{"paper_id":"326da488-0423-44e8-82c3-a3dcac93f494","body_text":"Novel avian metapneumovirus subtype C is a newly emerged pathogen causing hydrosalpinx fluid syndrome in Sheldrake ducks in China | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Novel avian metapneumovirus subtype C is a newly emerged pathogen causing hydrosalpinx fluid syndrome in Sheldrake ducks in China Qiu-ling Fu, Wei-wei Wang, Wen-long Jiao, Tao Zeng, Shen Cao, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6720429/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Since 2021, an epidemic disease characterized with hydrosalpinx fluid syndrome (HFS) has been circulating in the breeding and laying Sheldrake ducks in China, which seriously endangers the healthy development of the duck industry. The pathogen of the disease was tract to avian metapneumovirus subtype C (aMPV/C) causing egg-drop and acute upper respiratory diseases in poultry. To date, no further reports have been made to isolate and characterize aMPV/C infection in Sheldrake ducks in China. In this study, a strain of virus (named as aMPV-FJ21) was isolated from diseased Sheldrake ducks exhibiting HFS using Vero cell line. Transmission electron microscopy showed that the strain was an enveloped virus with spherical or multiple morphologies. The immunofluorescence assay revealed that the virus strain aMPV-FJ21 had an obvious reactive activity with the ploy-antibody against aMPV/C F protein. The genome sequence of aMPV-FJ21 was 14149 nucleotides (nt) in length, sharing 87.1%-95% nt similarity to that other aMPV/C strains, and yet the G protein of the strain was only 55.6%-78.8% identical to that of aMPV/C strains. Phylogenetic analysis showed that aMPV-FJ21 formed an independent branch of aMPV/C and had a distant genetic relationship with other aMPV/C strains, suggesting that it might represent a new genetic lineage. In vivo challenge experiments demonstrated that aMPV-FJ21 induced clinical symptoms similar to those of natural cases in laying Sheldrake ducks, with a reduction of approximately 15% in the average of daily egg production. In addition, aMPV-FJ21-infected ducks shed progeny virions via tears for the longest period (22 days). Detection of tissue distribution of viral RNA showed that the viral RNA exhibited higher expression in non-parenchymatous tissues than in parenchymatous tissues. Altogether, we isolated a new lineage of aMPV/C from Sheldrake ducks with HFS and confirmed that the virus is the real agent responsible for HFS in Sheldrake ducks for the first time, which provides basic data for further study of the pathogenic mechanism of the virus. Avian metapneumovirus subtype C Sheldrake ducks egg-drop hydrosalpinx fluid genome Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Introduction Avian metapneumovirus (aMPV) is an enveloped virus containing a single-stranded, negative-sense RNA genome and belongs to the genus Metapneumovirus in the subfamily Pneumovirina of the family Paramyxoviridae , as does human metapneumovirus (hMPV) [ 1 ]. The aMPV genome was found to be approximately 13.1 to 14.1 kb in length and encodes eight proteins in the order of 3’-N-P-M-F-M2-SH-G-L-5’ [ 2 ]. The glycoprotein (G) is considered to be suitable for analysis of genetic variation in aMPV viruses due to high level of diversity in nucleotide (nt) and amino acid (aa) sequences [ 3 , 4 ]. Based on the antigenic and genetic features, aMPV was formally classified by the International Committee of Virus Taxonomy (ICTV) into four subtypes: aMPV/A, aMPV/B, aMPV/C and aMPV/D [ 1 ]. aMPV/A and aMPV/B were known as the original and most prevalent subtypes [ 4 , 5 ]. aMPV/C has been divided into two distinct phylogenetic lineages, the North American and Eurasian lineages [ 6 , 7 ]. The North American lineage of aMPV/C was first discovered in commercial turkeys in the United States in 1996 [ 8 ], following reports in various wild birds from the North America such as American black ducks ( Anas rubripes ), American wigeons ( Mareca americana ), Northern shovelers ( Spatula clypeata ), wood ducks ( Aix sponsa ), snow geese ( Anser caerulescens ), Canadian geese ( Branta Canadensis ), ring-billed gulls ( Larus delawarensis ), house sparrows ( Passer domesticus ), barn swallows ( Hirundo rustic a), European starling ( Sturnus vulgaris ), blue-winged teals ( Spatula discors ) and wild mallards ( Anas platyrhynchos ) and so on [ 7 , 9 – 11 ]. The other lineage of this subtype has been reported in Europe and Asia such as France, China, Netherlands, Canada and Italy [ 7 , 12 – 19 ]. Interestingly, it exhibits greater susceptibility in ducks as opposed to turkeys [ 7 ]. Conversely, aMPV/D was geographically restricted to France [ 17 ]. In 2019, two novel divergent aMPV strains have been discovered in monk parakeets ( Myiopsitta monachus ) and great black-backed gulls ( Larus marinus ) [ 18 , 19 ], awaiting for formal classification by the ICTV. In China, the occurrence of aMPV/C in Muscovy ducks was first reported exclusively in 2014, with no reports of aMPV/C isolation from waterfowl [ 14 ]. By March 2021, we have first found aMPV/C infections reappearing in laying ducks from several southern regions of China, with distinct clinical signs characterized by chylous hydrosalpinx fluids, hemorrhagic, edematous, thickened mucosa and egg drop (10%-30%), which we tentatively named as “hydrosalpinx fluid syndrome” (HFS) [ 20 ]. Subsequently, similar disease occurred in Jinding ducks from northeastern China and the same causative agent was suggested by molecular evidence [ 21 ]. In addition, a recent case of aMPV/C infection with upper respiratory syndrome in Cherry Valley ducks has been reported [ 22 ]. On the basis of the G gene of all aMPV/C strains that have been reported in China, they are all members of the Eurasian lineage of aMPV/C. Here, we have isolated and characterized a subtype C aMPV strain, aMPV-FJ21, from the laying Sheldrake ducks with HFS in China and confirmed that aMPV/C is the causative agent of this disease. Subsequently, we then further analyzed its genetic and phenotypic characteristics and evaluated its pathogenicity specifically in laying Sheldrake ducks and found that aMPV-FJ21 is classified to a new genetic lineage of aMPV/C, which is also divergent from the strain (HL1) isolated from Jinding ducks with the similar clinic characters from the northeastern China. Our findings suggest that a novel aMPV/C strain has been circulating in Chinese poultry, accompanying with genetic variation, and that effective strategies should be taken immediately to prevent the spread of the virus. Materials and methods Ethical Statement The experimental procedures involving animals in this study were ethically approved by the Experimental Animal Management Committee of Fujian Academy of Agricultural Sciences in accordance with established animal welfare guidelines (Approval No.MYLISC2024-016). Sample Collection and Bacterial Culture Fresh tissues (such as hydrosalpinx fluids, oviducts, folliculus and air sac) were collected from the sick or dead Sheldrake ducks. The collected samples were used for bacterial culture and isolation. For bacteriological diagnosis, the hydrosalpinx fluids or oviduct samples from dead Sheldrake ducks were inoculated onto tryptic soy agar plates (BD Science, MD, USA) containing 2% fetal calf serum (FBS; Gibco, New York, USA) and incubated at 37 ℃ for 48 h. The oviducts were then mixed and ground in physiological saline to make 10% (wt./vol.) suspension. After freezing and thawing three times, the suspensions and hydrosalpinx fluids were clariﬁed by centrifugation at 8,000×g for 10 min at 4 ℃, and then serially ﬁltered through 0.22 μm ﬁlters (Millipore, Bedford, MA, USA). The filtrates were used immediately for RNA extraction or virus isolation. Virus detection and isolation Total DNA and RNA were extracted separately from the homogenized tissues using an EasyPure® Viral DNA/RNA Kit according to the manufacturer’s instructions (TransGen Biotech Co., Ltd., Beijing, China). DNA and RNA were subjected to PCR or RT-PCR for the detection of potential pathogens, such as aMPV/C [20, 23], avian influence virus (AIV) [24], avian tembusu virus (ATMUV) [25], egg drop syndrome-76 virus (EDSV-76) [26], duck plague virus (DPV) [27], avian paramyxovirus (APMV) [28] and duck hepatitis A virus type 1 (DHAV-1) [29], respectively (Table 1). PCR/RT-PCR kits were purchased from Takara Biotechnology Co., Ltd (Dalian, China). The amplified PCR fragments were sequenced by Sangon Biotech Co., Ltd (Shanghai, China). One of the isolated virus samples, which was designated aMPV-FJ21, was inoculated into the African green monkey kidney cell line (Vero, ATCC) at 80% confluence in a 6-well plate. The supernatant was discarded after 1.5 hours post infection (hpi). The aMPV-FJ21 virus isolate was then added to the DMEM medium (Gibco, New York, USA) containing 1% FBS. Infected cells were blindly passaged every 5-6 days. At 7 days postinfection (dpi), CPEs were quantified and virus titer was determined as the 50% tissue culture infectious dose (TCID 50 ) per 0.1 mL according to the Reed and Muench method. Meanwhile, the viral antigen was detected by indirect immunofluorescent assay (IFA). Table 1. Primers were used for detection in this study Primer name Sequence (5’–3’) Target Reference aMPV/C-F ACACCTCCTACAGTGCTACTAGAGCAGC M gene of aMPV/C (631 bp) 23 aMPV/C-R ACTTCAGGACATATCTCGTACCCTGG AIV-F AGR a CCTTGYTTCTGGGTTGA N gene of AIV (126 bp) 24 AIV-R ACCGTCTGGCCAAGACCA TMUV-F GCCACGGAATTAGCGGTTGT E gene of TMUV (401 bp) 25 TMUV-R TAATCCTCCATCTCAGCGGTGTAG EDSV-F TTGGCGTCTTCAAGGCACTG Hexon gene of EDSV (238 bp) 26 EDSV-R CACACAACTGCATCTGACTG DPV-F GGCTGGTATGCGTGACAT DNA polymerase gene of DPV (602 bp) 27 DPV-R GTATTGGTTTCTGAGTTGGC APMV-F TGACATTTGACAAG M gene of APMV (196 bp) 28 APMV-R CTCCAGAGTATCTTAG DHAV-1-F ACAATGACCCAGCCTTAG RNA polymerase gene of DHAV-1 (440 bp) 29 DHAV-1-R CCACTGTATCTTCCCTTC a Codes for ambiguous bases position and NTP analogues: R = A/G. Transmission electronic microscope (TEM) To observe viral particles, subconfluent monolayers of Vero cells infected with the strain aMPV-FJ21 for 72 h were obtained, pre-fixed in 3% glutaraldehyde (Sigma-Aldrich, Kenilworth, USA) at 4 °C, and then fixed in 1 % osmium tetroxide (Sigma-Aldrich, Kenilworth, USA) for 2 h after two washes with 0.1 mol/L PBS. The fixed cells then processed through an ethanol gradient, dehydrated in acetone, and cut into ultrathin 50 nm sections. After staining with uranium acetate and lead citrate (Sangon Biotech, Shanghai, China), the ultrathin sections were observed and photographed using a transmission electron microscope (TEM, H-7500, Hitachi, Japan). Additionally, four hundred milliliters of virus propagated in Vero cells was obtained, centrifuged at 10,000× g for 10 min to pellet large cellular debris, and then centrifuged again at 45,000× g for 3.5 h at 4 ℃ to obtain the virus. The purified virus was then placed on a copper grid, negatively stained with 3% phos-photungstic acid, and also observed and photographed by TEM as described by Sun et al [14]. Viral genome sequencing and analysis To determine the full-length nucleotide sequences of the virus, an illumina system (HiSeq 2000, BGI, Hong Kong) was used to obtain the entire complete genome of the strain aMPV-FJ21. Paired-end libraries were generated, and multiple virus samples were sequenced in a single lane. The obtained reads were used to assemble the virus genome against the available aMPV/C nucleotide sequences of strain 99178 (HG934338.1). Based on the nucleotide sequences of strain 99178, a set of primers were designed to amplify and proofread the complete genome sequence of the isolate (Table 2). PCR products of expected length were sequenced directly or cloned into the pEASY-T1 cloning vector (TransGen, Beijing, China) according to the manufacturer’s instructions and sequenced at Sangon Biotech Co., Ltd. (Shanghai, China). Nucleotide and amino acid sequences were assembled using Lasergene 11 (Madison, WI, USA), and multiple-sequence alignment was performed with the Clustal W (BioEdit version 7) program, and online alignment in NCBI-BLAST software ( https://blast.ncbi.nlm.nih.gov/Blast.cgi ). A neighbour-joining (NJ) tree based on the full genome and G amino acid sequences was constructed using the MEGA9.1 program. The robustness of the NJ tree was evaluated with a bootstrap analysis of 1,000 replicates. Table 2. Primers used to amplify the full genomic sequence of strain aMPV-FJ21 Primer Location (bp) Upstream primer (5’–3’) Downstream primer (5’–3’) Length (bp) 1-1365 ACGAGAAAAAAACGCATATAAGATAAC TGTCCTCCTATGTCCTACTT 1365 1189-2557 CTGAGAACTTCCTTAACATAAATG AAACTTTGAGACCATACCATAA 1369 2447-3766 TCGGTAGCACTAGATGATTAC GTTGATTTGTCCTGAAGATGT 1320 3636-5084 GATTCCTCAATGTGGTAAGAC ATGACAACACTAAGTTATGTAGAG 1449 4922-6316 GTCCAGAACTACATTGATAACA TGACTCCACATACATGATAGA 1395 6161-7492 GTAGAGAATGTTGGCAAGTC TGTTGTGTTGTTCCTTTCAG 1332 7284-8727 CACCAACAAAGCAAGAACAC ACTGAGCATAGAGTCAACAAT 1444 8619-10034 GTGGATCAGTAACAGTCTTAAC TCAATGTCATACACTCCTTCT 1416 9905-11206 CAGATGTAGTTGATGAATTGC CTTCTCCATTGATTGCTGAT 1302 11065-12446 ATTACACCAGTCTATCCACAT AACATCCTCCAGAATGAATTG 1382 12283-13626 GTTACGGATCATGCCTTTATAG TTCAACAGCCTTCACTTCTA 1344 13488-14139 ATCAGAGTGCTATGTCCTTC AAACCGTATTCATCCAATTTTG 652 Amino acid mutation of G protein and recombination analysis The characteristics of amino acid mutations were analyzed by means of comparing the amino acid sequences of the aMPV/C G genes utilizing the Clustal W module embedded in the DNASTAR software. Several bioinformatics tools and methods were used to analyze the recombination events of aMPV/C. The full genome sequences of isolates aMPV-FJ21, 9917 and a variety of representative MPV strains were downloaded from the GenBank database and then sequence alignment was performed using MEGA software to ensure high quality and consistency. After alignment, the RDP5.64 software ( Recombination Detection Program 5, http://web.cbio.uct.ac.za/ ~darren/rdp. html ) was used to perform preliminary detection of restructuring events. To validate the preliminary results, SimPlot 3.5.1 software ( https://www.softpedia. Com/get/Science-CAD/SimPlot.shtml ) was applied for rechecks. Indirect immunofluorescent assay (IFA) For indirect immunofluorescent assays (IFA), Vero cells in 96-well plates (1×10 5 cells/well) were infected with the strain aMPV-FJ21 (10 5 TCID 50 ) for 72 h. The cells were then fixed with pre-cooled 4% paraformaldehyde (Sigma-Aldrich, Kenilworth, USA) in PBS for 15 min at 4 °C and permeabilized with 0.1% Triton X-100 (Sigma-Aldrich, Kenilworth, USA) and in 2% BSA (Beyotime, Shanghai, China) in PBS for 30 min. The fixed cells were then incubated with a mouse anti-aMPV/C-F poly-antibody (1:100) produced in our laboratory for 1.5 h at 37 °C. After washing with PBS containing 0.05% Tween-20 (PBST), the cells were incubated with secondary 488-conjugated anti-mouse (1:1000, Beyotime, Shanghai, China) for 2 h at 37 °C. Finally, all cells were washed with PBST and observed under a Nikon AIR confocal immunofluorescence microscope (Nikon Instruments, Inc., Melville, NY, USA). Animals for in vivo experiments In this study, eighty 145-day-old Sheldrake ducks with laying rate ≥50% were obtained from Longyan Shan Partridge ducks breeding farm (Longyan, Fujian, China), all of which were confirmed to be free of antibodies and antigens against several viruses, including aMPV/C, AIV, ATMUV, EDSV and DPV. Throughout the experimental period, the experimental ducks were maintained in an isolated environment and provided with food and water ad libitum . After 10 days of acclimatisation to the new environment to minimise the effects of transport stress, the ducks were used for the animal regression experiment. A total of 80 ducks were randomly divided into two groups. The experimental group (group 1) consisted of ducks were challenged with 1.5 mL of the F5-cell-passaged aMPV-FJ21 (10 5.0 TCID 50 /mL) by cloacal injection and 0.5 mL of virus instilled into each nose using a micropipette. Ducks in the second group (group 2) were inoculated with a non-infected Vero cell suspension and was used as a negative control. Additionally, five ducks marked with numbers (1-5) were selected from each group as group 3 and group 4 to detect virus shedding. Nasal, eye, throat and cloacal swabs were collected from each duck in group 3 and 4, which were tested for virus shedding at 0, 1, 3, 7, 10, 14, 22 and 28 dpi. Egg production, survival and clinical signs of the remaining ducks in groups 1 and 2 were assessed daily. Five ducks were randomly selected from the inoculated and control groups and euthanatized using carbon dioxide inhalation at 7 and 14 dpi. Samples of the heart, liver, spleen, lung, kidney, larynx, trachea, air sac, thymus, pancreas, intestine, bursa of Fabricius, foliiculi, oviduct, brain, and Harderian gland were collected for virus detection. Oviduct and air sac samples were collected for histopathological analysis and immunohistochemistry (IHC). For immunohistochemical analysis, a mouse anti-aMPV/C F poly-antibodies (1:200) was