{"paper_id":"32b0e084-8d14-4a8c-9bb1-25cd94a58a69","body_text":"Rapid Detection of Typhoid Salmonellas (Salmonella Gallinarum and Salmonella Pullorum) and non-Typhoid Salmonellas (Salmonella Enteritidis and Salmonella Typhimurium) in Poultry through Multiplex-PCR Molecular Method | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Rapid Detection of Typhoid Salmonellas (Salmonella Gallinarum and Salmonella Pullorum) and non-Typhoid Salmonellas (Salmonella Enteritidis and Salmonella Typhimurium) in Poultry through Multiplex-PCR Molecular Method Ali Khodadadeh Jigheh, Younes Anzabi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2357502/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The Salmonella serotypes are detected mainly through traditional microbiologic methods, which are associated with problems. The invention of rapid molecular detection methods has somewhat resolved these problems. This study aimed to assess the possibility of rapid detection of typhoid and non-typhoid Salmonellas in poultry using the multiplex polymerase chain reaction (PCR). A total of 40 isolates of Salmonella from industrial poultry were collected veterinary laboratories in Tabriz, Iran. After microbiological and serological tests, we confirmed that 27 out of 40 isolates belonged to the Salmonella entrica species. Differential tests revealed that 15, 7, 2, and 3 isolates were Salmonella Gallinarum, Salmonella Enteritidis, Salmonella Typhimurium, and Salmonella Pullorum, respectively. We then used specific primers to multiply the genes inv A, rfb J, lyg D, I 137_08605 , and spe C. The 27 isolates were then genotypically analyzed through multiplex-PCR. The results showed that all 27 isolates and the standard strains of all 4 bacteria carry the inv A gene, while this gene was absent in 13 non-Salmonella isolates. The I 137_08605 gene was present in all isolates and the standard strains of S. Gallinarum and S. Pullorum ; the rfb J and lyg D genes were present in all isolates of S . Enteritidis and S. Typhimurium and their standard strains; and the spe C gene was present in all isolates of S. Gallinarum and some isolates of S. Typhimuriumand S . Entritidis and their standard strains. It seems that typhoid Salmonellas of poultry, i.e. , S. Gallinarum and S. Pullorum, can be discriminated from non-typhoid Salmonellas through the multiplex-PCR molecular method. poultry salmonellosis typhoid Salmonella non-typhoid Salmonella rapid detection multiplex polymerase chain reaction Figures Figure 1 Figure 2 Introduction Salmonella is a genus of rod-shaped Gram-negative bacteria of the family Enterobactriaceae (Jafari, Fazlara, and Dalirannia, 2006 ). More than 2700 serotypes are identified for Salmonellas so far, most of which can infect humans, livestock, and birds. Salmonellas are excreted from the stool of humans, livestock, and birds and can contaminate the environment, food, and water (Azizpour, 2018 ; Yazdi-Amirkhiz et al., 2020 ). Salmonella-contaminated chicken and eggs are the most important sources of Salmonella transmission to humans (Miranzadeh, T Salehi, and Karimi, 2010). According to the Kauffman-White Table, the most important serotypes that may infect humans, birds, and livestock are classified into specific serum groups; based on which the S. Typhimurium serotype belongs to the serum group B and S. Gallinarum, S. Pullorum, and S. Enteritidis belong to the serum group D (Sabeghi and Anzabi, 2019 ). In another classification of Salmonellas, these bacteria are divided into two groups, including typhoid and non-typhoid Salmonellas (Sabeghi and Anzabi, 2019 ). Non-typhoid Salmonellas are of great importance in humans because they can lead to life-threatening severe forms of salmonellosis in immunocompromised infants and the elderly (Fardous and Ahamsuzzaman, 2015). Salmonella infections in birds arise mainly due to typhoid serotypes, i.e. , S. Gallinarum and S. Pullorum, and some motile Salmonellas (paratyphoid serotypes and arizonae). S. Typhimurium and S. Enteritidis are among the most important paratyphoid Salmonellas that can infect poultry. Non-typhoid (paratyphoid) infections in birds are mainly asymptomatic, but they occasionally result in anorexia, fluffed-up feathers, diarrhea, slimness, neural signs, blindness, and drooping wings (Sabeghi and Anzabi, 2019 ). Non-typhoid Salmonellas of birds and poultry are also important for humans because they can cause typhoid fever and gastroenteritis in adults and even septicemia in immunocompromised people and children. Vegetables, eggs, chicken, beef, and lamb are the most important sources of non-typhoid salmonella (Mezal et al., 2014 ). S. Gallinarum can result in fowl typhoid and a high mortality rate, especially in mature birds. Fowl typhoid is associated with anemia, depression, diarrhea, and shortness of breath (Onuigbo, Iseghohimhen, Chah, Gyang, and Attama, 2018 ). In addition, S. Pullorum is the causing agent of pullorum disease, a serious systemic disease with a high mortality rate, especially in young birds. Although these two diseases are eliminated mostly from the poultry industry in certain developed countries, they are highly prevalent in developing countries, imposing economic losses (Xiong, Song, Pan, and Jiao, 2018 ). In recent years, molecular methods such as PCR are used for the rapid detection of Salmonella in different samples. This method is sensitive and cost-effective and reduces the time of detection. The polymerase chain reaction is a reliable method for the discrimination of Salmonella serovars (Alzwghaibi et al., 2019 ). Bioinformatics has shown that the inv A gene can be used for the rapid detection of S. enterica (da Cruz Rocha et al., 2014 ). The I 137_08605 gene is present in the S. Gallinarum and S. Pullorum serotypes. The speC gene is specific for the S. Gallinarum serotype (Xiong et al., 2018 ). The lyg D (SEN 1383) gene is found only in S. Enteritidis (Alzwghaibi et al., 2019 ). The rfb J gene is present only in the genome of the S. Typhimurium serotype (Alzwghaibi et al., 2019 ). Given the importance of Salmonellas in poultry, this study aims to evaluate the possibility of rapid discrimination of typhoid Salmonellas ( S. Gallinarum and S. Pullorum) and non-typhoid Salmonellas ( S. Enteritidis and S. Typhimurium) in poultry through the PCR molecular method. Materials And Methods In this descriptive-cross-sectional study, 40 isolates from the liver, cecum, and stool samples of industrial poultry were collected from veterinary laboratories of Tabriz, Iran, in about 4 months, in standard conditions using sterile dishes and equipment. The samples were placed beside dry ice in a cool box and sent to the microbiological laboratory of the Veterinary Hospital of Islamic Azad University of Medical Sciences, Tabriz Branch, in the shortest time. To ensure the identity of isolates and selective enrichment of Salmonellas and increase their number, an adequate volume of samples was taken, transferred to tetrathionate broth (TTB) (Merck, Germany) in sterile conditions, and incubated at 37°C for 18–24 hours. To selectively isolate Salmonellas, the samples were centrifuged and a loop of enriched sample sediment was cultured on xylose lysine deoxycholate (XLD) agar and incubated at 37°C for 24 hours. Then, to identify the phenotype of the grown colonies, differential culture media (all Merck, Germany) and polyvalent and monovalent antisera (Bahar Afshan, Iran) were used based on the protocol provided by Quinn et al. (Quinn et al., 2011 ). All Salmonella isolates, which phenotypes were confirmed and belonged to one of the 4 studied serotypes, were molecularly confirmed through multiplex-PCR using specific primers for genes inv A, rfb J, lyg D, I 137_08605 , and spe C. The primers were designed according to the valid references and BLAST search using programs in the NCBI website, and then purchased from SGB Company (Shanghai Generary Biotech Co., Ltd). Table 1 Features and sequences of the study primers and the PCR products of different Salmonella serotypes Bacterium Target gene Primer sequence (5’-3’) PCR product length Primer reference Various serotypes of S. enterica species inv A F: CGAGCAGCCGCTTAGTATTGAG R: CCATCAAATTAGCGGAGGCTTC 881 da Cruz Rocha et al., 2014 S. Typhimurium rfb J F: CCAGCACCAGTTCCAACTTGATAC R: GGCTTCCGGCTTTATTGGTAAGCA 663 Alzwghaibi et al., 2018 S. Enteritidis lyg D F: CATTCTGACCTTTAAGCCGGTCAATGAG R:CCAAAAAGCGAGACCTCAAACTTACTCAG 339 Alzwghaibi et al., 2019 S. Gallinarum and S. Pullorum I 137_08605 F: CACTGGAGACTCTGAGGACA R: GGGCAGGGAGTCTTGAGATT 290 Xiong et al., 2018 S. Gallinarum spe C F: GATCTGCTGCCAGCTCAA R: GCGCCCTTTTCAAAACATA 174 Alzwghaibi et al., 2019 Dna Extraction The genomic DNA of