{"paper_id":"2f26c959-abfb-49fa-96aa-9cb99a0e7684","body_text":"The association of P53 and Rb1 mutation in endometrial cancer development | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The association of P53 and Rb1 mutation in endometrial cancer development Mona Gebril, Mohammed Elsherbini, Marwa Fouad Sharaf, Mohamed Emam Mohamed, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6091807/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Endometrial cancer (EC) is the most prevalent invasive malignancy in females and accounts for 6% of malignancies in women worldwide, with reported continued increasing incidence. Recently, many studies proved many mutations in EC and added four main types in the molecular classification of EC. FIGO classification of EC in 2023 was modified to change the staging according to P53 & POLE mutations. Since P53 & Rb1 are known cell cycle repressors, we generated our unique mouse model with P53 & Rb1 deletion (Pgr- cre/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp ) to study their role in the incidence and onset of EC development. Pgr- cre/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice were generated by crossing Pgr- cre/+ , P53 Loxp/Loxp male and Rb1 Loxp/Loxp female mice; the incidence, onset, and characteristics of EC were studied histologically and by IHC. We also studied the expression of P53 and Rb1 over a year in women diagnosed with EC after their informed consent to explore a concomitant expression. We found that Pgr- cre/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice develop endometrial hyperplasia and cancer at a younger age with significant proliferation detected by Ki67 IHC and downregulation of P21 expression. While women had EC, we haven’t statistically significant results regarding the mean age of, no proven mutation, P53 mutation, and the associated P53&Rb1 mutation cases. We suggest that the double mutation of P53&Rb1 affects the age of incidence of EC in mice. At the same time, further multicenter studies, including higher sample sizes, are needed to prove or disprove this concept in women. Endometrial Neoplasm P53 gene mutations Rb1 gene mutations. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Background Endometrial cancer (EC) is a malignant tumor of the inner layer of the endometrial epithelium. It is the most common female reproductive tract invasive malignancy and ranked the sixth most common malignancy in females [ 1 ]. The incidence of the EC varies significantly across different regions, with the highest rates found in North America and Europe, while developing countries experience a much lower incidence, approximately five times less. Globally, EC is associated with higher incidence and mortality rates [ 1 ], [ 2 ]. Histopathologically, EC used to be classified into two main types: Type 1, which includes grade I and grade II endometrioid adenocarcinoma, and Type 2, which encompasses grade III endometrioid adenocarcinoma along with other forms of endometrial cancer such as serous, clear cell, and undifferentiated carcinoma [ 1 ], [ 2 ]. Type I ECs are linked to factors that increase estrogen levels, such as obesity and hormonal treatments. On the other hand, Type II ECs, exemplified by serous carcinoma, typically do not have a connection to estrogenic stimulation [ 1 ], [ 3 ]. Recent research studies utilizing advanced next-generation sequencing studies hypothesized that endometrioid and serous carcinoma can be classified into four main subtypes based on the mutational state of endometrial cancer. These classifications offer promising avenues for prevention, diagnosis, and patient management. The four proposed subtypes, the Ultramutated subtype, have high mutation rates exceeding 10,000 mutations due to a mutation in the POLE gene found in undifferentiated carcinomas [ 1 ]. The 2nd subtype is Hypermutated/Microsatellite Instability (MSI), which occurs due to high mutations of microsatellite DNA sequences and loss of DNA mismatch repair found in 20–25% of sporadic cases of endometrial cancer and cases of Lynch Syndrome. The 3rd subtype is Copy Number Low/Microsatellite stable (MSS); this subtype is composed entirely of endometrioid cancer with frequent mutations in PTEN, CTNNB1, PIK3CA, PIK3R1, and ARID1A. The last subtype is Copy Number High/Serous-Like, which includes a high frequency of TP53 mutations, usually serous tumors, some grades of grade III endometrioid, and some clear cell carcinoma [ 1 ]. Recent updates to the FIGO classification of endometrial cancer now include TP53 and POLE mutations [ 4 ]. The transcription factor P53 and retinoblastoma protein (RB) are crucial tumor suppressors found inactivated in various tumor types. Both proteins have fundamental roles in cell cycle regulation. A complex is formed from the RB and E2F family of transcription factors and downregulates various genes that are key cell cycle regulators. This suppression is lifted when RB is phosphorylated. Cyclin-dependent kinase inhibitor CDKN1A (P21) can prevent RB phosphorylation, thereby inhibiting the expression of cell cycle regulators. P53 can activate P21 transcription, making P53 and RB1 are considered tumor suppressors through several mechanisms, one of which is the P53-P21-RB signaling pathway [ 5 ], [ 6 ]. P53-P21-RB signaling pathway works after any stimulation to P53 like DNA damage, so P21 expression is upregulated, which promotes the formation of the RB-E2F complex. This complex subsequently suppresses the expression of various cell cycle genes, resulting in the arrest of the cell cycle [ 5 ]. The combined mutations of Rb1 and P53 have been investigated in various tumors using tissue-specific knockout mice models. Examples include squamous cell carcinoma of the skin, lung and prostate cancers [ 7 ], and chondrosarcoma[ 8 ] Albitar et al., (2006) explored the impact of Rb1 and PTEN mutations on resistance in endometrial cancer cell lines. Additionally, Serbes et al. (2024) studied the Rb1 loss in P53-mutated EC cases and suggested its potential for improving prognostic accuracy [ 9 ], [ 10 ] Given the lack of knowledge about the associated P53 and Rb1 mutation in EC, cell culture technical challenges to maintain p53&Rb1 dual blocked cells viability, and the absence of a mice model of EC with both Rb1 & P53 mutations, we used the cre-Loxp system with progesterone receptor promotor for the specific deletion of targeted genes in the uterine tissue [ 11 ]to delete Rb1 and P53 in the endometrium of our unique mouse model. In this study, we hypothesized that the P53 mutation reported in 90% of Copy Number High/Serous-Like subtypes of endometrial cancer and affects patient prognosis and management could be associated with the RB1 mutation and may influence the onset of EC. We used our unique mice model with a knockout of P53 and RB1 to investigate this. We examined the development of endometrial cancer in three age groups: early, mid, and late reproductive life. 2. Results 2.1. Mice with uterine deletion of P53 and Rb1 show early endometrial malignancy development. To identify the role of combined mutation in P53 and Rb1 in endometrial malignancy development, we generated female mice with uterine deficiency of both p53 and Rb1 (Pgr-cre/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice) in two steps as described in the methodology section. We confirmed the deletion of both p53 and Rb1 by performing PCR for the tail samples and genotyping where the band size of PR cre/+ is 403 bp while the wild type is 301 bp, and regarding Rb1 loxp/loxp, the band size is 700 bp while the wild type is 650 bp and finally the P53 loxp/loxp band size is 370 bp while the wild type is 288 bp [ 12 ] (Fig. 1A). Immunostaining was used to confirm the mouse genotype. The immunostaining of P53 has four patterns: normal (wild type), overexpression, cytoplasmic, and complete absence, and P53 is considered abnormal in the latter three types. These abnormal patterns of P53 staining are indicative of potential mutations or dysregulation in the P53 gene, which could be associated with the development of endometrial malignancy. [ 13 ], [ 14 ]. The expression of P53 by IHC was aberrant in different age groups; the early reproductive age (2–4 months) P53 expression was normal (wild type) in both the control and study groups, but in advanced age groups the expression of P53 was higher in the stroma first (age 4–6 months) then both the epithelium and stroma (more than 6 months) in the group of study (Pgr- cre/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice). Regarding Rb1 IHC, the expression is not expressed in the endometrial epithelium and downregulated in the stroma of the endometrium in Pgr- cre/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice. In contrast, the endometrial epithelium and stroma nuclei were usually stained in the control group (Pgr- +/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice) (Fig. 1B & Fig. 1c). After confirmation of the mice genotype, we studied the stained endometrium by H&E of the control and the study group. On comparing the difference of the histological findings of all control (Pgr- +/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice) and the study (Pgr- cre/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice) groups by Chi-square test irrespective of age, the incidence of hyperplasia, atypia, and myometrial invasion was higher with statistically significant P values were 0.006, 0.002, and 0.003 respectively that confirms P53 &Rb1 mutation role in EC development in Pgr- cre/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice. The age-specific difference was then thoroughly analyzed; regarding the early reproductive age group, we observed no hyperplasia, atypia, or myometrial invasion (endometrial carcinoma) in the control group. While in Pgr- cre/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice, we observed 60.7% of cases developed endometrial hyperplasia (Increased glandular stromal ratio, back-to-back architecture, abnormal size and shape of the endometrial glands) and 57% of hyperplasia cases had nuclear atypia (oval or rounded large nuclei, hyperchromatic, atypical nuclei with macro nucleoli, numerous apoptotic bodies, or vesicular changes, abnormal mitotic figures, loss of polarity and orientation to the basement membrane, pleomorphism) and 14% developed endometrial cancer that include the previous histopathological changes in addition to the hallmark in diagnosis of endometrial cancer, myometrial invasion [ 15 ]. These results were statistically significant for endometrial hyperplasia and atypia. P-values were 0.038 for both, while for myometrial invasion, it was an insignificant result with a P-value of 0.4. For the middle reproductive age group, in the control group, 43% developed endometrial hyperplasia, and 29% proved to have nuclear atypia. Only 14% had myometrial invasion (endometrial carcinoma). While in the study group, 75% developed endometrial hyperplasia with atypia, and 71% had myometrial invasion. These findings were statistically significant only for Atypia and myometrial invasion; P-values by chi-square test were 0.031 for both of them, while the hyperplasia, although it was higher in the study group, the difference was insignificant P value of 0.094; finally, in the old reproductive age group, 57% of Pgr- +/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice had hyperplasia with atypia, while only 14% developed myometrial invasion. But the Pgr- cre/+ , P53 Loxp/Loxp , and Rb1 Loxp/Loxp mice all had hyperplasia with atypia, and 83.33% had myometrial invasion. With insignificant differences for hyperplasia and atypia but significant for myometrial invasion, the P-values were 0.07, 0.07 & 0.013, respectively (Fig. 2A & B) (Supplementary Fig. 1). Collectively, we found that the Pgr-cre/+, P53 Loxp/Loxp, and Rb1 Loxp/Loxp mice model proved to develop endometrial hyperplasia with atypia and endometrial carcinoma at an earlier age and higher rates than the wild-type of control (Table 3 ). In women who had EC, it was reported that the mean age of type II (non-estrogen dependent) endometrial cancer is 66.5 years, while endometrioid endometrial carcinoma developed earlier in life at a mean age of 62 years [ 3 ]. From our results, the associated Rb1 mutation with P53 mutation led to earlier development and higher incidence of EC in mice. Table 3 Incidence of endometrial Hyperplasia, Atypia, and myometrial invasion in control and study groups, Statistical summary. Age Percentage (%) of Cases Chi-Square P-value control P53&Rb1 knockout Hyperplasia 2–4 months 0 60.7 0.038 4–6 months 43 75 0.094 More than 6 months 57 100 0.07 Atypia 2–4 months 0 57 0.038 4–6 months 29 75 0.031 More than 6 months 57 100 0.07 Invasion 2–4 months 0 14 0.4 4–6 months 14 71 0.031 More than 6 months 14 83.33 0.013 Total Control (N = 19 cases) P53&Rb1 knockout (N = 20 cases) Hyperplasia 7 16 0.006 Atypia 6 16 0.002 Invasion 2 11 0.003 2.2. Endometrial proliferation pattern in the mouse model We checked the Ki67 protein present in the active phases of the cell cycle, making it an excellent proliferation marker and often correlated to the clinical course of the disease [ 16 ]. The expression of Ki67 by IHC was higher in all age groups of Pgr- cre/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice model both in the endometrial epithelium and stroma (Fig. 3A). The intensity of stain was calculated by H-Score, In the early and mid-reproductive age groups the endometrial epithelium showed statistically significant results P-value was 0.006 & 0.02 respectively. While in late reproductive age, although the endometrial epithelium showed a higher H-score, there weren’t statistically substantial results, with a P-Value of 0.13 (Fig. 3B). These results are in concordance with endometrial hyperplasia in H&E staining insignificant analysis in middle and late reproductive age in the previous section, as during aging, the mice endometrium undergoes epithelial cell proliferation that results in endometrial hyperplasia [ 17 ] that may reflect the hyperplasia insignificant differences in old reproductive age groups. 