used as the primary antibody. Data Analysis The ratio (R) of the relative reduction in egg production was calculated as the average egg production of the infected ducks (P) minus the average egg production of the control ducks (N) divided by the average egg production of the control ducks (N), in other words, R=(P-N)/N×100%. GraphPad 8 was utilized for the organization and analysis of experimental data, which included egg production and viral load of the ducks. Significant differences were determined using t -tests and non-parametric tests in GraphPad 11.0 (San Diego, CA, USA), with a significance level set of p <0.05. Results Case history, microbiological examination, and virus isolation of the field samples From March 2021 to date, Sheldrake ducks with high egg production rates (≥85%), suddenly occurred in some duck flocks in Fujian, Guangdong, Anhui, Shandong province and Guangxi Municipality of China, and its morbidity and mortality rates were about 30% and 15%, respectively. The epidemic disease occurred during the cold and wet seasons, mainly in the spring, autumn and winter alternating. The diseased ducks presented coughing, mental depression, lying on the ground within 9-14 dpi and reduction of egg production by approximately 10%-30%. At necropsy, yellow mucosa was observed in the larynx of ducks with respiratory symptoms (Figure 1B). There were also yellow necrotic dots in the air sac and pancreas (data not shown). And accumulation of chylous fluid or conglobulated egg albumen appeared in the oviduct in accompany with hemorrhagic, edematous, and thickened mucosa (Figures 1D). There were sporadic cases of haemorrhagic folliculus (Figures 1H), oviductal obstruction and blockage of egg laying, which was provisionally named “Hydrosalpinx Fluid Syndrome (HFS)”. Tissue samples were collected from the ducks with HFS, no virulent bacteria were isolated, and the samples were tested negative for AIV, ATMUV, EDSV, DPV, APMV-1 and DHAV-1, but positive only for aMPV/C as determined by (RT-) PCR assays (data not shown). A 631-bp fragment was produced by RT-PCR amplification and sequence analysis showed that the 631-bp fragment shared a 95.5% nucleotide identity with the representative aMPV/C strain 99178 in the M gene. The virus was isolated in Vero cells, and the cells were harvested on 5-6 dpi. Compared to the mock cells, typical cytopathic effects (CPEs) were observed in aMPV/C infected cells after the fifth passage at 48 hpi. The infected cells initially became round and almost 70% of the cells became deciduous at 96 hpi (Figure 2). The growth curve of aMPV-FJ21 in Vero cells showed that the viral titer increased rapidly at 3 and 4 dpi, peaked on 6 dpi and then declined (Figure 3). The results of immunofluorescence detection showed that the virus-infected Vero cells exhibited obvious green fluorescence signals, whereas no fluorescence signal was detected in the uninfected control cells (Figure 4). Taken together, our findings revealed that the isolate, aMPV-FJ21, which was able to bind the poly-antibody to the F protein of the aMPV/C and produce a typical CPE in Vero cells, was an aMPV-like enveloped virus, and the best viral replication phase was at approximately 6 dpi in Vero cells. Virus morphology aMPV-FJ21 was serially cultured in Vero cells for 5 passages and then identified by TEM. The virus showed an irregular, spherical, long filamentous shape with a length of almost 1000 nm (Figure 5A). Enveloped virus particles with a diameter of 20-500 nm presented in the purified samples (Figure 5B-C), similar to that of aMPV. Genomic character of aMPV-FJ21 The complete genomic length of aMPV-FJ21 was determined to be 14149 nucleotides (nt) (GenBank accession number: PQ634415). The GC content of aMPV-FJ21 (41.32%) was similar to that of aMPV/C. The genomic nucleotide identity of aMPV-FJ21 with the representative aMPV/C strain 99178 (HG934338) was 95.0%. The sequence of aMPV-FJ21 also shared 87.1%-95.0%, 67.8%-68.3%, 59%-60.8%, 60.3%-60.5%, 59.8%, 62%, 62.5% and 41.8% nucleotide identities with that of aMPV/C, hMPV, aMPV/A, aMPV/B, aMPV/D, the potential new aMPV subtype strains PAR-05 (MK491499) and GuMPV_B29 (MN175553) and mice pneumovirus, respectively (Table 3). Compared with the full genomes of aMPV and hMPV, the results show that aMPV-FJ21 has a similar viral genomic structure and a consistent length of major viral protein genes to aMPV/C strains in ducks, such as strains 99178, S-01 (KF364615), and HL1 (OR365551), whereas the deduced amino acid sequence length of the L gene was longer than that of strain 15a (DQ009484) in geese, as well as the aa sequence length of the G gene longer than that of aMPV/C in turkeys or pheasants. The length of M remained the most conservative until the new aMPV subtype strain PAR-05 was found (Figure 6). Additionally, the lengths of the N, P, M and M2 genes exhibit remarkable stability between aMPV/C and hMPV. A high degree of amino acid sequence homology was found in other all seven of the proteins except for the G gene among the other fully sequenced aMPV/C. The sequencing data placed aMPV-FJ21 in the C subtype of aMPV. The amino acid sequence homology also indicated that aMPV-FJ21 was more homologous to hMPV than other aMPV including the potential new aMPV subtype, except for the G gene (Table 3). The phylogenetic tree based on the whole genomes or G protein of 39 representative strains downloaded from the GenBank database (13 strains of aMPV/C, 8 strains of hMPV, 6 strains of aMPV/A, 7 strains of aMPV/B, 1 strain of aMPV/D, 2 strains of mice pneumovirus, 2 strains of the potential new aMPV subtypes) indicated that aMPV-FJ21 belongs to aMPV/C, but is in a new genetic evolutionary branch and divergent from all the aMPV/C strains reported (Figure 7). In this paper, it is firstly reported that the strain aMPV-FJ21, isolated from Sheldrake ducks with hydrosalpinx fluid syndrome in Southeastern China, belongs to the aMPV/C family, but originated from a new lineage of aMPV/C. Table 3. Comprehensive genomic and amino acid homology comparison of the strain aMPV-FJ21 with other viruses Name Similarity to aMPV-FJ21 (%) aMPV/C hMPV aMPV/A aMPV/B aMPV/D New aMPV(MK491499) New aMPV(MN175553) MPV Genome 87.1-95.0 67.8-68.3 59-60.8 60.3-60.5 59.8 62 62.5 41.8 Nucleocapsid, N 93.6-96.2 88.9-89.6 70.7-71.4 71.4-71.7 73.7 72 84.1 43.7-43.9 Phosphoprotein, P 91.8-95.1 67.5-68.5 56.5-57.9 55.6-55.9 56.5 59.1 62.7 30-30.4 Matrix protein, M 94.7-95.7 87.1-87.8 78 78-78.8 78.4 82 85.5 39.8 Fusion protein, F 92.8-95.5 80.9-81.8 72.9-73.8 72.9-73.2 73.2 74.2 79.9 41.1-41.5 Second matrix-1, M2-1 94.2-96.0 82.2-83.8 7.12-72.4 74.6-75.1 72.4 75.1 77.3 38.1 Second matrix-2, M2-2 92.6-96.3 56.9-53.8 20.8-23.6 22.2-23.6 23.6 33.3 33.3 15.3 Small hydrophobic, SH 88.2-93.5 26.3-28.6 17.4 22.2-24.2 20 24.6 15.9 16.1-16.5 Glycoprotein, G 55.6-78.8 24.1-26.7 44.9-46.2 22.8-24.2 25.8 22.7 22.1 18.1 Large polymerase, L 93.1-95.6 80.6-80.9 64.1-64.3 64.3-64.5 64 62.7 69.6 50.4-50.5 Amino acid mutation of aMPV G proteins and recombination analysis The G gene of aMPV-FJ21 contained a major ORF of 585 aa, which was as long as published duck and goose isolates of aMPV/C, while the amino acid sequence length of the G protein was >2 times longer than that of the turkey aMPV/C strain USA-Colorado (252 aa) or pheasant aMPV/C strain PL-1 (264 aa), and was also the longest G gene in all Pneumovirinae sequenced to date. Furthermore, its membrane anchor is consists firstly of a cytoplasmic tail (30 aa) at the N-terminus and secondly of a trans-membrane domain (24 aa), followed by a long extracellular domain (55 aa-585 aa). Alignments of the seven G aa sequences available from aMPV/C isolates revealed relatively conserved cytoplasmic and trans-membrane domains within the aMPV/C lineages, also conserved in the two hMPV isolates, but without continuous conserved aa in cytoplasmic and trans-membrane domains of other subtypes of aMPV (Figure 8). Although the cytoplasmic and trans-membrane domains were conserved in aMPV/C strains, yet aMPV-FJ21 had 7 aa mutations in cytoplasmic and trans-membrane domains, which was more mutations than other members of aMPV/C. Additionally, the extracellular domain of the G protein indicated a clear compartmentalisation into an initially mutable and disordered region and then a conserved and ordered region rich in cysteine residues and closed to the C-terminus a clear compartmentation into firstly mutable and disordered region and then a conserved and ordered region, which was rich in cysteine residues and closed to the C-terminus (Figure 8). In pairwise alignments, the G aa sequence of aMPV-FJ21 shared only 55.6%-74.5% aa identity with the North American aMPV/C lineage, and 74.5%-78.7% with the Eurasian lineage, and at best 46.2% total aa identity with the G proteins of other aMPVs or hMPVs (Figure 8). Combined analysis of RDP4 and Simplot revealed no recombination events in aMPV-FJ21 (data not shown). Although strains aMPV-FJ21 and 99178 share 95% nucleotide homology, rather than the genetic differences between them due to mutations restructuring events. Pathogenicity of strain aMPV-FJ21 in laying Sheldrake ducks To evaluate the pathogenicity of strain aMPV-FJ21, clinical signs were observed daily in 155-day-old laying Sheldrake ducks inoculated with aMPV-FJ21. Infected laying ducks (group 1) exhibited mild upper respiratory tract cough, which appeared on dpi 3 and disappeared on dpi 8. No death occurred throughout the experimental period in any groups. As shown in Figure 9, the average egg-laying rates of each three days in the infected laying ducks (group 1) were 61.1%-74.67% during 6 dpi to 27 dpi, while it was 75.56%-88.07% in the uninfected control group. According to the formula [R=(P-N)/N×100%]), the ratio of relative reduction in egg laying during this period of time was 9.84%-22.18%. To 30 dpi, the average egg laying rate per three days in the infected group had almost recovered to the level of the control group. Moreover, necropsies revealed similar regression (Figure 1C, F and I). To detect viral shedding in aMPV-FJ21-infected ducks, viral RNA extracted from nasal, eye, throat and cloacal swabs were evaluated via RT-qPCR at 1, 3, 7, 10, 14, 22, 28 dpi. The results showed that viral shedding started at 1 dpi in nasal, eye, throat and cloacal swabs and continued via tears up to 22 dpi. Shedding in eye swabs was observed for the longest time (22 days), and the highest rate of shedding was at 1-7 dpi, at which point it reached 100%, then in nasal swabs for 14 days, yet shedding in throat swabs was the shortest time at 7 days (Table 4). Ducks in the control group were negative for aMPV/C. Table 4. Viral shedding of the strain aMPV-FJ21 in infected ducks Viral shedding The positive of RT-qPCR(%) on serial days postinfection 0 dpi 1 dpi 3 dpi 7 dpi 10 dpi 14 dpi 22 dpi 28 dpi Eye swabs 0 100 (5/5) 100 (5/5) 100 (5/5) 40 (2/5) 20 (1/5) 20 (1/5) 0 Nose swabs 0 100 (5/5) 80 (4/5) 40 (2/5) 20 (1/5) 20 (1/5) 0 0 Throat swabs 0 100 (5/5) 80 (4/5) 20 (1/5) 0 0 0 0 Cloacal swabs 0 100 (5/5) 60 (3/5) 40 (2/5) 20 (1/5) 0 0 0 To evaluate the distribution of aMPV-FJ21 in different tissues, viral RNA was extracted from 17 tissues at 14 dpi and detected using real-time qPCR. The results showed the viral RNA were detectable in all examined tissues, although their viral contents differed among the various tissues. Viral RNA was more highly expressed in the non-parenchymatous tissues, such as oviduct, bursa of Fabricius, air sac, lung, trachea and intestine, than that in the parenchymatous tissues (pancreas, spleen, kidney, heart, liver, brain, thymus, and Harderian gland), with the highest levels in hydrosalpinx fluid and the lowest levels in the brain (Figure 10). Histopathological analysis using hematoxylin and eosin staining showed that the oviduct and air sac showed obvious changes in ducks infected with aMPV-FJ21. Hemorrhage, congestion and severe inflammatory cell infiltration were observed in the fallopian tubal mucosal lamina propria and submucosa of the folds of the oviductal mucosa and similar lesions in the air sac, except for hemorrhage. No significant abnormalities were observed in the uninfected control group. IHC results showed that a strong brown staining signal was observed in the oviduct and air sac infected with aMPV-FJ21 (Figure 11). These results indicated that aMPV-FJ21 successfully infected the oviduct and air sac. Discussion The co-circulation of classical and emerging avian diseases in the Chinese duck industry remains a challenging situation, mainly due to the insufficient application of biosafety protection measures and genetic variations of pathogens. Although considerable attention has been paid to classical diseases such as AIV [30], ATMUV [25, 31], EDSV-76 [32], DPV [33], APMV [34], DHAV-1 [29] and various bacterial infections [35] in laying ducks, the prevalence of metapneumovirus in laying duck flocks has been largely ignored. Avian metapneumovirus subtype C (aMPV/C) was originally documented in turkeys with severe upper respiratory disease in the United States in 1996 [8]. Since its emergence, the occurrence of this disease has surged and undergone a geographic expansion [12-14, 36]. In China, there was only one report of aMPV/C in Muscovy ducks in 2014 [14], with no further reports of its isolation from other waterfowl in the Asian region. However, from March 2021, we found a severe viral disease caused by aMPV/C widespread around the laying-duck-producing regions of China [20]. Subsequently, Yu et al. also provided molecular evidence for aMPV/C as the cause of HFS in the local duck breeds, with no evidence of virus acquisition [21]. In this study, we successfully characterized and isolated an aMPV/C strain aMPV-FJ21 from an outbreak of laying Sheldrake ducks with HFS in southeastern China and determined that the strain aMPV-FJ21 belongs to a new lineage of aMPV/C. Together with the data on the previous characterization of aMPV/C in Muscovy ducks and Cherry valley ducks with upper respiratory symptom in China [22], the present study not only confirms the occurrence of the virus in Sheldrake ducks, but also suggests that aMPV/C infection might be widespread in Chinese duck flocks, accompanying with genetic variation and various pathogenic phenotypes. Our research is the first to report showing that a new lineage of aMPV/C was responsible for the epidemic occurring in Sheldrake ducks in China. Sequencing and analysis of the G protein from the strain aMPV-FJ21 revealed its closest genetic similarity (approximately 78%) to identity with that of the French isolate 99178 in Muscovy ducks, and also similar with the Chinese isolate S-01 in Muscovy ducks [14], however, it seems extremely low as an ancestor of aMPV-FJ21. Notably, the G protein of aMPV-FJ21 shared less homology with the strain HL1, which was isolated from Jinding ducks with HFS in northeastern China, with only 74.2% identity [21]. Additionally, the strain aMPV-FJ21 was classified as a new lineage of aMPV subgroup C based on phylogenetic analysis of the G gene and the full genome, and divergent from all the duck-originated strains. This may suggest that aMPV-FJ21 and HL1 or S-01 originated from different ancestor, indicating that the situation of aMPV/C infection in China is complex and the distribution of the virus is highly diverse. The relationship between aMPV-FJ21 and S-01 or HL1 needs more surveillance studies. Previous researches have revealed that wild birds, especially wild mallards, may be involved in the transmission of the aMPV/C virus [9, 37-39], suggesting that wild birds may be a reservoir of aMPV/C and have a potential mechanism for the spreading of aMPV/C to poultry. The results in the present study further indicate that the possibility of aMPV/C transmission from wild birds to ducks. How the aMPV-FJ21 was transmitted to Sheldrake ducks in China, and further investigation is needed to determine whether the outbreak lineage is or will become enzootic in China. The G protein is one of the viral attachment proteins known to be an important immune response antigen and virulence factor, and this protein has variance in all metapneumoviruses [4, 40]. Comparing the different G protein lengths, the same G protein lengths (585 aa) are found in all the published aMPV/C strains isolated from the different waterfowl species, including Muscovy ducks, Sheldrake ducks, Jinding ducks, Cherry ducks and geese (Figure 6). The recent and the previous duck aMPV/C strains from the ducks share the same G protein lengths with the goose-originated aMPV/C strain (15a, DQ009484) [41]. In contrast, the turkey (USA-Colorado, AY579780) [42] and pheasant aMPV/C strains (PL1, EF199771) [36], which contain similar G protein lengths, possess shorter G-protein lengths. This may suggest that the G-protein lengths of the aMPV/C strains are stable among the same species during virus evolution. In addition, the G deduced aa sequence of aMPV/A, aMPV/B, aMPV/D and hMPV, even the new aMPV strains PAR-05 [18] and GuMPV_B29 [19], was shorter than that of aMPV/C isolated from waterfowl. Previous reports suggest that