. 2022 Aug 1;18:e00261. \\u003c/li\\u003e\\n\\u003cli\\u003eBationo C, Cissoko M, Katil\\u0026eacute; A, Sylla B, Ou\\u0026eacute;draogo A, Ouedraogo JB, et al. Malaria in Burkina Faso: A comprehensive analysis of spatiotemporal distribution of incidence and environmental drivers, and implications for control strategies. PLOS ONE. 2023 Sep 13;18(9):e0290233. \\u003c/li\\u003e\\n\\u003cli\\u003eMullen GR, Durden LA. Medical and Veterinary Entomology. Academic Press; 2009. 646 p. \\u003c/li\\u003e\\n\\u003cli\\u003eKenea O, Balkew M, Gebre-Michael T. Environmental factors associated with larval habitats of anopheline mosquitoes (Diptera: Culicidae) in irrigation and major drainage areas in the middle course of the Rift Valley, central Ethiopia. J Vector Borne Dis. 2011; \\u003c/li\\u003e\\n\\u003cli\\u003eAmexo M, Tolhurst R, Barnish G, Bates I. Malaria misdiagnosis: effects on the poor and vulnerable. The Lancet. 2004 Nov 20;364(9448):1896\\u0026ndash;8. \\u003c/li\\u003e\\n\\u003cli\\u003eGardella F, Assi S, Simon F, Bogreau H, Eggelte T, Ba F, et al. Antimalarial drug use in general populations of tropical Africa. Malar J. 2008 Jul 8;7(1):124. \\u003c/li\\u003e\\n\\u003cli\\u003eRobert V, Macintyre K, Keating J, Trape JF, Duchemin JB, Warren M, et al. malaria transmission in urban sub-saharan africa. Am J Trop Med Hyg. 2003 Feb;68(2):169\\u0026ndash;76. \\u003c/li\\u003e\\n\\u003cli\\u003eTrape JF, Pison G, Spiegel A, Enel C, Rogier C. Combating malaria in Africa. Trends in Parasitology. 2002 May 1;18(5):224\\u0026ndash;30. \\u003c/li\\u003e\\n\\u003cli\\u003eGillies MT, De Meillon B. Gillies, M.T. and De Meillon, B. (1968) The Anophelinae of Africa South of the Sahara. Publications of the South African Institute for Medical Research, Johannesburg. - References - Scientific Research Publishing [Internet]. 1968 [cited 2025 Feb 16]. Available from: https://www.scirp.org/reference/referencespapers?referenceid=3151913\\u003c/li\\u003e\\n\\u003cli\\u003eSantolamazza F, Mancini E, Simard F, Qi Y, Tu Z, della Torre A. Insertion polymorphisms of SINE200 retrotransposons within speciation islands of Anopheles gambiae molecular forms. Malar J. 2008 Aug 25;7(1):163. \\u003c/li\\u003e\\n\\u003cli\\u003eBoonma P, Christensen PR, Suwanarusk R, Price RN, Russell B, Lek-Uthai U. Comparison of three molecular methods for the detection and speciation of Plasmodium vivax and Plasmodium falciparum. Malaria Journal. 2007 Sep 15;6(1):124. \\u003c/li\\u003e\\n\\u003cli\\u003eKent RJ, Norris de. identification of mammalian blood meals in mosquitoes by a multiplexed polymerase chain reaction targeting cytochrome B. Am J Trop Med Hyg. 2005 Aug;73(2):336\\u0026ndash;42. \\u003c/li\\u003e\\n\\u003cli\\u003eDjimde B, F Keit M, Seydou Yaro A, Maiga M, Sodio B. Susceptibilit\\u0026eacute; D\\u0026rsquo;adaptation d\\u0026rsquo;Anopheles Coluzzii Aux Conditions \\u0026Eacute;cologiques De Ponte Et De D\\u0026eacute;veloppements Larvaires Des Culex Et Aedes. ESJ. 2022 Apr 30;18(14):195. \\u003c/li\\u003e\\n\\u003cli\\u003eChahed S, Djouaher T, Brahmi K. \\u0026Eacute;tude sur la faune Culicidienne (Diptera: Culicidae) de la r\\u0026eacute;gion de Tizi-Ouzou (Nord d Alg\\u0026eacute;rie) : Biodiversit\\u0026eacute;, abondance et r\\u0026eacute;partition [Internet]. 2021 [cited 2025 Feb 17]. Available from: https://123dok.net/document/z1dw39mp-%C3%A9tude-culicidienne-diptera-culicidae-alg%C3%A9rie-biodiversit%C3%A9-abondance-r%C3%A9partition.html\\u003c/li\\u003e\\n\\u003cli\\u003eFillinger U, Kannady K, William G, Vanek MJ, Dongus S, Nyika D, et al. A tool box for operational mosquito larval control: preliminary results and early lessons from the Urban Malaria Control Programme in Dar es Salaam, Tanzania. Malar J. 2008 Jan 25;7:20. \\u003c/li\\u003e\\n\\u003cli\\u003eHamaidia H, Berchi S. Etude syst\\u0026eacute;matique et \\u0026eacute;cologique des Moustiques (Diptera: Culicidae) dans la r\\u0026eacute;gion de Souk-Ahras (Alg\\u0026eacute;rie). 2018; \\u003c/li\\u003e\\n\\u003cli\\u003eNamountougou M, Soma DD, Kientega M, Balbon\\u0026eacute; M, Kabor\\u0026eacute; DPA, Drabo SF, et al. Insecticide resistance mechanisms in Anopheles gambiae complex populations from Burkina Faso, West Africa. Acta Tropica. 