2.3. Detection of P21 expression in the mouse model In the P53-P21-RB signaling cascade, both P53 and Rb1 proteins are essential tumor suppressor proteins; after activation of P53, the expression of P21 is upregulated, which results in RB-E2F complex formation and downregulation of many cell cycle genes and cell cycle arrest [ 5 ]. In Pgr- cre/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice the expression of P21 by IHC is downregulated mainly in the endometrial stroma in comparison to Pgr- +/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice (Fig. 4). Usually Ki-67 and P21 expressions are reciprocal, and significant co-expression is not detected [ 18 ]. The knockout of Rb1 & P53 in our model led to downregulation of P21 function to arrest the cell cycle, so endometrial proliferation increased, as proved by increased Ki67 overexpression. 2.4. The Expression of Rb1 in P53 mutant Human Endometrial Carcinoma Women who are suspected of endometrial malignancy underwent surgical management and uterine samples. After their informed consent, the samples were evaluated under a light microscope by two pathologists (ME, MK). The endometrial carcinoma cases were diagnosed with H&E stain (Fig. 5). Then, the diagnosed cases were checked for the expression of both P53 and Rb1 proteins by IHC (Fig. 6A & B). From the results of IHC of all diagnosed cases of endometrial carcinoma, we detected 55.56% wild type (normal), 37.78% had P53 mutation only, and 6.67% had both P53 &Rb1 mutations (Fig. 6C). The mean age of women diagnosed with endometrial carcinoma in cases who had no mutation (wild type) was 62 years; for cases with only the P53 mutation, 67.2 years, and for cases with both P53 &Rb1 mutations, the mean age was 64 yrs. According to previous literature, endometrioid and low-grade endometrial carcinoma (Type 1) are developed younger than patients with serous type and high-grade endometrioid carcinoma (Type 2). The mean age is 62.2 and 65.6 years, respectively [ 3 ], [ 19 ]. P53 mutation is mainly associated with serous type and high-grade endometrial cancer (type 2) with consistent association with the poorest clinical outcomes and 50–70% endometrial cancer mortality [ 14 ], [ 20 ]. Our results were consistent with the literature, but the double mutation of P53 and Rb1 showed a younger age than the P53 mutation group and older than the wild-type endometrial carcinoma. However, our results weren’t statistically significant, P-value 0.2 (Fig. 6D). We also examined if there is an association between the tumor size and the mutation condition. We detected that the wild-type endometrial carcinoma had the smallest average size, 5.2 cm, then the P53 only mutation endometrial cancer, 6.7 cm, and the largest was the double mutation of P53 &Rb1 endometrial carcinoma group, 8.4 cm, and this difference wasn’t statistically significant. The P-value was 0.1(Fig. 6E). We compared the depth of myometrial invasion between groups. 40% of the wild-type endometrioid carcinoma cases showed myometrial invasion more than half the thickness. In comparison, the P53 mutation group showed 70.6%. Finally, the double P53 & Rb1 group showed a 33.33% P-value of 0.2 (Fig. 6F). The incidence of associated adenomyosis and/or endometriosis was higher in the P53 mutation group, 41.2%, than in the wild-type group, 24%. Regarding the double mutation P53 & Rb1, we found no case with endometriosis and/or adenomyosis (Fig. 6G) with no significant difference p-value of 0.25. 3. Discussion Endometrial cancer is a malignant tumor of the inner layer of the endometrial epithelium. It is the most common female reproductive tract invasive malignancy and the sixth most common malignancy in females[ 1 ] and accounts for 6% of malignancies in women worldwide [ 19 ]. Since 1990, the incidence has been rising, particularly in black women, who have an 80% higher mortality rate compared to white women. Data from the Central Cancer Registries, mortality records, and the National Center for Health Statistics in the United States indicate a continued increase in endometrial cancer cases from 2015 to 2019 [ 21 ]. EC used to be classified as type 1 and type 2, when type 1 endometrial cancer represents most diagnosed cases, around 65–70%, and is linked to unopposed estrogen exposure and typically occurs in a younger age (average 62.2 years) than type 2 (average 65.6 years). Type 2 endometrial cancer is not associated with an unopposed estrogen state, and it is more aggressive and has a poorer prognosis [ 2 ]. Many studies reported new molecular classification according to gene mutations. TP53 and POLE mutations have recently been included in the FIGO classification of endometrial cancer [ 4 ]. P53 mutations were identified in endometrial cancer as a subgroup with the poorest prognosis and the EC type that is most likely to benefit from adjuvant chemo(radio)-therapy [ 14 ], [ 20 ], [ 22 ]. RB1, the first identified tumor suppressor gene, plays a significant role in tumor development. Mice deficient in the Rb protein exhibit various hyperplasias and pituitary and thyroid tumors [ 23 ]. Analysis of data from 12 tumor types revealed RB1 mutations or deletions in breast, colorectal, cervical, ovarian, bladder, and lung cancers [ 24 ]. In cervical cancer, Rb1 is phosphorylated by E7 produced by human papillomavirus (HPV), resulting in the release of E2F and activation, which induce cell cycle progression [ 25 ]. The TCGA classification highlights the link between frequent TP53 mutations and focal amplification of genes involved in the Rb1 pathway, such as CCNE1 [ 26 ] So, we generated our unique mice model Pgr- cre/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice that proved to have increased incidence of endometrial hyperplasia, atypia and myometrial invasion at an earlier age than the control with evidence of increased endometrial proliferation detected by Ki67 IHC and the downregulation of P21 expression by IHC. These findings align with the previous literature describing the role of P21 as a tumor suppressor, which is disrupted in mutant P53 tumors or at low P53 levels, leading to an oncogenic state [ 5 ]. Typically, Ki-67 and P21 expressions are reciprocal, and significant co-expression is not detected [ 18 ]. However, the loss of p21 alone is insufficient for tumorigenesis, as P21 Knockout mice do not develop tumors within seven months of age, and its mutation is infrequent in humans [ 27 ]. In our previous study of Pgr-cre/+, Rb1 Loxp/Loxp mice at late reproductive age (over 6 months), we did not detect malignancy in this conditional knockout model for Rb1[ 12 ], (supplementary Fig. 2). These findings suggest that the combination of Rb1 and TP53 knockouts plays a role in the early onset of endometrial carcinoma and disease progression in mice. In the second step of our study, we examined the expression of P53 and Rb1 in 45 women diagnosed with endometrial cancer. Among them, 25 women (55.56%) had endometrial cancer without abnormal expression of TP53 or Rb1 (wild type), 17 women (37.78%) had TP53 mutations, and three women (6.67%) had both TP53 and Rb1 mutations. We compared the age difference among the three groups. The wild type of EC group had a younger mean age compared to the other two groups with mutations, which aligns with Feinberg et al., 2019, who described the younger mean age of type 1 EC cases than Type 2 [ 19 ]. The mean age in cases with P53 mutation is older than cases with both P53 & Rb1 mutations, 67.2 yrs and 64 yrs, respectively. Our results suggest that endometrial cancer cases with P53 mutations occur at an older age, and the presence of Rb1 mutations reduces the mean age, although it remains higher than in wild type cases. However, these findings are not statistically significant, and we plan to increase the sample size in future studies. Additionally, EC cases with both P53 & Rb1 had the largest tumor size, the lowest depth of invasion, and no associated adenomyosis and/or endometriosis, which may reflect a better prognosis. For instance, the depth of myometrial invasion is crucial for staging and management planning [ 4 ]. These results were not statistically significant and could be affirmed by increasing the sample size in future studies. The impact of P53 and Rb1 mutations was first explored by Albitar et al., 2007; who demonstrated how Rb1 and PTEN mutations, or PTEN mutations alone, down-regulate P53 expression and increase resistance to gefitinib in their cell mode [ 9 ], and Serbes et al., 2024 in their large cohort study that described 7% (n = 7/227) Rb1 mutation in EC cases that have abnormal p53 expression, These cases, confirmed by IHC, exhibited high-grade nuclear atypia and were diagnosed at earlier stages than cases with only P53 mutations, similar to our findings. However, our results are not statistically significant; the percentage of cases was 6.67%, close to their percentage, while the mean age in their study for the combined mutation of Rb1&P53 was older than the EC with P53 mutation and normal Rb1 cases, 73.17 and 68.75, respectively. Still, it was diagnosed at earlier stages than EC with P53 mutation only. They also identified copy number loss involving the Rb1 locus in most combined mutation cases, explaining the loss of Rb1 locus expression [ 10 ]. Based on these findings and our results, we believe in the potential use of Rb1 to elaborate on the prognosis of endometrial cancer cases with P53 mutations, pending future studies with larger sample sizes. 4. Conclusion Pgr- cre/+ , P53 Loxp/Loxp , Rb1 Loxp/Loxp mice develop endometrial hyperplasia and cancer at a younger age with significant proliferation detected by Ki67 IHC and downregulation of P21 expression. While women had EC, we haven’t statistically significant results regarding the mean age of, no proven mutation, P53 mutation, and the associated P53&Rb1 mutation cases. We suggest that the double mutation of P53&Rb1 affects the age of incidence of EC in mice. At the same time, further multicenter studies, including higher sample sizes, are needed to prove or disprove this concept in women. 5. Materials and Methods The study was conducted at the National Research Center of Egypt, with approval number 01460523, after the approval of the medical research ethics committee, federal-wide assurance 00014747 RHDIRB: 2017103002. This is in accordance with the provisions of the relevant Egyptian laws, the Helsinki Declaration, the World Health Organization (WHO), good medical and laboratory practice guidelines, recommendations, and rules regarding the ethics of scientific research. 5.1. Mice: To create the mouse model for this study, Pgr-Cre mice, Rb1-floxed mice, and P53-Floxed mice [ 12 ] Were utilized. Initially, Pgr-cre/+ males were bred with P53-Loxp/Loxp females to produce Pgr-cre/+, P53-Loxp/Loxp offspring. Subsequently, these Pgr-cre/+, P53 Loxp/Loxp males were mated with RB1 Loxp/Loxp females, resulting in the final mouse model: Pgr-cre/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp. The study group consisted of litters from Pgr-cre/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice, while the control group included Pgr-+/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice. All mice were housed at the National Research Center Animal Care Facility, adhering to institutional guidelines for laboratory animal use. They were kept at a temperature of 24°C, with 50% relative humidity, and a 12:12 light-dark cycle, with food and water available. Uteri were collected from the mice according to three age groups based on reproductive age: early reproductive age (2–4 months), mid reproductive age (4–6 months) and late reproductive age (≥ 6 months) [ 28 ] Each group included a minimum of five mice. 5.2. Human Endometrial Samples The study involved women who underwent hysterectomy or fractional curettage due to suspected malignant lesions, dysfunctional uterine bleeding, postmenopausal bleeding (with or without increased endometrial thickness), endometrial polyps, endometrial lesions invading the myometrium, myomas, or adenomyosis. Women with malignancies in other tissues, including primary cervical or ovarian tumors, or those with hepatitis C or B viral infections, were excluded. Participants were recruited from the outpatient clinic at the National Research Centre after providing informed consent. The study was structured as a case-control study, comprising 55 cases (10 controls with normal endometrium and 45 in the endometrial cancer group), with groups formed following histopathological confirmation of diagnosis. Pipelle samples were collected at the National Research Center's outpatient clinics, while hysterectomy operations were performed at the Obstetrics and Gynecology Hospital, Cairo University. Endometrial samples, ranging from 3–10 mm, were obtained from surgically extracted tissue. Histopathological analyses were conducted at Cairo University and in the private sector. The recruitment of cases spanned one year, from January 2023 to January 2024. 