all of the deletion regions may be related to host specificity [11, 37, 43], and our findings clearly show that the G protein plays a pivotal role in the cross-species transmission of metapneumoviruses. Prior to our study, there was no published report that successfully replicated the disease with experimental aMPV/C infection in Sheldrake ducks. Although Yu et al. provided the genome of aMPV/C with HFS in local duck breeds, they did not mention to reproduce a clinical case of aMPV/C infection in Sheldrake ducks [21]. Our studies on the pathogenicity of the strain aMPV-FJ21 in laying ducks revealed that the virus not only triggers slight coughing, egg-drop but also leads to viral shedding and accumulation of hydrosalpinx fluid in the oviducts. The egg drop rate is consistent with that observed in clinical cases infected with aMPV/C [21, 22], but is lower than that of the S-01 strain-infected Muscovy ducks with the highest drop rate of about 72.5% [14]. Furthermore, during experimental infection of Sheldrake ducks, we first observed an extended period of virus shedding was detected in eye swabs, with a maximum rate of 100% at 7 dpi. Thereinto, virus shedding was also detected in nasal, throat and cloacal swabs. The virus shedding was also observed in nasal swabs from the aMPV/C-infected Cherry valley ducks with different pathogenic phenotype [22]. The results suggest that aMPV/C originated from different hosts may be transmitted horizontally via eye, nosal, pharyngeal and cloacal secretions or wastes. No deaths occurred in this experimental animal challenge, but the mortality rate in the affected flocks was approximately 15% [20, 21]. We speculate that this may be due to environmental conditions, stocking density, or the presence of secondary infections such as Escherichia coli, Riemerella anatipestifer or Pasteurella multocida in the field. Notably, the results of the pathological changes and histopathological analysis showed that the strain aMPV-FJ21 mainly targets the oviducts, causing an accumulation of hydrosalpinx fluid, as well as lesions in the air sacs involved in respiration. Furthermore, viral tissue distribution results also showed that viral RNA was more highly expressed in non-parenchymatous tissues with mucous membranes, including the oviducts, bursa of Fabricius and air sacs, compared to parenchymatous tissues such as livers, kidneys or brains. It suggests that the virus is capable of infecting all host tissues with mucous membranes, attacking not only the reproductive tract but also the respiratory tract. Whereas, preciously reported aMPV/C strains with respiratory symptoms mainly target the respiratory tract [14, 22, 44, 45], resulting in lesions of the nose, tracheae and lung, with no reports of the pathological changes in the air sacs. These pathogenic differences may be associated with the variance in the viral glycoproteins, the G and SH proteins, but further experimental evidence is required to confirm this hypothesis. In conclusion, we successfully isolated a new strain, aMPV-FJ21, of aMPV/C from Shelduck ducks with hydrosalpinx fluid syndrome, and provided insights into its genomic characteristics and pathogenicity. G-protein and whole-genome phylogenetic analyses indicated that aMPV-FJ21 represents a new lineage of aMPV/C and is divergent from the North American and Eurasian lineages. Pathogenicity analysis revealed that aMPV-FJ21-infected laying ducks exhibited hemorrhage, congestion, increased inflammatory cell infiltration in the oviduct or air sac, and thickening of the oviductal mucosal folds. Our results have increased the knowledge of the molecular characteristics of aMPV/C, and enriched the understanding of aMPV/C diversity. We have confusion how this new aMPV/C strain was introduced into duck populations and how many poultry they have infected in China. Therefore, further studies on rapid diagnosis technology, pathogenic mechanism, and vaccine development of aMPV/C are needed to lay the groundwork for the prevention and control of this disease. Declarations Competing interests The authors declare that they have no competing interests. Authors’ contributions QLF: acquisition, analysis, and interpretation of data; statistical analysis; and drafting of the manuscript. WWW, WLJ, JHL: data acquisition and analysis. SC, TZ, LL, NSJ, CHW, QZL, LFC, HMC, RCL: contributing to the animal experiments. YH, LZL, GHF: study design, critical revision of the manuscript for important intellectual content, study supervision. All authors read and approved the final manuscript. Funding This work was supported by the earmarked fund for China Agriculture Research System (CARS-42), the Free Exploration of Scientific and Technological Innovation Projects of Fujian Academy of Agricultural Sciences (ZYTS202419), the Fundamental Research funds of Fujian for Public Welfare Research Institutes (2024R1025009, 2023R1024005), the Fujian Academy of Agricultural Sciences Talent Project Order (YC2019010), and the Special Projects for the Central-Guided Local Science and Technology Development (2023L3023). Availability of data and materials All data underlying the results are available as the article and no additional source data are required. Further inquiries can be directed to the corresponding author. The whole genome of aMPV-FJ21 have been deposited to the Genbank with the accession number PQ634415. Acknowledgements We thank Mr. XD Zhuang and Mr. YM Cai for helping animal experiment in this study. References Rima B, Collins P, Easton A, Fouchier R, Kurath G, Lamb RA, Lee B, Maisner A, Rota P, Wang L, ICTV Report Consortium (2017) ICTV virus taxonomy profile: pneumoviridae. J Gen Virol 98:2912–2913 Abdel-Azeem AA, Franzo G, Dalle Zotte A, Drigo M, Catelli E, Lupini C, Martini M, Cecchinato M (2014) First evidence of avian metapneumovirus subtype A infection in turkeys in Egypt. Trop Anim Health Prod 46(1):1093–1097 Franzo G, Legnardi M, Mescolini G, Tucciarone CM, Lupini C, Quaglia G, Catelli E, Cecchinato M (2020) Avian metapneumovirus subtype B around Europe: a phylodynamic reconstruction. Vet Res 51(1):88 Juhasz K, Easton AJ (1994) Extensive sequence variation in the attachment (G) protein gene of avian pneumovirus: evidence for two distinct subgroups. J Gen Virol 75(11):2873–2880 Brown PA, Allée C, Courtillon C, Szerman N, Lemaitre E, Toquin D, Mangart JM, Amelot M, Eterradossi N (2019) Host specificity of avian metapneumoviruses. Avian Pathol 48(4):311–318 Toquin D, Guionie O, Jestin V, Zwingelstein F, Allee C, Eterradossi N (2006) European and American subgroup C isolates of avian metapneumovirus belong to different genetic lineages. Virus Genes 32(1):97–103 Jesse ST, Ribó-Molina P, Jo WK, Rautenschlein S, Vuong O, Fouchier RAM, Ludlow M, Osterhaus ADME (2022) Molecular characterization of avian metapneumovirus subtype C detected in wild mallards ( Anas platyrhynchos ) in the Netherlands. Transbound Emerg Dis 69(6):3360–3370 Kleven SH (1997) Report of the committee: Transmissible diseases of poultry and other avian species. Proceedings of the U.S. Animal Health Association 101st Annual Meeting. U.S. Animal Health Association,Washington, D.C Shin HJ, Njenga MK, McComb B, Halvorson DA, Nagaraja KV (2000) Avian pneumovirus (APV) RNA from wild and sentinel birds in the United States has genetic homology with RNA from APV isolates from domestic turkeys. J Clin Microbiol 38(11):4282–4284 Cha RM, Yu Q, Zsak L (2013) The pathogenicity of avian metapneumovirus subtype C wild bird isolates in domestic turkeys. Virol J 30(10):38 Jesse ST, Ludlow M, Osterhaus ADME (2022) Zoonotic origins of human metapneumovirus: A journey from birds to humans. Viruses 14(4):677 Toquin D, Bäyon-Auboyer MH, Eterradossi N, Jestin V, Morin H (1999) Isolation of a pneumovirus from a Muscovy duck. Vet Rec 145(23):680 Wei L, Zhu SS, Yan X, Wang J, Zhang CY, Liu SH, She RP, Hu FJ, Quan R, Liu J (2013) Avian metapneumovirus subgroup C infection in chickens, China. Emerg Infect Dis 19(7):1092–1094 Sun SK, Chen F, Cao S, Liu JJ, Lei W, Li GW, Song YF, Lu JP, Liu C, Qin JP, Li HY (2014) Isolation and characterization of a subtype C avian metapneumovirus circulating in Muscovy ducks in China. Vet Res 45(1):74–87 Jardine CM, Parmley EJ, Buchanan T, Nituch L, Ojkic D (2018) Avian metapneumovirus subtype C in wild waterfowl in Ontario, Canada. Transbound Emerg Dis 65(4):1098–1102 Graziosi G, Mescolini G, Silveira F, Lupini C, Tucciarone CM, Franzo G, Cecchinato M, Legnardi M, Gobbo F, Terregino C, Catelli E (2022) First detection of avian metapneumovirus subtype C Eurasian lineage in a Eurasian wigeon ( Mareca penelope ) wintering in Northeastern Italy: an additional hint on the role of migrating birds in the viral epidemiology. Avian Pathol 51(3):283–290 Bäyon-Auboyer MH, Arnauld C, Toquin D, Eterradossi N (2000) Nucleotide sequences of the F, L and G protein genes of two non-A/non-B avian pneumoviruses (APV) reveal a novel APV subgroup. J Gen Virol 81(11):2723–2733 Retallack H, Clubb S, DeRisi JL (2019) Genome sequence of a divergent avian metapneumovirus from a Monk Parakeet ( Myiopsitta monachus ). Microbiol Resour Announc 8(16):e00284–e00219 Canuti M, Kroyer ANK, Ojkic D, Whitney HG, Robertson GJ, Lang AS (2019) Discovery and characterization of novel RNA viruses in aquatic North American wild birds. Viruses 11(9):768 Fu QL, Jiang NS, Liang QZ, Liu RC, Wan CH, Cheng LF, Chen HM, Lin L, Jiao WL, Wu SH, Jiang B, Zheng XL, Lin JS, Fu GH, Huang Y (2023) Hydrosalpinx fluid syndrome in ducks caused by avian metapneumovirus subgroup C. FJAS 38(12):1387–1394 Yu RL, Zhong XF, Zeng YT, Wang XY, Zhang DB (2024) Molecular characterization of avian metapneumovirus subtype C associated with hydrosalpinx fluid and egg drop syndrome in Jinding ducks. Arch Virol 169(9):191–196 Xu GG, Wang BN, Qiao ZW, Fan L, Jiang SJ, Zhang RH (2025) Isolation and characterization of an avian metapneumovirus subtype C circulating in Cherry Valley ducks. Poult Sci 104(2):104650 Ali A, Reynolds DL (1999) A reverse transcription-polymerase chain reaction assay for the detection of avian pneumovirus (Colorado strain). Avian Dis 43(3):600–603 Fereidouni SR, Starick E, Grund C, Globig A, Mettenleiter TC, Beer M, Harder T (2009) Rapid molecular subtyping by reverse transcription polymerase chain reaction of the neuraminidase gene of avian influenza A viruses. Vet Microbiol 135:253–260 Su JL, Li S, Hu XD, Yu XL, Wang YY, Liu PP, Lu XS, Zhang GZ, Hu XY, Liu D, Li XX, Su WL, Lu H, Mok NS, Wang PY, Wang M, Tian KG, Gao GF (2011) Duck egg-drop syndrome caused by BYD virus, a new Tembusu-related flavivirus. PLoS ONE 6(3):e18106 Kumar NS, Kataria JM, Koti M, Dhama K, Toroghi R (2003) Detection of egg drop syndrome 1976 virus by polymerase chain reaction and study of its persistence in experimentally infected layer birds. Acta Virol 47:179–184 Hansen WR, Brown SE, Nashold SW, Knudson DL (1999) Identification of duck plague virus by polymerase chain reaction. Avian Dis 43(1):106–115 Hines NL, Killian ML, Pedersen JC, Reising MM, Mosos NA, Mathieu-Benson C, Miller CL (2012) An rRT-PCR assay to detect the matrix gene of a broad range of avian paramyxovirus serotype-1 strains. Avian Dis 56(2):387–395 Zhang RH, Chen JH, Zhang JQ, Yang YP, Li PF, Lan JJ, Xie ZJ, Jiang SJ (2018) Novel duck hepatitis A virus type 1 isolates from adult ducks showing egg drop syndrome. Vet Microbiol 221(23):33–37 Rehman S, Rantam FA, Batool K, Shehzad A, Effendi MH, Witaningrum AM, Bilal M, Elziyad Purnama MT (2022) Emerging threats and vaccination strategies of H9N2 viruses in poultry in Indonesia: A review. F1000 Res 11:548–564 Wan CH, Huang Y, Fu GH, Shi SH, Cheng LL, Chen HM (2012) Complete genome sequence of avian tembusu-related virus strain WR isolated from White Kaiya ducks in Fujian, China. J Virol 86(19):10912 Razmarai Iranagh AA, Razmaraii N, Aghaei R, Shayegh J, Mousaviyan M, Ameghi Roudsary A (2023) Study on propagation and adaptation of EDS-76 avian adenovirus in duck and SPF primary embryonic chicken cell culture comparison to duck and SPF embryonated chicken eggs. Arch Razi Inst 78(3):1095–1105 Wu LP, Tian B, Wang MS, Cheng AC, Jia RY, Zhu DK, Liu MF, Yang Q, Wu Y, Huang J, Zhao XX, Chen S, Zhang SQ, Ou XM, Mao S, Gao Q, Sun D, Yu YL, Zhang L, Pan LC (2022) Duck plague virus negatively regulates IFN signaling to promote virus proliferation via JNK signaling pathway. Front Immunol 13:935454 Sobolev IA, Sharshov K, Yurchenko K, Korneev D, Glushchenko A, Alikina T, Kabilov M, Bi Y, Liu W, Gubanova N, Shestopalov A (2016) Characterization of avian paramyxovirus type 6 isolated from a Eurasian teal in the intersection of migratory flyways in Russia. Arch Virol 161(11):3275–3279 Songer JG, Uzal F (2013) Ulcerative enteritis. In: Swayne DE (ed) Diseases of poultry. John Wiley and Sons, Inc, Iowa, pp 944–948 Lee Eh, Song MS, Shin JY, Lee YM, Kim CJ, Lee YS, Kim H, Choi YK (2007) Genetic characterization of avian metapneumovirus subtype C isolated from pheasants in a live bird market. Virus Res 128(1–2):18–25 Bennett RS, LaRue R, Shaw D, Yu Q, Nagaraja KV, Halvorson DA, Njenga MK (2005) A wild goose metapneumovirus containing a large attachment glycoprotein is avirulent but immunoprotective in domestic turkeys. J Virol 79(23):14834–14842 Turpin EA, Stallknecht DE, Slemons RD, Zsak L, Swayne DE (2008) Evidence of avian metapneumovirus subtype C infection of wild birds in Georgia, South Carolina, Arkansas and Ohio USA. Avian Pathol 37:343–351 Salles GBC, Pilati GVT, Muniz EC, de Lima Neto AJ, Vogt JR, Dahmer M, Savi BP, Padilha DA, Fongaro G (2023) Trends and challenges in the surveillance and control of avian metapneumovirus. Viruses 15(9):1960 Ishiguro N, Ebihara T, Endo R, Ma X, Kikuta H, Ishiko H, Kobayashi K (2004) High genetic diversity of the attachment (G) protein of human metapneumovirus. J Clin Microbiol 42(8):3406–3414 Chockalingam AK, Chander Y, Halvorson DA, Goyal SM (2010) Stability of the glycoprotein gene of avian metapneumovirus (Canada goose isolate 15a/01) after serial passages in cell cultures. Avian Dis 54(2):915–918 Velayudhan BT, Yu Q, Estevez CN, Nagaraja KV, Halvorson DA (2008) Glycoprotein gene truncation in avian metapneumovirus subtype C isolates from the United States. Virus Genes 37(2):266–272 Kong BW, Foster LK, Foster DN (2008) Species-specific deletion of the viral attachment glycoprotein of avian metapneumovirus. Virus Res 132(1–2):114–121 Wang J, Hou L, Wei L, Yan X, Zhu SS, Quan R, Li ZX, Wang D, Jiang HJ, Song JW, Cui YQ, Liu J (2023) Characterization of avain metapneumovirus subgroup C isolated from chickens in Beijing, China. Poult Sci 102(1):102250 Yao ZY, Li YJ, Shi YY, Sun T, Yang XY, Mao JY, Quan R, Wang D, Wang DD, Zhou JW, Liu J, Chu J, Hou L (2025) Isolation and identification of a subtype C avian metapneumovirus in chickens in Jiangsu, China. Microb Pathog 202:107394 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6720429\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":460924709,\"identity\":\"bcb1568b-b2b0-4dbe-ad58-480c506ed4d4\",\"order_by\":0,\"name\":\"Qiu-ling Fu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine/Fujian Key Laboratory for Control and Prevention of Avian Diseases, Fujian Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qiu-ling\",\"middleName\":\"\",\"lastName\":\"Fu\",\"suffix\":\"\"},{\"id\":460924710,\"identity\":\"663ff8a0-9bac-45e7-8a31-d53280123c77\",\"order_by\":1,\"name\":\"Wei-wei Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine/Fujian Key Laboratory for Control and Prevention of Avian Diseases, Fujian Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Wei-wei\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":460924711,\"identity\":\"d6478181-648f-4b77-b031-5f3e2c4bda34\",\"order_by\":2,\"name\":\"Wen-long Jiao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine/Fujian Key Laboratory for Control and Prevention of Avian Diseases, Fujian Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Wen-long\",\"middleName\":\"\",\"lastName\":\"Jiao\",\"suffix\":\"\"},{\"id\":460924713,\"identity\":\"6e362c4d-2ba2-45d0-841a-fedf4130dd78\",\"order_by\":3,\"name\":\"Tao Zeng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine of Zhejiang Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tao\",\"middleName\":\"\",\"lastName\":\"Zeng\",\"suffix\":\"\"},{\"id\":460924715,\"identity\":\"48ead453-d770-4cdd-ab34-d1afa9764531\",\"order_by\":4,\"name\":\"Shen Cao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine/Fujian Key Laboratory for Control and Prevention of Avian Diseases, Fujian Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shen\",\"middleName\":\"\",\"lastName\":\"Cao\",\"suffix\":\"\"},{\"id\":460924716,\"identity\":\"e415bb6a-5aa4-4f52-9cb0-1afc3edc77ed\",\"order_by\":5,\"name\":\"Lin Lin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine/Fujian Key Laboratory for Control and Prevention of Avian Diseases, Fujian Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lin\",\"middleName\":\"\",\"lastName\":\"Lin\",\"suffix\":\"\"},{\"id\":460924719,\"identity\":\"055ad85c-0604-4666-9f58-beb87158d855\",\"order_by\":6,\"name\":\"Nan-song