standard Salmonellas and confirmed isolates was extracted through the boiling method with some modifications. To this end, a fresh young culture was prepared through culturing in a Brain-Heart Infusion solid medium (Merck, Germany) and incubated at 37°C for 24 hours. Then, an adequate amount of the single colonies grown on the culture medium surface was transferred to a 2-mL microtube containing 300 µL of basic TE buffer under the hood near a flame using a sterile loop. The microtube was vortexed, placed in boiling water for 20 min, and centrifuged at 12,000 rpm for 10 min. Then its supernatant which contained DNA was transferred to another microtube (Alzwghaibi et al., 2018 ). Since PCR requires at least 50 ng/µL of pure extracted DNA, the nanodrop device (Nanodrop Technologies, Wilmington, DE, USA) of the Biotechnology Research Center of the Islamic Azad University, Tabriz Branch, was used to quantify and qualify the extracted DNA. Program Of Multiplex-pcr The ingredients and compounds presented in Table 2 were used to evaluate the presence of genes inv A, rfb J, lyg D, I 137_08605 , and spe C through multiplex-PCR. The PCR program was as follows: initial denaturation at 94°C for 5 min, 35 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and elongation at 72°C for 45 s, and final elongation at 72°C for 10 min. Table 2 Ingredients used for multiplex-PCR Ingredients Volume per sample Master 12.5 µL Primer F inv A 0.3 µL Primer R inv A 0.3 µL Primer F I 137_08605 0.4 µL Primer R I 137_08605 0.4 µL Primer F spe C 0.5 µL Primer R spe C 0.5 µL Primer F rfb J 0.3 µL Primer R rfb J 0.3 µL Primer F lyg D 0.35 µL Primer R lyg D 0.35 µL Template DNA 1 µL ddH 2 O 7.8 µL Total 25 µL The multiplex-PCR products were then loaded on 1% electrophoresis gel and visualized and photographed under UV light using the Box™ Gel documentation device (Cingen Cambridge, UK) in the Biotechnology Research Center of the Islamic Azad University, Tabriz Branch. The standard strains of S. Gallinarum (PTCC:1093), S. Typhimurium (PTCC:1709), S. Enteritidis (PTCC:1787), and S. Pullorum (ATCC:19945), serotypes were used in different phases of this study as positive controls and the standard strain of Proteus mirabilis (PTCC:1793) as the negative control; all of which were obtained from the Iranian Research Organization for Science and Technology (Tehran, Iran). Results Out of 40 isolates, 27 were identified as the serotypes S. Gallinarum, S. Pullorum, S. Typhimurium, and S. Enteritidis according to the specific bacteriologic table provided by Quinn et al . In this study, usual clinical microbiology detection tests showed that out of 40 isolates transferred to the microbiology laboratory of the Veterinary Hospital of the Islamic Azad University of Medical Sciences, Tabriz Branch, 27 isolates belonged to the S. enterica species, of which, 15, 7, 2, and 3 isolates belonged to S. Gallinarum, S. Enteritidis, S. Typhimurium, and S. Pullorum, respectively. In addition, the results of multiplex-PCR showed that the inv A gene was present in all 4 standard serotypes and in all isolates that were phenotypically identified as the serotype belonging to the S. enterica species; however, this gene was absent in all 13 isolates that did not belong to the S. enterica species (Fig. 1). It was also revealed that the genes I 137_08605 and spe C were present in all isolates and in the standard strain of serotype S. Gallinarum ; however, only the I 137_08605 gene was found in the isolates and in the standard strain of S. Pullorum serotype. In addition, the results showed that the rfb J and lyg D genes were present in all isolates and in the standard strains of S. Enteritidis and S. Typhimurium serotypes, but the gene spe C was present in some of them (Fig. 2). Discussion And Conclusion The results of genotype detection of Salmonella isolates through the multiplex-PCR molecular method showed that the inv A gene with an 881 bp band was present in all isolates; this finding is consistent with previous studies. The inv A gene was observed in isolates that were phenotypically and serologically considered S. Gallinarum. The rfb J and lyg D genes were absent in all isolates, indicating that if they are present in a Salmonella isolate, that isolate is certainly not S. Gallinarum, so other serotypes should be considered. This claim can be investigated in future studies. However, the bands of I 137_08605 and spe C genes were found in all isolates, indicating that they can be used to discriminate this serotype from others. All isolates identified as S. Enteritidis carried the inv A gene, and it was certainly confirmed that all of them were genotypically Salmonella according to previous studies. Since all isolates had the rfb J and lyg D genes, they can be used to genotypically discriminate S. Enteritidis (non-typhoid Salmonella) and S. Gallinarum (typhoid Salmonella). In addition, the I 137_08605 gene was absent in the isolate, while the spe C gene was present in some isolates. Regarding the 2 isolates that were confirmed as S. Typhimurium, the results were completely similar to S . Enteritidis, so they have the inv A, rfb J, and lyg D genes, but lack the I 137_08605 gene. In addition, the spe C gene band was observed only in one isolate. All S. Pullorum isolates had the inv A gene and lack the spe C, rfb J, and lyg D genes, but the I 137_08605 gene was found in all isolates of S. Pullorum. According to these findings, we can claim that typhoid Salmonellas ( S. Gallinarum and S. Pullorum) and non-typhoid Salmonellas ( S. Enteritidis and S. Typhimurium) in poultry can be genotypically discriminated. Similarly, the spe C gene can be used to discriminate the S. Pullorum and S. Gallinarum serotypes, although further research is required to confirm this claim. However, according to the results, the S. Enteritidis and S. Typhimurium serotypes cannot be discriminated with certainty using these 5 genes. According to the study of Alzwghaibi et al. (2018), the inv A gene was present in all serotypes of Salmonella, the rfb J gene only in S. Typhimurium, the slg C gene in two serotypes of S. Gallinarum and S. Pullorum, and the spe C gene only in S. Gallinarum (Alzwghaibi et al. , 2018). The results of this study are consistent with that of Alzwghaibi et al. regarding the inv A gene, but inconsistent regarding the rfb J gene because in our study, this gene was found in both S. Typhimurium and S. Enteritidis serotypes. Regarding the spe C gene, our study was highly consistent with the mentioned study. In another study by Alzwghaibi et al. in 2019, the inv A gene was present in all four serovars of S. enteritidis , S. Gallinarum, S. Pullorum, and S. Dublin, but the lyg D gene was found only in S. Enteritidis. The slgC gene was seen in the S. Gallinarum and S. Pullorum serovars and the spe C gene only in S. Gallinarum (Alzwghaibi et al. , 2019). In our study, the inv A gene was found in all isolates, indicating the consistency of our study with the mentioned one regarding the inv A gene. In addition, our study was inconsistent with that of Alzwghaibi et al. regarding the lyg D gene because this gene was present in S. Enteritidis and S. Typhimurium. However, these studies were highly consistent regarding other genes. In the study of da Cruz et al. (2014) performed in Brazil, the inv A gene was found in all isolates of Salmonella (da Cruz Rocha et al. , 2014); this finding is in line with that of this study since the inv A gene was also observed in all isolates. Pal et al. showed that the glg C and spe C genes were present in all isolates of S. Gallinarum (Pal et al. , 2019); this finding is highly consistent with that of our study because we also showed that the spe C gene was present in all isolates of S. Gallinarum. In a study by Xiong et al. (2017), the lyg D gene was found only in S. Enteritidis, and the flh B only in S. Gallinarum and S. Pullorum (Xiong et al. , 2017). The results of this study regarding the exclusiveness of the lyg D gene to S. Enteritidis are inconsistent with our study because this gene was present in both S. Enteritidis and S. Typhimurium serotypes. A study by Xiong et al. in 2018 indicated that the I 137_08605 gene was present in two serotypes of S. Gallinarum and S. Pullorum (Xiong et al. , 2018). This finding is highly consistent with that of our study because we observed the I 137_08605 gene only in S. Gallinarum and S. Pullorum and not in other serotypes of Salmonella ( S. Enteritidis and S. Typhimurium). Yazdi et al. showed that all isolates of Salmonella carried the inv A gene (Yazdi Amirkhizi et al. , 2020). The results of our study regarding the presence of the inv A gene in all isolates of Salmonella are consistent with