{"paper_id":"30e7c782-8fa0-43c8-87fa-426ca32b6e25","body_text":"1 \n \nInfluence of the ectopic location on the antigen expression  and functional \ncharacteristics of endometrioma stromal cells \n \nMaría José Ruiz-Magaña1, José M. Puerta1,§, Tatiana Llorca1,2, Cristina Méndez-Malagón1,2, Rocío \nMartínez-Aguilar1,2,§, Ana Clara Abadía-Molina1,2, Enrique G. Olivares1,2,3*, Carmen Ruiz-Ruiz1,2* \n \n1Instituto de Biopatología y Medicina Regenerativa, Centro de Investigación Biomédica, \nUniversidad de Granada, Armilla, Granada, Spain \n2Departamento de Bioquímica y Biología Molecular III e Inmunología, Universidad de Granada, \nGranada, Spain \n3Unidad de Gestión Clínica Laboratorios, Complejo Hospitalario Universitario de Granada, \nGranada, Spain  \n \n*Address for correspondence:  \nDepartamento de Bioquímica y Biología Molecular III e Inmunología, Facultad de Medicina, \nAvenida de la Investigación, 11, 18016 Granada, Spain. Tel: +34-958 248809. E-mail: \nengarcia@ugr.es (E.G.O.)  \nDepartamento de Bioquímica y Biología Molecular III e Inmunología, Facultad de Medicina, \nAvenida de la Investigación, 11, 18016 Granada, Spain. Tel: +34-958 246631. E-mail: \nmcarmenr@ugr.es (C.R.R.)  \n \n§Present address:  \nHospital Quirón Ruber Juan Bravo, Madrid, Spain (J.M.P.).  \nMedical Research Council Centre for Reproductive Health, University of Edinburgh, Scotland, \nUK (R.M.-A.).  \n\n2 \n \nABSTRACT \nResearch question \nEndometriosis has been defined as a progesterone (P4)-resistance disease. Comparative studies of \nthe ectopic and eutopic endometrium of patients have revealed differentially expressed genes that \nmay be involved in the pathogenesis of endometriosis; are the alterations observed in the \nendometriotic cells already present in the eutopic endometrium or are acquired in the ectopic \nlocation? \nDesign \nThe response to decidualization with P4 and cAMP for up to 28 days was compared in different \nendometrial stromal cell (EnSC) lines established from samples of endometriomas (eEnSC), \neutopic endometrium from women with endometriosis (eBEnSC), endometrial tissue from healthy \nwomen (BEnSC), and menstrual blood from healthy donors (mEnSC).  \nResults \nUsual features of decidualized cells, such as the change in cell morphology and the expression of \nprolactin, were similarly observed in the three types of eutopic EnSCs studied, but not in the \nectopic cells upon decidualization. Among the phenotypic markers analyzed, CD105 was down-\nregulated under decidualization in all cell types (mEnSC: P = 0.005, BEnSC: P = 0.029, eBEnSC: \nP = 0.022), except in eEnSCs.  mEnSCs and BEnSCs underwent apoptosis during decidualization, \nwhereas eBEnSCs and eEnSCs were resistant to the induction of cell death. Lastly, migration \nstudies revealed that mEnSCs secreted undetermined factors during decidualization that inhibited \ncell motility, whereas eEnSCs showed a significantly lower ability to produce those migration \nregulating factors (P < 0.0001, P < 0.001 and P = 0.0013 for migration of mEnSC at 24, 48 and 72 \nh, respectively; P < 0.0001 for migration of eEnSC at all times studied). \nConclusions \nThis study provides novel insights into the differences between endometriotic and eutopic \nendometrial cells and reinforce the idea that the microenvironment in the ectopic location plays \nadditional roles in the acquisition of the alterations that characterize the cells of the endometriotic \nfoci. \nComentario [DH1]: Where statistical \nsignificance is reported, please ensure \np values are provided as exact values, \nalthough p<0.001 can be used. \nComentario [MCR2]: It has been \nrevised \nComentario [DH3]: For example, \nthese changes are statistically \nsignificant in Figure 3, so the p values \nneed to be reported in the abstract. \nComentario [MCR4]: It has been \nincluded \nComentario [DH5]: Again, please \nprovide p values to support this \nstatement. \nComentario [MCR6]: It has been \nadded \n\n3 \n \n \nKEYWORDS: endometriosis, endometrial stromal cells, decidualization.  \n\n4 \n \nINTRODUCTION \nEndometriosis is a common gynecologic disease characterized by the presence of endometrial \nglands and stroma outside the uterine cavity. It can affect the ovaries, pelvic organs, peritoneal \ncavity and, less frequently, distant organs such as lungs or pleura (Zondervan et al., 2018).  \nAlthough endometriosis is still an enigmatic disease, several theories have been proposed to \nexplain its etiology. The most widely accepted is the theory of retrograde menstruation, which \nstates that menstruation ascends through the fallopian tubes and flows into the peritoneal cavity, \nfavoring adhesion, invasion and growth of the endometrial fragments deposited there (Zondervan \net al., 2018). However, the cases in which endometrial tissue appears in distant locations would not \nbe attributable to this retrograde menstruation hypothesis. In addition, retrograde menstruation is \nfrequent in healthy women in which endometriosis does not appear. Recently, it has been proposed \nthe stem cell theory which could explain peritoneal as well as extraperitoneal endometriosis \nlesions (Taylor, 2020). This theory asserts that circulating stem cells (mesenchymal stem/stromal \ncells -MSC-) from bone marrow and MSC-related precursors from the endometrium basal layer \ncould undergo a “erroneous homing” to different organs, even in remote locations, where they \nwould differentiate into endometrial tissue (Maruyama and Yoshimura, 2012; Taylor, 2020).  \nDuring the secretory phase of the menstrual cycle and, especially, if pregnancy occurs, the \nendometrial stromal cells (EnSCs) located around the spiral arteries in the human endometrium \nundergo a process of differentiation, called decidualization, in response to progesterone (P4) and \nother ovarian hormones. In this reaction, EnSCs increase in size, change their fibroblastic shape to \na rounder morphology and produce distinctive factors such as prolactin (PRL), insulin-like growth \nfactor binding protein-1 (IGFBP-1) and IL-15 (Bergeron, 2000; Dunn et al., 2003; Richards et al., \n1995). Interestingly, endometriosis has been defined as an estrogen-dependent and P4-resistant \nprocess, so that stromal cells in endometriosis foci (eEnSCs) show an antigen phenotype \nequivalent to that of EnSCs but do not completely decidualize (Bulun et al., 2006) \nThere is opposing literature regarding whether P4 resistance in endometriosis originates in the \neutopic or the ectopic tissue (McKinnon et al., 2018). The eutopic endometrium of women with \nendometriosis have demonstrated an altered response to P4 (Osteen et al., 2005) and numerous \n\n5 \n \ngenes known to be targets of P4 have been found dysregulated in the secretory endometrium from \nwomen with disease (Burney et al., 2007). However, several studies have also identified a large \nnumber of differentially expressed genes and microRNAs (miRNAs) between the ectopic and \neutopic endometrium of women with endometriosis, which may regulate molecular pathways \ninfluencing the pathogenesis of endometriosis (Eyster et al., 2007; Ohlsson Teague et al., 2009; \nTeague et al., 2010). \nTherefore, it is currently unknown whether the alterations detected in the eEnSCs are already \npresent in the eutopic endometrium or are acquired in the ectopic location. Here, we compared the \nantigenic phenotype and functional characteristics in response to decidualization of EnSCs from \nectopic (eEnSCs) and eutopic (eBEnSCs) endometrial tissue of patients with endometriosis. In \naddition, eEnSCs were compared with EnSC of healthy women obtained from two different \nsources: menstrual blood (mEnSC), as it is the best suited source of normal endometrial cells to \ncompare to the chocolate-cyst (endometrioma), and endometrial biopsy (BEnSC) as the \ncounterpart of the eutopic tissue of patients. The change in cell morphology, the production of \nprolactin, the induction of apoptosis and the antigen profile were analyzed in decidualization \nconditions. Moreover, the effect of decidualization on the migration abilities of eEnSCs and \nmEnSCs was investigated.  \n \nMATERIALS AND METHODS \nSamples \nSamples from patients with endometriosis were obtained by laparoscopic surgery at the Hospital \nQuirón Ruber Juan Bravo and Hospital La Zarzuela in Madrid. Endometrial stromal cells were \nisolated from 15 samples of eutopic and 30 samples of ectopic endometrium of patients of \nchildbearing age. The endometriotic cells were isolated from the chocolate content of the \nendometriotic cysts. In all cases, the diagnosis of endometriosis was made intraoperatively and \nlater confirmed by histological study of the sample. In accordance with the revised American \n\n6 \n \nSociety for Reproductive Medicine classification, all patients had moderate to severe \nendometriosis (stage III-IV disease). \nEndometrial samples from 12 non-endometriosis patients were obtained using a hysteroscopic \napproach in women under the age of 40 who underwent the intervention for different reasons, \nexcluding those in which there was suspicion of a malignant neoplastic process. All samples were \nobtained at the Hospital Quirón Ruber Juan Bravo and Hospital La Zarzuela in Madrid. mEnSC \nlines were obtained from 30 menstrual blood samples collected with menstrual cups or tampons \nand donated by healthy women aged 20 to 35 years. Those who were using any medication or with \ninfectious, autoimmune, or other systemic or local disease were excluded.  \nAll donors provided a written informed consent. The Research and Ethics Committee of University \nof Granada approved the study (reference number 186/CEIH/2016, approval date 4 July 2016). \nIsolation and culture of EnSC lines \nFor eEnSC and mEnSC lines, the procedure started with the dilution and washing in phosphate \nbuffer saline (PBS) of chocolate content and menstrual blood, respectively, followed by \ncentrifugation on a Ficoll-Paque  (Sigma-Aldrich, St. Louis, MO, USA) density gradient at 600 g \nfor 20 min. Cells were collected from the interface, washed in PBS, and incubated in culture flasks \nfor 24 h at 37ᵒC with 5% CO2 in OptiMEM (Thermo Fisher Scientific, Waltham, MA, USA) \nsupplemented with 3% (v/v) fetal calf serum (FCS) (Thermo Fisher Scientific), 100 IU/mL \npenicillin, 100 g/mL streptomycin and 0,25 g/mL amphotericin (Sigma-Aldrich). After \novernight incubation to allow adherent cells to attach to the flask, non-adherent cells in the \nsupernatant were discarded. The medium was then replaced and changed thereafter every 3-4 days. \nAfter 1-3 weeks, adherent cells were morphologically uniform and covered the whole surface of \nthe 25-cm2 culture flask.  \nBEnSC and eBEnSc lines were established from endometrial samples by explant culture. Briefly, \nsamples were minced into fragments of about 1-3 mm3, washed in PBS and explants were placed \nin culture flasks with OptiMEM medium, supplemented as indicated above, to allow for cell \nmigration and proliferation. The medium was changed every 3 days without disturbing the \n\n7 \n \nexplants. Cells migrate out of the explant within 5-10 days. When the explants were surrounded by \ncells, they were trypsinized and subcultured. \nIn the low serum-containing medium used for cell culture, cell lines showed a stable antigen \nphenotype and functional activities for 8–12 weeks (up to ten passages) (Garcia-Pacheco et al., \n2001; Muñoz-Fernandez et al., 2006). For all experiments in this study, cell lines were used at \nearly passages (P2-P4, between 3 and 4 weeks after collection). \nDecidualization \nTo induce decidualization, cell lines were cultured to 70% confluence (1.5 x 106 cells in a 75-cm2 \nculture flask or 2 x 105 cells/well in 6-well plates, depending on the type of analysis) and treated \nwith 300 nM P4 and 500 M 8-bromo-cAMP (Sigma-Aldrich) for up to 28 days. The \ndecidualization medium was changed every 4 days. Conditioned media (CM) were collected from \ncultures of undifferentiated and decidualized