Jiang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine/Fujian Key Laboratory for Control and Prevention of Avian Diseases, Fujian Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Nan-song\",\"middleName\":\"\",\"lastName\":\"Jiang\",\"suffix\":\"\"},{\"id\":460924720,\"identity\":\"4be29faf-85a1-42f4-90e1-b38aceca8c96\",\"order_by\":7,\"name\":\"Chun-he Wan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine/Fujian Key Laboratory for Control and Prevention of Avian Diseases, Fujian Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chun-he\",\"middleName\":\"\",\"lastName\":\"Wan\",\"suffix\":\"\"},{\"id\":460924723,\"identity\":\"8f755201-1469-48cc-a305-c2b0fa9d3198\",\"order_by\":8,\"name\":\"Qi-zhang Liang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine/Fujian Key Laboratory for Control and Prevention of Avian Diseases, Fujian Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qi-zhang\",\"middleName\":\"\",\"lastName\":\"Liang\",\"suffix\":\"\"},{\"id\":460924724,\"identity\":\"5d4426ce-4c71-4dcf-9fd8-31f58e13deb6\",\"order_by\":9,\"name\":\"Long-fei Cheng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine/Fujian Key Laboratory for Control and Prevention of Avian Diseases, Fujian Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Long-fei\",\"middleName\":\"\",\"lastName\":\"Cheng\",\"suffix\":\"\"},{\"id\":460924725,\"identity\":\"921ef5d5-f331-4238-a81f-cce1103c7d8a\",\"order_by\":10,\"name\":\"Hong-mei Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine/Fujian Key Laboratory for Control and Prevention of Avian Diseases, Fujian Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hong-mei\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":460924726,\"identity\":\"8b084f34-6ea3-4e76-ac48-c266dc50f4e8\",\"order_by\":11,\"name\":\"Jin-hua Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"College of Veterinary Medicine of China Agricultural University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jin-hua\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":460924727,\"identity\":\"58552520-5dad-4308-8334-6d3e1526e352\",\"order_by\":12,\"name\":\"Rong-chang Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine/Fujian Key Laboratory for Control and Prevention of Avian Diseases, Fujian Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Rong-chang\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":460924728,\"identity\":\"0e1eca62-36bc-4692-9d4e-bc9b287768a8\",\"order_by\":13,\"name\":\"Guang-hua Fu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine/Fujian Key Laboratory for Control and Prevention of Avian Diseases, Fujian Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Guang-hua\",\"middleName\":\"\",\"lastName\":\"Fu\",\"suffix\":\"\"},{\"id\":460924729,\"identity\":\"ab2ab185-3356-430e-bb8a-e3487972c132\",\"order_by\":14,\"name\":\"Li-zhi Lu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine of Zhejiang Academy of Agricultural Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Li-zhi\",\"middleName\":\"\",\"lastName\":\"Lu\",\"suffix\":\"\"},{\"id\":460924730,\"identity\":\"2948d1bf-0fc5-4598-b6fb-60c98dfa4199\",\"order_by\":15,\"name\":\"Yu Huang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIiWNgGAWjYBACAxiDn5n/4YOEihoStEi28zAbPDhzjAQtBud52CQftjAT1mIukfzs4de2wwySzbzHKhIb2Bj427sT8GqxnJFmbiwL1MLPzJd2I3GHDIPEmbMb8DvsRoKZtCTYFgazG4ln2BgMJHIJaUn/BtZicJjBrCCxjZkYLTlmkh/BWnjMGIjTcuZNmTTDuXSgw9iSJRLOHOMh7Jfj6dskf5RZM/DzHz748UdFjRx/ey9+LSDAzMvGUN8A5fAQVA4CjD/+EKVuFIyCUTAKRioAAPu8R9kqD/tmAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Institute of Animal Husbandry and Veterinary Medicine/Fujian Key Laboratory for Control and Prevention of Avian Diseases, Fujian Academy of Agricultural Sciences\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Yu\",\"middleName\":\"\",\"lastName\":\"Huang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-05-22 02:38:19\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6720429/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6720429/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":83479497,\"identity\":\"9cd5bccc-269c-4442-9b1f-57c323165f58\",\"added_by\":\"auto\",\"created_at\":\"2025-05-27 06:10:59\",\"extension\":\"jpeg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":199323,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ePathological studies of the naturally and artificially infected ducks.\\u003c/strong\\u003e Anatomic investigations of the naturally infected ducks revealed that the prevalence of yellow mucosa in the larynx of ducks with respiratory symptoms (B), ovarian hemorrhage and chylous fluids or conglobate egg albumen accumulated in the oviduct (E), and follicular hemorrhage (H). The artificial infected ducks experiencing necropsies showed yellow mucosa in the larynx (C), uterine flushing, white discharge in the uterine (F) and hemorrhagic folliculus (I). Mock duck larynx (A), oviduct (D) and folliculus (G).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image1.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6720429/v1/ce2ca5e19b080f0a4cdd480e.jpeg\"},{\"id\":83479501,\"identity\":\"be85aadc-ae2a-48d6-8c19-017c820a13ed\",\"added_by\":\"auto\",\"created_at\":\"2025-05-27 06:10:59\",\"extension\":\"jpeg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":159848,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe CPEs observed in Vero cells infected with aMPV/C strain aMPV-FJ21. \\u003c/strong\\u003eThe CPEs\\u003cstrong\\u003e \\u003c/strong\\u003ewere observed in the cells infected with aMPV-FJ21 after the fifth passage at 48 hpi. The infected cells became round at the beginning and almost 70% cells became deciduous at 96 hpi.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image2.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6720429/v1/9aa6f5e6d8846d868643f4d5.jpeg\"},{\"id\":83479495,\"identity\":\"f9bd4311-95cf-4dff-8deb-fca942405fb1\",\"added_by\":\"auto\",\"created_at\":\"2025-05-27 06:10:59\",\"extension\":\"jpeg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":28093,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe growth kinetics of aMPV-FJ21 in Vero cells. \\u003c/strong\\u003eThe viral titer increased rapidly on 3 and 4 dpi, peaked on 6 dpi and then declined.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image3.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6720429/v1/9c664d4502577c2168e92d4b.jpeg\"},{\"id\":83479612,\"identity\":\"d5e50304-bfac-430d-abaf-bcb89eb06334\",\"added_by\":\"auto\",\"created_at\":\"2025-05-27 06:18:59\",\"extension\":\"jpeg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":81057,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe IFA results for aMPV-FJ21 in Vero cells. \\u003c/strong\\u003eThe Vero cells infected with aMPV-FJ21 exhibited obvious green fluorescence signals, but no fluorescence signal was detected in the negative control cells, indicating aMPV-FJ21 could react with the anti-aMPV/C-F poly-antibody.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image4.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6720429/v1/ccd1549a7f5f842c84a2683b.jpeg\"},{\"id\":83480036,\"identity\":\"324d1218-983f-4886-a2e7-54e29fdbd556\",\"added_by\":\"auto\",\"created_at\":\"2025-05-27 06:26:59\",\"extension\":\"jpeg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":102293,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe electron micrograph of aMPV-FJ21.\\u003c/strong\\u003eSpherical, irregular, long filamentous and enveloped particles were observed (A). The representative, spherical particle with a diameter of 150 nm (B) and irregular and filamentous particle with a length of 1000 nm presented in the purified samples (C).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image5.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6720429/v1/dc0c3f207871e91d819072ce.jpeg\"},{\"id\":83479616,\"identity\":\"bf1004b1-22b0-42ef-a70c-2621bfe2679a\",\"added_by\":\"auto\",\"created_at\":\"2025-05-27 06:18:59\",\"extension\":\"jpeg\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":179929,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eLength comparison of viral gene sequences in completely sequenced aMPV and hMPV. \\u003c/strong\\u003eA comparison of duck-origin aMPV/C strains (aMPV-FJ21/PQ634415, 99178/HG934338, S-01/KF364615, and HL1/OR365551), goose-origin aMPV/C strain(15a/DQ009484), chicken-origin aMPV/C strains (USA-Colorado/AY579780, and PL-1/EF199771), hMPV strains (001/AF371337, and GZ01/GO153651), aMPV/A strain (IT /JF424833), aMPV/B strain (VC03/AB548428), aMPV/D strain (Fr85.1/HG934339) and new aMPV strain (PAR-05/MK491499) was accomplished. Variation in size of eight viral main protein genes was indicated. nt, Nucleotides and aa, Amino acids. The different regions are shown in red marks and shaded areas in different colors.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image6.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6720429/v1/4b723752538d9bb510da13fa.jpeg\"},{\"id\":83479502,\"identity\":\"468c240d-7a9f-48cd-b52e-d8d88029e91d\",\"added_by\":\"auto\",\"created_at\":\"2025-05-27 06:10:59\",\"extension\":\"jpeg\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":85702,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ePhylogenetic relationships of the full genome and G amino acid sequence between isolate and other pneumoviruses.\\u003c/strong\\u003e After the full genomic sequence of aMPV-FJ21 was obtained, the phylogenetic tree of the complete genome (A) and G amino acid sequence (B) of aMPV-FJ21 were indicated that aMPV-FJ21 belongs to aMPV/C, but is in a new genetic evolutionary branch and divergent from Eurasian and American lineages. Each strain was denoted by its GenBank accession number and strain name. The isolate (aMPV-FJ21) was marked with red triangle.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image7.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6720429/v1/03f1a570017c6e9befbea2eb.jpeg\"},{\"id\":83479506,\"identity\":\"72a38c64-b9dc-471c-a7c3-4fd9870d6a67\",\"added_by\":\"auto\",\"created_at\":\"2025-05-27 06:10:59\",\"extension\":\"jpeg\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":388250,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eAlignment of the G amino acid sequence between isolate and other metapneumoviruses. \\u003c/strong\\u003eAll\\u003cstrong\\u003e \\u003c/strong\\u003eG protein sequences of aMPV/C are 585 aa in length, except for PL-1. Variation in size of G protein is shown in other metapneumoviruses. Highlighted in light green and orange were the aMPV/C strains from Eurasian and American lineages. aMPV-FJ21 strain was marked with red triangle. 7 aa mutations in cytoplasmic and trans-membrane domains of aMPV-FJ21 were presented in red italic font. The conserved tryptophan residues are shown in bold red letters. Asterisks denote conserved amino acids, whilst two dots denote conservative substitutions.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image8.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6720429/v1/33eac3f80c5e73a75076ba39.jpeg\"},{\"id\":83480038,\"identity\":\"5c52995c-f7e8-4f3f-9a96-b3ea0efc0d65\",\"added_by\":\"auto\",\"created_at\":\"2025-05-27 06:26:59\",\"extension\":\"png\",\"order_by\":9,\"title\":\"Figure 9\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":62023,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe average egg laying rates of each three days. \\u003c/strong\\u003eThe 155-day\\u003cstrong\\u003e \\u003c/strong\\u003elaying Sheldrake ducks were infected with aMPV-FJ21. The average egg laying rates of each three days in the infected laying ducks were 61.1%-74.67% during 6 dpi to 27 dpi, while it was 75.56%-88.07% in the uninfected control group. And the ratio of relative egg laying reduction was 9.84%-22.18% during that period of time.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image9.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6720429/v1/2df427044fe96aa6abb0606e.png\"},{\"id\":83480310,\"identity\":\"828a6b9d-66d4-46e5-81bd-1f40affbf238\",\"added_by\":\"auto\",\"created_at\":\"2025-05-27 06:34:59\",\"extension\":\"jpeg\",\"order_by\":10,\"title\":\"Figure 10\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":68817,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe distribution of aMPV-FJ21 in different tissues.\\u003c/strong\\u003e The viral RNA exhibited higher expression in the non-parenchymatous tissues, such as oviduct, bursa of Fabricius, air sac, lung, trachea and intestine, than that in the parenchymatous tissues (pancreas, spleen, kidney, heart, liver, brain, thymus, and Harderian gland).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image10.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6720429/v1/c8b7b3e60a9d127afdfbf8c8.jpeg\"},{\"id\":83479507,\"identity\":\"a7e3490f-7398-40df-bf50-33d712b44dfc\",\"added_by\":\"auto\",\"created_at\":\"2025-05-27 06:10:59\",\"extension\":\"jpeg\",\"order_by\":11,\"title\":\"Figure 11\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":182958,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eHistopathological examination of both the experimental and control groups. \\u003c/strong\\u003eH\\u0026amp;E results revealed hemorrhage and congestion, and severe inflammatory cell infiltration in the mucosal lamina propria, submucosa of the folds of the oviductal mucosa and similar lesions in the air sacs from aMPV-FJ21-infected ducks. IHC showed that aMPV/C-specific antigen could be detected.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image11.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6720429/v1/0bf33b48425877b731378d83.jpeg\"},{\"id\":86219264,\"identity\":\"f5c7ccae-6e62-4af3-af63-44a2b30085f5\",\"added_by\":\"auto\",\"created_at\":\"2025-07-08 06:40:28\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2839523,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6720429/v1/4473a153-a409-40a7-b5c2-6d00eadfe6ce.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Novel avian metapneumovirus subtype C is a newly emerged pathogen causing hydrosalpinx fluid syndrome in Sheldrake ducks in China\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eAvian metapneumovirus (aMPV) is an enveloped virus containing a single-stranded, negative-sense RNA genome and belongs to the genus \\u003cem\\u003eMetapneumovirus\\u003c/em\\u003e in the subfamily \\u003cem\\u003ePneumovirina\\u003c/em\\u003e of the family \\u003cem\\u003eParamyxoviridae\\u003c/em\\u003e, as does human metapneumovirus (hMPV) [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. The aMPV genome was found to be approximately 13.1 to 14.1 kb in length and encodes eight proteins in the order of 3\\u0026rsquo;-N-P-M-F-M2-SH-G-L-5\\u0026rsquo; [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. The glycoprotein (G) is considered to be suitable for analysis of genetic variation in aMPV viruses due to high level of diversity in nucleotide (nt) and amino acid (aa) sequences [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Based on the antigenic and genetic features, aMPV was formally classified by the International Committee of Virus Taxonomy (ICTV) into four subtypes: aMPV/A, aMPV/B, aMPV/C and aMPV/D [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. aMPV/A and aMPV/B were known as the original and most prevalent subtypes [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. aMPV/C has been divided into two distinct phylogenetic lineages, the North American and Eurasian lineages [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. The North American lineage of aMPV/C was first discovered in commercial turkeys in the United States in 1996 [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e], following reports in various wild birds from the North America such as American black ducks (\\u003cem\\u003eAnas rubripes\\u003c/em\\u003e), American wigeons (\\u003cem\\u003eMareca americana\\u003c/em\\u003e), Northern shovelers (\\u003cem\\u003eSpatula clypeata\\u003c/em\\u003e), wood ducks (\\u003cem\\u003eAix sponsa\\u003c/em\\u003e), snow geese (\\u003cem\\u003eAnser caerulescens\\u003c/em\\u003e), Canadian geese (\\u003cem\\u003eBranta Canadensis\\u003c/em\\u003e), ring-billed gulls (\\u003cem\\u003eLarus delawarensis\\u003c/em\\u003e), house sparrows (\\u003cem\\u003ePasser domesticus\\u003c/em\\u003e), barn swallows (\\u003cem\\u003eHirundo rustic\\u003c/em\\u003ea), European starling (\\u003cem\\u003eSturnus vulgaris\\u003c/em\\u003e), blue-winged teals (\\u003cem\\u003eSpatula discors\\u003c/em\\u003e) and wild mallards (\\u003cem\\u003eAnas platyrhynchos\\u003c/em\\u003e) and so on [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR10\\\" citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. The other lineage of this subtype has been reported in Europe and Asia such as France, China, Netherlands, Canada and Italy [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e, \\u003cspan additionalcitationids=\\\"CR13 CR14 CR15 CR16 CR17 CR18\\\" citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. Interestingly, it exhibits greater susceptibility in ducks as opposed to turkeys [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. Conversely, aMPV/D was geographically restricted to France [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. In 2019, two novel divergent aMPV strains have been discovered in monk parakeets (\\u003cem\\u003eMyiopsitta monachus\\u003c/em\\u003e) and great black-backed gulls (\\u003cem\\u003eLarus marinus\\u003c/em\\u003e) [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e], awaiting for formal classification by the ICTV.