that of Yazdi’s study. Differences in the results of our study and similar studies can be attributed to the differences in the origin of samples and the geographic area. For example, the isolates in our study were collected from the liver, cecum, and stool of industrial poultry; the sources of isolates may vary in similar studies and lead to the difference in the results obtained. On the other hand, these differences can be attributed to the genome of Salmonella serotypes; for example, given the time interval between this study and similar studies, some changes may occur in the genome of the studied Salmonella serotypes during this time and result in these differences. According to the results of this study, multiplex-PCR can be used for the discrimination of typhoid Salmonellas ( S. Gallinarum and S. Pullorum) and non-typhoid Salmonellas ( S. Enteritidis and S. Typhimurium) in poultry in a short time although genes used in this study cannot discriminate the serotypes S. Enteritidis and S. Typhimurium . In the first step, the genotypes of typhoid Salmonellas and non-typhoid Salmonellas can be discriminated, and the S. Gallinarum and S. Pullorum serotypes can be rapidly differentiated in the next step. Identifying the specific genes of S. Gallinarum, S. Pullorum , S. Enteritidis, and S. Typhimurium in isolates obtained from the liver, cecum, and stool of poultry can facilitate the discrimination of typhoid Salmonellas ( S. Gallinarum and S. Pullorum) and non-typhoid Salmonellas ( S. Enteritidis and S. Typhimurium) through molecular methods such as PCR in the shortest time. When typhoid Salmonella is diagnosed, the infected poultry is not treated, rather all poultry are destroyed; therefore, rapid detection of these two serovars of Salmonella that are the pathogenic agents of typhoid Salmonella can help eradicate them in developing countries. Declarations Acknowledgment This article is derived from the master thesis in microbiology, pathogenic microbes approved by the Islamic Azad University, Tabriz Branch. The authors would like to give their gratitude to the university officials for their material and moral support. Conflict of interest The authors state that they have no conflict of interest. References Alzwghaibi, A., Yahyaraeyat, R., Fasaei, B. N., Langeroudi, A. G., & Salehi, T. Z. (2018). Rapid molecular identification and differentiation of common Salmonella serovars isolated from poultry, domestic animals and foodstuff using multiplex PCR assay. Archives of microbiology, 200 (7), 1009-1016. Alzwghaibi, A. B., Yahyaraeyat, R., Nayeri Fasaei, B., Ghalyanchi Langeroudi, A., & Zahraei Salehi, T. (2019). Identification and discrimination of Salmonella Enteritidis, S. Pullorum, S. Gallinarum and S. Dublin using Salmonella specific genomic regions amplification assay. Iranian Journal of Veterinary Medicine, 13 (2), 131-142. Azizpour, A. (2018). A survey on prevalence of Salmonella enteritidis and Salmonella typhimurium serotypes in broiler flocks of Ardabil province and determination of their antibiotics resistance to five antibacterial agents widely used in the Iranian medical field. Journal of Health, 9 (2), 143-151. da Cruz Rocha, D. C., do Rosario Marinho, A. N., dos Reis, M. d. S. O., Borges, I. R., de Paula Ramos, F. L., & Loureiro, E. C. B. (2014). Perfil epidemiológico e caracterização molecular de Salmonella Typhi isoladas no Estado do Pará, Brasil. Revista Pan-Amazônica de Saúde, 5 (4), 10-10. Fardous, J., & Shamsuzzaman, S. (2015). Detection of potential pathogenic aerobic bacteria from egg shell and egg contents of hen collected from poultry. Bangladesh Medical Research Council Bulletin, 41 (2), 67-72. Jafari, R., Fazlara, A., & Dalirannia, A. (2006). An investigation into salmonella contamination of native hens'eggs in ahvaz. Mezal, E. H., Sabol, A., Khan, M. A., Ali, N., Stefanova, R., & Khan, A. A. (2014). Isolation and molecular characterization of Salmonella enterica serovar Enteritidis from poultry house and clinical samples during 2010 . Food microbiology, 38 , 67-74. Miranzadeh, H., T Salehi, Z., & Karimi, V. (2012). The count of aerobic mesophill bacteria and isolate salmonella Spp on egg in Isfahan1389. Veterinary Researches & Biological Products, 25 (1), 31-35. Onuigbo, E., Iseghohimhen, J., Chah, K., Gyang, M., & Attama, A. (2018). Chitosan/alginate microparticles for the oral delivery of fowl typhoid vaccine: Innate and acquired immunity. Vaccine, 36 (33), 4973-4978. Pal, S., Dey, S., Batabyal, K., Banerjee, A., Joardar, S. N., & Isore, D. P. (2019). Evaluation of a Multiplex PCR Assay for Rapid Diagnosis of Fowl Typhoid. Int. J. Curr. Microbiol. App. Sci, 8 (6), 2054-2058. Quinn, P. J., Markey, B. K., Leonard, F. C., Hartigan, P., Fanning, S., & Fitzpatrick, E. (2011). Veterinary microbiology and microbial disease : John Wiley & Sons. Sabeghi, M., & Anzabi, Y. (2019). Determination of serogroup and antibiotic resistance pattern of Salmonellas isolated from commercial laying poultry of Tabriz area. Veterinary Clinical Pathology, 13 (50) Xiong, D., Song, L., Pan, Z., & Jiao, X. (2018). Identification and discrimination of Salmonella enterica serovar gallinarum biovars pullorum and gallinarum based on a one-step multiplex PCR assay. Frontiers in Microbiology, 9 , 1718. Xiong, D., Song, L., Tao, J., Zheng, H., Zhou, Z., Geng, S., . . . Jiao, X. (2017). An efficient multiplex PCR-based assay as a novel tool for accurate inter-serovar discrimination of Salmonella Enteritidis, S. Pullorum/Gallinarum and S. Dublin. Frontiers in Microbiology, 8 , 420. Yazdi-Amirkhiz, S., Anzabi, Y., & Mahmazi, S. (2020). Evaluation of rapid detection and investigation of the presence of spv operon virulence genes in Salmonella isolates using simplex PCR and multiplex PCR molecular methods. Veterinary Clinical Pathology, 14 (55). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-2357502\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":158688017,\"identity\":\"9c58e9b9-b18c-4bc9-bfcd-7ca787dedcec\",\"order_by\":0,\"name\":\"Ali Khodadadeh Jigheh\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Islamic Azad University of Tabriz\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ali\",\"middleName\":\"Khodadadeh\",\"lastName\":\"Jigheh\",\"suffix\":\"\"},{\"id\":158688019,\"identity\":\"887a9cd0-2eab-4901-bfc6-29d832f8c79f\",\"order_by\":1,\"name\":\"Younes Anzabi\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwklEQVRIiWNgGAWjYJACZgYDGx4YhwefSmQtaTwgihQtDIcZYFoIA/7Z7Q8/FxScl+GfkX+A4UcNg4x5AwEtEncOJEvPMLjNI3EjmYGx5xgDj8wBQtbcSDggzQPUwgDUwsDbwMAjQUiH/I3E5t88Bud45EG2/CVGi8GNZDagLQd4gAwGZqJsMbyRxmY9wyCZx/DMY4PDMsckCGuRu5H++HbBHzt7ueOJDx++qbGxJ6gFBRwAhiBJGkbBKBgFo2AU4AAAOIY01Ql1QnAAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Islamic Azad University of Tabriz\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Younes\",\"middleName\":\"\",\"lastName\":\"Anzabi\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2022-12-08 10:59:14\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-2357502/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-2357502/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":30214004,\"identity\":\"bf4e26d4-dab3-457f-aad2-a2c33feb698f\",\"added_by\":\"auto\",\"created_at\":\"2022-12-12 16:02:06\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":308522,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eLane m: Ladder 50 bp; Lane 1: the \\u003cem\\u003eP. mirabilis\\u003c/em\\u003e negative control; Lane 2: the \\u003cem\\u003eS. \\u003c/em\\u003eTyphimurium positive control; Lane 3: the presence of the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene in the isolate phenotypically identified as the serotype of Salmonella species; Lane 4: the presence of the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene in the isolate phenotypically identified as the serotype of Salmonella species; Lane 5: the presence of the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene in the isolate phenotypically identified as the serotype of Salmonella species; Lane 6: the presence of the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene in the isolate phenotypically identified as the serotype of Salmonella species; Lane 7: the absence of the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene in the isolate which was not phenotypically the serotype of Salmonella species; Lane 8: the absence of the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene in the isolate which was not phenotypically the serotype of Salmonella species; Lane 9: \\u0026nbsp;the absence of the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene in the isolate which was not phenotypically the serotype of Salmonella species; Lane 