5.3. Genotyping of mice letters Tail samples, measuring 2–3 mm, were collected from mice at 3 weeks of age. These samples were incubated overnight at 55°C in a solution consisting of 189.6 µl lysis buffer, 10 µl Actinase E, and 0.4 µl RNase. Following incubation, 200 µl of Acid-Phenol-chloroform (pH 4.5, Invitrogen™) was added, and DNA extraction was carried out according to the manufacturer's instructions. The extracted DNA was then subjected to PCR to amplify the genes of interest (Pgr-cre/+, P53 Loxp/Loxp, and Rb1 Loxp/Loxp), following previously established protocols [ 29 ]. The primer sequences used for PCR are detailed in Table 1 . Agarose gel electrophoresis was employed to determine the size of the DNA fragments and to identify the genotype[ 30 ] The expected band sizes are indicated in Table 2 . Table 1 Primers for PCR. Gene Forward Reverse Pgr cre Cre: 5’ TATACCGATCTCCCTGGACG 3’PR WT: 5’ CCCAAAGAGACACCAGGAAG 3’ 5’ ATGTTTAGCTGGCCCAAATG 3’ P53 Loxp 5'-cAcAAAAAcAGGTTAAAcccA G -3' 5'-AGcAcATAGGAGGcAGAGAc − 3' Rb1 Loxp 5'-CT AAGAGCTCAGACTCATGG-3' 5'-GGCGTGTGCCATCAATG-3' Table 2 Band size in Agarose gel electrophoresis for detected genes. Gene Wild type (bp) Cre or Loxp (bp) Pgr 302 522 P53 288 370 Rb1 650 700 5.4. Hematoxylin and Eosin staining. Formalin-fixed paraffin-embedded sections (6 µm) of both human and mouse uterine samples were stained with hematoxylin (Wako) and 1% eosin (Wako) (H&E) to detect endometrial malignancy [ 11 ], [ 31 ]. The tissue sections were deparaffinized and rehydrated using a series of xylene and ethanol washes. Endometrial carcinoma was identified in both human and mouse samples based on several criteria: increased glandular-to-stromal ratio, loss of intervening stroma, back-to-back glandular architecture, abnormal gland size and shape, and atypical nuclear changes (such as oval or rounded large nuclei, hyperchromatic nuclei, atypical nuclei with prominent nucleoli, numerous apoptotic bodies, vesicular changes, abnormal mitotic figures, loss of polarity and orientation to the basement membrane, and pleomorphism). Additional features included hemorrhage, tumor necrosis, and myometrial invasion, which distinguishes endometrial hyperplasia from endometrial cancer [ 15 ], [ 32 ]. For human samples, Lymph nodes, ovarian tissues, and cervical involvement were investigated for staging [ 4 ]. The grading of human samples followed the FIGO and World Health Organization criteria: Grade 1 (solid growth < 5%), Grade 2 (solid growth 6–50%), and Grade 3 (solid growth > 50%) [ 4 ] 5.5. Immunohistochemistry (IHC): 2.5a. Mice uterine samples : Formalin-fixed paraffin-embedded sections (6 µm) were subjected to immunohistochemistry [ 11 ], [ 12 ], [ 33 ]. Tissue sections were deparaffinized and rehydrated through a series of xylene and ethanol washes. Heating the slides at 98°C for 60 minutes in 10 mM citrate buffer (pH 6.0) was performed for antigen retrieval. To block endogenous peroxidase activity, the sections were incubated in 3% H2O2 diluted with methanol for 10 minutes. After blocking with nonspecific staining by blocking reagent (X0909, DAKO), the slides were incubated with the primary antibodies overnight at 4°C. The primary antibodies against Rb1 (ab181616, Abcam, 1:200) [ 12 ], P53 (IR616, monoclonal DO-7, Dako; 1:200) [ 34 ], MKI67 (A2094, ABclonal; 1:100) [ 35 ], P21 (ab2881097, Proteintech; 1:500) [ 36 ]. The sections were then incubated with the horse radish peroxidase-polymer secondary antibodies (DAKO Envision + System, K4000 and K4002, DAKO) for 60 minutes at room temperature. Staining was detected with 3,3-diaminobenzidine (DAB) using an N-Histofine DAB-3S kit (415192F, Nichirei Biosciences). The sections were counterstained with hematoxylin and evaluated under a light microscope. Rb1 IHC for human uterine samples followed the same protocol. The intensities of MKI67 staining were assessed by a semiquantitative method of H-scoring [ 11 ]. The staining intensity of each cell in the high-power field was assessed and assigned a score of 0, 1+, 2+, or 3+ (indicating negative, weak, moderate, or strong staining, respectively). The percentage of cells at each intensity level was then calculated. The H-score was determined using the formula: H-score = 1 × (% cells 1+) + 2 × (% cells 2+) + 3 × (% cells 3+). This evaluation was performed across five high-power fields per section. 5.5b. Human uterine samples : Formalin-fixed paraffin-embedded sections (4 µm) were deparaffinized in EZ prep 75°C 8 mins. Then, Conditioner #1, Standard Cell Conditioning Solution (CC1, Tris-EDTA based buffer pH 7.8, 950 − 124), at 95°C, 44 mins for Cell Conditioning. Blocking endogenous peroxidase activity with Inhibitor CM, 37°C, 4 mins. No Heat. Application of anti-p53 (DO-7, prediluted 0.5 µg/ml, Ventana) [ 14 ] for 60 mins. A drop of OmniMap anti-Ms HRP (760–4310) was added and incubated for 16 minutes. After that, A drop of DAB CM (ChromoMap DAB kit, 760 − 159) and One Drop of H2O2 CM were added and incubated for 8 minutes. Then, a drop of Copper CM was applied, and the incubation lasted 5 minutes. The sections were counterstained with Hematoxylin (760–2021) and incubated for 8 minutes. After counterstain with Bluing Reagent (760–2037) for 8 mins. Slide Cleaning [ 37 ]. And evaluated under a light microscope by two pathologists (ME, MK). The discordant results were reviewed by consensus at the multiheaded microscope in the presence of a third pathologist. Staining of the nucleus is considered a positive reaction. The staining extent was estimated to be the nearest 10% level of positive tumor cells [ 38 ]. 5.6. Statistical analysis: The data from mice and humans was collected and summarized; the results were analyzed using the SPSS 21 version. A 2-tailed Student t-test was used to compare the numerical data of two groups, a one-way ANOVA test was used for multiple groups comparison followed by a Tukey multiple comparisons test to compare multiple groups, and a Chi-square (2) test was performed for categorical data. A P-value of less than 0.05 will be considered statistically significant for all tests. Abbreviations Abbreviation Expansion EC Endometrial cancer FIGO International Federation of Gynecology and Obstetrics P53/TP53 Tumor protein P53 Rb1 Retinoblastoma protein 1 Pgr Progesterone Receptor P21/ CDKN1A Cyclin-dependent kinase inhibitor Ki67 Kiel 67 POLE DNA Polymerase Epsilon, Catalytic Subunit PTEN Phosphatase and tensin homolog CTNNB1 Catenin Beta 1 PIK3R1 Phosphoinositide-3-Kinase Regulatory Subunit 1 PCR Polymerase chain reaction H&E Hematoxylin and Eosin IHC Immunohistochemistry Declarations Ethics approval and consent to participate: The study was conducted at the National Research Center of Egypt, with approval number 01460523, after the approval of the medical research ethics committee federal-wide assurance 00014747 RHDIRB: 2017103002. This is in accordance with the provisions of the relevant Egyptian laws, the Helsinki Declaration, the World Health Organization (WHO), good medical and laboratory practice guidelines, recommendations, and rules regarding the ethics of scientific research. And an informed consent was taken from all participant females. Availability of data and material: All data generated or analyzed during this study are included in this published article and its supplementary information files. Consent for publication: And an informed consent was taken from all participant females. Competing interest: The authors declare that they do not have any conflict of interest. Funding: self-funded by the authors (we had no grants). Authors Contributions: Mona Gebril: Study plan, mice care collecting and processing samples, PCR, IHC, examining suspected women in NRC outpatient clinics, paper writing. Mohammed Elsherbini: IHC of mice samples, paper writing. Marwa Fouad Sharaf: Examining and operating suspected women cases with endometrial cancer. Mohamed Emam Mohamed: Histopathological study of collected samples. Mohammed El-Kherbetawy: Histopathological study of collected samples. Engi Elzemeti: Examining and operating suspected women cases with endometrial cancer. Mohamed A. Sayed: Histopathological study of collected mice samples. Amal Aboelmaaty: histopathological study of collected samples and statistical analysis of the collected data paper writing. Acknowledgement: We want to thank Dr. Yasushi Hirota, professor of Obstetrics and Gynecology at the University of Tokyo, Graduate School of Medicine, Tokyo, Japan, for providing us with all three mouse models: PR-cre, P53 loxp/loxp, and Rb1 loxp/loxp mice. References B. M. R. R. A. S. R. R. L. R. J. K. L. H. Elleson, Blaustein’s Pathology of the Female Genital Tract , 7th ed. Cham: Springer International Publishing, 2019. doi: 10.1007/978-3-319-46334-6_9 . V. Makker et al. , “Endometrial cancer,” Dec. 01, 2021, Nature Research. doi: 10.1038/s41572-021-00324-8 . D. Arciuolo et al. , “TCGA Molecular Prognostic Groups of Endometrial Carcinoma: Current Knowledge and Future Perspectives,” Int J Mol Sci, vol. 23, no. 19, p. 11684, Oct. 2022, doi: 10.3390/ijms231911684 . J. S. Berek et al. , “FIGO staging of endometrial cancer: 2023,” International Journal of Gynecology and Obstetrics , vol. 162, no. 2, pp. 383–394, Aug. 2023, doi: 10.1002/ijgo.14923 . K. Engeland, “Cell cycle regulation: p53-p21-RB signaling,” May 01, 2022, Springer Nature. doi: 10.1038/s41418-022-00988-z . A. Hafner, M. L. Bulyk, A. Jambhekar, and G. Lahav, “The multiple mechanisms that regulate p53 activity and cell fate,” Apr. 01, 2019, Nature Publishing Group. doi: 10.1038/s41580-019-0110-x . A. Quintanal-Villalonga et al. , “CDC7 inhibition impairs neuroendocrine transformation in lung and prostate tumors through MYC degradation,” Signal Transduct Target Ther, vol. 9, no. 1, Dec. 2024, doi: 10.1038/s41392-024-01908-y . Y. Li, S. Yang, Y. Liu, and S. Yang, “Mice with Trp53 and Rb1 deficiency in chondrocytes spontaneously develop chondrosarcoma via overactivation of YAP signaling,” Cell Death Dis, vol. 13, no. 6, Jun. 2022, doi: 10.1038/s41419-022-04916-4 . L. Albitar, M. B. Carter, S. Davies, and K. K. Leslie, “Consequences of the loss of p53, RB1, and PTEN: Relationship to gefitinib resistance in endometrial cancer,” Gynecol Oncol , vol. 106, no. 1, pp. 94–104, Jul. 2007, doi: 10.1016/j.ygyno.2007.03.006 . E. D. Serbes et al. , “RB Loss in p53 Abnormal Endometrial Carcinoma: Histological and Clinicopathological Correlates.,” Mod Pathol, p. 100660, Nov. 2024, doi: 10.1016/j.modpat.2024.100660 . M. Gebril et al. , “Uterine Epithelial Progesterone Receptor Governs Uterine Receptivity through Epithelial Cell Differentiation,” Endocrinology (United States), vol. 161, no. 12, Dec. 2020, doi: 10.1210/endocr/bqaa195 . S. Akaeda et al. , “Retinoblastoma protein promotes uterine epithelial cell cycle arrest and necroptosis for embryo invasion,” EMBO Rep, vol. 22, no. 2, Feb. 2021, doi: 10.15252/embr.202050927 . M. Köbel, B. M. Ronnett, N. Singh, R. A. Soslow, C. B. Gilks, and W. G. McCluggage, “Interpretation of P53 Immunohistochemistry in Endometrial Carcinomas: Toward Increased Reproducibility,” International Journal of Gynecological Pathology , vol. 38, no. Supplement 1, pp. S123–S131, Jan. 2019, doi: 10.1097/PGP.0000000000000488 . K. W. Thiel et al. , “ TP53 Sequencing and p53 Immunohistochemistry Predict Outcomes When Bevacizumab Is Added to Frontline Chemotherapy in Endometrial Cancer: An NRG Oncology/Gynecologic Oncology Group Study,” Journal of Clinical Oncology , vol. 40, no. 28, pp. 3289–3300, Oct. 2022, doi: 10.1200/JCO.21.02506 . R. Murali et al. , “High-grade Endometrial Carcinomas: Morphologic and Immunohistochemical Features, Diagnostic Challenges and Recommendations,” International Journal of Gynecological Pathology , vol. 38, no. Supplement 1, pp. S40–S63, Jan. 2019, doi: 10.1097/PGP.0000000000000491 . M. Gebril, A. Aboelmaaty, O. Al Balah, T. Taha, A. Abbassy, and M. A. H. Elnoury, “Bio-modulated mice epithelial endometrial organoids by low-level laser therapy serves as an invitro model for endometrial regeneration,” Reprod Biol , vol. 21, no. 4, Dec. 2021, doi: 10.1016/j.repbio.2021.100564 . P. Bajwa et al. , “Overactive mTOR signaling leads to endometrial hyperplasia in aged women and mice,” Oncotarget, vol. 8, no. 5, pp. 7265–7275, Jan. 2017, doi: 10.18632/oncotarget.13919 . S. Uxa, P. Castillo-Binder, R. Kohler, K. Stangner, G. A. Müller, and K. Engeland, “Ki-67 gene expression,” Cell Death Differ , vol. 28, no. 12, pp. 3357–3370, Dec. 2021, doi: 10.1038/s41418-021-00823-x . J. Feinberg et al. , “Ten-Year Comparison Study of Type 1 and 2 Endometrial Cancers: Risk Factors and Outcomes,” Gynecol Obstet Invest, vol. 84, no. 3, pp. 290–297, 2019, doi: 10.1159/000493132 . A. Jamieson, E. F. Thompson, J. Huvila, C. B. Gilks, and J. N. McAlpine, “p53abn Endometrial Cancer: understanding the most aggressive endometrial cancers in the era of molecular classification,” International Journal of Gynecologic Cancer , vol. 31, no. 6, pp. 907–913, Jun. 2021, doi: 10.1136/ijgc-2020-002256 . R. L. Siegel, K. D. Miller, N. S. Wagle, and A. Jemal, “Cancer statistics, 2023,” CA Cancer J Clin, vol. 73, no. 1, pp. 17–48, Jan. 2023, doi: 10.3322/caac.21763 . L. Vermij et al. , “p53 immunohistochemistry in endometrial cancer: clinical and molecular correlates in the PORTEC-3 trial,” Modern Pathology , vol. 35, no. 10, pp. 1475–1483, Oct. 2022, doi: 10.1038/s41379-022-01102-x . K. A. Wikenheiser-Brokamp, “Retinoblastoma