\\u003c/p\\u003e \\u003cp\\u003eIn China, the occurrence of aMPV/C in Muscovy ducks was first reported exclusively in 2014, with no reports of aMPV/C isolation from waterfowl [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. By March 2021, we have first found aMPV/C infections reappearing in laying ducks from several southern regions of China, with distinct clinical signs characterized by chylous hydrosalpinx fluids, hemorrhagic, edematous, thickened mucosa and egg drop (10%-30%), which we tentatively named as \\u0026ldquo;hydrosalpinx fluid syndrome\\u0026rdquo; (HFS) [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. Subsequently, similar disease occurred in Jinding ducks from northeastern China and the same causative agent was suggested by molecular evidence [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. In addition, a recent case of aMPV/C infection with upper respiratory syndrome in Cherry Valley ducks has been reported [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. On the basis of the G gene of all aMPV/C strains that have been reported in China, they are all members of the Eurasian lineage of aMPV/C. Here, we have isolated and characterized a subtype C aMPV strain, aMPV-FJ21, from the laying Sheldrake ducks with HFS in China and confirmed that aMPV/C is the causative agent of this disease. Subsequently, we then further analyzed its genetic and phenotypic characteristics and evaluated its pathogenicity specifically in laying Sheldrake ducks and found that aMPV-FJ21 is classified to a new genetic lineage of aMPV/C, which is also divergent from the strain (HL1) isolated from Jinding ducks with the similar clinic characters from the northeastern China. Our findings suggest that a novel aMPV/C strain has been circulating in Chinese poultry, accompanying with genetic variation, and that effective strategies should be taken immediately to prevent the spread of the virus.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003ch2\\u003eEthical Statement\\u003c/h2\\u003e\\n\\u003cp\\u003eThe experimental procedures involving animals in this study were ethically approved by the Experimental Animal Management Committee of Fujian Academy of Agricultural Sciences in accordance with established animal welfare guidelines (Approval No.MYLISC2024-016).\\u003c/p\\u003e\\n\\u003ch2\\u003eSample Collection and Bacterial Culture\\u003c/h2\\u003e\\n\\u003cp\\u003eFresh tissues (such as hydrosalpinx fluids, oviducts, folliculus and air sac) were collected from the sick or dead Sheldrake ducks. The collected samples were used for bacterial culture and isolation. For bacteriological diagnosis, the hydrosalpinx fluids or oviduct samples from dead Sheldrake ducks were inoculated onto tryptic soy agar plates (BD Science, MD, USA) containing 2% fetal calf serum (FBS; Gibco, New York, USA) and incubated at 37 ℃ for 48 h. The oviducts were then mixed and ground in physiological saline to make 10% (wt./vol.) suspension. After freezing and thawing three times, the suspensions and hydrosalpinx fluids were clariﬁed by centrifugation at 8,000\\u0026times;g for 10 min at 4 ℃, and then serially ﬁltered through 0.22 \\u0026mu;m ﬁlters (Millipore, Bedford, MA, USA). The filtrates were used immediately for RNA extraction or virus isolation.\\u003c/p\\u003e\\n\\u003ch2\\u003eVirus detection and isolation\\u003c/h2\\u003e\\n\\u003cp\\u003eTotal DNA and RNA were extracted separately from the homogenized tissues using an EasyPure\\u0026reg; Viral DNA/RNA Kit according to the manufacturer\\u0026rsquo;s instructions (TransGen Biotech Co., Ltd., Beijing, China). DNA and RNA were subjected to PCR or RT-PCR for the detection of potential pathogens, such as aMPV/C [20, 23], avian influence virus (AIV) [24], avian tembusu virus (ATMUV) [25], egg drop syndrome-76 virus (EDSV-76) [26], duck plague virus (DPV) [27], avian paramyxovirus (APMV) [28] and duck hepatitis A virus type 1 (DHAV-1) [29], respectively (Table 1). PCR/RT-PCR kits were purchased from Takara Biotechnology Co., Ltd (Dalian, China). The amplified PCR fragments were sequenced by Sangon Biotech Co., Ltd (Shanghai, China).\\u003c/p\\u003e\\n\\u003cp\\u003eOne of the isolated virus samples, which was designated aMPV-FJ21, was inoculated into the African green monkey kidney cell line (Vero, ATCC) at 80% confluence in a 6-well plate. The supernatant was discarded after 1.5 hours post infection (hpi). The aMPV-FJ21 virus isolate was then added to the DMEM medium (Gibco, New York, USA) containing 1% FBS. Infected cells were blindly passaged every 5-6 days. At 7 days postinfection (dpi), CPEs were quantified and virus titer was determined as the 50% tissue culture infectious dose (TCID\\u003csub\\u003e50\\u003c/sub\\u003e) per 0.1 mL according to the Reed and Muench method. Meanwhile, the viral antigen was detected by indirect immunofluorescent assay (IFA).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 1. Primers were used for detection in this study\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"0\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"730\\\" class=\\\"fr-table-selection-hover\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003ePrimer name\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eSequence (5\\u0026rsquo;\\u0026ndash;3\\u0026rsquo;)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eTarget\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eReference\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eaMPV/C-F\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eACACCTCCTACAGTGCTACTAGAGCAGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eM\\u0026nbsp;\\u003c/em\\u003egene of aMPV/C (631 bp)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e23\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eaMPV/C-R\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eACTTCAGGACATATCTCGTACCCTGG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eAIV-F\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eAGR\\u003csup\\u003ea\\u003c/sup\\u003eCCTTGYTTCTGGGTTGA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eN\\u003c/em\\u003e gene of AIV (126 bp)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e24\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eAIV-R\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eACCGTCTGGCCAAGACCA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eTMUV-F\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eGCCACGGAATTAGCGGTTGT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eE\\u0026nbsp;\\u003c/em\\u003egene of TMUV (401 bp)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e25\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eTMUV-R\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eTAATCCTCCATCTCAGCGGTGTAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eEDSV-F\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eTTGGCGTCTTCAAGGCACTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHexon\\u0026nbsp;\\u003c/em\\u003egene of EDSV (238 bp)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e26\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eEDSV-R\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eCACACAACTGCATCTGACTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eDPV-F\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eGGCTGGTATGCGTGACAT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003eDNA polymerase gene of DPV (602 bp)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e27\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eDPV-R\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eGTATTGGTTTCTGAGTTGGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eAPMV-F\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eTGACATTTGACAAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eM\\u0026nbsp;\\u003c/em\\u003egene of APMV (196 bp)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e28\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eAPMV-R\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eCTCCAGAGTATCTTAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eDHAV-1-F\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eACAATGACCCAGCCTTAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003eRNA polymerase gene of DHAV-1 (440 bp)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e29\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eDHAV-1-R\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eCCACTGTATCTTCCCTTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003csup\\u003ea\\u0026nbsp;\\u003c/sup\\u003eCodes for ambiguous bases position and NTP analogues: R = A/G.\\u003c/p\\u003e\\n\\u003ch2\\u003eTransmission electronic microscope (TEM)\\u003c/h2\\u003e\\n\\u003cp\\u003eTo observe viral particles, subconfluent monolayers of Vero cells infected with the strain aMPV-FJ21 for 72 h were obtained, pre-fixed in 3% glutaraldehyde (Sigma-Aldrich, Kenilworth, USA) at 4 \\u0026deg;C, and then fixed in 1 % osmium tetroxide (Sigma-Aldrich, Kenilworth, USA) for 2 h after two washes with 0.1 mol/L PBS. The fixed cells then processed through an ethanol gradient, dehydrated in acetone, and cut into ultrathin 50 nm sections. After staining with uranium acetate and lead citrate (Sangon Biotech, Shanghai, China), the ultrathin sections were observed and photographed using a transmission electron microscope (TEM, H-7500, Hitachi, Japan). Additionally, four hundred milliliters of virus propagated in Vero cells was obtained, centrifuged at 10,000\\u0026times; g for 10 min to pellet large cellular debris, and then centrifuged again at 45,000\\u0026times; g for 3.5 h at 4 ℃ to obtain the virus. The purified virus was then placed on a copper grid, negatively stained with 3% phos-photungstic acid, and also observed and photographed by TEM as described by Sun et al [14].\\u003c/p\\u003e\\n\\u003ch2\\u003eViral genome sequencing and analysis\\u003c/h2\\u003e\\n\\u003cp\\u003eTo determine the full-length nucleotide sequences of the virus, an illumina system (HiSeq 2000, BGI, Hong Kong) was used to obtain the entire complete genome of the strain aMPV-FJ21. Paired-end libraries were generated, and multiple virus samples were sequenced in a single lane. The obtained reads were used to assemble the virus genome against the available aMPV/C nucleotide sequences of strain 99178 (HG934338.1). Based on the nucleotide sequences of strain 99178, a set of primers were designed to amplify and proofread the complete genome sequence of the isolate (Table 2). PCR products of expected length were sequenced directly or cloned into the pEASY-T1 cloning vector (TransGen, Beijing, China) according to the manufacturer\\u0026rsquo;s instructions and sequenced at Sangon Biotech Co., Ltd. (Shanghai, China). Nucleotide and amino acid sequences were assembled using Lasergene 11 (Madison, WI, USA), and multiple-sequence alignment was performed with the Clustal W (BioEdit version 7) program, and online alignment in NCBI-BLAST software (\\u003cu\\u003ehttps://blast.ncbi.nlm.nih.gov/Blast.cgi\\u003c/u\\u003e). A neighbour-joining (NJ) tree based on the full genome and G amino acid sequences was constructed using the MEGA9.1 program. The robustness of the NJ tree was evaluated with a bootstrap analysis of 1,000 replicates.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 2. Primers used to amplify the full genomic sequence of strain aMPV-FJ21\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"0\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"753\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePrimer Location (bp)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eUpstream primer (5\\u0026rsquo;\\u0026ndash;3\\u0026rsquo;)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eDownstream primer (5\\u0026rsquo;\\u0026ndash;3\\u0026rsquo;)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eLength (bp)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1-1365\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eACGAGAAAAAAACGCATATAAGATAAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTGTCCTCCTATGTCCTACTT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1365\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1189-2557\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCTGAGAACTTCCTTAACATAAATG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAAACTTTGAGACCATACCATAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1369\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e2447-3766\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTCGGTAGCACTAGATGATTAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGTTGATTTGTCCTGAAGATGT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1320\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e3636-5084\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGATTCCTCAATGTGGTAAGAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eATGACAACACTAAGTTATGTAGAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1449\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e4922-6316\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGTCCAGAACTACATTGATAACA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTGACTCCACATACATGATAGA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1395\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e6161-7492\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGTAGAGAATGTTGGCAAGTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTGTTGTGTTGTTCCTTTCAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1332\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e7284-8727\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCACCAACAAAGCAAGAACAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eACTGAGCATAGAGTCAACAAT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1444\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e8619-10034\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGTGGATCAGTAACAGTCTTAAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTCAATGTCATACACTCCTTCT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1416\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e9905-11206\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCAGATGTAGTTGATGAATTGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCTTCTCCATTGATTGCTGAT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1302\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e11065-12446\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eATTACACCAGTCTATCCACAT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAACATCCTCCAGAATGAATTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1382\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e12283-13626\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGTTACGGATCATGCCTTTATAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTTCAACAGCCTTCACTTCTA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1344\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e13488-14139\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eATCAGAGTGCTATGTCCTTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAAACCGTATTCATCCAATTTTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e652\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003ch2\\u003eAmino acid mutation of G protein and recombination analysis\\u0026nbsp;\\u003c/h2\\u003e\\n\\u003cp\\u003eThe characteristics of amino acid mutations were analyzed by means of comparing the amino acid sequences of the aMPV/C G genes utilizing the Clustal W module embedded in the DNASTAR software. Several bioinformatics tools and methods were used to analyze the recombination events of aMPV/C. The full genome sequences of isolates aMPV-FJ21, 9917 and a variety of representative MPV strains were downloaded from the GenBank database and then sequence alignment was performed using MEGA software to ensure high quality and consistency. After alignment, the RDP5.64 software (\\u003cu\\u003eRecombination Detection Program 5, http://web.cbio.uct.ac.za/ ~darren/rdp. html\\u003c/u\\u003e) was used to perform preliminary detection of restructuring events. To validate the preliminary results, SimPlot 3.5.1 software (\\u003cu\\u003ehttps://www.softpedia. Com/get/Science-CAD/SimPlot.shtml\\u003c/u\\u003e) was applied for rechecks.