10: \\u0026nbsp;the absence of the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene in the isolate which was not phenotypically the serotype of Salmonella species\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2357502/v1/40d97bb82f1ff3e103e0599d.png\"},{\"id\":30214003,\"identity\":\"cbecf81d-b6a7-47c0-b551-62f33468779f\",\"added_by\":\"auto\",\"created_at\":\"2022-12-12 16:02:06\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":358275,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eA sample gel electrophoresis of multiplex-PCR products: Lane a: \\u0026nbsp;Ladder 50 bp; Lane b: \\u0026nbsp;\\u003cem\\u003eP. mirabilis\\u003c/em\\u003e negative control; Lane 1: the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene, the 663 bp band of \\u003cem\\u003erfb\\u003c/em\\u003eJ gene, the 339 bp band of \\u003cem\\u003elyg\\u003c/em\\u003eD gene, the 174 bp band of \\u003cem\\u003espe\\u003c/em\\u003eC gene in the standard strain of \\u003cem\\u003eS. \\u003c/em\\u003eTyphimurium; Lane 2: the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene, the 663 bp band of \\u003cem\\u003erfb\\u003c/em\\u003eJ gene, the 339 bp band of \\u003cem\\u003elyg\\u003c/em\\u003eD gene, the 174 bp band of \\u003cem\\u003espe\\u003c/em\\u003eC gene in the standard strain of \\u003cem\\u003eS. \\u003c/em\\u003eEnteritidis; Lane 3: the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene, the 290 bp band of I\\u003cem\\u003e137_08605\\u003c/em\\u003egene, the 174 bp band of \\u003cem\\u003espe\\u003c/em\\u003eC gene in the standard strain of\\u003cem\\u003e S. \\u003c/em\\u003eGallinarum; Lane 4: the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene, the 290 bp band of I\\u003cem\\u003e137_08605\\u003c/em\\u003egene in the standard strain of\\u003cem\\u003e S. \\u003c/em\\u003ePullorum; Lane 5: the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene, the 290 bp band of I\\u003cem\\u003e137_08605\\u003c/em\\u003e gene in the \\u003cem\\u003eS. \\u003c/em\\u003eGallinarum\\u003cem\\u003e \\u003c/em\\u003eisolate; Lane 6: the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene, the 663 bp band of \\u003cem\\u003erfb\\u003c/em\\u003eJ gene, the 339 bp band of \\u003cem\\u003elyg\\u003c/em\\u003eD gene, the 174 bp band of \\u003cem\\u003espe\\u003c/em\\u003eC gene in the \\u003cem\\u003eS. \\u003c/em\\u003eTyphimurium isolate; Lane 7: the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene, the 663 bp band of \\u003cem\\u003erfb\\u003c/em\\u003eJ gene, the 339 bp band of \\u003cem\\u003elyg\\u003c/em\\u003eD gene, the 174 bp band of \\u003cem\\u003espe\\u003c/em\\u003eC gene in the \\u003cem\\u003eS. \\u003c/em\\u003eEnteritidis isolate; Lane 8: the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene, the 290 bp band of I\\u003cem\\u003e137_08605\\u003c/em\\u003egene in the \\u003cem\\u003eS. \\u003c/em\\u003ePullorum isolate; Lane 9: the 881 bp band of \\u003cem\\u003einv\\u003c/em\\u003eA gene, the 290 bp band of I\\u003cem\\u003e137_08605\\u003c/em\\u003e gene, the 174 bp band of \\u003cem\\u003espe\\u003c/em\\u003eC gene in the \\u003cem\\u003eS. \\u003c/em\\u003eGallinarum isolate\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2357502/v1/91c03f48ac960cb978540900.png\"},{\"id\":30214010,\"identity\":\"4397d7bc-22c7-4e9d-8cfc-e161fe9b5ea5\",\"added_by\":\"auto\",\"created_at\":\"2022-12-12 16:02:17\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":800732,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2357502/v1/f52e920f-8dff-4b43-b06b-d7e21064d0a5.pdf\"},{\"id\":30214006,\"identity\":\"411fcedd-8c88-455e-8b8c-b7fb47dd9dbd\",\"added_by\":\"auto\",\"created_at\":\"2022-12-12 16:02:11\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":800732,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-2357502/v1/46fb0d49-06e5-40ca-a51d-28721a1e3bb8.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Rapid Detection of Typhoid Salmonellas (Salmonella Gallinarum and Salmonella Pullorum) and non-Typhoid Salmonellas (Salmonella Enteritidis and Salmonella Typhimurium) in Poultry through Multiplex-PCR Molecular Method\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eSalmonella is a genus of rod-shaped Gram-negative bacteria of the family Enterobactriaceae (Jafari, Fazlara, and Dalirannia, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2006\\u003c/span\\u003e). More than 2700 serotypes are identified for Salmonellas so far, most of which can infect humans, livestock, and birds. Salmonellas are excreted from the stool of humans, livestock, and birds and can contaminate the environment, food, and water (Azizpour, \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e; Yazdi-Amirkhiz et al., \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). Salmonella-contaminated chicken and eggs are the most important sources of Salmonella transmission to humans (Miranzadeh, T Salehi, and Karimi, 2010).\\u003c/p\\u003e \\u003cp\\u003eAccording to the Kauffman-White Table, the most important serotypes that may infect humans, birds, and livestock are classified into specific serum groups; based on which the \\u003cem\\u003eS.\\u003c/em\\u003e Typhimurium serotype belongs to the serum group B and \\u003cem\\u003eS.\\u003c/em\\u003e Gallinarum, \\u003cem\\u003eS.\\u003c/em\\u003e Pullorum, and \\u003cem\\u003eS.\\u003c/em\\u003e Enteritidis belong to the serum group D (Sabeghi and Anzabi, \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). In another classification of Salmonellas, these bacteria are divided into two groups, including typhoid and non-typhoid Salmonellas (Sabeghi and Anzabi, \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). Non-typhoid Salmonellas are of great importance in humans because they can lead to life-threatening severe forms of salmonellosis in immunocompromised infants and the elderly (Fardous and Ahamsuzzaman, 2015). Salmonella infections in birds arise mainly due to typhoid serotypes, \\u003cem\\u003ei.e.\\u003c/em\\u003e, \\u003cem\\u003eS.\\u003c/em\\u003e Gallinarum and \\u003cem\\u003eS.\\u003c/em\\u003e Pullorum, and some motile Salmonellas (paratyphoid serotypes and arizonae). \\u003cem\\u003eS.\\u003c/em\\u003e Typhimurium and \\u003cem\\u003eS.\\u003c/em\\u003e Enteritidis are among the most important paratyphoid Salmonellas that can infect poultry. Non-typhoid (paratyphoid) infections in birds are mainly asymptomatic, but they occasionally result in anorexia, fluffed-up feathers, diarrhea, slimness, neural signs, blindness, and drooping wings (Sabeghi and Anzabi, \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). Non-typhoid Salmonellas of birds and poultry are also important for humans because they can cause typhoid fever and gastroenteritis in adults and even septicemia in immunocompromised people and children. Vegetables, eggs, chicken, beef, and lamb are the most important sources of non-typhoid salmonella (Mezal et al., \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). \\u003cem\\u003eS.\\u003c/em\\u003e Gallinarum can result in fowl typhoid and a high mortality rate, especially in mature birds. Fowl typhoid is associated with anemia, depression, diarrhea, and shortness of breath (Onuigbo, Iseghohimhen, Chah, Gyang, and Attama, \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). In addition, \\u003cem\\u003eS.\\u003c/em\\u003e Pullorum is the causing agent of pullorum disease, a serious systemic disease with a high mortality rate, especially in young birds. Although these two diseases are eliminated mostly from the poultry industry in certain developed countries, they are highly prevalent in developing countries, imposing economic losses (Xiong, Song, Pan, and Jiao, \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eIn recent years, molecular methods such as PCR are used for the rapid detection of Salmonella in different samples. This method is sensitive and cost-effective and reduces the time of detection. The polymerase chain reaction is a reliable method for the discrimination of Salmonella serovars (Alzwghaibi et al., \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). Bioinformatics has shown that the \\u003cem\\u003einv\\u003c/em\\u003eA gene can be used for the rapid detection of \\u003cem\\u003eS. enterica\\u003c/em\\u003e (da Cruz Rocha et al., \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). The I\\u003cem\\u003e137_08605\\u003c/em\\u003e gene is present in the \\u003cem\\u003eS.\\u003c/em\\u003e Gallinarum and \\u003cem\\u003eS.\\u003c/em\\u003e Pullorum serotypes. The \\u003cem\\u003espeC\\u003c/em\\u003e gene is specific for the \\u003cem\\u003eS.