eEnSC and mEnSC, after 12 days of incubation \nwithout or with P4 and cAMP, and kept frozen until use. \nMorphological analysis \nImages of representative areas of undifferentiated and decidualized cell cultures were acquired \nusing a Leica DMi8 optical microscope equipped with digital camera and processed using the free \nImage J software. Fibroblast-like cells and cells with rounded morphology were counted and the \nresults were expressed as the percentage of rounded cells. \nDetection of apoptotic cells \nDuring decidualization, cells were collected every 7 days to determine the percentage of apoptotic \ncells. Hypodiploid apoptotic cells were detected by flow cytometry according to the published \nprocedures (Gong et al., 1994). Briefly, cells were washed with PBS, fixed in cold 70% (v/v) \nethanol, and later stained with propidium iodide while treated with RNase (Sigma-Aldrich). Sub-\nG1 apoptotic cells were quantified in a FACSCalibur cytometer with the Cell Quest software (BD \nBiosciences, San Jose, CA, USA). \nFlow cytometry analysis \nAnalysis of antigen expression was assessed on the FACSCalibur flow cytometer as previously \ndescribed (Ruiz-Magana et al., 2021). Briefly, cells were detached from the culture flask, \n\n8 \n \nsuspended in PBS and incubated with the appropriate monoclonal antibody for 30 min at 4 ºC in \nthe dark. After incubation, cells were washed, suspended in PBS and analyzed in the flow \ncytometer. For intracytoplasmic labeling, cells were fixed with 4% paraformaldehyde (PFA) \n(Merck, Darmstadt, Germany) for 20 min at 4 ºC and permeabilized with cold 0.05 % PBS saponin \n(Merck) before the antibody was added. For indirect labeling, a labeled goat anti-mouse \nIg was added after the first monoclonal antibody. The percentage of antibody-positive cells was \ncalculated by comparison with the appropriate isotype control.  \nThe monoclonal antibodies used for flow cytometry were against CD10-phycoerythrin (PE) \n(#312204), CD29- allophycocyanin (APC) (#303007),  CD31-fluorescein isothiocyanate (FITC) \n(#303103), CD44-FITC (#338803), CD73-PE (#344003), CD105 (#323202), CD140b-PE \n(#323605), CD146-APC (#361015), cytokeratin (CK) (#628602), podoplanin (PDPN)-AlexaFluor \n647 (#337008), SUSD2 (W5C5)-APC (#327408), (Biolegend, San Diego, CA, USA), -smooth \nmuscle actin (-SM actin)-FITC or cyanine 3 (Cy3) (#F3777, #C6198, Sigma-Aldrich). The \nisotype controls used were immunoglobulin IgM, IgG1-FITC, IgG1-PE, IgG1-APC, IgG2A-\nAlexaFluor 488 and IgG2-PE (Biolegend). The secondary antibodies were FITC-labeled goat anti-\nmouse IgM and PE-labeled goat anti-mouse IgG (Thermo Fisher Scientific).  \nData were processed using FlowJo software (v.10, FlowJo LLC). \nReverse transcription polymerase chain reaction (RT-PCR) \nTotal RNA was extracted from cells with the TRIzol isolation method (Thermo Fisher Scientific). \ncDNA was synthesized from 0.5 g of RNA using Access RT-PCR System kit (Promega \nCorporation, Madison, WI, USA) with Oligo-dT primers according to the manufacturer’s protocol. \nFor conventional PCR, the PCR Master Mix kit (Promega), along with the appropriate primers and \ncDNA samples, were mixed and placed in a 2720 Thermal Cycler (Applied Biosystems, Foster \nCity, CA, USA). After initial incubation for 3 min at 95ᵒC, each cycle consisted of 95ᵒC for 30 s, \n58,5ᵒC for 45 s and 72ᵒC for 45 s, for a total of 35 cycles. The PCR products were size-separated \non Gel Red-stained 1,5% (w/v) agarose gels (Biotium Inc, Fremont, CA, USA) and a 100-bp DNA \nladder (Promega) was included in each run. \n\n9 \n \nThe following primers, obtained from the Instituto de Parasitología y Biomedicina, Granada, \nSpain, were used: \nGAPDH: 5′- GCACCACCAACTGCTTAGC-3′ (forward) and 5′-\nGGCATGGACTGTGGTCATGAG-3′ (reverse). \nProlactin: 5′- AATCTGTTCCGCTGGTGACT -3′ (forward) and 5′- \nGAAGTGGGGCAGTCATTGAT -3′ (reverse). \nWound healing assay \nCells (1.5 x 104 cells/well) were seeded in 96-well plates until they reached 95% confluence, and a \nscratch was made in the monolayer using a sterile 200 L micropipette tip. Culture medium with \ncell debris was then removed and replaced with the different culture media used in the experiment \n(OPTIMEM, CM from undifferentiated or CM from decidualized cells). Images were acquired at \ninitial time (T0) and after 24, 48 and 72 h using 50x magnification on a Leica DMi8 optical \nmicroscope equipped with digital camera. The images were processed using the free Image J \nsoftware. The cell-free area at each time point was subtracted from the T0 cell-free area and the \nresults were expressed as percentage of covered area. \nStatistical analysis \nAll experiments were repeated at least three times with different cell lines. The statistical analysis \nwas performed using GraphPad Prism 6 software. Comparisons were carried out using the \nunpaired two-tailed t-test with Welch’s correction. Values of p < 0.05 were consider significant.  \n \nRESULTS \nEndometrial stromal cells from ectopic and eutopic endometrial tissue exhibit a similar \nantigen phenotype \nThe antigenic profile of EnSCs obtained from menstrual blood has been previously extensively \nanalyzed (Ruiz Magana et al., 2020). Here, we compared the antigenic phenotype of eEnSC cell \nlines with that of mEnSCs and EnSCs obtained from endometrial biopsies of women with and \nwithout endometriosis. More than 90% of cells in all cell lines expressed the EnSC marker CD10 \n(Sumathi and McCluggage, 2002) as well as the MSC biomarkers CD29, CD44 and CD73, and \n\n10 \n \nlacked CD31 and cytokeratin expression (Figure 1). They also exhibited similar levels of CD146 \nand α-SM actin. The expression of CD105 showed no significant variability, not only between \ndifferent cell lines but also between samples of the same cell type. Moreover, CD140b, PDPN and \nSUSD2 presented a certain degree of variability, being their expression significantly higher in \nmEnSC, compared to the rest of cell lines (CD140b: P = 0.0054, P < 0.001 and P = 0.0091 for \nmEnSC versus BEnSC, eBEnSC and eEnSC, respectively; PDPN: P = 0.018 and P = 0.0018 for \nmEnSC versus BEnSC and eEnSC, respectively; SUSD2, P < 0.001 for mEnSC versus BEnSC, \neBEnSC and eEnSC) (Figure 1). \nEffects of decidualization on the phenotype and survival of EnSCs from women with \nendometriosis \nIn order to compare the decidualization ability of the different cell lines, they were treated with P4 \nand cAMP for 20 days. While mEnSCs, BEnSCs and eBEnSCs underwent a similar change from a \nfibroblastic-like appearance to a rounder shape characteristic of decidualized cells (P = 0.014, \nP = 0.0003 and P = 0.0001, respectively), eEnSCs did not significantly alter their morphology \n(Figure 2A and B). In addition, decidualization remarkably induced the mRNA expression of \nprolactin, as determined by RT-PCR, in all cell lines except for eEnSCs where a much lower \nincrease of prolactin mRNA was observed in response to treatment with P4 and cAMP (Figure \n2C). \nSince apoptosis has been reported to occur in parallel with decidualization (Leno-Duran et al., \n2014), we compared the effect of decidualization on the viability of the different cell lines. As \nexpected, a time-dependent increase in the induction of apoptosis of mEnSCs (day 7: P = 0.022, \nday 14: P = 0.035, day 21: P < 0.001, day 28: P < 0.0001) and BEnSCs (day 21: P = 0.026, day 28: \nP = 0.033) was observed after incubation with P4 and cAMP for up to 28 days (Figure 2D and E). \nHowever, there was no apoptosis in either eBEnSC or eEnSC (Figure 2F and G). \nWe also analyzed the antigen profile of the different cell lines under decidualization conditions. \nThe expression of distinctive markers, such as CD10 and CD29, did not change in response to \ndecidualization in any of the cell lines. Moreover, the proportion of CD146+ and SUSD2+ cells \ndid not significantly vary with decidualization (Figure 3). In contrast, the expression of CD105 \n\n11 \n \nwas significantly down-modulated in response to P4 and cAMP in all cell types except for eEnSCs \n(mEnSC: P = 0.005, BEnSC: P = 0.029, eBEnSC: P = 0.022). We further found that the levels of \nCD140b and α-SM actin only decreased significantly in decidualized mEnSCs (P = 0.032 and P = \n0.021, respectively), whereas slight non-significant reduction of both antigens was also observed \nin BEnSCs upon decidualization (Figure 3).   \nEffects of decidualization on the migration ability of ectopic and eutopic EnSC \nUnder decidualization conditions, it has been reported a reduction in the motility of eutopic EnSCs \nwhile endometriotic cells seem to retain their ability to migrate (Lavogina et al., 2021; Sultana et \nal., 2017). To further characterize this different behaviour of eutopic and ectopic cells, we studied \nthe migration of mEnSCs and eEnSCs upon incubation with the conditioned medium (CM) \nobtained from cultures of undifferentiated (U) and decidualized (D) mEnSCs and eEnSCs by the \nwound closure assay. Migration in OptiMEM medium was also analyzed as a control. \nInterestingly, similar profiles were observed in both cell types (Figure 4A). Migration of mEnSC \nand eEnSC similarly increased upon incubation with OptiMEM and CM from undifferentiated \ncells (CM -U) in a time-dependent manner while motility of both, mEnSCs and eEnSCs, was \nsignificantly inhibited when cultured with CM from decidualized cells (CM -D) at all-time points \nanalyzed (mEnSC: P < 0.0001 for CM -U versus CM -D at all times and conditions; eEnSC: P = \n0.0017 for CM eEnSC-U versus CM eEnSC-D at 24 h, P < 0.0001 for the rest of the comparisons \nof CM -U and CM -D). The most remarkable differences were found when we compared the \nmigration of cells upon incubation with CM from decidualized mEnSCs and CM from \ndecidualized eEnSCs (Figure 4A, black and white bars; Figure 4B, left and rights panels) so that \ninhibition of migration of both, mEnSCs and eEnSCs, was significantly higher in the presence of \nCM mEnSC-D (mEnSC: P < 0.0001, P < 0.001 and P = 0.0013 for 24, 48 and 72 h, respectively; \neEnSC: P < 0.0001 for all times). In addition, a slight but significant difference was found in the \nmotility of mEnSCs and eEnSCs only when cultured with CM eEnSC-D, being the capacity for \nmigration of eEnSCs less impaired than that of mEnSCs in this case (Figure 4B, right lower and \nupper panels; Figure 4C). The same experiment was conducted with BEnSC and eBEnSC lines, \n\n12 \n \nboth showing a migration capacity similar to that of mEnSCs and lower than that of eEnSCs upon \nincubation with CM eEnSC-D (Figure 4C). \n \nDISCUSSION \nNowadays, knowing the exact mechanism of the pathogenesis of endometriosis remains a \nchallenge. Even though several theories have been proposed to explain the origin of endometriosis \n(Taylor, 2020; Zondervan et al., 2018) and a variety of factors – such as genetic, epigenetic, \nimmunological, hormonal and environmental – have been involved in the onset of the disease \n(Bulun et al., 2019; Symons et al., 2018; Szukiewicz et al., 2021; Zondervan et al., 2018), it is not \nyet clear whether the alterations found in the endometriotic cells are intrinsic to them or induced \nby the ectopic location (McKinnon et al., 2018). Progesterone resistance is one of the main \ncharacteristics of the endometriotic tissue. In the present study, for the first time to our knowledge, \nwe have compared the response to decidualization with P4 and cAMP in ectopic EnSCs obtained \nfrom endometriomas (eEnSCs) and eutopic EnSC from three different sources and we have shown \nthat eEnSCs are more resistant to changes induced by decidualization than eutopic EnSC from \npatients with endometriosis. \nWe have recently described that EnSCs from menstrual blood (mEnSCs) from normal women \nunderwent changes in cellular morphology and apoptosis and secreted PRL during decidualization, \nalthough to a lesser extent than decidual stromal cells (DSCs) (Ruiz Magana et al., 2020). Now, a \nsimilar response has been observed for