\\u003c/p\\u003e\\n\\u003ch2\\u003eIndirect immunofluorescent assay (IFA)\\u003c/h2\\u003e\\n\\u003cp\\u003eFor indirect immunofluorescent assays (IFA), Vero cells in 96-well plates (1\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e cells/well) were infected with the strain aMPV-FJ21 (10\\u003csup\\u003e5\\u003c/sup\\u003e TCID\\u003csub\\u003e50\\u003c/sub\\u003e) for 72 h. The cells were then fixed with pre-cooled 4% paraformaldehyde (Sigma-Aldrich, Kenilworth, USA) in PBS for 15 min at 4 \\u0026deg;C and permeabilized with 0.1% Triton X-100 (Sigma-Aldrich, Kenilworth, USA) and in 2% BSA (Beyotime, Shanghai, China) in PBS for 30 min. The fixed cells were then incubated with a mouse anti-aMPV/C-F poly-antibody (1:100) produced in our laboratory for 1.5 h at 37 \\u0026deg;C. After washing with PBS containing 0.05% Tween-20 (PBST), the cells were incubated with secondary 488-conjugated anti-mouse (1:1000, Beyotime, Shanghai, China) for 2 h at 37 \\u0026deg;C. Finally, all cells were washed with PBST and observed under a Nikon AIR confocal immunofluorescence microscope (Nikon Instruments, Inc., Melville, NY, USA).\\u003c/p\\u003e\\n\\u003ch2\\u003eAnimals for\\u0026nbsp;in\\u0026nbsp;vivo experiments\\u003c/h2\\u003e\\n\\u003cp\\u003eIn this study, eighty 145-day-old Sheldrake ducks with laying rate \\u0026ge;50% were obtained from Longyan Shan Partridge ducks breeding farm (Longyan, Fujian, China), all of which were confirmed to be free of antibodies and antigens against several viruses, including aMPV/C, AIV, ATMUV, EDSV and DPV. Throughout the experimental period, the experimental ducks were maintained in an isolated environment and provided with food and water \\u003cem\\u003ead libitum\\u003c/em\\u003e. After 10 days of acclimatisation to the new environment to minimise the effects of transport stress, the ducks were used for the animal regression experiment.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eA total of 80 ducks were randomly divided into two groups. The experimental group (group 1) consisted of ducks were challenged with 1.5 mL of the F5-cell-passaged aMPV-FJ21 (10\\u003csup\\u003e5.0\\u0026nbsp;\\u003c/sup\\u003eTCID\\u003csub\\u003e50\\u003c/sub\\u003e/mL) by cloacal injection and 0.5 mL of virus instilled into each nose using a micropipette. Ducks in the second group (group 2) were inoculated with a non-infected Vero cell suspension and was used as a negative control. Additionally, five ducks marked with numbers (1-5) were selected from each group as group 3 and group 4 to detect virus shedding. Nasal, eye, throat and cloacal swabs were collected from each duck in group 3 and 4, which were tested for virus shedding at 0, 1, 3, 7, 10, 14, 22 and 28 dpi. Egg production, survival and clinical signs of the remaining ducks in groups 1 and 2 were assessed daily. Five ducks were randomly selected from the inoculated and control groups and euthanatized using carbon dioxide inhalation at 7 and 14 dpi. Samples of the heart, liver, spleen, lung, kidney, larynx, trachea, air sac, thymus, pancreas, intestine, bursa of Fabricius, foliiculi, oviduct, brain, and Harderian gland were collected for virus detection. Oviduct and air sac samples were collected for histopathological analysis and immunohistochemistry (IHC). For immunohistochemical analysis, a mouse anti-aMPV/C F poly-antibodies (1:200) was used as the primary antibody.\\u003c/p\\u003e\\n\\u003ch2\\u003eData Analysis\\u003c/h2\\u003e\\n\\u003cp\\u003eThe ratio (R) of the relative reduction in egg production was calculated as the average egg production of the infected ducks (P) minus the average egg production of the control ducks (N) divided by the average egg production of the control ducks (N), in other words, R=(P-N)/N\\u0026times;100%. GraphPad 8 was utilized for the organization and analysis of experimental data, which included egg production and viral load of the ducks. Significant differences were determined using \\u003cem\\u003et\\u003c/em\\u003e-tests and non-parametric tests in GraphPad 11.0 (San Diego, CA, USA), with a significance level set of \\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt;0.05.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003ch2\\u003eCase history, microbiological examination, and virus isolation of the field samples\\u003c/h2\\u003e\\n\\u003cp\\u003eFrom March 2021 to date, Sheldrake ducks with high egg production rates (\\u0026ge;85%), suddenly occurred in some duck flocks in Fujian, Guangdong, Anhui, Shandong province and Guangxi Municipality of China, and its morbidity and mortality rates were about 30% and 15%, respectively. The epidemic disease occurred during the cold and wet seasons, mainly in the spring, autumn and winter alternating. The diseased ducks presented coughing, mental depression, lying on the ground within 9-14 dpi and reduction of egg production by approximately 10%-30%. At necropsy, yellow mucosa was observed in the larynx of ducks with respiratory symptoms (Figure 1B). There were also yellow necrotic dots in the air sac and pancreas (data not shown). And accumulation of chylous fluid or conglobulated egg albumen appeared in the oviduct in accompany with hemorrhagic, edematous, and thickened mucosa (Figures 1D). There were sporadic cases of haemorrhagic folliculus (Figures 1H), oviductal obstruction and blockage of egg laying, which was provisionally named \\u0026ldquo;Hydrosalpinx Fluid Syndrome (HFS)\\u0026rdquo;.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTissue samples were collected from the ducks with HFS, no virulent bacteria were isolated, and the samples were tested negative for AIV, ATMUV, EDSV, DPV, APMV-1 and DHAV-1, but positive only for aMPV/C as determined by (RT-) PCR assays (data not shown). A 631-bp fragment was produced by RT-PCR amplification and sequence analysis showed that the 631-bp fragment shared a 95.5% nucleotide identity with the representative aMPV/C strain 99178 in the\\u003cem\\u003e\\u0026nbsp;M\\u003c/em\\u003e gene. The virus was isolated in Vero cells, and the cells were harvested on 5-6 dpi. Compared to the mock cells, typical cytopathic effects (CPEs) were observed in aMPV/C infected cells after the fifth passage at 48 hpi. The infected cells initially became round and almost 70% of the cells became deciduous at 96 hpi (Figure 2). The growth curve of aMPV-FJ21 in Vero cells showed that the viral titer increased rapidly at 3 and 4 dpi, peaked on 6 dpi and then declined (Figure 3). The results of immunofluorescence detection showed that the virus-infected Vero cells exhibited obvious green fluorescence signals, whereas no fluorescence signal was detected in the uninfected control cells (Figure 4). Taken together, our findings revealed that the isolate, aMPV-FJ21, which was able to bind the poly-antibody to the F protein of the aMPV/C and produce a typical CPE in Vero cells, was an aMPV-like enveloped virus, and the best viral replication phase was at approximately 6 dpi in Vero cells.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003ch2\\u003eVirus morphology\\u003c/h2\\u003e\\n\\u003cp\\u003eaMPV-FJ21 was serially cultured in Vero cells for 5 passages and then identified by TEM. The virus showed an irregular, spherical, long filamentous shape with a length of almost 1000 nm (Figure 5A). Enveloped virus particles with a diameter of 20-500 nm presented in the purified samples (Figure 5B-C), similar to that of aMPV.\\u003c/p\\u003e\\n\\u003ch2\\u003eGenomic character of aMPV-FJ21\\u003c/h2\\u003e\\n\\u003cp\\u003eThe complete genomic length of aMPV-FJ21 was determined to be 14149 nucleotides (nt) (GenBank accession number: PQ634415). The GC content of aMPV-FJ21 (41.32%) was similar to that of aMPV/C. The genomic nucleotide identity of aMPV-FJ21 with the representative aMPV/C strain 99178 (HG934338) was 95.0%. The sequence of aMPV-FJ21 also shared 87.1%-95.0%, 67.8%-68.3%, 59%-60.8%, 60.3%-60.5%, 59.8%, 62%, 62.5% and 41.8% nucleotide identities with that of aMPV/C, hMPV, aMPV/A, aMPV/B, aMPV/D, the potential new aMPV subtype strains PAR-05 (MK491499) and GuMPV_B29 (MN175553) and mice pneumovirus, respectively (Table 3). Compared with the full genomes of aMPV and hMPV, the results show that aMPV-FJ21 has a similar viral genomic structure and a consistent length of major viral protein genes to aMPV/C strains in ducks, such as strains 99178, S-01 (KF364615), and HL1 (OR365551), whereas the deduced amino acid sequence length of the L gene was longer than that of strain 15a (DQ009484) in geese, as well as the aa sequence length of the G gene longer than that of aMPV/C in turkeys or pheasants. The length of M remained the most conservative until the new aMPV subtype strain PAR-05 was found (Figure 6). Additionally, the lengths of the N, P, M and M2 genes exhibit remarkable stability between aMPV/C and hMPV. A high degree of amino acid sequence homology was found in other all seven of the proteins except for the G gene among the other fully sequenced aMPV/C. The sequencing data placed aMPV-FJ21 in the C subtype of aMPV. The amino acid sequence homology also indicated that aMPV-FJ21 was more homologous to hMPV than other aMPV including the potential new aMPV subtype, except for the G gene (Table 3). The phylogenetic tree based on the whole genomes or G protein of 39 representative strains downloaded from the GenBank database (13 strains of aMPV/C, 8 strains of hMPV, 6 strains of aMPV/A, 7 strains of aMPV/B, 1 strain of aMPV/D, 2 strains of mice pneumovirus, 2 strains of the potential new aMPV subtypes) indicated that aMPV-FJ21 belongs to aMPV/C, but is in a new genetic evolutionary branch and divergent from all the aMPV/C strains reported (Figure 7). In this paper, it is firstly reported that the strain aMPV-FJ21, isolated from Sheldrake ducks with hydrosalpinx fluid syndrome in Southeastern China, belongs to the aMPV/C family, but originated from a new lineage of aMPV/C.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 3. Comprehensive genomic and amino acid homology comparison of the strain aMPV-FJ21 with other viruses\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"738\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\" style=\\\"width: 133px;\\\"\\u003e\\n \\u003cp\\u003eName\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd colspan=\\\"8\\\" style=\\\"width: 604px;\\\"\\u003e\\n \\u003cp\\u003eSimilarity to aMPV-FJ21 (%)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003eaMPV/C\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003ehMPV\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 72px;\\\"\\u003e\\n \\u003cp\\u003eaMPV/A\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003eaMPV/B\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 67px;\\\"\\u003e\\n \\u003cp\\u003eaMPV/D\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 81px;\\\"\\u003e\\n \\u003cp\\u003eNew aMPV(MK491499)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003eNew aMPV(MN175553)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003eMPV\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 133px;\\\"\\u003e\\n \\u003cp\\u003eGenome\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e87.1-95.0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e67.8-68.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 72px;\\\"\\u003e\\n \\u003cp\\u003e59-60.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e60.3-60.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 67px;\\\"\\u003e\\n \\u003cp\\u003e59.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 81px;\\\"\\u003e\\n \\u003cp\\u003e62\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e62.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e41.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 133px;\\\"\\u003e\\n \\u003cp\\u003eNucleocapsid, N\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e93.6-96.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e88.9-89.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 72px;\\\"\\u003e\\n \\u003cp\\u003e70.7-71.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e71.4-71.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 67px;\\\"\\u003e\\n \\u003cp\\u003e73.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 81px;\\\"\\u003e\\n \\u003cp\\u003e72\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e84.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e43.7-43.9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 133px;\\\"\\u003e\\n \\u003cp\\u003ePhosphoprotein, P\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e91.8-95.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e67.5-68.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 72px;\\\"\\u003e\\n \\u003cp\\u003e56.5-57.9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e55.6-55.9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 67px;\\\"\\u003e\\n \\u003cp\\u003e56.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 81px;\\\"\\u003e\\n \\u003cp\\u003e59.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e62.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e30-30.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 133px;\\\"\\u003e\\n \\u003cp\\u003eMatrix protein, M\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e94.7-95.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e87.1-87.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 72px;\\\"\\u003e\\n \\u003cp\\u003e78\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e78-78.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 67px;\\\"\\u003e\\n \\u003cp\\u003e78.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 81px;\\\"\\u003e\\n \\u003cp\\u003e82\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e85.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e39.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 133px;\\\"\\u003e\\n \\u003cp\\u003eFusion protein, F\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e92.8-95.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e80.9-81.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 72px;\\\"\\u003e\\n \\u003cp\\u003e72.9-73.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e72.9-73.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 67px;\\\"\\u003e\\n \\u003cp\\u003e73.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 81px;\\\"\\u003e\\n \\u003cp\\u003e74.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e79.9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e41.1-41.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 133px;\\\"\\u003e\\n \\u003cp\\u003eSecond matrix-1, M2-1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e94.2-96.0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e82.2-83.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 72px;\\\"\\u003e\\n \\u003cp\\u003e7.12-72.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e74.6-75.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 67px;\\\"\\u003e\\n \\u003cp\\u003e72.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 81px;\\\"\\u003e\\n \\u003cp\\u003e75.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e77.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e38.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 133px;\\\"\\u003e\\n \\u003cp\\u003eSecond matrix-2, M2-2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e92.6-96.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e56.9-53.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 72px;\\\"\\u003e\\n \\u003cp\\u003e20.8-23.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e22.2-23.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 67px;\\\"\\u003e\\n \\u003cp\\u003e23.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 81px;\\\"\\u003e\\n \\u003cp\\u003e33.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e33.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e15.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 133px;\\\"\\u003e\\n \\u003cp\\u003eSmall hydrophobic, SH\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e88.2-93.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e26.3-28.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 72px;\\\"\\u003e\\n \\u003cp\\u003e17.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e22.2-24.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 67px;\\\"\\u003e\\n \\u003cp\\u003e20\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 81px;\\\"\\u003e\\n \\u003cp\\u003e24.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e15.9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e16.1-16.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 133px;\\\"\\u003e\\n \\u003cp\\u003eGlycoprotein, G\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e55.6-78.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e24.1-26.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 72px;\\\"\\u003e\\n \\u003cp\\u003e44.9-46.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e22.8-24.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 67px;\\\"\\u003e\\n \\u003cp\\u003e25.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 81px;\\\"\\u003e\\n \\u003cp\\u003e22.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e22.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e18.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 133px;\\\"\\u003e\\n \\u003cp\\u003eLarge polymerase, L\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 79px;\\\"\\u003e\\n \\u003cp\\u003e93.1-95.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e80.6-80.9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 72px;\\\"\\u003e\\n \\u003cp\\u003e64.1-64.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e64.3-64.