\\u003c/em\\u003e Gallinarum serotype (Xiong et al., \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). The \\u003cem\\u003elyg\\u003c/em\\u003eD\\u003cem\\u003e(SEN 1383)\\u003c/em\\u003e gene is found only in \\u003cem\\u003eS.\\u003c/em\\u003e Enteritidis (Alzwghaibi et al., \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). The \\u003cem\\u003erfb\\u003c/em\\u003eJ gene is present only in the genome of the \\u003cem\\u003eS.\\u003c/em\\u003e Typhimurium serotype (Alzwghaibi et al., \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eGiven the importance of Salmonellas in poultry, this study aims to evaluate the possibility of rapid discrimination of typhoid Salmonellas (\\u003cem\\u003eS.\\u003c/em\\u003e Gallinarum and \\u003cem\\u003eS.\\u003c/em\\u003e Pullorum) and non-typhoid Salmonellas (\\u003cem\\u003eS.\\u003c/em\\u003e Enteritidis and \\u003cem\\u003eS.\\u003c/em\\u003e Typhimurium) in poultry through the PCR molecular method.\\u003c/p\\u003e\"},{\"header\":\"Materials And Methods\",\"content\":\"\\u003cp\\u003eIn this descriptive-cross-sectional study, 40 isolates from the liver, cecum, and stool samples of industrial poultry were collected from veterinary laboratories of Tabriz, Iran, in about 4 months, in standard conditions using sterile dishes and equipment. The samples were placed beside dry ice in a cool box and sent to the microbiological laboratory of the Veterinary Hospital of Islamic Azad University of Medical Sciences, Tabriz Branch, in the shortest time. To ensure the identity of isolates and selective enrichment of Salmonellas and increase their number, an adequate volume of samples was taken, transferred to tetrathionate broth (TTB) (Merck, Germany) in sterile conditions, and incubated at 37\\u0026deg;C for 18\\u0026ndash;24 hours. To selectively isolate Salmonellas, the samples were centrifuged and a loop of enriched sample sediment was cultured on xylose lysine deoxycholate (XLD) agar and incubated at 37\\u0026deg;C for 24 hours. Then, to identify the phenotype of the grown colonies, differential culture media (all Merck, Germany) and polyvalent and monovalent antisera (Bahar Afshan, Iran) were used based on the protocol provided by Quinn \\u003cem\\u003eet al.\\u003c/em\\u003e (Quinn et al., \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eAll Salmonella isolates, which phenotypes were confirmed and belonged to one of the 4 studied serotypes, were molecularly confirmed through multiplex-PCR using specific primers for genes \\u003cem\\u003einv\\u003c/em\\u003eA, \\u003cem\\u003erfb\\u003c/em\\u003eJ, \\u003cem\\u003elyg\\u003c/em\\u003eD, I\\u003cem\\u003e137_08605\\u003c/em\\u003e, and \\u003cem\\u003espe\\u003c/em\\u003eC. The primers were designed according to the valid references and BLAST search using programs in the NCBI website, and then purchased from SGB Company (Shanghai Generary Biotech Co., Ltd).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eFeatures and sequences of the study primers and the PCR products of different Salmonella serotypes\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"5\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBacterium\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTarget gene\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003ePrimer sequence (5\\u0026rsquo;-3\\u0026rsquo;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003ePCR product length\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003ePrimer reference\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eVarious serotypes of \\u003cem\\u003eS. enterica\\u003c/em\\u003e species\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003einv\\u003c/em\\u003eA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eF: CGAGCAGCCGCTTAGTATTGAG\\u003c/p\\u003e \\u003cp\\u003eR: CCATCAAATTAGCGGAGGCTTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e881\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eda Cruz Rocha et al., \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS.\\u003c/em\\u003e Typhimurium\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003erfb\\u003c/em\\u003eJ\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eF: CCAGCACCAGTTCCAACTTGATAC\\u003c/p\\u003e \\u003cp\\u003eR: GGCTTCCGGCTTTATTGGTAAGCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e663\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eAlzwghaibi et al., \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS.\\u003c/em\\u003e Enteritidis\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003elyg\\u003c/em\\u003eD\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eF: CATTCTGACCTTTAAGCCGGTCAATGAG\\u003c/p\\u003e \\u003cp\\u003eR:CCAAAAAGCGAGACCTCAAACTTACTCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e339\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eAlzwghaibi et al., \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS.\\u003c/em\\u003e Gallinarum and \\u003cem\\u003eS.\\u003c/em\\u003e Pullorum\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eI\\u003cem\\u003e137_08605\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eF: CACTGGAGACTCTGAGGACA\\u003c/p\\u003e \\u003cp\\u003eR: GGGCAGGGAGTCTTGAGATT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e290\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eXiong et al., \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eS.\\u003c/em\\u003e Gallinarum\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003espe\\u003c/em\\u003eC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eF: GATCTGCTGCCAGCTCAA\\u003c/p\\u003e \\u003cp\\u003eR: GCGCCCTTTTCAAAACATA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e174\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eAlzwghaibi et al., \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e\\n\\u003ch3\\u003eDna Extraction\\u003c/h3\\u003e\\n\\u003cp\\u003eThe genomic DNA of standard Salmonellas and confirmed isolates was extracted through the boiling method with some modifications. To this end, a fresh young culture was prepared through culturing in a Brain-Heart Infusion solid medium (Merck, Germany) and incubated at 37\\u0026deg;C for 24 hours. Then, an adequate amount of the single colonies grown on the culture medium surface was transferred to a 2-mL microtube containing 300 \\u0026micro;L of basic TE buffer under the hood near a flame using a sterile loop. The microtube was vortexed, placed in boiling water for 20 min, and centrifuged at 12,000 rpm for 10 min. Then its supernatant which contained DNA was transferred to another microtube (Alzwghaibi et al., \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). Since PCR requires at least 50 ng/\\u0026micro;L of pure extracted DNA, the nanodrop device (Nanodrop Technologies, Wilmington, DE, USA) of the Biotechnology Research Center of the Islamic Azad University, Tabriz Branch, was used to quantify and qualify the extracted DNA.\\u003c/p\\u003e\\n\\u003ch3\\u003eProgram Of Multiplex-pcr\\u003c/h3\\u003e\\n\\u003cp\\u003eThe ingredients and compounds presented in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e were used to evaluate the presence of genes \\u003cem\\u003einv\\u003c/em\\u003eA, \\u003cem\\u003erfb\\u003c/em\\u003eJ, \\u003cem\\u003elyg\\u003c/em\\u003eD, I\\u003cem\\u003e137_08605\\u003c/em\\u003e, and \\u003cem\\u003espe\\u003c/em\\u003eC through multiplex-PCR. The PCR program was as follows: initial denaturation at 94\\u0026deg;C for 5 min, 35 cycles of denaturation at 94\\u0026deg;C for 1 min, annealing at 55\\u0026deg;C for 1 min, and elongation at 72\\u0026deg;C for 45 s, and final elongation at 72\\u0026deg;C for 10 min.