family proteins: insights gained through genetic manipulation of mice,” Cellular and Molecular Life Sciences , vol. 63, no. 7–8, pp. 767–780, Apr. 2006, doi: 10.1007/s00018-005-5487-3 . G. Ciriello, M. L. Miller, B. A. Aksoy, Y. Senbabaoglu, N. Schultz, and C. Sander, “Emerging landscape of oncogenic signatures across human cancers,” Nat Genet , vol. 45, no. 10, pp. 1127–1133, Oct. 2013, doi: 10.1038/ng.2762 . C. de Martel, M. Plummer, J. Vignat, and S. Franceschi, “Worldwide burden of cancer attributable to HPV by site, country and HPV type,” Int J Cancer , vol. 141, no. 4, pp. 664–670, Aug. 2017, doi: 10.1002/ijc.30716 . D. A. Levine, “Integrated genomic characterization of endometrial carcinoma,” Nature, vol. 497, no. 7447, pp. 67–73, May 2013, doi: 10.1038/nature12113 . C. Deng, P. Zhang, J. Wade Harper, S. J. Elledge, and P. Leder, “Mice Lacking p21CIP1/WAF1 undergo normal development, but are defective in G1 checkpoint control,” Cell , vol. 82, no. 4, pp. 675–684, Aug. 1995, doi: 10.1016/0092-8674(95)90039-X . C. Lliberos, S. H. Liew, P. Zareie, N. L. La Gruta, A. Mansell, and K. Hutt, “Evaluation of inflammation and follicle depletion during ovarian ageing in mice,” Sci Rep, vol. 11, no. 1, Dec. 2021, doi: 10.1038/s41598-020-79488-4 . M. R. Green and J. Sambrook, “Polymerase chain reaction,” Cold Spring Harb Protoc , vol. 2019, no. 6, pp. 436–456, Jun. 2019, doi: 10.1101/pdb.top095109 . A. Ouellette, M. Mahendroo, and S. Nallasamy, “Collagen and elastic fiber remodeling in the pregnant mouse myometrium,” Biol Reprod , vol. 107, no. 3, pp. 741–751, Sep. 2022, doi: 10.1093/biolre/ioac102 . M. Matsuo et al. , “Levonorgestrel Inhibits Embryo Attachment by Eliminating Uterine Induction of Leukemia Inhibitory Factor,” Endocrinology, vol. 161, no. 2, Feb. 2020, doi: 10.1210/endocr/bqz005 . S. F. Lax, R. J. Kurman, E. S. Pizer, L. Wu, and B. M. Ronnett, “A Binary Architectural Grading System for Uterine Endometrial Endometrioid Carcinoma Has Superior Reproducibility Compared With FIGO Grading and Identifies Subsets of Advance-Stage Tumors With Favorable and Unfavorable Prognosis,” Am J Surg Pathol , vol. 24, no. 9, pp. 1201–1208, Sep. 2000, doi: 10.1097/00000478-200009000-00002 . T. Hiraoka et al. , “Differential roles of uterine epithelial and stromal STAT3 coordinate uterine receptivity and embryo attachment,” Sci Rep, vol. 10, no. 1, Dec. 2020, doi: 10.1038/s41598-020-72640-0 . L. F. Sallum et al. , “WT1, p53 and p16 expression in the diagnosis of low- and high-grade serous ovarian carcinomas and their relation to prognosis,” Oncotarget , vol. 9, no. 22, pp. 15818–15827, Mar. 2018, doi: 10.18632/oncotarget.24530 . J. Li, J. Ding, H. Wu, C. Lu, J. Wu, and Q. Luo, “Tat-CIRP Peptide Facilitates Frozen Wound Healing by Ameliorating Inflammation and Promoting Angiogenesis,” J Inflamm Res , vol. Volume 17, pp. 2205–2215, Apr. 2024, doi: 10.2147/JIR.S450288 . A. Takahashi et al. , “Downregulation of cytoplasmic DNases is implicated in cytoplasmic DNA accumulation and SASP in senescent cells,” Nat Commun, vol. 9, no. 1, p. 1249, Mar. 2018, doi: 10.1038/s41467-018-03555-8 . R. Roman, M. Molina-Vila, E. Aldeguer, and S. Rodriguez, “Immunohistochemistry with Ventana,” Protoc Exch, 2019, doi: 10.1038/protex.2019.023 . A. Yemelyanova et al. , “Immunohistochemical staining patterns of p53 can serve as a surrogate marker for TP53 mutations in ovarian carcinoma: an immunohistochemical and nucleotide sequencing analysis,” Modern Pathology , vol. 24, no. 9, pp. 1248–1253, Sep. 2011, doi: 10.1038/modpathol.2011.85 . Additional Declarations No competing interests reported. Supplementary Files fullgenotypingimage.pdf SuppFig1.png Supplementary Fig1: H&E evidence of malignancy and myometrial invasion by high power field. The figure showing mice with double knockout of P53 and Rb1 proved to have earlier endometrial cancer development with criteria described before. Magnifications 40x, scale bar 100 μm. Abbreviations: L, luminal epithelium. G, glandular epithelium. St, endometrial stroma. SuppFig2.png Supplementary Fig2: Old Rb1 knockout mice (Pgr-cre/+, Rb1 Loxp/Loxp mice) did not develop endometrial cancer. H&E staining. Magnifications 10x & 40x, scale bar 100 μm. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6091807\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":443309764,\"identity\":\"eefc7e63-dc49-417b-9016-35d3c02ad999\",\"order_by\":0,\"name\":\"Mona Gebril\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDUlEQVRIiWNgGAWjYPCCAwxs7MwHDBIM/suBuQ+I0sLMllDwoIDZGMxNIEYLAzOPwccHH5gTG0B8fFp023sPfvxScSefj5ktcUOCAVv6/LDDD4G22MnpNmDXYnbmXLK0zJlnlm3MzIeBfuHJ3Xg7zQCoJdnY7AAOLTdyDKQl2w4bAP2SBtQikbtxdgJIy4HEbbi1GP+W/AfSwmP+I8HAIN1wdvoHQlrMJD82gLUYAG1JSJCXziFgy5kzZtYMx56BHAbUYHDAcIN0TsGBBAM8fjneY3zzR80dA/n25gOGP/4ckJefnb75w4cKOzlcWkCAmQeZZwBWaYBbOQgw/kDmyTfgVz0KRsEoGAUjDwAALVllsumu5UUAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"National Research Center of Egypt\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Mona\",\"middleName\":\"\",\"lastName\":\"Gebril\",\"suffix\":\"\"},{\"id\":443309765,\"identity\":\"61709ee1-0aae-45c6-93e7-5b59124b1336\",\"order_by\":1,\"name\":\"Mohammed Elsherbini\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The University of Tokyo\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mohammed\",\"middleName\":\"\",\"lastName\":\"Elsherbini\",\"suffix\":\"\"},{\"id\":443309766,\"identity\":\"31fccef0-3cff-4d84-a9f2-fc3832b468f8\",\"order_by\":2,\"name\":\"Marwa Fouad Sharaf\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Cairo University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Marwa\",\"middleName\":\"Fouad\",\"lastName\":\"Sharaf\",\"suffix\":\"\"},{\"id\":443309769,\"identity\":\"3e0c1eb4-757f-431d-b9a8-7ce9e7787213\",\"order_by\":3,\"name\":\"Mohamed Emam Mohamed\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Cairo University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mohamed\",\"middleName\":\"Emam\",\"lastName\":\"Mohamed\",\"suffix\":\"\"},{\"id\":443309771,\"identity\":\"4f88ae9f-9057-493e-86ce-8985bc7375a1\",\"order_by\":4,\"name\":\"Mohammed El-Kherbetawy\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Suez Canal University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mohammed\",\"middleName\":\"\",\"lastName\":\"El-Kherbetawy\",\"suffix\":\"\"},{\"id\":443309772,\"identity\":\"b4a57e0b-1159-4eac-b99e-223ed118eee5\",\"order_by\":5,\"name\":\"Engi Elzemeti\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Mansoura University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Engi\",\"middleName\":\"\",\"lastName\":\"Elzemeti\",\"suffix\":\"\"},{\"id\":443309774,\"identity\":\"c9b769a2-1468-433c-ab18-ec5df67e03a6\",\"order_by\":6,\"name\":\"Mohammed Aly Sayed\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"National Research Center of Egypt\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mohammed\",\"middleName\":\"Aly\",\"lastName\":\"Sayed\",\"suffix\":\"\"},{\"id\":443309776,\"identity\":\"2f31814f-679c-41a6-930c-34f697b5a539\",\"order_by\":7,\"name\":\"Amal Aboelmaaty\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"National Research Center of Egypt\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Amal\",\"middleName\":\"\",\"lastName\":\"Aboelmaaty\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-02-23 19:38:16\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6091807/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6091807/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":80802123,\"identity\":\"488fe13c-5804-448d-82e6-f91846c3af63\",\"added_by\":\"auto\",\"created_at\":\"2025-04-17 08:48:19\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":574601,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eConfirmation of the mice genotype: A.\\u003c/strong\\u003e The results of PCR for the mice tail samples, mice of study efficiently had the band sizes of PR cre/+ 403 bp, P53 Lox/Lox 370 bp and Rb1 Lox/Lox 700 bp, while the control mice had the band sizes of the wild type of PR +/+ 301 bp, P53 +/+ 288 bp and Rb1+/+ 650 bp. \\u003cstrong\\u003eB\\u003c/strong\\u003e. Confirmation of P53 mutations by IHC as P53 abnormally expressed in stromal cytoplasm and nuclei of mid and late age study groups endometrial in Pgr-cre/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice. Magnification 40x, scale bar 100 μm \\u003cstrong\\u003eC\\u003c/strong\\u003e. Confirmation of Rb1 mutations by IHC, there is no expression of Rb1 in the endometrial epithelium and down regulation of its expression the endometrial stroma of Pgr-cre/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice in comparison to the control. Magnification 40x, scale bar 100 μm. Abbreviations: -ve, negative control. +ve, positive control. W.T, wild type. PR cre, PR knockout. Rb1 lox, Rb1 floxed/floxed. L, luminal epithelium. G, glandular epithelium. St, endometrial stroma.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6091807/v1/45b49fdbad2146ecd53236d3.png\"},{\"id\":80803059,\"identity\":\"4fc4ab67-8ba0-430e-adfb-a77892608748\",\"added_by\":\"auto\",\"created_at\":\"2025-04-17 08:56:19\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":486238,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMice with double knockout of P53 and Rb1 proved to have earlier endometrial cancer development. A. H\\u0026amp;E staining of all age groups. \\u003c/strong\\u003ePgr-cre/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice had higher incidence of endometrial hyperplasia, atypia and myometrial invasion. Black arrows defining abnormal size and shape of the glands. Red arrows delineating the myometrial invasion sites. Magnification 10x, scale bar 100 μm. Abbreviations: L, luminal epithelium. g, glandular epithelium. St, endometrial stroma. M, myometrium. \\u003cstrong\\u003eB. Graph analysis of incidence of endometrial hyperplasia, Atypia \\u0026amp; myometrial invasion in all age groups. \\u003c/strong\\u003eUsing Chi sq test P-values were 0.014, 0.008 and 0.004 respectively.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6091807/v1/9d577f3df14c2dfb48aa111a.png\"},{\"id\":80801774,\"identity\":\"ca141590-926f-4a5d-832e-bf712df6b85d\",\"added_by\":\"auto\",\"created_at\":\"2025-04-17 08:40:19\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":623345,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eEndometrial proliferation pattern in Pgr-cre/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice model. A. Ki67 Immunohistochemistry. \\u003c/strong\\u003eShowed immunostaining of both the epithelium and stroma of the endometrium of Pgr-cre/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice in comparison to the control Pgr-+/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice. Magnification 40x, scale bar 100 μm. \\u003cstrong\\u003eB.\\u003c/strong\\u003e \\u003cstrong\\u003eH-score of Ki67 staining in all age groups\\u003c/strong\\u003e both in the epithelium and stroma showing higher staining density in Pgr-cre/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice of all groups with statistically significant differences in the early and med-reproductive age groups. Abbreviations: L, luminal epithelium. G, glandular epithelium. St, endometrial stroma.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6091807/v1/2d6c144d11e8ea4067f6d856.png\"},{\"id\":80801783,\"identity\":\"0bf20209-e582-46c1-bb3f-80ca2e09ecef\",\"added_by\":\"auto\",\"created_at\":\"2025-04-17 08:40:20\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":673268,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eP21 expression by IHC in Pgr-cre/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice model. The \\u003c/strong\\u003eexpression of P21 is downregulated mainly in the endometrial stroma of Pgr-cre/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice in comparison to control.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6091807/v1/b9bee45031842cf035a80a80.png\"},{\"id\":80802128,\"identity\":\"0e854495-48ac-474d-90f4-8dd16dad1583\",\"added_by\":\"auto\",\"created_at\":\"2025-04-17 08:48:19\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":616967,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eH\\u0026amp;E staining of women endometrial samples to diagnose endometrial cancer. \\u003c/strong\\u003eA. proliferative endometrium. B. Endometrial cancer. Cases diagnosed with endometrial cancer proved to have Increased glandular stromal ratio, loss of intervening stroma, back-to-back architecture, abnormal size and shape of the endometrial glands, in addition to atypical changes of the gland’s nuclei, hemorrhage, tumor necrosis, and myometrial invasion. Magnification 40x, scale bar 100 μm.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6091807/v1/c12410e1f044aa386fb2ac94.png\"},{\"id\":80801779,\"identity\":\"67732a3f-dd62-4da0-a708-03790ff22bf3\",\"added_by\":\"auto\",\"created_at\":\"2025-04-17 08:40:19\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":541258,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eThe expression of P53 and Rb1 in endometrial cancer cases. \\u003c/strong\\u003eA. P53 Immunostaining, P53 mutation is considered in negative and overexpression stains. B. Rb1 immunostaining, Mutation is considered in down regulated expression both in epithelium and stroma. Magnifications 10x\\u0026amp; 40x, scale bar 100 μm. C. percentage of P53 and Rb1 mutations in endometrial cancer cases. D. The average age of women with endometrial cancer, without mutation, P53 mutation and P53\\u0026amp; Rb1 mutations. E. the average size in cases of endometrial cancer according to mutation of P53 and Rb1. F. comparing the depth of invasion in the same groups. G. describes the percentage of associated incidence of adenomyosis/or endometriosis with P53 and Rb1 mutation. In all graphs P value \\u0026gt; 0.05.