EnSCs obtained from endometrial biopsy of healthy \nwomen (BEnSC), confirming the equivalence of both sources, menstrual blood and endometrial \nbiopsy, of endometrial cells. In agreement with previous reports comparing the decidualization \ncapacity of eEnSCs with that of EnSCs from healthy donors (Sultana et al., 2017; Yin et al., 2012), \nwe also found that eEnSCs mostly retained their fibroblastic morphology and barely expressed \nPRL in response to treatment with P4 and cAMP. Moreover, we showed that eEnSCs did not \nundergo apoptosis, even after prolonged incubation with P4 and cAMP. Interestingly, no apoptosis \nwas observed in EnSC obtained from eutopic endometrium of patients (eBEnSCs), even they \n\n13 \n \nchanged their morphology to a rounder shape and produced PRL upon decidualization, suggesting \na partial response to this process. Klemmt et al. previously reported similar morphological \nchanges, but a reduced PRL secretion, in cultures of eutopic endometrial stromal cells from \nwomen with endometriosis in comparison with cells from healthy women, after in vitro \ndecidualization (Klemmt et al., 2006). Moreover, although they were not quantified, \npolygonal/rounded cells were found in cultures of decidualized endometriotic stromal cells, even \ntheir ability to secrete PRL was significantly lower than that of eutopic cells. Discrepancies with \nour results may be due to the different experimental conditions, as they decidualized with cAMP \nalone (Klemmt et al., 2006), while we used the standard protocol for decidualization with P4 and \ncAMP (Gellersen and Brosens, 2003). In agreement with our results and the role of P4 in the \nregulation of PRL production, similar levels of PRL have been reported to be produced by eutopic \ncells from women with and without endometriosis in response to P4, but not to cAMP \n(Aghajanova et al., 2009). Regarding the resistance to apoptosis, it has been considered a \ncharacteristic of endometriotic cells and different authors have demonstrated that spontaneous \napoptosis in endometriotic lesions is lower than that in the eutopic endometrium of patients and \nthis, in turn, lower than that of endometrial tissue from control women (Gebel et al., 1998; Imai et \nal., 2000; Meresman et al., 2000). Here, we found that eBEnSCs were as resistant to the induction \nof apoptosis during decidualization as eEnSCs, which is in accordance with the altered expression \nof antiapoptotic and proapoptotic genes reported in the eutopic endometrial cells from women with \nendometriosis (Ahn et al., 2016). In particular, the antiapoptotic genes Bcl-2 and Bcl-xL have been \nshown to be increased in the proliferative and early secretory endometrium from patients with \nendometriosis, compared with women without disease (Braun et al., 2007; Burney et al., 2007; \nMeresman et al., 2000), and reduced levels of the proapoptotic genes p53 and caspase-1 have been \ndescribed in the eutopic endometrium of patients (Braun et al., 2007). Moreover, miRNAs families \ninvolved in the regulation of cell cycle and cell death are also down-regulated in the endometrium \nof women with endometriosis, such as the miR-9 family, one of whose targets is Bcl-2 (Burney et \nal., 2009). Altogether, these data provide a basis for the observed resistance of eBEnSCs and \neEnSCs to decidualization-induced apoptosis. \n\n14 \n \nThe comparative study of the antigen phenotype in the four types of cell lines revealed a similar \nprofile with no substantial differences between cells derived from ectopic (eEnSCs) and eutopic \nendometrium, either from patients (eBEnSCs) or healthy women (BEnSCs). Our results reinforce \nprevious data showing a similar expression of MSC markers in endometrial stem cells obtained \nfrom ectopic endometrial tissues compared with cells from the endometrium of either patients \n(Kao et al., 2011) or healthy donors (Koippallil Gopalakrishnan Nair et al., 2015; Liu et al., 2020). \nWe only found significant differences in the phenotype of mEnSCs, showing a higher expression \nof CD140b, PDPN and SUSD-2. The overall greater expression of MSC markers in mEnSC \n(Bozorgmehr et al., 2020; Gargett et al., 2016) suggests that menstrual blood is more suitable than \nendometrial biopsy as a source for obtaining more undifferentiated endometrial MSC which, along \nwith their easy accessibility, make it promising for therapeutic approaches (Bozorgmehr et al., \n2020).   \nIn response to decidualizing factors, DSCs have been recently reported to down-modulate the \nexpression of several pericyte/MSC markers such as CD140b, CD146, α-SM actin and SUSD2 \n(Ruiz-Magana et al., 2021), a change probably related to the location and functional variations of \nthese cells during decidualization. Likewise, decidualization of mEnSCs significantly reduced the \nexpression of CD140b and α-SM actin and induced a slight, although no significant decrease, in \nthe percentage of CD146+ and SUSD2+ cells. These differences between DSCs and mEnSCs may \nbe due to the demonstrated different ability of both cell types to decidualize (Ruiz Magana et al., \n2020). Interestingly, the expression of the aforementioned antigens did not significantly vary upon \ndecidualization in the rest of cell lines, although they all showed a trend to decrease in BEnSCs. \nThe different response of mEnSCs and BEnSCs could be explained on the basis of the more \nundifferentiated state of mEnSCs suggested above. The only MSC marker that was regulated in all \ncell lines, except those derived from ectopic tissue, was CD105. Endoglin or CD105 is a \ntransmembrane glycoprotein which plays an essential role in angiogenesis (Duff et al., 2003). Its \nexpression was reported to negatively correlate with the degree of differentiation of umbilical cord \nblood derived-MSCs (UCB-MSCs) so it was proposed as a marker of the differentiation status of \nthese cells (Jin et al., 2009). Our results show that the four types of cell lines displayed a \n\n15 \n \nheterogeneous CD105 expression profile in their undifferentiated state and, similar to UCB-MSCs, \na decrease in the expression of CD105 was observed in mEnSCs, BEnSCs and eBEnSCs upon \ndifferentiation with P4+cAMP. In contrast, and according to their resistance to decidualization, the \nlevel of CD105 did not change in eEnSC in response to treatment with decidualizing factors.  \nThe capacity of EnSC to migrate is one of the cellular functions altered during decidualization. \nDifferent authors have reported that decidualization of endometrial cells in vitro with P4 and \ncAMP induces an intense decrease in basal cell motility (Chen et al., 2020; Lavogina et al., 2021; \nSultana et al., 2017). On the other hand, ectopic endometrial MSCs from women with \nendometriosis have shown a higher migration ability than eutopic MSCs, either from patients or \nhealthy women (Kao et al., 2011; Liu et al., 2020), and retained this ability upon decidualization \n(Sultana et al., 2017). As decidualized cells acquire a secretory phenotype, we have addressed the \nstudy of the changes in motility in response to decidualization from a different perspective, trying \nto examine whether decidualized cells could secrete factors that reduce their own motility rather \nthan lose their migration ability. Certainly, our results show that mEnSCS, as well as eEnSCs, \nreduced their motility when incubated with the CM from decidualized mEnSCs suggesting that, \nduring decidualization, EnSCs may produce some factors capable of inhibiting migration. Given \nthe impact of EnSC motility on endometrial tissue remodeling during endometrial regeneration and \nembryo implantation, it is not surprising that this process is highly regulated and that decidualized \nEnSCs themselves produce factors that contribute to its regulation. The specific products and the \nmechanism mediating this effect are yet to be determined. It has been recently published that \nsecretion of decorin, a small leucine-rich proteoglycan that interacts with transforming growth \nfactor (TGF)-β among many other molecules, is enhanced during decidualization and required for \nthe acquisition of the decidual phenotype (Halari et al., 2020). In addition, decorin repress \nthrophoblast migration and invasion (Halari et al., 2020). It should be interesting to study whether \nthis protein may also restrain endometrial cell motility. In accordance with their defective response \nto decidualization, ectopic EnSCs showed a lower ability to produce those motility regulating \nfactors as migration of mEnSCs and eEnSC was significantly higher after incubation with CM \nfrom decidualized eEnSCs than when incubated with CM from decidualized mEnSCs. Regarding \n\n16 \n \npotential differences in the migration capacity of ectopic and eutopic cells, either from patients or \nhealthy women, they were only exhibited in response to incubation with CM from decidualized \neEnSCs. It is reasonable to speculate that the greater capacity of ectopic cells to migrate can be \nonly appreciated in those conditions in which motility is limited, while in situations of strong \ninhibition (CM-mEnSC-D) or, on the contrary, optimal for migration (OptiMEM, CM-U), \ndifferences are not evident. \nIn summary, this study demonstrates that eutopic endometrial cells from women with \nendometriosis may exhibit alterations in some phenomena associated to decidualization, such as \nthe induction of apoptosis. However, endometrioma cells must undergo further changes in the \nendometriotic foci, probably derived from their interaction with the microenvironment in the \nectopic location, that contribute to the acquisition of their high resistance to decidualization. \nFurther studies with samples from different ectopic sites are needed to determine whether different \nmicroenvironments may similarly influence the characteristics and decidualization resistance of \neEnSCs. \n \nDECLARATION OF INTEREST \nThe authors declare no conflict of interest. \n \nAUTHOR CONTRIBUTION  \nM.J.R-M. contributed to the study design, execution, data analysis and critical discussion. J.M.P. \ncollected samples and participated in execution and data analysis. T.L., C.M.-M. and R.M.-A. \nparticipated in execution and data analysis. A.C.A.-M. contributed to the study design, data \ninterpretation and critical discussion. E.G.O. and C.R.-R. were responsible for the conception and \nstudy design, financial support, data analysis and interpretation, and manuscript writing. All \nauthors read and approved the final manuscript. \n \nFUNDING \n\n17 \n \nThis work was supported by the Plan Estatal de Investigación Científica y Técnica y de Innovación \n2013-2016, ISCIII Subdirección General de Evaluación y Fomento de la Investigación, Ministerio \nde Economía y Competitividad, Spain (Grant PI16/01642); the European Regional Development \nFund (ERDF/634 FEDER funding); and the Plan Propio, Universidad de Granada (Grant \nPP2021.PP-12). \n \nAKNOWLEDGEMENTS \nJ.M.P. is a PhD student belonging to the Official Doctoral Programme in Biomedicine of the \nUniversity of Granada. This article contributes to COST Action CA17116 “International Network \nfor Translating Research on Perinatal Derivatives into Therapeutic Approaches (SPRINT)”, \nsupported by COST (European Cooperation in Science and Technology). The authors are grateful \nto patients who participated in the study and Hospitals Quirón Ruber Juan Bravo and La Zarzuela, \nMadrid, for providing with samples. \n \nREFERENCES \nAghajanova, L., Hamilton, A., Kwintkiewicz, J., Vo, K.C., Giudice, L.C., 2009. Steroidogenic \nenzyme and key decidualization marker dysregulation in endometrial stromal cells from \nwomen with versus without endometriosis. Biol. Reprod. 80, 105-114. \nAhn, S.H., Khalaj, K., Young, S.L., Lessey, B.A., Koti, M., Tayade, C., 2016. Immune-\ninflammation gene signatures in endometriosis patients. Fertil. Steril. 106, 1420-1431.e7. \nBergeron, C., 2000. Morphological changes and protein secretion induced by progesterone in the \nendometrium during the luteal phase in preparation for nidation. Hum. Reprod. 