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eIngredients used for multiplex-PCR\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIngredients\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eVolume per sample\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMaster\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e12.5 \\u0026micro;L\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer F \\u003cem\\u003einv\\u003c/em\\u003eA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.3 \\u0026micro;L\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer R \\u003cem\\u003einv\\u003c/em\\u003eA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.3 \\u0026micro;L\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer F I\\u003cem\\u003e137_08605\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.4 \\u0026micro;L\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer R I\\u003cem\\u003e137_08605\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.4 \\u0026micro;L\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer F \\u003cem\\u003espe\\u003c/em\\u003eC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.5 \\u0026micro;L\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer R \\u003cem\\u003espe\\u003c/em\\u003eC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.5 \\u0026micro;L\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer F \\u003cem\\u003erfb\\u003c/em\\u003eJ\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.3 \\u0026micro;L\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer R \\u003cem\\u003erfb\\u003c/em\\u003eJ\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.3 \\u0026micro;L\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer F \\u003cem\\u003elyg\\u003c/em\\u003eD\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.35 \\u0026micro;L\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer R \\u003cem\\u003elyg\\u003c/em\\u003eD\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e0.35 \\u0026micro;L\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTemplate DNA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e1 \\u0026micro;L\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eddH\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e7.8 \\u0026micro;L\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTotal\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e25 \\u0026micro;L\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe multiplex-PCR products were then loaded on 1% electrophoresis gel and visualized and photographed under UV light using the Box\\u0026trade; Gel documentation device (Cingen Cambridge, UK) in the Biotechnology Research Center of the Islamic Azad University, Tabriz Branch.\\u003c/p\\u003e \\u003cp\\u003eThe standard strains of \\u003cem\\u003eS.\\u003c/em\\u003e Gallinarum (PTCC:1093), \\u003cem\\u003eS.\\u003c/em\\u003e Typhimurium (PTCC:1709), \\u003cem\\u003eS.\\u003c/em\\u003e Enteritidis (PTCC:1787), and \\u003cem\\u003eS.\\u003c/em\\u003ePullorum (ATCC:19945), serotypes were used in different phases of this study as positive controls and the standard strain of \\u003cem\\u003eProteus mirabilis\\u003c/em\\u003e (PTCC:1793) as the negative control; all of which were obtained from the Iranian Research Organization for Science and Technology (Tehran, Iran).\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003eOut of 40 isolates, 27 were identified as the serotypes \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum, \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum, \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eTyphimurium,\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis according to the specific bacteriologic table provided by Quinn \\u003cem\\u003eet al\\u003c/em\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003eIn this study, usual clinical microbiology detection tests showed that out of 40 isolates transferred to the microbiology laboratory of the Veterinary Hospital of the Islamic Azad University of Medical Sciences, Tabriz Branch, 27 isolates belonged to the \\u003cem\\u003eS. enterica\\u003c/em\\u003e species, of which, 15, 7, 2, and 3 isolates belonged to \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum, \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis, \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eTyphimurium,\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum, respectively.\\u003c/p\\u003e\\n\\u003cp\\u003eIn addition, the results of multiplex-PCR showed that the \\u003cem\\u003einv\\u003c/em\\u003eA gene was present in all 4 standard serotypes and in all isolates that were phenotypically identified as the serotype belonging to the \\u003cem\\u003eS. enterica\\u003c/em\\u003e species; however, this gene was absent in all 13 isolates that did not belong to the \\u003cem\\u003eS. enterica\\u003c/em\\u003e species (Fig. 1). It was also revealed that the genes I\\u003cem\\u003e137_08605\\u003c/em\\u003e and \\u003cem\\u003espe\\u003c/em\\u003eC were present in all isolates and in the standard strain of serotype\\u003cem\\u003e\\u0026nbsp;S.\\u0026nbsp;\\u003c/em\\u003eGallinarum\\u003cem\\u003e;\\u003c/em\\u003e however, only the I\\u003cem\\u003e137_08605\\u003c/em\\u003e gene was found in the isolates and in the standard strain of \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eserotype. In addition, the results showed that the \\u003cem\\u003erfb\\u003c/em\\u003eJ and \\u003cem\\u003elyg\\u003c/em\\u003eD genes were present in all isolates and in the standard strains of \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis and \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eTyphimurium\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eserotypes, but the gene \\u003cem\\u003espe\\u003c/em\\u003eC was present in some of them (Fig. 2).\\u003c/p\\u003e\"},{\"header\":\"Discussion And Conclusion\",\"content\":\"\\u003cp\\u003eThe results of genotype detection of Salmonella isolates through the multiplex-PCR molecular method showed that the \\u003cem\\u003einv\\u003c/em\\u003eA gene with an 881 bp band was present in all isolates; this finding is consistent with previous studies.\\u003c/p\\u003e\\n\\u003cp\\u003eThe \\u003cem\\u003einv\\u003c/em\\u003eA gene was observed in isolates that were phenotypically and serologically considered \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum. The \\u003cem\\u003erfb\\u003c/em\\u003eJ and \\u003cem\\u003elyg\\u003c/em\\u003eD genes were absent in all isolates, indicating that if they are present in a Salmonella isolate, that isolate is certainly not \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum, so other serotypes should be considered. This claim can be investigated in future studies. However, the bands of I\\u003cem\\u003e137_08605\\u003c/em\\u003e and \\u003cem\\u003espe\\u003c/em\\u003eC genes were found in all isolates, indicating that they can be used to discriminate this serotype from others.\\u003c/p\\u003e\\n\\u003cp\\u003eAll isolates identified as \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003ecarried the \\u003cem\\u003einv\\u003c/em\\u003eA gene, and it was certainly confirmed that all of them were genotypically Salmonella according to previous studies. Since all isolates had the \\u003cem\\u003erfb\\u003c/em\\u003eJ and \\u003cem\\u003elyg\\u003c/em\\u003eD genes, they can be used to genotypically discriminate \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis (non-typhoid Salmonella) and \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum (typhoid Salmonella). In addition, the I\\u003cem\\u003e137_08605\\u003c/em\\u003e gene was absent in the isolate, while the \\u003cem\\u003espe\\u003c/em\\u003eC gene was present in some isolates.\\u003c/p\\u003e\\n\\u003cp\\u003eRegarding the 2 isolates that were confirmed as \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eTyphimurium, the results were completely similar to \\u003cem\\u003eS\\u003c/em\\u003e. Enteritidis, so they have the \\u003cem\\u003einv\\u003c/em\\u003eA, \\u003cem\\u003erfb\\u003c/em\\u003eJ, and \\u003cem\\u003elyg\\u003c/em\\u003eD genes, but lack the I\\u003cem\\u003e137_08605\\u003c/em\\u003e gene. In addition, the \\u003cem\\u003espe\\u003c/em\\u003eC gene band was observed only in one isolate.\\u003c/p\\u003e\\n\\u003cp\\u003eAll \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum isolates had the \\u003cem\\u003einv\\u003c/em\\u003eA gene and lack the \\u003cem\\u003espe\\u003c/em\\u003eC,\\u003cem\\u003e\\u0026nbsp;rfb\\u003c/em\\u003eJ, and \\u003cem\\u003elyg\\u003c/em\\u003eD genes, but the I\\u003cem\\u003e137_08605\\u003c/em\\u003e gene was found in all isolates of \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum.\\u003c/p\\u003e\\n\\u003cp\\u003eAccording to these findings, we can claim that typhoid Salmonellas (\\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum and \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum) and non-typhoid Salmonellas (\\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eTyphimurium) in poultry can be genotypically discriminated. Similarly, the \\u003cem\\u003espe\\u003c/em\\u003eC gene can be used to discriminate the \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum serotypes, although further research is required to confirm this claim. However, according to the results, the \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis and \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eTyphimurium serotypes cannot be discriminated with certainty using these 5 genes.\\u003c/p\\u003e\\n\\u003cp\\u003eAccording to the study of Alzwghaibi \\u003cem\\u003eet al.