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6091807/v1/874635dd5a2c125d67234799.png\"},{\"id\":85598036,\"identity\":\"2cff3fa3-47d5-443f-a0ca-6b52c2312d26\",\"added_by\":\"auto\",\"created_at\":\"2025-06-28 16:46:31\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":4611064,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6091807/v1/80b5863e-b8b4-4cf4-a090-99093c5f3425.pdf\"},{\"id\":80801769,\"identity\":\"5313fa7d-fdae-42b8-903a-653670440435\",\"added_by\":\"auto\",\"created_at\":\"2025-04-17 08:40:19\",\"extension\":\"pdf\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":107775,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"fullgenotypingimage.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6091807/v1/2b778fe8d3b9c89faa1fd3c4.pdf\"},{\"id\":80801772,\"identity\":\"c4eca8ad-2750-4d09-9e99-9699a200bcff\",\"added_by\":\"auto\",\"created_at\":\"2025-04-17 08:40:19\",\"extension\":\"png\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1010028,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Fig1: H\\u0026amp;E evidence of malignancy and myometrial invasion by high power field. \\u003c/strong\\u003eThe figure showing mice with double knockout of P53 and Rb1 proved to have earlier endometrial cancer development with criteria described before.\\u003cstrong\\u003e \\u003c/strong\\u003eMagnifications 40x, scale bar 100 μm. Abbreviations: L, luminal epithelium. G, glandular epithelium. St, endometrial stroma.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"SuppFig1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6091807/v1/60479e709de071a8f26334ea.png\"},{\"id\":80802125,\"identity\":\"887540e6-811d-4189-93fe-5a55e6149d2e\",\"added_by\":\"auto\",\"created_at\":\"2025-04-17 08:48:19\",\"extension\":\"png\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":727162,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSupplementary Fig2:\\u003c/strong\\u003e \\u003cstrong\\u003eOld Rb1 knockout mice (Pgr-cre/+, Rb1 Loxp/Loxp mice) did not develop endometrial cancer. H\\u0026amp;E staining. \\u003c/strong\\u003eMagnifications 10x \\u0026amp; 40x, scale bar 100 μm.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"SuppFig2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6091807/v1/b7ae58f8647385b2f302729f.png\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"The association of P53 and Rb1 mutation in endometrial cancer development\",\"fulltext\":[{\"header\":\"1. Background\",\"content\":\"\\u003cp\\u003eEndometrial cancer (EC) is a malignant tumor of the inner layer of the endometrial epithelium. It is the most common female reproductive tract invasive malignancy and ranked the sixth most common malignancy in females [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. The incidence of the EC varies significantly across different regions, with the highest rates found in North America and Europe, while developing countries experience a much lower incidence, approximately five times less. Globally, EC is associated with higher incidence and mortality rates [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Histopathologically, EC used to be classified into two main types: Type 1, which includes grade I and grade II endometrioid adenocarcinoma, and Type 2, which encompasses grade III endometrioid adenocarcinoma along with other forms of endometrial cancer such as serous, clear cell, and undifferentiated carcinoma [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Type I ECs are linked to factors that increase estrogen levels, such as obesity and hormonal treatments. On the other hand, Type II ECs, exemplified by serous carcinoma, typically do not have a connection to estrogenic stimulation [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. Recent research studies utilizing advanced next-generation sequencing studies hypothesized that endometrioid and serous carcinoma can be classified into four main subtypes based on the mutational state of endometrial cancer. These classifications offer promising avenues for prevention, diagnosis, and patient management. The four proposed subtypes, the Ultramutated subtype, have high mutation rates exceeding 10,000 mutations due to a mutation in the POLE gene found in undifferentiated carcinomas [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. The 2nd subtype is Hypermutated/Microsatellite Instability (MSI), which occurs due to high mutations of microsatellite DNA sequences and loss of DNA mismatch repair found in 20\\u0026ndash;25% of sporadic cases of endometrial cancer and cases of Lynch Syndrome. The 3rd subtype is Copy Number Low/Microsatellite stable (MSS); this subtype is composed entirely of endometrioid cancer with frequent mutations in PTEN, CTNNB1, PIK3CA, PIK3R1, and ARID1A. The last subtype is Copy Number High/Serous-Like, which includes a high frequency of TP53 mutations, usually serous tumors, some grades of grade III endometrioid, and some clear cell carcinoma [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. Recent updates to the FIGO classification of endometrial cancer now include TP53 and POLE mutations [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. The transcription factor P53 and retinoblastoma protein (RB) are crucial tumor suppressors found inactivated in various tumor types. Both proteins have fundamental roles in cell cycle regulation. A complex is formed from the RB and E2F family of transcription factors and downregulates various genes that are key cell cycle regulators. This suppression is lifted when RB is phosphorylated. Cyclin-dependent kinase inhibitor CDKN1A (P21) can prevent RB phosphorylation, thereby inhibiting the expression of cell cycle regulators. P53 can activate P21 transcription, making P53 and RB1 are considered tumor suppressors through several mechanisms, one of which is the P53-P21-RB signaling pathway [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eP53-P21-RB signaling pathway works after any stimulation to P53 like DNA damage, so P21 expression is upregulated, which promotes the formation of the RB-E2F complex. This complex subsequently suppresses the expression of various cell cycle genes, resulting in the arrest of the cell cycle [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eThe combined mutations of Rb1 and P53 have been investigated in various tumors using tissue-specific knockout mice models. Examples include squamous cell carcinoma of the skin, lung and prostate cancers [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e], and chondrosarcoma[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e] Albitar et al., (2006) explored the impact of Rb1 and PTEN mutations on resistance in endometrial cancer cell lines. Additionally, Serbes et al. (2024) studied the Rb1 loss in P53-mutated EC cases and suggested its potential for improving prognostic accuracy [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]\\u003c/p\\u003e \\u003cp\\u003eGiven the lack of knowledge about the associated P53 and Rb1 mutation in EC, cell culture technical challenges to maintain p53\\u0026amp;Rb1 dual blocked cells viability, and the absence of a mice model of EC with both Rb1 \\u0026amp; P53 mutations, we used the cre-Loxp system with progesterone receptor promotor for the specific deletion of targeted genes in the uterine tissue [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]to delete Rb1 and P53 in the endometrium of our unique mouse model.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we hypothesized that the P53 mutation reported in 90% of Copy Number High/Serous-Like subtypes of endometrial cancer and affects patient prognosis and management could be associated with the RB1 mutation and may influence the onset of EC. We used our unique mice model with a knockout of P53 and RB1 to investigate this. We examined the development of endometrial cancer in three age groups: early, mid, and late reproductive life.\\u003c/p\\u003e\"},{\"header\":\"2. Results\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1. Mice with uterine deletion of P53 and Rb1 show early endometrial malignancy development.\\u003c/h2\\u003e \\u003cp\\u003eTo identify the role of combined mutation in P53 and Rb1 in endometrial malignancy development, we generated female mice with uterine deficiency of both p53 and Rb1 (Pgr-cre/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice) in two steps as described in the methodology section. We confirmed the deletion of both p53 and Rb1 by performing PCR for the tail samples and genotyping where the band size of PR cre/+ is 403 bp while the wild type is 301 bp, and regarding Rb1 loxp/loxp, the band size is 700 bp while the wild type is 650 bp and finally the P53 loxp/loxp band size is 370 bp while the wild type is 288 bp [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e] (Fig.\\u0026nbsp;1A). Immunostaining was used to confirm the mouse genotype. The immunostaining of P53 has four patterns: normal (wild type), overexpression, cytoplasmic, and complete absence, and P53 is considered abnormal in the latter three types. These abnormal patterns of P53 staining are indicative of potential mutations or dysregulation in the P53 gene, which could be associated with the development of endometrial malignancy. [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. The expression of P53 by IHC was aberrant in different age groups; the early reproductive age (2\\u0026ndash;4 months) P53 expression was normal (wild type) in both the control and study groups, but in advanced age groups the expression of P53 was higher in the stroma first (age 4\\u0026ndash;6 months) then both the epithelium and stroma (more than 6 months) in the group of study (Pgr-\\u003csup\\u003ecre/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice). Regarding Rb1 IHC, the expression is not expressed in the endometrial epithelium and downregulated in the stroma of the endometrium in Pgr-\\u003csup\\u003ecre/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice. In contrast, the endometrial epithelium and stroma nuclei were usually stained in the control group (Pgr-\\u003csup\\u003e+/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice) (Fig.\\u0026nbsp;1B \\u0026amp; Fig.\\u0026nbsp;1c).\\u003c/p\\u003e \\u003cp\\u003eAfter confirmation of the mice genotype, we studied the stained endometrium by H\\u0026amp;E of the control and the study group. On comparing the difference of the histological findings of all control (Pgr-\\u003csup\\u003e+/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice) and the study (Pgr-\\u003csup\\u003ecre/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice) groups by Chi-square test irrespective of age, the incidence of hyperplasia, atypia, and myometrial invasion was higher with statistically significant P values were 0.006, 0.002, and 0.003 respectively that confirms P53 \\u0026amp;Rb1 mutation role in EC development in Pgr-\\u003csup\\u003ecre/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice. The age-specific difference was then thoroughly analyzed; regarding the early reproductive age group, we observed no hyperplasia, atypia, or myometrial invasion (endometrial carcinoma) in the control group. While in Pgr-\\u003csup\\u003ecre/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice, we observed 60.7% of cases developed endometrial hyperplasia (Increased glandular stromal ratio, back-to-back architecture, abnormal size and shape of the endometrial glands) and 57% of hyperplasia cases had nuclear atypia (oval or rounded large nuclei, hyperchromatic, atypical nuclei with macro nucleoli, numerous apoptotic bodies, or vesicular changes, abnormal mitotic figures, loss of polarity and orientation to the basement membrane, pleomorphism) and 14% developed endometrial cancer that include the previous histopathological changes in addition to the hallmark in diagnosis of endometrial cancer, myometrial invasion [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. These results were statistically significant for endometrial hyperplasia and atypia. P-values were 0.038 for both, while for myometrial invasion, it was an insignificant result with a P-value of 0.4. For the middle reproductive age group, in the control group, 43% developed endometrial hyperplasia, and 29% proved to have nuclear atypia. Only 14% had myometrial invasion (endometrial carcinoma). While in the study group, 75% developed endometrial hyperplasia with atypia, and 71% had myometrial invasion. These findings were statistically significant only for Atypia and myometrial invasion; P-values by chi-square test were 0.031 for both of them, while the hyperplasia, although it was higher in the study group, the difference was insignificant P value of 0.094; finally, in the old reproductive age group, 57% of Pgr-\\u003csup\\u003e+/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice had hyperplasia with atypia, while only 14% developed myometrial invasion. But the Pgr-\\u003csup\\u003ecre/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, and Rb1 Loxp/Loxp mice all had hyperplasia with atypia, and 83.33% had myometrial invasion. With insignificant differences for hyperplasia and atypia but significant for myometrial invasion, the P-values were 0.07, 0.07 \\u0026amp; 0.013, respectively (Fig.