15, Suppl 1, \n119-128. \nBozorgmehr, M., Gurung, S., Darzi, S., Nikoo, S., Kazemnejad, S., Zarnani, A.H., Gargett, C.E., \n2020. Endometrial and menstrual blood mesenchymal stem/stromal cells: Biological properties \nand clinical application. Front. Cell Dev. Biol. 8, 497. \n\n18 \n \nBraun, D.P., Ding, J., Shaheen, F., Willey, J.C., Rana, N., Dmowski, W.P., 2007. Quantitative \nexpression of apoptosis-regulating genes in endometrium from women with and without \nendometriosis. Fertil. Steril. 87, 263-268. \nBulun, S.E., Cheng, Y.H., Yin, P., Imir, G., Utsunomiya, H., Attar, E., Innes, J., Kim J.J., 2006. \nProgesterone resistance in endometriosis: link to failure to metabolize estradiol. Mol. Cell. \nEndocrinol. 248, 94-103. \nBulun, S.E., Yilmaz, B.D., Sison, C., Miyazaki, K., Bernardi, L., Liu, S., Kohlmeier, A., Yin, P., \nMilad, M., Wei, J., 2019. Endometriosis. Endocr. Rev. 40, 1048-1079. \nBurney, R.O., Hamilton, A.E., Aghajanova, L., Vo, K.C., Nezhat, C.N., Lessey, B.A., Giudice, \nL.C., 2009. MicroRNA expression profiling of eutopic secretory endometrium in women with \nversus without endometriosis. Mol. Hum. Reprod. 15, 625-631. \nBurney, R.O., Talbi, S., Hamilton, A.E., Vo, K.C., Nyegaard, M., Nezhat, C.R., Lessey, B.A., \nGiudice, L.C., 2007. Gene expression analysis of endometrium reveals progesterone resistance \nand candidate susceptibility genes in women with endometriosis. Endocrinology 148, 3814-\n3826. \nChen, C., Li, C., Liu, W., Guo, F., Kou, X., Sun, S., Ye, T., Li, S., Zhao, A., 2020. Estrogen-\ninduced FOS-like 1 regulates matrix metalloproteinase expression and the motility of human \nendometrial and decidual stromal cells. J. Biol. Chem. 295, 2248-2258. \nDuff, S.E., Li, C., Garland, J.M., Kumar, S., 2003. CD105 is important for angiogenesis: evidence \nand potential applications. FASEB J. 17, 984-992. \nDunn, C.L., Kelly, R.W., Critchley, H.O., 2003. Decidualization of the human endometrial stromal \ncell: an enigmatic transformation. Reprod. Biomed. Online 7, 151–161. \nEyster, K.M., Klinkova, O., Kennedy, V., Hansen, K.A., 2007. Whole genome deoxyribonucleic \nacid microarray analysis of gene expression in ectopic versus eutopic endometrium. Fertil. \nSteril. 88, 1505-1533. \nGarcia-Pacheco, J.M., Oliver, C., Kimatrai, M., Blanco, F.J., Olivares, E.G., 2001. Human \ndecidual stromal cells express CD34 and STRO-1 and are related to bone marrow stromal \nprecursors. Mol. Hum. Reprod. 7, 1151-1157. \n\n19 \n \nGargett, C.E., Schwab, K.E., Deane, J.A., 2016. Endometrial stem/progenitor cells: the first 10 \nyears. Hum. Reprod. Update 22, 137-163. \nGebel, H.M., Braun, D.P., Tambur, A., Frame, D., Rana, N., Dmowski, W.P., 1998. Spontaneous \napoptosis of endometrial tissue is impaired in women with endometriosis. Fertil. Steril. 69, \n1042-1047. \nGellersen, B., Brosens, J., 2003. Cyclic AMP and progesterone receptor cross-talk in human \nendometrium: a decidualizing affair. J. Endocrinol. 178, 357-372. \nGong, J., Traganos, F., Darzynkiewicz, Z., 1994. A selective procedure for DNA extraction from \napoptotic cells applicable for gel electrophoresis and flow cytometry. Anal. Biochem. 218, 314-\n319. \nHalari, C.D., Nandi, P., Jeyarajah, M.J., Renaud, S.J., Lala, P.K., 2020. Decorin production by the \nhuman decidua: role in decidual cell maturation. Mol. Hum. Reprod. 26, 784-796. \nImai, A., Takagi, A., Tamaya, T., 2000. Gonadotropin-releasing hormone analog repairs reduced \nendometrial cell apoptosis in endometriosis in vitro. Am. J. Obstet. Gynecol. 182, 1142-1146. \nJin, H.J., Park, S.K., Oh, W., Yang, Y.S., Kim, S.W., Choi, S.J., 2009. Down-regulation of CD105 \nis associated with multi-lineage differentiation in human umbilical cord blood-derived \nmesenchymal stem cells. Biochem. Biophys. Res. Commun. 381, 676-681. \nKao, A.P., Wang, K.H., Chang, C.C., Lee, J.N., Long, C.Y., Chen, H.S., Tsai, C.F., Hsieh, T.H., \nTsai, E.M., 2011. Comparative study of human eutopic and ectopic endometrial mesenchymal \nstem cells and the development of an in vivo endometriotic invasion model. Fertil. Steril. 95, \n1308-1315.e1. \nKlemmt, P.A., Carver, J.G., Kennedy, S.H., Koninckx, P.R., Mardon, H.J., 2006. Stromal cells \nfrom endometriotic lesions and endometrium from women with endometriosis have reduced \ndecidualization capacity. Fertil. Steril. 85, 564-572. \nKoippallil Gopalakrishnan Nair, A.R., Pandit, H., Warty, N., Madan, T., 2015. Endometriotic \nmesenchymal stem cells exhibit a distinct immune phenotype. Int. Immunol. 27, 195-204. \nLavogina, D., Stepanjuk, A., Peters, M., Samuel, K., Kasvandik, S., Khatun, M., Arffman, R.K., \nEnkvist, E., Viht, K., Kopanchuk, S., Lättekivi, F., Velthut-Meikas, A., Uri, A., Piltonen, T.T., \n\n20 \n \nRinken, A., Salumets, A., 2021. Progesterone triggers Rho kinase-cofilin axis during in vitro \nand in vivo endometrial decidualization. Hum. Reprod. 36, 2230-2248. \nLeno-Duran, E., Ruiz-Magana, M.J., Munoz-Fernandez, R., Requena, F., Olivares, E.G., Ruiz-\nRuiz, C., 2014. Human decidual stromal cells secrete soluble pro-apoptotic factors during \ndecidualization in a cAMP-dependent manner. Hum. Reprod. 29, 2269-2277. \nLiu, Y., Liang, S., Yang, F., Sun, Y., Niu, L., Ren, Y., Wang, H., He, Y., Du, J., Yang, J., Lin, J., \n2020. Biological characteristics of endometriotic mesenchymal stem cells isolated from ectopic \nlesions of patients with endometriosis. Stem Cell Res. Ther. 11, 346. \nMaruyama, T., Yoshimura, Y., 2012. Stem cell theory for the pathogenesis of endometriosis. \nFront. Biosci. (Elite Ed.) 4, 2754-2763. \nMcKinnon, B., Mueller, M., Montgomery, G., 2018. Progesterone resistance in endometriosis: an \nacquired property? Trends Endocrinol. Metab. 29, 535-548. \nMeresman, G.F., Vighi, S., Buquet, R.A., Contreras-Ortiz, O., Tesone, M., Rumi, L.S., 2000. \nApoptosis and expression of Bcl-2 and Bax in eutopic endometrium from women with \nendometriosis. Fertil. Steril. 