\\u003c/em\\u003e (2018), the \\u003cem\\u003einv\\u003c/em\\u003eA gene was present in all serotypes of Salmonella, the \\u003cem\\u003erfb\\u003c/em\\u003eJ gene only in \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eTyphimurium, the \\u003cem\\u003eslg\\u003c/em\\u003eC gene in two serotypes of \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum and \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum, and the \\u003cem\\u003espe\\u003c/em\\u003eC gene only in \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum (Alzwghaibi \\u003cem\\u003eet al.\\u003c/em\\u003e, 2018). The results of this study are consistent with that of Alzwghaibi \\u003cem\\u003eet al.\\u0026nbsp;\\u003c/em\\u003eregarding the \\u003cem\\u003einv\\u003c/em\\u003eA gene, but inconsistent regarding the \\u003cem\\u003erfb\\u003c/em\\u003eJ gene because in our study, this gene was found in both \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eTyphimurium\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eand\\u003cem\\u003e\\u0026nbsp;S.\\u0026nbsp;\\u003c/em\\u003eEnteritidis serotypes. Regarding the \\u003cem\\u003espe\\u003c/em\\u003eC gene, our study was highly consistent with the mentioned study. In another study by Alzwghaibi \\u003cem\\u003eet al.\\u003c/em\\u003e in 2019, the \\u003cem\\u003einv\\u003c/em\\u003eA gene was present in all four serovars of \\u003cem\\u003eS. enteritidis\\u003c/em\\u003e, \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum, \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum, and \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eDublin, but the \\u003cem\\u003elyg\\u003c/em\\u003eD gene was found only in \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis. The \\u003cem\\u003eslgC\\u003c/em\\u003e gene was seen in the \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum and \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum serovars and the \\u003cem\\u003espe\\u003c/em\\u003eC gene only in \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum (Alzwghaibi \\u003cem\\u003eet al.\\u003c/em\\u003e, 2019). In our study, the \\u003cem\\u003einv\\u003c/em\\u003eA gene was found in all isolates, indicating the consistency of our study with the mentioned one regarding the \\u003cem\\u003einv\\u003c/em\\u003eA gene. In addition, our study was inconsistent with that of Alzwghaibi \\u003cem\\u003eet al.\\u003c/em\\u003e regarding the \\u003cem\\u003elyg\\u003c/em\\u003eD gene because this gene was present in \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis and \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eTyphimurium. However, these studies were highly consistent regarding other genes. In the study of da Cruz \\u003cem\\u003eet al.\\u003c/em\\u003e (2014) performed in Brazil, the \\u003cem\\u003einv\\u003c/em\\u003eA gene was found in all isolates of Salmonella (da Cruz Rocha \\u003cem\\u003eet al.\\u003c/em\\u003e, 2014); this finding is in line with that of this study since the \\u003cem\\u003einv\\u003c/em\\u003eA gene was also observed in all isolates. Pal \\u003cem\\u003eet al.\\u003c/em\\u003e showed that the \\u003cem\\u003eglg\\u003c/em\\u003eC and \\u003cem\\u003espe\\u003c/em\\u003eC genes were present in all isolates of \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum (Pal \\u003cem\\u003eet al.\\u003c/em\\u003e, 2019); this finding is highly consistent with that of our study because we also showed that the\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003espe\\u003c/em\\u003eC gene was present in all isolates of \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum. In a study by Xiong \\u003cem\\u003eet al.\\u003c/em\\u003e (2017), the \\u003cem\\u003elyg\\u003c/em\\u003eD gene was found only in \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis, and the \\u003cem\\u003eflh\\u003c/em\\u003eB only in \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum (Xiong \\u003cem\\u003eet al.\\u003c/em\\u003e, 2017). The results of this study regarding the exclusiveness of the \\u003cem\\u003elyg\\u003c/em\\u003eD gene to\\u003cem\\u003e\\u0026nbsp;S.\\u0026nbsp;\\u003c/em\\u003eEnteritidis are inconsistent with our study because this gene was present in both \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis and \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eTyphimurium serotypes. A study by Xiong \\u003cem\\u003eet al.\\u003c/em\\u003e in 2018 indicated that the I\\u003cem\\u003e137_08605\\u003c/em\\u003e gene was present in two serotypes of \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum (Xiong \\u003cem\\u003eet al.\\u003c/em\\u003e, 2018). This finding is highly consistent with that of our study because we observed the I\\u003cem\\u003e137_08605\\u003c/em\\u003e gene only in \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum and not in other serotypes of Salmonella (\\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis and \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eTyphimurium). Yazdi \\u003cem\\u003eet al.\\u003c/em\\u003e showed that all isolates of Salmonella carried the \\u003cem\\u003einv\\u003c/em\\u003eA gene (Yazdi Amirkhizi \\u003cem\\u003eet al.\\u003c/em\\u003e, 2020). The results of our study regarding the presence of the \\u003cem\\u003einv\\u003c/em\\u003eA gene in all isolates of Salmonella are consistent with that of Yazdi\\u0026rsquo;s study.\\u003c/p\\u003e\\n\\u003cp\\u003eDifferences in the results of our study and similar studies can be attributed to the differences in the origin of samples and the geographic area. For example, the isolates in our study were collected from the liver, cecum, and stool of industrial poultry; the sources of isolates may vary in similar studies and lead to the difference in the results obtained. On the other hand, these differences can be attributed to the genome of Salmonella serotypes; for example, given the time interval between this study and similar studies, some changes may occur in the genome of the studied Salmonella serotypes during this time and result in these differences.\\u003c/p\\u003e\\n\\u003cp\\u003eAccording to the results of this study, multiplex-PCR can be used for the discrimination of typhoid Salmonellas (\\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum) and non-typhoid Salmonellas (\\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis and \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eTyphimurium) in poultry in a short time although genes used in this study cannot discriminate the serotypes \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eTyphimurium\\u003cem\\u003e.\\u003c/em\\u003e In the first step, the genotypes of typhoid Salmonellas and non-typhoid Salmonellas can be discriminated, and the \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum serotypes can be rapidly differentiated in the next step.\\u003c/p\\u003e\\n\\u003cp\\u003eIdentifying the specific genes of \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum, \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum\\u003cem\\u003e,\\u0026nbsp;S.\\u0026nbsp;\\u003c/em\\u003eEnteritidis, and\\u003cem\\u003e\\u0026nbsp;S.\\u0026nbsp;\\u003c/em\\u003eTyphimurium in isolates obtained from the liver, cecum, and stool of poultry can facilitate the discrimination of typhoid Salmonellas (\\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eGallinarum\\u0026nbsp;and \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003ePullorum) and non-typhoid Salmonellas (\\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eEnteritidis and \\u003cem\\u003eS.\\u0026nbsp;\\u003c/em\\u003eTyphimurium) through molecular methods such as PCR in the shortest time. When typhoid Salmonella is diagnosed, the infected poultry is not treated, rather all poultry are destroyed; therefore, rapid detection of these two serovars of Salmonella that are the pathogenic agents of typhoid Salmonella can help eradicate them in developing countries.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgment\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis article is derived from the master thesis in microbiology, pathogenic microbes approved by the Islamic Azad University, Tabriz Branch. The authors would like to give their gratitude to the university officials for their material and moral support.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors state that they have no conflict of interest.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n \\u003cli\\u003eAlzwghaibi, A., Yahyaraeyat, R., Fasaei, B. N., Langeroudi, A. G., \\u0026amp; Salehi, T. Z. (2018). Rapid molecular identification and differentiation of common Salmonella serovars isolated from poultry, domestic animals and foodstuff using multiplex PCR assay. \\u003cem\\u003eArchives of microbiology, 200\\u003c/em\\u003e(7), 1009-1016.