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 67px;\\\"\\u003e\\n \\u003cp\\u003e64\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 81px;\\\"\\u003e\\n \\u003cp\\u003e62.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 82px;\\\"\\u003e\\n \\u003cp\\u003e69.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 71px;\\\"\\u003e\\n \\u003cp\\u003e50.4-50.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003ch2\\u003eAmino acid mutation of aMPV G proteins and recombination analysis\\u003c/h2\\u003e\\n\\u003cp\\u003eThe G gene of aMPV-FJ21 contained a major ORF of 585 aa, which was as long as published duck and goose isolates of aMPV/C, while the amino acid sequence length of the G protein was \\u0026gt;2 times longer than that of the turkey aMPV/C strain USA-Colorado (252 aa) or pheasant aMPV/C strain PL-1 (264 aa), and was also the longest G gene in all \\u003cem\\u003ePneumovirinae\\u003c/em\\u003e sequenced to date. Furthermore, its membrane anchor is consists firstly of a cytoplasmic tail (30 aa) at the N-terminus and secondly of a trans-membrane domain (24 aa), followed by a long extracellular domain (55 aa-585 aa). Alignments of the seven G aa sequences available from aMPV/C isolates revealed relatively conserved cytoplasmic and trans-membrane domains within the aMPV/C lineages, also conserved in the two hMPV isolates, but without continuous conserved aa in cytoplasmic and trans-membrane domains of other subtypes of aMPV (Figure 8). Although the cytoplasmic and trans-membrane domains were conserved in aMPV/C strains, yet aMPV-FJ21 had 7 aa mutations in cytoplasmic and trans-membrane domains, which was more mutations than other members of aMPV/C. Additionally, the extracellular domain of the G protein indicated a clear compartmentalisation into an initially mutable and disordered region and then a conserved and ordered region rich in cysteine residues and closed to the C-terminus a clear compartmentation into firstly mutable and disordered region and then a conserved and ordered region, which was rich in cysteine residues and closed to the C-terminus (Figure 8). In pairwise alignments, the G aa sequence of aMPV-FJ21 shared only 55.6%-74.5% aa identity with the North American aMPV/C lineage, and 74.5%-78.7% with the Eurasian lineage, and at best 46.2% total aa identity with the G proteins of other aMPVs or hMPVs (Figure 8).\\u003c/p\\u003e\\n\\u003cp\\u003eCombined analysis of RDP4 and Simplot revealed no recombination events in aMPV-FJ21 (data not shown). Although strains aMPV-FJ21 and 99178 share 95% nucleotide homology, rather than the genetic differences between them due to mutations restructuring events.\\u003c/p\\u003e\\n\\u003ch2\\u003ePathogenicity of strain aMPV-FJ21 in laying Sheldrake ducks\\u003c/h2\\u003e\\n\\u003cp\\u003eTo evaluate the pathogenicity of strain aMPV-FJ21, clinical signs were observed daily in 155-day-old laying Sheldrake ducks inoculated with aMPV-FJ21. Infected laying ducks (group 1) exhibited mild upper respiratory tract cough, which appeared on dpi 3 and disappeared on dpi 8. No death occurred throughout the experimental period in any groups. As shown in Figure 9, the average egg-laying rates of each three days in the infected laying ducks (group 1) were 61.1%-74.67% during 6 dpi to 27 dpi, while it was 75.56%-88.07% in the uninfected control group. According to the formula [R=(P-N)/N\\u0026times;100%]), the ratio of relative reduction in egg laying during this period of time was 9.84%-22.18%. To 30 dpi, the average egg laying rate per three days in the infected group had almost recovered to the level of the control group. Moreover, necropsies revealed similar regression (Figure 1C, F and I).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTo detect viral shedding in aMPV-FJ21-infected ducks, viral RNA extracted from nasal, eye, throat and cloacal swabs were evaluated via RT-qPCR at 1, 3, 7, 10, 14, 22, 28 dpi. The results showed that viral shedding started at 1 dpi in nasal, eye, throat and cloacal swabs and continued via tears up to 22 dpi. Shedding in eye swabs was observed for the longest time (22 days), and the highest rate of shedding was at 1-7 dpi, at which point it reached 100%, then in\\u0026nbsp;nasal swabs\\u0026nbsp;for 14 days, yet shedding in throat swabs was the shortest time at 7 days (Table 4). Ducks in the control group were negative for aMPV/C.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 4. Viral shedding of the strain aMPV-FJ21 in infected ducks\\u0026nbsp;\\u003c/strong\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"739\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003eViral shedding\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd colspan=\\\"8\\\"\\u003e\\n \\u003cp\\u003eThe positive of RT-qPCR(%) on serial days postinfection\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0 dpi\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e1 dpi\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e3 dpi\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e7 dpi\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e10 dpi\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e14 dpi\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e22 dpi\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e28 dpi\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e\\u0026nbsp;Eye swabs\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e100 (5/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e100 (5/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e100 (5/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e40 (2/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e20 (1/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e20 (1/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eNose swabs\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e100 (5/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e80 (4/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e40 (2/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e20 (1/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e20 (1/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eThroat swabs\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e100 (5/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e80 (4/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e20 (1/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003eCloacal swabs\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e100 (5/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e60 (3/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e40 (2/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e20 (1/5)\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd\\u003e\\n \\u003cp\\u003e0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u0026nbsp;To evaluate the distribution of aMPV-FJ21 in different tissues, viral RNA was extracted from 17 tissues at 14 dpi and detected using real-time qPCR. The results showed the viral RNA were detectable in all examined tissues, although their viral contents differed among the various tissues. Viral RNA was more highly expressed in the non-parenchymatous tissues, such as oviduct, bursa of Fabricius, air sac, lung, trachea and intestine, than that in the parenchymatous tissues (pancreas, spleen, kidney, heart, liver, brain, thymus, and Harderian gland), with the highest levels in hydrosalpinx fluid and the lowest levels in the brain (Figure 10).\\u003c/p\\u003e\\n\\u003cp\\u003eHistopathological analysis using hematoxylin and eosin staining showed that the oviduct and air sac showed obvious changes in ducks infected with aMPV-FJ21. Hemorrhage, congestion and severe inflammatory cell infiltration were observed in the fallopian tubal mucosal lamina propria and submucosa of the folds of the oviductal mucosa and similar lesions in the air sac, except for hemorrhage. No significant abnormalities were observed in the uninfected control group. IHC results showed that a strong brown staining signal was observed in the oviduct and air sac infected with aMPV-FJ21 (Figure 11). These results indicated that aMPV-FJ21 successfully infected the oviduct and air sac.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThe co-circulation of classical and emerging avian diseases in the Chinese duck industry remains a challenging situation, mainly due to the insufficient application of biosafety protection measures and genetic variations of pathogens. Although considerable attention has been paid to classical diseases such as AIV [30], ATMUV [25, 31], EDSV-76 [32], DPV [33], APMV [34], DHAV-1 [29] and various bacterial infections [35] in laying ducks, the prevalence of metapneumovirus in laying duck flocks has been largely ignored. Avian metapneumovirus subtype C (aMPV/C) was originally documented in turkeys with severe upper respiratory disease in the United States in 1996 [8]. Since its emergence, the occurrence of this disease has surged and undergone a geographic expansion [12-14, 36]. In China, there was only one report of aMPV/C in Muscovy ducks in 2014 [14], with no further reports of its isolation from other waterfowl in the Asian region. However, from March 2021, we found a severe viral disease caused by aMPV/C widespread around the laying-duck-producing regions of China [20]. Subsequently, Yu et al. also provided molecular evidence for aMPV/C as the cause of HFS in the local duck breeds, with no evidence of virus acquisition [21]. In this study, we successfully characterized and isolated an aMPV/C strain aMPV-FJ21 from an outbreak of laying Sheldrake ducks with HFS in southeastern China and determined that the strain aMPV-FJ21 belongs to a new lineage of aMPV/C. Together with the data on the previous characterization of aMPV/C in Muscovy ducks and Cherry valley ducks with upper respiratory symptom in China [22], the present study not only confirms the occurrence of the virus in Sheldrake ducks, but also suggests that aMPV/C infection might be widespread in Chinese duck flocks, accompanying with genetic variation and various pathogenic phenotypes.\\u003c/p\\u003e\\n\\u003cp\\u003eOur research is the first to report showing that a new lineage of aMPV/C was responsible for the epidemic occurring in Sheldrake ducks in China. Sequencing and analysis of the G protein from the strain aMPV-FJ21 revealed its closest genetic similarity (approximately 78%) to identity with that of the French isolate 99178 in Muscovy ducks, and also similar with the Chinese isolate S-01 in Muscovy ducks [14], however, it seems extremely low as an ancestor of aMPV-FJ21. Notably, the G protein of aMPV-FJ21 shared less homology with the strain HL1, which was isolated from Jinding ducks with HFS in northeastern China, with only 74.2% identity [21]. Additionally, the strain aMPV-FJ21 was classified as a new lineage of aMPV subgroup C based on phylogenetic analysis of the G gene and the full genome, and divergent from all the duck-originated strains. This may suggest that aMPV-FJ21 and HL1 or S-01 originated from different ancestor, indicating that the situation of aMPV/C infection in China is complex and the distribution of the virus is highly diverse. The relationship between aMPV-FJ21 and S-01 or HL1 needs more surveillance studies. Previous researches have revealed that wild birds, especially wild mallards, may be involved in the transmission of the aMPV/C virus [9, 37-39], suggesting that wild birds may be a reservoir of aMPV/C and have a potential mechanism for the spreading of aMPV/C to poultry. The results in the present study further indicate that the possibility of aMPV/C transmission from wild birds to ducks. How the aMPV-FJ21 was transmitted to Sheldrake ducks in China, and further investigation is needed to determine whether the outbreak lineage is or will become enzootic in China.\\u003c/p\\u003e\\n\\u003cp\\u003eThe G protein is one of the viral attachment proteins known to be an important immune response antigen and virulence factor, and this protein has variance in all metapneumoviruses [4, 40]. Comparing the different G protein lengths, the same G protein lengths (585 aa) are found in all the published aMPV/C strains isolated from the different waterfowl species, including Muscovy ducks, Sheldrake ducks, Jinding ducks, Cherry ducks and geese (Figure 6). The recent and the previous duck aMPV/C strains from the ducks share the same G protein lengths with the goose-originated aMPV/C strain (15a, DQ009484) [41]. In contrast, the turkey (USA-Colorado, AY579780) [42] and pheasant aMPV/C strains (PL1, EF199771) [36], which contain similar G protein lengths, possess shorter G-protein lengths. This may suggest that the G-protein lengths of the aMPV/C strains are stable among the same species during virus evolution. In addition, the G deduced aa sequence of aMPV/A, aMPV/B, aMPV/D and hMPV, even the new aMPV strains PAR-05 [18] and GuMPV_B29 [19], was shorter than that of aMPV/C isolated from waterfowl. Previous reports suggest that all of the deletion regions may be related to host specificity [11, 37, 43], and our findings clearly show that the G protein plays a pivotal role in the cross-species transmission of metapneumoviruses. \\u0026nbsp; \\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003ePrior to our study, there was no published report that successfully replicated the disease with experimental aMPV/C infection in Sheldrake ducks. Although Yu et al. provided the genome of aMPV/C with HFS in local duck breeds, they did not mention to reproduce a clinical case of aMPV/C infection in Sheldrake ducks [21]. Our studies on the pathogenicity of the strain aMPV-FJ21 in laying ducks revealed that the virus not only triggers slight coughing, egg-drop but also leads to viral shedding and accumulation of hydrosalpinx fluid in the oviducts. The egg drop rate is consistent with that observed in clinical cases infected with aMPV/C [21, 22], but is lower than that of the S-01 strain-infected Muscovy ducks with the highest drop rate of about 72.5% [14]. Furthermore, during experimental infection of Sheldrake ducks, we first observed an extended period of virus shedding was detected in eye swabs, with a maximum rate of 100% at 7 dpi. Thereinto, virus shedding was also detected in nasal, throat and cloacal swabs. The virus shedding was also observed in nasal swabs from the aMPV/C-infected Cherry valley ducks with different pathogenic phenotype [22]. The results suggest that aMPV/C originated from different hosts may be transmitted horizontally via eye, nosal, pharyngeal and cloacal secretions or wastes. No deaths occurred in this experimental animal challenge, but the mortality rate in the affected flocks was approximately 15% [20, 21]. We speculate that this may be due to environmental conditions, stocking density, or the presence of secondary infections such as \\u003cem\\u003eEscherichia coli, Riemerella anatipestifer or Pasteurella multocida\\u003c/em\\u003e in the field. Notably, the results of the pathological changes and histopathological analysis showed that the strain aMPV-FJ21 mainly targets the oviducts, causing an accumulation of hydrosalpinx fluid, as well as lesions in the air sacs involved in respiration. Furthermore, viral tissue distribution results also showed that viral RNA was more highly expressed in non-parenchymatous tissues with mucous membranes, including the oviducts, bursa of Fabricius and air sacs, compared to parenchymatous tissues such as livers, kidneys or brains. It suggests that the virus is capable of infecting all host tissues with mucous membranes, attacking not only the reproductive tract but also the respiratory tract. Whereas, preciously reported aMPV/C strains with respiratory symptoms mainly target the respiratory tract [14, 22, 44, 45], resulting in lesions of the nose, tracheae and lung, with no reports of the pathological changes in the air sacs. These pathogenic differences may be associated with the variance in the viral glycoproteins, the G and SH proteins, but further experimental evidence is required to confirm this hypothesis.\\u003c/p\\u003e\\n\\u003cp\\u003eIn conclusion, we successfully isolated a new strain, aMPV-FJ21, of aMPV/C from Shelduck ducks with hydrosalpinx fluid syndrome, and provided insights into its genomic characteristics and pathogenicity. G-protein and whole-genome phylogenetic analyses indicated that aMPV-FJ21 represents a new lineage of aMPV/C and is divergent from the North American and Eurasian lineages. Pathogenicity analysis revealed that aMPV-FJ21-infected laying ducks exhibited hemorrhage, congestion, increased inflammatory cell infiltration in the oviduct or air sac, and thickening of the oviductal mucosal folds. Our results have increased the knowledge of the molecular characteristics of aMPV/C, and enriched the understanding of aMPV/C diversity. We have confusion how this new aMPV/C strain was introduced into duck populations and how many poultry they have infected in China. Therefore, further studies on rapid diagnosis technology, pathogenic mechanism, and vaccine development of aMPV/C are needed to lay the groundwork for the prevention and control of this disease.