74, 760-766. \nMuñoz-Fernandez, R., Blanco F.J., Frecha, C., Martin, F., Kimatrai, M., Abadia-Molina, A.C., \nGarcia-Pacheco, J.M., Olivares, E.G., 2006. Follicular dendritic cells are related to bone \nmarrow stromal cell progenitors and to myofibroblasts. J. Immunol. 177, 280-289. \nOhlsson Teague, E.M., Van der Hoek, K.H., Van der Hoek, M.B., Perry, N., Wagaarachchi, P., \nRobertson, S.A., Print, C.G., Hull, L.M., 2009. MicroRNA-regulated pathways associated with \nendometriosis. Mol. Endocrinol. 23, 265-275. \nOsteen, K.G., Bruner-Tran, K.L., Eisenberg, E., 2005. Reduced progesterone action during \nendometrial maturation: a potential risk factor for the development of endometriosis. Fertil. \nSteril. 83, 529-537. \nRichards, R.G., Brar, A.K., Frank, G.R., Hartman, S.M., Jikihara, H., 1995. Fibroblast cells from \nterm human decidua closely resemble endometrial stromal cells: induction of prolactin and \ninsulin-like growth factor binding protein-1 expression. Biol. Reprod. 52, 609-615. \n\n21 \n \nRuiz-Magana, M.J., Martinez-Aguilar, R., Llorca, T., Abadia-Molina, A.C., Ruiz-Ruiz, C., \nOlivares, E.G., 2021. Decidualization modulates the mesenchymal stromal/stem cell and \npericyte characteristics of human decidual stromal cells. Effects on antigen expression, \nchemotactic activity on monocytes and antitumoral activity. J. Reprod. Immunol. 145, 103326. \nRuiz Magana, M.J., Puerta, J.M., Martinez-Aguilar, R., Llorca, T., Blanco, O., Munoz-Fernandez, \nR., Olivares, E.G., Ruiz-Ruiz, C., 2020. Endometrial and decidual stromal precursors show a \ndifferent decidualization capacity. Reproduction 160, 83-91. \nSultana, S., Kajihara, T., Mizuno, Y., Sato, T., Oguro, T., Kimura, M., Akita, M., Ishihara, O., \n2017. Overexpression of microRNA-542-3p attenuates the differentiating capacity of \nendometriotic stromal cells. Reprod. Med. Biol. 16, 170-178. \nSumathi, V.P., McCluggage, W.G., 2002. CD10 is useful in demonstrating endometrial stroma at \nectopic sites and in confirming a diagnosis of endometriosis. J. Clin. Pathol. 55, 391-392. \nSymons, L.K., Miller, J.E., Kay, V.R., Marks, R.M., Liblik, K., Koti, M., Tayade, C., 2018. The \nimmunopathophysiology of endometriosis. Trends Mol. Med. 24, 748-762. \nSzukiewicz, D., Stangret, A., Ruiz-Ruiz, C., Olivares, E.G., Soritau, O., Susman, S., Szewczyk, \nG., 2021 Estrogen- and progesterone (P4)-mediated epigenetic modifications of endometrial \nstromal cells (EnSCs) and/or mesenchymal stem/stromal cells (MSCs) in the etiopathogenesis \nof endometriosis. Stem Cell Rev. Rep. 17, 1174-1193. \nTaylor, H.S., 2020. Bone marrow in the pathophysiology of endometriosis. Fertil. Steril. 113, 942. \nTeague, E.M., Print, C.G., Hull, M.L., 2010. The role of microRNAs in endometriosis and \nassociated reproductive conditions. Hum. Reprod. Update 16, 142-165. \nYin, X., Pavone, M.E., Lu, Z., Wei, J., Kim, J.J., 2012. Increased activation of the PI3K/AKT \npathway compromises decidualization of stromal cells from endometriosis. J. Clin. Endocrinol. \nMetab. 97, E35-43. \nZondervan, K.T., Becker, C.M., Koga, K., Missmer, S.A., Taylor, R.N., Vigano, P., 2018. \nEndometriosis. Nat. Rev. Dis. Primers 4, 9. \n \nFIGURE LEGENDS \n\n22 \n \nFigure 1. Antigen phenotype of ectopic and eutopic EnSCs obtained from different sources. \nmEnSCs, BEnSCs, eBEnSCs and eEnSCs were stained with antibodies for different antigens and \nanalyzed by flow cytometry. The graphs represent the mean percentage of positive cells for the \nindicated markers.  Error bars show the SEM from 10 (mEnSC), 7 (BEnSC and eBEnSC) and 15 \n(eEnSC) different cell lines.  \nFigure 2. Comparative analysis of cell morphology, prolactin production and induction \napoptosis in response to decidualization. mEnSCs, BEnSCs, eBEnSCs and eEnSCs were \nincubated either for 20 days (A, B, C) or for up to 28 days (D, E, F, G) without (undifferentiated) \nor with P4 and cAMP. A) Morphological changes during decidualization. Images of a \nrepresentative cell line of each cell type are shown. B) Mean percentage of rounded cells after \nquantification of representative areas (n=3 per sample).  Error bars show SEM of three \nindependent experiments with different cell lines. C) Detection of prolactin by RT-PCR in the four \ncell lines after decidualization. The expression of the reference gene GAPDH was determined as a \ncontrol. D-G) Percentage of sub-G1 apoptotic cells analyzed every 7 days, during decidualization, \nby flow cytometry. Error bars show SEM from eight (mEnSC and eEnSC) and five (BEnSC and \neBEnSC) independent experiments with different cell lines.  \nFigure 3. Comparative analysis of the antigen phenotype upon decidualization. Antigen \nexpression was determined by flow cytometry in mEnSCs, BEnSCs, eBEnSCs and eEnSCs after \nincubation for 20 days without (undifferentiated) or with P4 and cAMP.  The bar charts represent \nthe mean percentage of antigen-expressing cells. Error bars show the SEM from five (mEnSC and \neEnSC) and three (BEnSC and eBEnSC) different cell lines.  \nFigure 4. Effect of CM from undifferentiated and decidualized mEnSC and eEnSC on the \nmigration of ectopic and eutopic EnSCs. A) Motility of mEnSCs (upper panel) and eEnSCs \n(lower panel) was determined by the wound healing assay after incubation for 24, 48 and 72 h with \ncontrol medium (OptiMEM), CM from undifferentiated cells (CM mEnSC-U, CM-eEnSC-U) or \nCM from decidualized cells (CM mEnSC-D, CM eENSC-D). Wound closure is represented as the \npercentage of covered area with respect to time zero (time of scratch). B) Representative pictures \nof the migration of mEnSC and eEnSC incubated for 72 h with CM from decidualized cells. C) \n\n23 \n \nComparison of the migration of mEnSCs, BEnSCs, eBEnSCs and eEnSCS at the indicated times \nupon incubation with CM from decidualized eEnSCs, as represented by the percentage of wound \nclosure. In A) and C), error bars show the SEM from three independent experiments with different \ncell lines.","source_license":"CC0","license_restricted":false}