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eAlzwghaibi, A. B., Yahyaraeyat, R., Nayeri Fasaei, B., Ghalyanchi Langeroudi, A., \\u0026amp; Zahraei Salehi, T. (2019). Identification and discrimination of Salmonella Enteritidis, S. Pullorum, S. Gallinarum and S. Dublin using Salmonella specific genomic regions amplification assay. \\u003cem\\u003eIranian Journal of Veterinary Medicine, 13\\u003c/em\\u003e(2), 131-142.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eAzizpour, A. (2018). A survey on prevalence of Salmonella enteritidis and Salmonella typhimurium serotypes in broiler flocks of Ardabil province and determination of their antibiotics resistance to five antibacterial agents widely used in the Iranian medical field. \\u003cem\\u003eJournal of Health, 9\\u003c/em\\u003e(2), 143-151.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eda Cruz Rocha, D. C., do Rosario Marinho, A. N., dos Reis, M. d. S. O., Borges, I. R., de Paula Ramos, F. L., \\u0026amp; Loureiro, E. C. B. (2014). Perfil epidemiol\\u0026oacute;gico e caracteriza\\u0026ccedil;\\u0026atilde;o molecular de Salmonella Typhi isoladas no Estado do Par\\u0026aacute;, Brasil. \\u003cem\\u003eRevista Pan-Amaz\\u0026ocirc;nica de Sa\\u0026uacute;de, 5\\u003c/em\\u003e(4), 10-10.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eFardous, J., \\u0026amp; Shamsuzzaman, S. (2015). Detection of\\u003cspan dir=\\\"RTL\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003epotential pathogenic aerobic bacteria from egg shell and egg contents of hen collected from poultry. \\u003cem\\u003eBangladesh Medical Research Council Bulletin, 41\\u003c/em\\u003e(2), 67-72.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eJafari, R., Fazlara, A., \\u0026amp; Dalirannia, A. (2006). An investigation into salmonella contamination of native hens\\u0026apos;eggs in ahvaz.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eMezal, E. H., Sabol, A., Khan, M. A., Ali, N., Stefanova, R., \\u0026amp; Khan, A. A. (2014). Isolation and molecular characterization of Salmonella enterica serovar Enteritidis from poultry house and clinical samples during 2010\\u003cspan dir=\\\"RTL\\\"\\u003e.\\u0026nbsp;\\u003c/span\\u003e\\u003cem\\u003eFood microbiology, 38\\u003c/em\\u003e, 67-74.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eMiranzadeh, H., T Salehi, Z., \\u0026amp; Karimi, V. (2012). The count of aerobic mesophill bacteria and isolate salmonella Spp on egg in Isfahan1389. \\u003cem\\u003eVeterinary Researches \\u0026amp; Biological Products, 25\\u003c/em\\u003e(1), 31-35.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eOnuigbo, E., Iseghohimhen, J., Chah, K., Gyang, M., \\u0026amp; Attama, A. (2018). Chitosan/alginate microparticles for the oral delivery of fowl typhoid vaccine: Innate and acquired immunity. \\u003cem\\u003eVaccine, 36\\u003c/em\\u003e(33), 4973-4978.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003ePal, S., Dey, S., Batabyal, K., Banerjee, A., Joardar, S. N., \\u0026amp; Isore, D. P. (2019). Evaluation of a Multiplex PCR Assay for Rapid Diagnosis of Fowl Typhoid. \\u003cem\\u003eInt. J. Curr. Microbiol. App. Sci, 8\\u003c/em\\u003e(6), 2054-2058.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eQuinn, P. J., Markey, B. K., Leonard, F. C., Hartigan, P., Fanning, S., \\u0026amp; Fitzpatrick, E. (2011). \\u003cem\\u003eVeterinary\\u003c/em\\u003e\\u003cspan dir=\\\"RTL\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003cem\\u003emicrobiology and microbial disease\\u003c/em\\u003e: John Wiley \\u0026amp; Sons.\\u003c/li\\u003e\\n \\u003cli\\u003eSabeghi, M., \\u0026amp; Anzabi, Y. (2019). Determination of serogroup and antibiotic resistance pattern of Salmonellas isolated from commercial laying poultry of Tabriz area. \\u003cem\\u003eVeterinary Clinical Pathology, 13\\u003c/em\\u003e (50)\\u003c/li\\u003e\\n \\u003cli\\u003eXiong, D., Song, L., Pan, Z., \\u0026amp; Jiao, X. (2018). Identification and discrimination of Salmonella enterica serovar gallinarum biovars pullorum and gallinarum based on a one-step multiplex PCR assay. \\u003cem\\u003eFrontiers in Microbiology, 9\\u003c/em\\u003e, 1718.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eXiong, D., Song, L., Tao, J., Zheng, H., Zhou, Z., Geng, S., . . . Jiao, X. (2017). An efficient multiplex PCR-based assay as a novel tool for accurate inter-serovar discrimination of Salmonella Enteritidis, S. Pullorum/Gallinarum and S. Dublin. \\u003cem\\u003eFrontiers in Microbiology, 8\\u003c/em\\u003e, 420.\\u0026nbsp;\\u003c/li\\u003e\\n \\u003cli\\u003eYazdi-Amirkhiz, S., Anzabi, Y., \\u0026amp; Mahmazi, S. (2020). Evaluation of rapid detection and investigation of the \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;presence of spv operon virulence genes in Salmonella isolates using simplex PCR and multiplex PCR molecular methods. \\u003cem\\u003eVeterinary Clinical Pathology, 14\\u003c/em\\u003e(55).\\u0026nbsp;\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"poultry salmonellosis, typhoid Salmonella, non-typhoid Salmonella, rapid detection, multiplex polymerase chain reaction\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-2357502/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-2357502/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eThe Salmonella serotypes are detected mainly through traditional microbiologic methods, which are associated with problems. The invention of rapid molecular detection methods has somewhat resolved these problems. This study aimed to assess the possibility of rapid detection of typhoid and non-typhoid Salmonellas in poultry using the multiplex polymerase chain reaction (PCR). A total of 40 isolates of Salmonella from \\u0026nbsp;industrial poultry were collected veterinary laboratories in Tabriz, Iran. After microbiological and serological tests, we confirmed that 27 out of 40 isolates belonged to the \\u003cem\\u003eSalmonella entrica\\u003c/em\\u003e species. Differential tests revealed that 15, 7, 2, and 3 isolates were \\u003cem\\u003eSalmonella \\u003c/em\\u003eGallinarum, \\u003cem\\u003eSalmonella \\u003c/em\\u003eEnteritidis, \\u003cem\\u003eSalmonella \\u003c/em\\u003eTyphimurium,\\u003cem\\u003e \\u003c/em\\u003eand \\u003cem\\u003eSalmonella \\u003c/em\\u003ePullorum, respectively. We then used specific primers to multiply the genes \\u003cem\\u003einv\\u003c/em\\u003eA, \\u003cem\\u003erfb\\u003c/em\\u003eJ, \\u003cem\\u003elyg\\u003c/em\\u003eD, I\\u003cem\\u003e137_08605\\u003c/em\\u003e, and \\u003cem\\u003espe\\u003c/em\\u003eC. The 27 isolates were then genotypically analyzed through multiplex-PCR. The results showed that all 27 isolates and the standard strains of all 4 bacteria carry the \\u003cem\\u003einv\\u003c/em\\u003eA gene, while this gene was absent in 13 non-Salmonella isolates. The I\\u003cem\\u003e137_08605\\u003c/em\\u003e gene was present in all isolates and the standard strains of \\u003cem\\u003eS. \\u003c/em\\u003eGallinarum and\\u003cem\\u003e S. \\u003c/em\\u003ePullorum\\u003cem\\u003e;\\u003c/em\\u003e the \\u003cem\\u003erfb\\u003c/em\\u003eJ and \\u003cem\\u003elyg\\u003c/em\\u003eD genes were present in all isolates of \\u003cem\\u003eS\\u003c/em\\u003e. Enteritidis and \\u003cem\\u003eS. \\u003c/em\\u003eTyphimurium and their standard strains; and the \\u003cem\\u003espe\\u003c/em\\u003eC gene was present in all isolates of\\u003cem\\u003e S. \\u003c/em\\u003eGallinarum and some isolates of \\u003cem\\u003eS. \\u003c/em\\u003eTyphimuriumand \\u003cem\\u003eS\\u003c/em\\u003e. Entritidis and their standard strains. It seems that typhoid Salmonellas of poultry, \\u003cem\\u003ei.e.\\u003c/em\\u003e,\\u003cem\\u003e S. \\u003c/em\\u003eGallinarum\\u003cem\\u003e \\u003c/em\\u003eand \\u003cem\\u003eS. \\u003c/em\\u003ePullorum, can be discriminated from non-typhoid Salmonellas through the multiplex-PCR molecular method.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Rapid Detection of Typhoid Salmonellas (Salmonella Gallinarum and Salmonella Pullorum) and non-Typhoid Salmonellas (Salmonella Enteritidis and Salmonella Typhimurium) in Poultry through Multiplex-PCR Molecular Method\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2022-12-12 16:02:02\",\"doi\":\"10.21203/rs.3.rs-2357502/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"895b9bce-28aa-4797-be53-18cf70a69d40\",\"owner\":[],\"postedDate\":\"December 12th, 2022\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2023-02-20T09:14:21+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2022-12-12 16:02:02\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-2357502\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-2357502\",\"identity\":\"rs-2357502\",\"version\":[\"v1\"]},\"buildId\":\"7rjqhiLT3MXkJMwkYKINL\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}