2019 Sep 1;197:105054. \\u003c/li\\u003e\\n\\u003cli\\u003eDrake JM, Beier JC. Ecological niche and potential distribution of Anopheles arabiensis in Africa in 2050. Malar J. 2014 Jun 3;13(1):213. \\u003c/li\\u003e\\n\\u003cli\\u003eTapily A, Sagara I, Machault V, Niare S, Konate S, Diarra M, et al. Variation spatio-temporelle de la population Culicidae et de la transmission du paludisme en milieu urbain du district de Bamako au Mali. International Journal of Biological and Chemical Sciences. 2024 Dec 3;18(4):1522\\u0026ndash;40. \\u003c/li\\u003e\\n\\u003cli\\u003eIsaac O. Relative abundance of adult female anopheline mosquitoes in Ugah, Nasarawa State, Nigeria. 2009 Jun 15;Vol. 1 (1):005-008,. \\u003c/li\\u003e\\n\\u003cli\\u003eAtia MA, Bashir NH, Azrag RS, Hassan MM. Resting behaviors and seasonal variation of Anopheles arabiensis in River Nile State, Sudan. Int J Mosq Res. 2022 Jan 1;9(1):99\\u0026ndash;104. \\u003c/li\\u003e\\n\\u003cli\\u003eLamidi T, Babatunde, Alo E, Babatope, Naphtali R, Lamidi T. distribution and abundance of anopheles mosquito species in three selected areas of taraba state, north-eastern nigeria. Animal Research International. 2017 Apr 1;14:2730\\u0026ndash;40. \\u003c/li\\u003e\\n\\u003cli\\u003eCarnevale P, Fouque F, Gay F, Manguin S. Les Le\\u0026ccedil;ons du Programme de Lutte Contre les Vecteurs du Paludisme Par Aspersions Intradomiciliaires de DDT ou de Dieldrine dans la Zone Pilote de Bobo-Dioulasso: \\u0026Eacute;chec ou Succ\\u0026egrave;s? Med Trop Sante Int. 2021 Mar 6;1(1):mtsibulletin.V9I9.66. \\u003c/li\\u003e\\n\\u003cli\\u003eBouafou L. Ecologie des populations selvatiques d\\u0026rsquo;Anopheles gambiae, vecteur du paludisme [Internet] [phdthesis]. Universit\\u0026eacute; de Montpellier; 2024 [cited 2025 Feb 16]. Available from: https://hal.science/tel-04607278\\u003c/li\\u003e\\n\\u003cli\\u003eDahoui M. Evaluation de l\\u0026rsquo;impact des mises en valeur agricole sur la transmission du paludisme \\u0026agrave; Bouak\\u0026eacute;, C\\u0026ocirc;te d\\u0026rsquo;Ivoire [Internet] [phdthesis]. Universit\\u0026eacute; de Montpellier; 2023 [cited 2025 Feb 18]. Available from: https://theses.hal.science/tel-04908551\\u003c/li\\u003e\\n\\u003cli\\u003eDossou-Yovo J, Doannio JMC, Diarrassouba S. Pr\\u0026eacute;f\\u0026eacute;rences trophiques des vecteurs du paludisme dans la ville de Bouak\\u0026eacute; et dans les villages environnants de C\\u0026ocirc;te d\\u0026rsquo;Ivoire. 1998; \\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"malaria-journal\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"malj\",\"sideBox\":\"Learn more about [Malaria Journal](http://malariajournal.biomedcentral.com/)\",\"snPcode\":\"12936\",\"submissionUrl\":\"https://submission.nature.com/new-submission/12936/3\",\"title\":\"Malaria Journal\",\"twitterHandle\":\"@malariajournal\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Malaria, Anopheles s.l., Plasmodium, human exposure, Bobo-Dioulasso\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-7048284/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-7048284/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e\\u003cp\\u003eUrban malaria poses a significant public health challenge in many African countries, driven by rapid urbanization and accelerating population growth. Malaria transmission among non-immune urban populations has the potential to emerge as a critical public health concern. To address this threat, a more comprehensive understanding of the biological and ecological factors of urban malaria transmission is essential for set up an updated vector control strategies.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e\\u003cp\\u003eThis study aimed to investigate key biological aspects of the \\u003cem\\u003eAnopheles\\u003c/em\\u003e vector and their implications for residual malaria transmission in order to guide vector control strategies tailored to vulnerable populations in Bobo-Dioulasso, Burkina Faso. For this purpose, mosquito sampling was conducted in 2023 and 2024, using both fauna residual capture and human landing catch techniques in areas located close and distant from riverbanks. Collected specimens were morphologically identified, and molecular analyses (PCR) were performed to i) determine species composition within the \\u003cem\\u003eAnopheles gambiae\\u003c/em\\u003e complex, ii) detect \\u003cem\\u003ePlasmodium\\u003c/em\\u003e infections, and iii) assess host feeding preferences.