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch2\\u003eCompeting interests\\u003c/h2\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e\\n\\u003ch2\\u003eAuthors’ contributions\\u003c/h2\\u003e\\n\\u003cp\\u003eQLF: acquisition, analysis, and interpretation of data; statistical analysis; and drafting of the manuscript. WWW, WLJ, JHL: data acquisition and analysis. SC, TZ, LL, NSJ, CHW, QZL, LFC, HMC, RCL: contributing to the animal experiments.\\u0026nbsp;YH, LZL, GHF: study design, critical revision of the manuscript for important intellectual content, study supervision. All authors read and approved the final manuscript.\\u003c/p\\u003e\\n\\u003ch2\\u003eFunding\\u003c/h2\\u003e\\n\\u003cp\\u003eThis work was supported by the earmarked fund for China Agriculture Research System (CARS-42), the Free Exploration of Scientific and Technological Innovation Projects of Fujian Academy of Agricultural Sciences (ZYTS202419), the Fundamental Research funds of Fujian for Public Welfare Research Institutes (2024R1025009, 2023R1024005), the Fujian Academy of Agricultural Sciences Talent Project Order (YC2019010),\\u0026nbsp;and the Special Projects for the Central-Guided Local Science and Technology Development (2023L3023).\\u003c/p\\u003e\\n\\u003ch2\\u003eAvailability of data and materials\\u003c/h2\\u003e\\n\\u003cp\\u003eAll data underlying the results are available as the article and no additional source data are required. Further inquiries can be directed to the corresponding author. The whole genome of aMPV-FJ21 have been deposited to the Genbank with the accession number PQ634415.\\u003c/p\\u003e\\n\\u003ch2\\u003eAcknowledgements\\u003c/h2\\u003e\\n\\u003cp\\u003eWe thank Mr. XD Zhuang and Mr. YM Cai for helping animal experiment in this study.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eRima B, Collins P, Easton A, Fouchier R, Kurath G, Lamb RA, Lee B, Maisner A, Rota P, Wang L, ICTV Report Consortium (2017) ICTV virus taxonomy profile: pneumoviridae. J Gen Virol 98:2912\\u0026ndash;2913\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAbdel-Azeem AA, Franzo G, Dalle Zotte A, Drigo M, Catelli E, Lupini C, Martini M, Cecchinato M (2014) First evidence of avian metapneumovirus subtype A infection in turkeys in Egypt. Trop Anim Health Prod 46(1):1093\\u0026ndash;1097\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFranzo G, Legnardi M, Mescolini G, Tucciarone CM, Lupini C, Quaglia G, Catelli E, Cecchinato M (2020) Avian metapneumovirus subtype B around Europe: a phylodynamic reconstruction. Vet Res 51(1):88\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJuhasz K, Easton AJ (1994) Extensive sequence variation in the attachment (G) protein gene of avian pneumovirus: evidence for two distinct subgroups. J Gen Virol 75(11):2873\\u0026ndash;2880\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBrown PA, All\\u0026eacute;e C, Courtillon C, Szerman N, Lemaitre E, Toquin D, Mangart JM, Amelot M, Eterradossi N (2019) Host specificity of avian metapneumoviruses. Avian Pathol 48(4):311\\u0026ndash;318\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eToquin D, Guionie O, Jestin V, Zwingelstein F, Allee C, Eterradossi N (2006) European and American subgroup C isolates of avian metapneumovirus belong to different genetic lineages. Virus Genes 32(1):97\\u0026ndash;103\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJesse ST, Rib\\u0026oacute;-Molina P, Jo WK, Rautenschlein S, Vuong O, Fouchier RAM, Ludlow M, Osterhaus ADME (2022) Molecular characterization of avian metapneumovirus subtype C detected in wild mallards (\\u003cem\\u003eAnas platyrhynchos\\u003c/em\\u003e) in the Netherlands. Transbound Emerg Dis 69(6):3360\\u0026ndash;3370\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKleven SH (1997) Report of the committee: Transmissible diseases of poultry and other avian species. Proceedings of the U.S. Animal Health Association 101st Annual Meeting. U.S. Animal Health Association,Washington, D.C\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShin HJ, Njenga MK, McComb B, Halvorson DA, Nagaraja KV (2000) Avian pneumovirus (APV) RNA from wild and sentinel birds in the United States has genetic homology with RNA from APV isolates from domestic turkeys. J Clin Microbiol 38(11):4282\\u0026ndash;4284\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCha RM, Yu Q, Zsak L (2013) The pathogenicity of avian metapneumovirus subtype C wild bird isolates in domestic turkeys. Virol J 30(10):38\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJesse ST, Ludlow M, Osterhaus ADME (2022) Zoonotic origins of human metapneumovirus: A journey from birds to humans. Viruses 14(4):677\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eToquin D, B\\u0026auml;yon-Auboyer MH, Eterradossi N, Jestin V, Morin H (1999) Isolation of a pneumovirus from a Muscovy duck. Vet Rec 145(23):680\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWei L, Zhu SS, Yan X, Wang J, Zhang CY, Liu SH, She RP, Hu FJ, Quan R, Liu J (2013) Avian metapneumovirus subgroup C infection in chickens, China. Emerg Infect Dis 19(7):1092\\u0026ndash;1094\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSun SK, Chen F, Cao S, Liu JJ, Lei W, Li GW, Song YF, Lu JP, Liu C, Qin JP, Li HY (2014) Isolation and characterization of a subtype C avian metapneumovirus circulating in Muscovy ducks in China. Vet Res 45(1):74\\u0026ndash;87\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJardine CM, Parmley EJ, Buchanan T, Nituch L, Ojkic D (2018) Avian metapneumovirus subtype C in wild waterfowl in Ontario, Canada. Transbound Emerg Dis 65(4):1098\\u0026ndash;1102\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGraziosi G, Mescolini G, Silveira F, Lupini C, Tucciarone CM, Franzo G, Cecchinato M, Legnardi M, Gobbo F, Terregino C, Catelli E (2022) First detection of avian metapneumovirus subtype C Eurasian lineage in a Eurasian wigeon (\\u003cem\\u003eMareca penelope\\u003c/em\\u003e) wintering in Northeastern Italy: an additional hint on the role of migrating birds in the viral epidemiology. Avian Pathol 51(3):283\\u0026ndash;290\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eB\\u0026auml;yon-Auboyer MH, Arnauld C, Toquin D, Eterradossi N (2000) Nucleotide sequences of the F, L and G protein genes of two non-A/non-B avian pneumoviruses (APV) reveal a novel APV subgroup. J Gen Virol 81(11):2723\\u0026ndash;2733\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRetallack H, Clubb S, DeRisi JL (2019) Genome sequence of a divergent avian metapneumovirus from a Monk Parakeet (\\u003cem\\u003eMyiopsitta monachus\\u003c/em\\u003e). Microbiol Resour Announc 8(16):e00284\\u0026ndash;e00219\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCanuti M, Kroyer ANK, Ojkic D, Whitney HG, Robertson GJ, Lang AS (2019) Discovery and characterization of novel RNA viruses in aquatic North American wild birds. Viruses 11(9):768\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFu QL, Jiang NS, Liang QZ, Liu RC, Wan CH, Cheng LF, Chen HM, Lin L, Jiao WL, Wu SH, Jiang B, Zheng XL, Lin JS, Fu GH, Huang Y (2023) Hydrosalpinx fluid syndrome in ducks caused by avian metapneumovirus subgroup C. FJAS 38(12):1387\\u0026ndash;1394\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYu RL, Zhong XF, Zeng YT, Wang XY, Zhang DB (2024) Molecular characterization of avian metapneumovirus subtype C associated with hydrosalpinx fluid and egg drop syndrome in Jinding ducks. Arch Virol 169(9):191\\u0026ndash;196\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXu GG, Wang BN, Qiao ZW, Fan L, Jiang SJ, Zhang RH (2025) Isolation and characterization of an avian metapneumovirus subtype C circulating in Cherry Valley ducks. Poult Sci 104(2):104650\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAli A, Reynolds DL (1999) A reverse transcription-polymerase chain reaction assay for the detection of avian pneumovirus (Colorado strain). Avian Dis 43(3):600\\u0026ndash;603\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFereidouni SR, Starick E, Grund C, Globig A, Mettenleiter TC, Beer M, Harder T (2009) Rapid molecular subtyping by reverse transcription polymerase chain reaction of the neuraminidase gene of avian influenza A viruses. Vet Microbiol 135:253\\u0026ndash;260\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSu JL, Li S, Hu XD, Yu XL, Wang YY, Liu PP, Lu XS, Zhang GZ, Hu XY, Liu D, Li XX, Su WL, Lu H, Mok NS, Wang PY, Wang M, Tian KG, Gao GF (2011) Duck egg-drop syndrome caused by BYD virus, a new Tembusu-related flavivirus. PLoS ONE 6(3):e18106\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKumar NS, Kataria JM, Koti M, Dhama K, Toroghi R (2003) Detection of egg drop syndrome 1976 virus by polymerase chain reaction and study of its persistence in experimentally infected layer birds. Acta Virol 47:179\\u0026ndash;184\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHansen WR, Brown SE, Nashold SW, Knudson DL (1999) Identification of duck plague virus by polymerase chain reaction. Avian Dis 43(1):106\\u0026ndash;115\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHines NL, Killian ML, Pedersen JC, Reising MM, Mosos NA, Mathieu-Benson C, Miller CL (2012) An rRT-PCR assay to detect the matrix gene of a broad range of avian paramyxovirus serotype-1 strains. Avian Dis 56(2):387\\u0026ndash;395\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang RH, Chen JH, Zhang JQ, Yang YP, Li PF, Lan JJ, Xie ZJ, Jiang SJ (2018) Novel duck hepatitis A virus type 1 isolates from adult ducks showing egg drop syndrome. Vet Microbiol 221(23):33\\u0026ndash;37\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRehman S, Rantam FA, Batool K, Shehzad A, Effendi MH, Witaningrum AM, Bilal M, Elziyad Purnama MT (2022) Emerging threats and vaccination strategies of H9N2 viruses in poultry in Indonesia: A review. F1000 Res 11:548\\u0026ndash;564\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWan CH, Huang Y, Fu GH, Shi SH, Cheng LL, Chen HM (2012) Complete genome sequence of avian tembusu-related virus strain WR isolated from White Kaiya ducks in Fujian, China. J Virol 86(19):10912\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRazmarai Iranagh AA, Razmaraii N, Aghaei R, Shayegh J, Mousaviyan M, Ameghi Roudsary A (2023) Study on propagation and adaptation of EDS-76 avian adenovirus in duck and SPF primary embryonic chicken cell culture comparison to duck and SPF embryonated chicken eggs. Arch Razi Inst 78(3):1095\\u0026ndash;1105\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu LP, Tian B, Wang MS, Cheng AC, Jia RY, Zhu DK, Liu MF, Yang Q, Wu Y, Huang J, Zhao XX, Chen S, Zhang SQ, Ou XM, Mao S, Gao Q, Sun D, Yu YL, Zhang L, Pan LC (2022) Duck plague virus negatively regulates IFN signaling to promote virus proliferation via JNK signaling pathway. Front Immunol 13:935454\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSobolev IA, Sharshov K, Yurchenko K, Korneev D, Glushchenko A, Alikina T, Kabilov M, Bi Y, Liu W, Gubanova N, Shestopalov A (2016) Characterization of avian paramyxovirus type 6 isolated from a Eurasian teal in the intersection of migratory flyways in Russia. Arch Virol 161(11):3275\\u0026ndash;3279\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSonger JG, Uzal F (2013) Ulcerative enteritis. In: Swayne DE (ed) Diseases of poultry. John Wiley and Sons, Inc, Iowa, pp 944\\u0026ndash;948\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLee Eh, Song MS, Shin JY, Lee YM, Kim CJ, Lee YS, Kim H, Choi YK (2007) Genetic characterization of avian metapneumovirus subtype C isolated from pheasants in a live bird market. Virus Res 128(1\\u0026ndash;2):18\\u0026ndash;25\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBennett RS, LaRue R, Shaw D, Yu Q, Nagaraja KV, Halvorson DA, Njenga MK (2005) A wild goose metapneumovirus containing a large attachment glycoprotein is avirulent but immunoprotective in domestic turkeys. J Virol 79(23):14834\\u0026ndash;14842\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTurpin EA, Stallknecht DE, Slemons RD, Zsak L, Swayne DE (2008) Evidence of avian metapneumovirus subtype C infection of wild birds in Georgia, South Carolina, Arkansas and Ohio USA. Avian Pathol 37:343\\u0026ndash;351\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSalles GBC, Pilati GVT, Muniz EC, de Lima Neto AJ, Vogt JR, Dahmer M, Savi BP, Padilha DA, Fongaro G (2023) Trends and challenges in the surveillance and control of avian metapneumovirus. Viruses 15(9):1960\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eIshiguro N, Ebihara T, Endo R, Ma X, Kikuta H, Ishiko H, Kobayashi K (2004) High genetic diversity of the attachment (G) protein of human metapneumovirus. J Clin Microbiol 42(8):3406\\u0026ndash;3414\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChockalingam AK, Chander Y, Halvorson DA, Goyal SM (2010) Stability of the glycoprotein gene of avian metapneumovirus (Canada goose isolate 15a/01) after serial passages in cell cultures. Avian Dis 54(2):915\\u0026ndash;918\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVelayudhan BT, Yu Q, Estevez CN, Nagaraja KV, Halvorson DA (2008) Glycoprotein gene truncation in avian metapneumovirus subtype C isolates from the United States. Virus Genes 37(2):266\\u0026ndash;272\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKong BW, Foster LK, Foster DN (2008) Species-specific deletion of the viral attachment glycoprotein of avian metapneumovirus. Virus Res 132(1\\u0026ndash;2):114\\u0026ndash;121\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang J, Hou L, Wei L, Yan X, Zhu SS, Quan R, Li ZX, Wang D, Jiang HJ, Song JW, Cui YQ, Liu J (2023) Characterization of avain metapneumovirus subgroup C isolated from chickens in Beijing, China. Poult Sci 102(1):102250\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYao ZY, Li YJ, Shi YY, Sun T, Yang XY, Mao JY, Quan R, Wang D, Wang DD, Zhou JW, Liu J, Chu J, Hou L (2025) Isolation and identification of a subtype C avian metapneumovirus in chickens in Jiangsu, China. Microb Pathog 202:107394\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Avian metapneumovirus subtype C, Sheldrake ducks, egg-drop, hydrosalpinx fluid, genome\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6720429/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6720429/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eSince 2021, an epidemic disease characterized with hydrosalpinx fluid syndrome (HFS) has been circulating in the breeding and laying Sheldrake ducks in China, which seriously endangers the healthy development of the duck industry. The pathogen of the disease was tract to avian metapneumovirus subtype C (aMPV/C) causing egg-drop and acute upper respiratory diseases in poultry. To date, no further reports have been made to isolate and characterize aMPV/C infection in Sheldrake ducks in China. In this study, a strain of virus (named as aMPV-FJ21) was isolated from diseased Sheldrake ducks exhibiting HFS using Vero cell line. Transmission electron microscopy showed that the strain was an enveloped virus with spherical or multiple morphologies. The immunofluorescence assay revealed that the virus strain aMPV-FJ21 had an obvious reactive activity with the ploy-antibody against aMPV/C F protein. The genome sequence of aMPV-FJ21 was 14149 nucleotides (nt) in length, sharing 87.1%-95% nt similarity to that other aMPV/C strains, and yet the G protein of the strain was only 55.6%-78.8% identical to that of aMPV/C strains. Phylogenetic analysis showed that aMPV-FJ21 formed an independent branch of aMPV/C and had a distant genetic relationship with other aMPV/C strains, suggesting that it might represent a new genetic lineage. In vivo challenge experiments demonstrated that aMPV-FJ21 induced clinical symptoms similar to those of natural cases in laying Sheldrake ducks, with a reduction of approximately 15% in the average of daily egg production. In addition, aMPV-FJ21-infected ducks shed progeny virions via tears for the longest period (22 days). Detection of tissue distribution of viral RNA showed that the viral RNA exhibited higher expression in non-parenchymatous tissues than in parenchymatous tissues. Altogether, we isolated a new lineage of aMPV/C from Sheldrake ducks with HFS and confirmed that the virus is the real agent responsible for HFS in Sheldrake ducks for the first time, which provides basic data for further study of the pathogenic mechanism of the virus.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Novel avian metapneumovirus subtype C is a newly emerged pathogen causing hydrosalpinx fluid syndrome in Sheldrake ducks in China\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-05-27 06:10:54\",\"doi\":\"10.21203/rs.3.rs-6720429/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"d2c76d3d-f19f-44aa-83cc-8aeebadeda41\",\"owner\":[],\"postedDate\":\"May 27th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-07-08T06:23:51+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-05-27 06:10:54\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6720429\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6720429\",\"identity\":\"rs-6720429\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}