\\u0026nbsp;2A \\u0026amp; B) (Supplementary Fig.\\u0026nbsp;1). Collectively, we found that the Pgr-cre/+, P53 Loxp/Loxp, and Rb1 Loxp/Loxp mice model proved to develop endometrial hyperplasia with atypia and endometrial carcinoma at an earlier age and higher rates than the wild-type of control (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). In women who had EC, it was reported that the mean age of type II (non-estrogen dependent) endometrial cancer is 66.5 years, while endometrioid endometrial carcinoma developed earlier in life at a mean age of 62 years [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. From our results, the associated Rb1 mutation with P53 mutation led to earlier development and higher incidence of EC in mice.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eIncidence of endometrial Hyperplasia, Atypia, and myometrial invasion in control and study groups, Statistical summary.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"5\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eAge\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c4\\\" namest=\\\"c3\\\"\\u003e \\u003cp\\u003ePercentage (%) of Cases\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eChi-Square\\u003c/p\\u003e \\u003cp\\u003eP-value\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003econtrol\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eP53\\u0026amp;Rb1 knockout\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"2\\\" rowspan=\\\"3\\\"\\u003e \\u003cp\\u003eHyperplasia\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e2\\u0026ndash;4 months\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e60.7\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.038\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e4\\u0026ndash;6 months\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e43\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e75\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.094\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eMore than 6 months\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e57\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.07\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"2\\\" rowspan=\\\"3\\\"\\u003e \\u003cp\\u003eAtypia\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e2\\u0026ndash;4 months\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e57\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.038\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e4\\u0026ndash;6 months\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e29\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e75\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.031\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eMore than 6 months\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e57\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.07\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"2\\\" rowspan=\\\"3\\\"\\u003e \\u003cp\\u003eInvasion\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e2\\u0026ndash;4 months\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e14\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.4\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e4\\u0026ndash;6 months\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e14\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e71\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.031\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eMore than 6 months\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e14\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e83.33\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.013\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"3\\\" rowspan=\\\"4\\\"\\u003e \\u003cp\\u003eTotal\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eControl\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003e\\u003cb\\u003e(N\\u0026thinsp;=\\u0026thinsp;19 cases)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eP53\\u0026amp;Rb1 knockout\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003e\\u003cb\\u003e(N\\u0026thinsp;=\\u0026thinsp;20 cases)\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eHyperplasia\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e7\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e16\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.006\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eAtypia\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e16\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.002\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003eInvasion\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e11\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.003\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2. Endometrial proliferation pattern in the mouse model\\u003c/h2\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e \\u003cp\\u003eWe checked the Ki67 protein present in the active phases of the cell cycle, making it an excellent proliferation marker and often correlated to the clinical course of the disease [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. The expression of Ki67 by IHC was higher in all age groups of Pgr-\\u003csup\\u003ecre/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice model both in the endometrial epithelium and stroma (Fig.\\u0026nbsp;3A). The intensity of stain was calculated by H-Score, In the early and mid-reproductive age groups the endometrial epithelium showed statistically significant results P-value was 0.006 \\u0026amp; 0.02 respectively. While in late reproductive age, although the endometrial epithelium showed a higher H-score, there weren\\u0026rsquo;t statistically substantial results, with a P-Value of 0.13 (Fig.\\u0026nbsp;3B). These results are in concordance with endometrial hyperplasia in H\\u0026amp;E staining insignificant analysis in middle and late reproductive age in the previous section, as during aging, the mice endometrium undergoes epithelial cell proliferation that results in endometrial hyperplasia [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e] that may reflect the hyperplasia insignificant differences in old reproductive age groups.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3. Detection of P21 expression in the mouse model\\u003c/h2\\u003e \\u003cp\\u003eIn the P53-P21-RB signaling cascade, both P53 and Rb1 proteins are essential tumor suppressor proteins; after activation of P53, the expression of P21 is upregulated, which results in RB-E2F complex formation and downregulation of many cell cycle genes and cell cycle arrest [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. In Pgr-\\u003csup\\u003ecre/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice the expression of P21 by IHC is downregulated mainly in the endometrial stroma in comparison to Pgr-\\u003csup\\u003e+/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice (Fig.\\u0026nbsp;4). Usually Ki-67 and P21 expressions are reciprocal, and significant co-expression is not detected [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. The knockout of Rb1 \\u0026amp; P53 in our model led to downregulation of P21 function to arrest the cell cycle, so endometrial proliferation increased, as proved by increased Ki67 overexpression.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4. The Expression of Rb1 in P53 mutant Human Endometrial Carcinoma\\u003c/h2\\u003e \\u003cp\\u003eWomen who are suspected of endometrial malignancy underwent surgical management and uterine samples. After their informed consent, the samples were evaluated under a light microscope by two pathologists (ME, MK). The endometrial carcinoma cases were diagnosed with H\\u0026amp;E stain (Fig.\\u0026nbsp;5). Then, the diagnosed cases were checked for the expression of both P53 and Rb1 proteins by IHC (Fig.\\u0026nbsp;6A \\u0026amp; B). From the results of IHC of all diagnosed cases of endometrial carcinoma, we detected 55.56% wild type (normal), 37.78% had P53 mutation only, and 6.67% had both P53 \\u0026amp;Rb1 mutations (Fig.\\u0026nbsp;6C).\\u003c/p\\u003e \\u003cp\\u003eThe mean age of women diagnosed with endometrial carcinoma in cases who had no mutation (wild type) was 62 years; for cases with only the P53 mutation, 67.2 years, and for cases with both P53 \\u0026amp;Rb1 mutations, the mean age was 64 yrs. According to previous literature, endometrioid and low-grade endometrial carcinoma (Type 1) are developed younger than patients with serous type and high-grade endometrioid carcinoma (Type 2). The mean age is 62.2 and 65.6 years, respectively [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. P53 mutation is mainly associated with serous type and high-grade endometrial cancer (type 2) with consistent association with the poorest clinical outcomes and 50\\u0026ndash;70% endometrial cancer mortality [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. Our results were consistent with the literature, but the double mutation of P53 and Rb1 showed a younger age than the P53 mutation group and older than the wild-type endometrial carcinoma. However, our results weren\\u0026rsquo;t statistically significant, P-value 0.2 (Fig.\\u0026nbsp;6D).\\u003c/p\\u003e \\u003cp\\u003eWe also examined if there is an association between the tumor size and the mutation condition. We detected that the wild-type endometrial carcinoma had the smallest average size, 5.2 cm, then the P53 only mutation endometrial cancer, 6.7 cm, and the largest was the double mutation of P53 \\u0026amp;Rb1 endometrial carcinoma group, 8.4 cm, and this difference wasn\\u0026rsquo;t statistically significant. The P-value was 0.1(Fig.\\u0026nbsp;6E). We compared the depth of myometrial invasion between groups. 40% of the wild-type endometrioid carcinoma cases showed myometrial invasion more than half the thickness. In comparison, the P53 mutation group showed 70.6%. Finally, the double P53 \\u0026amp; Rb1 group showed a 33.33% P-value of 0.2 (Fig.\\u0026nbsp;6F). The incidence of associated adenomyosis and/or endometriosis was higher in the P53 mutation group, 41.2%, than in the wild-type group, 24%. Regarding the double mutation P53 \\u0026amp; Rb1, we found no case with endometriosis and/or adenomyosis (Fig.\\u0026nbsp;6G) with no significant difference p-value of 0.25.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Discussion\",\"content\":\" \\u003cp\\u003eEndometrial cancer is a malignant tumor of the inner layer of the endometrial epithelium. It is the most common female reproductive tract invasive malignancy and the sixth most common malignancy in females[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e] and accounts for 6% of malignancies in women worldwide [\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. Since 1990, the incidence has been rising, particularly in black women, who have an 80% higher mortality rate compared to white women. Data from the Central Cancer Registries, mortality records, and the National Center for Health Statistics in the United States indicate a continued increase in endometrial cancer cases from 2015 to 2019 [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. EC used to be classified as type 1 and type 2, when type 1 endometrial cancer represents most diagnosed cases, around 65\\u0026ndash;70%, and is linked to unopposed estrogen exposure and typically occurs in a younger age (average 62.2 years) than type 2 (average 65.6 years). Type 2 endometrial cancer is not associated with an unopposed estrogen state, and it is more aggressive and has a poorer prognosis [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Many studies reported new molecular classification according to gene mutations. TP53 and POLE mutations have recently been included in the FIGO classification of endometrial cancer [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. P53 mutations were identified in endometrial cancer as a subgroup with the poorest prognosis and the EC type that is most likely to benefit from adjuvant chemo(radio)-therapy [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. RB1, the first identified tumor suppressor gene, plays a significant role in tumor development. Mice deficient in the Rb protein exhibit various hyperplasias and pituitary and thyroid tumors [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. Analysis of data from 12 tumor types revealed RB1 mutations or deletions in breast, colorectal, cervical, ovarian, bladder, and lung cancers [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. In cervical cancer, Rb1 is phosphorylated by E7 produced by human papillomavirus (HPV), resulting in the release of E2F and activation, which induce cell cycle progression [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. The TCGA classification highlights the link between frequent TP53 mutations and focal amplification of genes involved in the Rb1 pathway, such as CCNE1 [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]\\u003c/p\\u003e \\u003cp\\u003eSo, we generated our unique mice model Pgr-\\u003csup\\u003ecre/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice that proved to have increased incidence of endometrial hyperplasia, atypia and myometrial invasion at an earlier age than the control with evidence of increased endometrial proliferation detected by Ki67 IHC and the downregulation of P21 expression by IHC. These findings align with the previous literature describing the role of P21 as a tumor suppressor, which is disrupted in mutant P53 tumors or at low P53 levels, leading to an oncogenic state [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. Typically, Ki-67 and P21 expressions are reciprocal, and significant co-expression is not detected [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. However, the loss of p21 alone is insufficient for tumorigenesis, as P21 Knockout mice do not develop tumors within seven months of age, and its mutation is infrequent in humans [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. In our previous study of Pgr-cre/+, Rb1 Loxp/Loxp mice at late reproductive age (over 6 months), we did not detect malignancy in this conditional knockout model for Rb1[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e], (supplementary Fig.