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e\\u003cp\\u003eThese data were used to evaluate levels of malaria exposure in urban settings. As results, three mosquito genera were identified: \\u003cem\\u003eCulex\\u003c/em\\u003e spp. (72.63%), \\u003cem\\u003eAnopheles\\u003c/em\\u003e spp. (22.68%), and \\u003cem\\u003eAedes\\u003c/em\\u003e spp. (4.68%). All \\u003cem\\u003eAnopheles\\u003c/em\\u003e specimens belonged to the \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e complex, comprising 90.82% \\u003cem\\u003eAn. arabiensis\\u003c/em\\u003e, 6.00% \\u003cem\\u003eAn. gambiae\\u003c/em\\u003e s.s., and 3.22% \\u003cem\\u003eAn. coluzzii\\u003c/em\\u003e. Among these, both endophilic and exophilic populations were observed, with 58.84% of females being gravid. Molecular diagnostics revealed that 27.03% of the \\u003cem\\u003eAnopheles\\u003c/em\\u003e specimens were infected with \\u003cem\\u003ePlasmodium falciparum\\u003c/em\\u003e, while 0.16% carried a dual infection (\\u003cem\\u003eP. falciparum\\u003c/em\\u003e and \\u003cem\\u003eP. malariae\\u003c/em\\u003e). Blood meal analysis indicated a predominance of mixed blood meals (56.65%), followed by zoophilic (22.44%) and anthropophilic (20.91%) feedings.\\u003c/p\\u003e\\u003ch2\\u003eConclusions\\u003c/h2\\u003e\\u003cp\\u003eThese findings confirm the presence of active, indigenous malaria transmission hotspots within the urban environment of Bobo-Dioulasso. The observed vector behaviors and infection rates underscore the importance of context-specific interventions aimed at mitigating malaria transmission in urban African settings.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Human population exposure to residual malaria transmission by the main vector, Anopheles s.l. in the city of Bobo-Dioulasso, Burkina Faso\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-08-14 11:27:15\",\"doi\":\"10.21203/rs.3.rs-7048284/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2026-03-24T02:40:57+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-03-24T02:24:31+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"319072610760255258974064134987116509538\",\"date\":\"2026-03-24T02:12:09+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-09-05T14:08:45+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-08-22T23:57:28+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"163825310194816209410042362989536319590\",\"date\":\"2025-08-12T09:31:38+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"154644669987729709100038070981545765737\",\"date\":\"2025-08-12T06:16:11+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"44495829732522020652113385668528305412\",\"date\":\"2025-08-11T06:44:06+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"57581852891698581557323486159084607093\",\"date\":\"2025-08-09T21:44:27+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-08-09T20:57:14+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-07-08T10:02:45+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-07-08T10:01:14+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Malaria Journal\",\"date\":\"2025-07-04T15:43:48+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"malaria-journal\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"malj\",\"sideBox\":\"Learn more about [Malaria Journal](http://malariajournal.biomedcentral.com/)\",\"snPcode\":\"12936\",\"submissionUrl\":\"https://submission.nature.com/new-submission/12936/3\",\"title\":\"Malaria Journal\",\"twitterHandle\":\"@malariajournal\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC/SO AJ\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"00032090-6b31-4fca-8c0f-a3f82ee5ee8d\",\"owner\":[],\"postedDate\":\"August 14th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-04-21T18:53:46+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-08-14 11:27:15\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-7048284\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-7048284\",\"identity\":\"rs-7048284\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}