\\u0026nbsp;2). These findings suggest that the combination of Rb1 and TP53 knockouts plays a role in the early onset of endometrial carcinoma and disease progression in mice.\\u003c/p\\u003e \\u003cp\\u003eIn the second step of our study, we examined the expression of P53 and Rb1 in 45 women diagnosed with endometrial cancer. Among them, 25 women (55.56%) had endometrial cancer without abnormal expression of TP53 or Rb1 (wild type), 17 women (37.78%) had TP53 mutations, and three women (6.67%) had both TP53 and Rb1 mutations. We compared the age difference among the three groups. The wild type of EC group had a younger mean age compared to the other two groups with mutations, which aligns with Feinberg et al., 2019, who described the younger mean age of type 1 EC cases than Type 2 [\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. The mean age in cases with P53 mutation is older than cases with both P53 \\u0026amp; Rb1 mutations, 67.2 yrs and 64 yrs, respectively. Our results suggest that endometrial cancer cases with P53 mutations occur at an older age, and the presence of Rb1 mutations reduces the mean age, although it remains higher than in wild type cases. However, these findings are not statistically significant, and we plan to increase the sample size in future studies.\\u003c/p\\u003e \\u003cp\\u003eAdditionally, EC cases with both P53 \\u0026amp; Rb1 had the largest tumor size, the lowest depth of invasion, and no associated adenomyosis and/or endometriosis, which may reflect a better prognosis. For instance, the depth of myometrial invasion is crucial for staging and management planning [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. These results were not statistically significant and could be affirmed by increasing the sample size in future studies.\\u003c/p\\u003e \\u003cp\\u003eThe impact of P53 and Rb1 mutations was first explored by Albitar et al., 2007; who demonstrated how Rb1 and PTEN mutations, or PTEN mutations alone, down-regulate P53 expression and increase resistance to gefitinib in their cell mode [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e], and Serbes et al., 2024 in their large cohort study that described 7% (n\\u0026thinsp;=\\u0026thinsp;7/227) Rb1 mutation in EC cases that have abnormal p53 expression, These cases, confirmed by IHC, exhibited high-grade nuclear atypia and were diagnosed at earlier stages than cases with only P53 mutations, similar to our findings. However, our results are not statistically significant; the percentage of cases was 6.67%, close to their percentage, while the mean age in their study for the combined mutation of Rb1\\u0026amp;P53 was older than the EC with P53 mutation and normal Rb1 cases, 73.17 and 68.75, respectively. Still, it was diagnosed at earlier stages than EC with P53 mutation only. They also identified copy number loss involving the Rb1 locus in most combined mutation cases, explaining the loss of Rb1 locus expression [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. Based on these findings and our results, we believe in the potential use of Rb1 to elaborate on the prognosis of endometrial cancer cases with P53 mutations, pending future studies with larger sample sizes.\\u003c/p\\u003e \"},{\"header\":\"4. Conclusion\",\"content\":\"\\u003cp\\u003e \\u003cdiv class=\\\"BlockQuote\\\"\\u003e\\u003cp\\u003ePgr-\\u003csup\\u003ecre/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice develop endometrial hyperplasia and cancer at a younger age with significant proliferation detected by Ki67 IHC and downregulation of P21 expression. While women had EC, we haven\\u0026rsquo;t statistically significant results regarding the mean age of, no proven mutation, P53 mutation, and the associated P53\\u0026amp;Rb1 mutation cases. We suggest that the double mutation of P53\\u0026amp;Rb1 affects the age of incidence of EC in mice. At the same time, further multicenter studies, including higher sample sizes, are needed to prove or disprove this concept in women.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\"},{\"header\":\"5. Materials and Methods\",\"content\":\"\\u003cp\\u003e The study was conducted at the National Research Center of Egypt, with approval number 01460523, after the approval of the medical research ethics committee, federal-wide assurance 00014747 RHDIRB: 2017103002. This is in accordance with the provisions of the relevant Egyptian laws, the Helsinki Declaration, the World Health Organization (WHO), good medical and laboratory practice guidelines, recommendations, and rules regarding the ethics of scientific research.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e5.1. Mice:\\u003c/h2\\u003e \\u003cp\\u003eTo create the mouse model for this study, Pgr-Cre mice, Rb1-floxed mice, and P53-Floxed mice [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e] Were utilized. Initially, Pgr-cre/+ males were bred with P53-Loxp/Loxp females to produce Pgr-cre/+, P53-Loxp/Loxp offspring. Subsequently, these Pgr-cre/+, P53 Loxp/Loxp males were mated with RB1 Loxp/Loxp females, resulting in the final mouse model: Pgr-cre/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp. The study group consisted of litters from Pgr-cre/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice, while the control group included Pgr-+/+, P53 Loxp/Loxp, Rb1 Loxp/Loxp mice. All mice were housed at the National Research Center Animal Care Facility, adhering to institutional guidelines for laboratory animal use. They were kept at a temperature of 24\\u0026deg;C, with 50% relative humidity, and a 12:12 light-dark cycle, with food and water available. Uteri were collected from the mice according to three age groups based on reproductive age: early reproductive age (2\\u0026ndash;4 months), mid reproductive age (4\\u0026ndash;6 months) and late reproductive age (\\u0026ge;\\u0026thinsp;6 months) [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e] Each group included a minimum of five mice.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e5.2. Human Endometrial Samples\\u003c/h2\\u003e \\u003cp\\u003eThe study involved women who underwent hysterectomy or fractional curettage due to suspected malignant lesions, dysfunctional uterine bleeding, postmenopausal bleeding (with or without increased endometrial thickness), endometrial polyps, endometrial lesions invading the myometrium, myomas, or adenomyosis. Women with malignancies in other tissues, including primary cervical or ovarian tumors, or those with hepatitis C or B viral infections, were excluded. Participants were recruited from the outpatient clinic at the National Research Centre after providing informed consent. The study was structured as a case-control study, comprising 55 cases (10 controls with normal endometrium and 45 in the endometrial cancer group), with groups formed following histopathological confirmation of diagnosis. Pipelle samples were collected at the National Research Center's outpatient clinics, while hysterectomy operations were performed at the Obstetrics and Gynecology Hospital, Cairo University. Endometrial samples, ranging from 3\\u0026ndash;10 mm, were obtained from surgically extracted tissue. Histopathological analyses were conducted at Cairo University and in the private sector. The recruitment of cases spanned one year, from January 2023 to January 2024.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e5.3. Genotyping of mice letters\\u003c/h2\\u003e \\u003cp\\u003eTail samples, measuring 2\\u0026ndash;3 mm, were collected from mice at 3 weeks of age. These samples were incubated overnight at 55\\u0026deg;C in a solution consisting of 189.6 \\u0026micro;l lysis buffer, 10 \\u0026micro;l Actinase E, and 0.4 \\u0026micro;l RNase. Following incubation, 200 \\u0026micro;l of Acid-Phenol-chloroform (pH 4.5, Invitrogen\\u0026trade;) was added, and DNA extraction was carried out according to the manufacturer's instructions. The extracted DNA was then subjected to PCR to amplify the genes of interest (Pgr-cre/+, P53 Loxp/Loxp, and Rb1 Loxp/Loxp), following previously established protocols [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. The primer sequences used for PCR are detailed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. Agarose gel electrophoresis was employed to determine the size of the DNA fragments and to identify the genotype[\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e] The expected band sizes are indicated in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimers for PCR.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGene\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eReverse\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePgr cre\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCre: 5\\u0026rsquo; TATACCGATCTCCCTGGACG 3\\u0026rsquo;PR\\u003c/p\\u003e \\u003cp\\u003eWT: 5\\u0026rsquo; CCCAAAGAGACACCAGGAAG 3\\u0026rsquo;\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5\\u0026rsquo; ATGTTTAGCTGGCCCAAATG 3\\u0026rsquo;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eP53 Loxp\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5'-cAcAAAAAcAGGTTAAAcccA G -3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5'-AGcAcATAGGAGGcAGAGAc \\u0026minus;\\u0026thinsp;3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRb1 Loxp\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e5'-CT AAGAGCTCAGACTCATGG-3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e5'-GGCGTGTGCCATCAATG-3'\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eBand size in Agarose gel electrophoresis for detected genes.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGene\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eWild type (bp)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCre or Loxp (bp)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePgr\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e302\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e522\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eP53\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e288\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e370\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRb1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e650\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e700\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e5.4. Hematoxylin and Eosin staining.\\u003c/h2\\u003e \\u003cp\\u003eFormalin-fixed paraffin-embedded sections (6 \\u0026micro;m) of both human and mouse uterine samples were stained with hematoxylin (Wako) and 1% eosin (Wako) (H\\u0026amp;E) to detect endometrial malignancy [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. The tissue sections were deparaffinized and rehydrated using a series of xylene and ethanol washes. Endometrial carcinoma was identified in both human and mouse samples based on several criteria: increased glandular-to-stromal ratio, loss of intervening stroma, back-to-back glandular architecture, abnormal gland size and shape, and atypical nuclear changes (such as oval or rounded large nuclei, hyperchromatic nuclei, atypical nuclei with prominent nucleoli, numerous apoptotic bodies, vesicular changes, abnormal mitotic figures, loss of polarity and orientation to the basement membrane, and pleomorphism). Additional features included hemorrhage, tumor necrosis, and myometrial invasion, which distinguishes endometrial hyperplasia from endometrial cancer [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. For human samples, Lymph nodes, ovarian tissues, and cervical involvement were investigated for staging [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. The grading of human samples followed the FIGO and World Health Organization criteria: Grade 1 (solid growth\\u0026thinsp;\\u0026lt;\\u0026thinsp;5%), Grade 2 (solid growth 6\\u0026ndash;50%), and Grade 3 (solid growth\\u0026thinsp;\\u0026gt;\\u0026thinsp;50%) [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e5.5. Immunohistochemistry (IHC):\\u003c/h2\\u003e \\u003cp\\u003e\\u003cb\\u003e2.5a. Mice uterine samples\\u003c/b\\u003e: Formalin-fixed paraffin-embedded sections (6 \\u0026micro;m) were subjected to immunohistochemistry [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]. Tissue sections were deparaffinized and rehydrated through a series of xylene and ethanol washes. Heating the slides at 98\\u0026deg;C for 60 minutes in 10 mM citrate buffer (pH 6.0) was performed for antigen retrieval. To block endogenous peroxidase activity, the sections were incubated in 3% H2O2 diluted with methanol for 10 minutes. After blocking with nonspecific staining by blocking reagent (X0909, DAKO), the slides were incubated with the primary antibodies overnight at 4\\u0026deg;C. The primary antibodies against Rb1 (ab181616, Abcam, 1:200) [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e], P53 (IR616, monoclonal DO-7, Dako; 1:200) [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e], MKI67 (A2094, ABclonal; 1:100) [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e], P21 (ab2881097, Proteintech; 1:500) [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. The sections were then incubated with the horse radish peroxidase-polymer secondary antibodies (DAKO Envision\\u0026thinsp;+\\u0026thinsp;System, K4000 and K4002, DAKO) for 60 minutes at room temperature. Staining was detected with 3,3-diaminobenzidine (DAB) using an N-Histofine DAB-3S kit (415192F, Nichirei Biosciences). The sections were counterstained with hematoxylin and evaluated under a light microscope. Rb1 IHC for human uterine samples followed the same protocol. The intensities of MKI67 staining were assessed by a semiquantitative method of H-scoring [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. The staining intensity of each cell in the high-power field was assessed and assigned a score of 0, 1+, 2+, or 3+ (indicating negative, weak, moderate, or strong staining, respectively). The percentage of cells at each intensity level was then calculated. The H-score was determined using the formula: H-score\\u0026thinsp;=\\u0026thinsp;1 \\u0026times; (% cells 1+)\\u0026thinsp;+\\u0026thinsp;2 \\u0026times; (% cells 2+)\\u0026thinsp;+\\u0026thinsp;3 \\u0026times; (% cells 3+). This evaluation was performed across five high-power fields per section.\\u003c/p\\u003e\\u003cp\\u003e\\u003cb\\u003e5.5b. Human uterine samples\\u003c/b\\u003e: Formalin-fixed paraffin-embedded sections (4 \\u0026micro;m) were deparaffinized in EZ prep 75\\u0026deg;C 8 mins. Then, Conditioner #1, Standard Cell Conditioning Solution (CC1, Tris-EDTA based buffer pH 7.8, 950\\u0026thinsp;\\u0026minus;\\u0026thinsp;124), at 95\\u0026deg;C, 44 mins for Cell Conditioning. Blocking endogenous peroxidase activity with Inhibitor CM, 37\\u0026deg;C, 4 mins. No Heat. Application of anti-p53 (DO-7, prediluted 0.5 \\u0026micro;g/ml, Ventana) [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e] for 60 mins. A drop of OmniMap anti-Ms HRP (760\\u0026ndash;4310) was added and incubated for 16 minutes. After that, A drop of DAB CM (ChromoMap DAB kit, 760\\u0026thinsp;\\u0026minus;\\u0026thinsp;159) and One Drop of H2O2 CM were added and incubated for 8 minutes. Then, a drop of Copper CM was applied, and the incubation lasted 5 minutes. The sections were counterstained with Hematoxylin (760\\u0026ndash;2021) and incubated for 8 minutes. After counterstain with Bluing Reagent (760\\u0026ndash;2037) for 8 mins. Slide Cleaning [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. And evaluated under a light microscope by two pathologists (ME, MK). The discordant results were reviewed by consensus at the multiheaded microscope in the presence of a third pathologist. Staining of the nucleus is considered a positive reaction. The staining extent was estimated to be the nearest 10% level of positive tumor cells [\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e].\\u003c/p\\u003e\\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e5.6. Statistical analysis:\\u003c/h2\\u003e \\u003cp\\u003eThe data from mice and humans was collected and summarized; the results were analyzed using the SPSS 21 version. A 2-tailed Student t-test was used to compare the numerical data of two groups, a one-way ANOVA test was used for multiple groups comparison followed by a Tukey multiple comparisons test to compare multiple groups, and a Chi-square (2) test was performed for categorical data. A P-value of less than 0.05 will be considered statistically significant for all tests.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\" \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Taba\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eAbbreviation\\u003c/div\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eExpansion\\u003c/div\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eEC\\u003c/div\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eEndometrial cancer\\u003c/div\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eFIGO\\u003c/div\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eInternational Federation of Gynecology and Obstetrics\\u003c/div\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eP53/TP53\\u003c/div\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eTumor protein P53\\u003c/div\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eRb1\\u003c/div\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eRetinoblastoma protein 1\\u003c/div\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003ePgr\\u003c/div\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eProgesterone Receptor\\u003c/div\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eP21/ CDKN1A\\u003c/div\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eCyclin-dependent kinase inhibitor\\u003c/div\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eKi67\\u003c/div\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eKiel 67\\u003c/div\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003ePOLE\\u003c/div\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eDNA Polymerase Epsilon, Catalytic Subunit\\u003c/div\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003ePTEN\\u003c/div\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003ePhosphatase and tensin homolog\\u003c/div\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eCTNNB1\\u003c/div\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eCatenin Beta 1\\u003c/div\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003ePIK3R1\\u003c/div\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003ePhosphoinositide-3-Kinase Regulatory Subunit 1\\u003c/div\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003ePCR\\u003c/div\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003ePolymerase chain reaction\\u003c/div\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eH\\u0026amp;E\\u003c/div\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eHematoxylin and Eosin\\u003c/div\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eIHC\\u003c/div\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cdiv class=\\\"SimplePara\\\"\\u003eImmunohistochemistry\\u003c/div\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003cbr/\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate:\\u003c/strong\\u003e The study was conducted at the National Research Center of Egypt, with approval number 01460523, after the approval of the medical research ethics committee federal-wide assurance 00014747 RHDIRB: 2017103002. This is in accordance with the provisions of the relevant Egyptian laws, the Helsinki Declaration, the World Health Organization (WHO), good medical and laboratory practice guidelines, recommendations, and rules regarding the ethics of scientific research. And an informed consent was taken from all participant females.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and material:\\u003c/strong\\u003e All data generated or analyzed during this study are included in this published article and its supplementary information files.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication:\\u0026nbsp;\\u003c/strong\\u003eAnd an informed consent was taken from all participant females.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interest:\\u003c/strong\\u003e The authors declare that they do not have any conflict of interest.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding:\\u003c/strong\\u003e self-funded by the authors (we had no grants).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors Contributions:\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eMona Gebril: Study plan, mice care collecting and processing samples, PCR, IHC, examining suspected women in NRC outpatient clinics, paper writing.\\u003c/p\\u003e\\n\\u003cp\\u003eMohammed Elsherbini: IHC of mice samples, paper writing.\\u003c/p\\u003e\\n\\u003cp\\u003eMarwa Fouad Sharaf: Examining and operating suspected women cases with endometrial cancer.\\u003c/p\\u003e\\n\\u003cp\\u003eMohamed Emam Mohamed: Histopathological study of collected samples.\\u003c/p\\u003e\\n\\u003cp\\u003eMohammed El-Kherbetawy: Histopathological study of collected samples.\\u003c/p\\u003e\\n\\u003cp\\u003eEngi Elzemeti: Examining and operating suspected women cases with endometrial cancer.\\u003c/p\\u003e\\n\\u003cp\\u003eMohamed A. Sayed: Histopathological study of collected mice samples.\\u003c/p\\u003e\\n\\u003cp\\u003eAmal Aboelmaaty: histopathological study of collected samples and statistical analysis of the collected data paper writing.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgement:\\u0026nbsp;\\u003c/strong\\u003eWe want to thank Dr. Yasushi Hirota, professor of Obstetrics and Gynecology at the University of Tokyo, Graduate School of Medicine, Tokyo, Japan, for providing us with all three mouse models: PR-cre, P53 loxp/loxp, and Rb1 loxp/loxp mice.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eB. M. R. R. A. S. R. R. L. R. J. K. L. H. Elleson, \\u003cem\\u003eBlaustein\\u0026rsquo;s Pathology of the Female Genital Tract\\u003c/em\\u003e, 7th ed. Cham: Springer International Publishing, 2019. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/978-3-319-46334-6_9\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/978-3-319-46334-6_9\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eV. Makker \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;Endometrial cancer,\\u0026rdquo; Dec. 01, 2021, Nature Research. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41572-021-00324-8\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41572-021-00324-8\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eD. Arciuolo \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;TCGA Molecular Prognostic Groups of Endometrial Carcinoma: Current Knowledge and Future Perspectives,\\u0026rdquo; Int J Mol Sci, vol. 23, no. 19, p. 11684, Oct. 2022, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3390/ijms231911684\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/ijms231911684\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJ. S. Berek \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;FIGO staging of endometrial cancer: 2023,\\u0026rdquo; \\u003cem\\u003eInternational Journal of Gynecology and Obstetrics\\u003c/em\\u003e, vol. 162, no. 2, pp. 383\\u0026ndash;394, Aug. 2023, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/ijgo.14923\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/ijgo.14923\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eK. Engeland, \\u0026ldquo;Cell cycle regulation: p53-p21-RB signaling,\\u0026rdquo; May 01, 2022, Springer Nature. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41418-022-00988-z\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41418-022-00988-z\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. Hafner, M. L. Bulyk, A. Jambhekar, and G. Lahav, \\u0026ldquo;The multiple mechanisms that regulate p53 activity and cell fate,\\u0026rdquo; Apr. 01, 2019, Nature Publishing Group. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41580-019-0110-x\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41580-019-0110-x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. Quintanal-Villalonga \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;CDC7 inhibition impairs neuroendocrine transformation in lung and prostate tumors through MYC degradation,\\u0026rdquo; Signal Transduct Target Ther, vol. 9, no. 1, Dec. 2024, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41392-024-01908-y\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41392-024-01908-y\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eY. Li, S. Yang, Y. Liu, and S. Yang, \\u0026ldquo;Mice with Trp53 and Rb1 deficiency in chondrocytes spontaneously develop chondrosarcoma via overactivation of YAP signaling,\\u0026rdquo; Cell Death Dis, vol. 13, no. 6, Jun. 2022, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41419-022-04916-4\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41419-022-04916-4\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eL. Albitar, M. B. Carter, S. Davies, and K. K. Leslie, \\u0026ldquo;Consequences of the loss of p53, RB1, and PTEN: Relationship to gefitinib resistance in endometrial cancer,\\u0026rdquo; \\u003cem\\u003eGynecol Oncol\\u003c/em\\u003e, vol. 106, no. 1, pp. 94\\u0026ndash;104, Jul. 2007, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.ygyno.2007.03.006\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.ygyno.2007.03.006\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eE. D. Serbes \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;RB Loss in p53 Abnormal Endometrial Carcinoma: Histological and Clinicopathological Correlates.,\\u0026rdquo; Mod Pathol, p. 100660, Nov. 2024, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.modpat.2024.100660\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.modpat.2024.100660\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eM. Gebril \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;Uterine Epithelial Progesterone Receptor Governs Uterine Receptivity through Epithelial Cell Differentiation,\\u0026rdquo; Endocrinology (United States), vol. 161, no. 12, Dec. 2020, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1210/endocr/bqaa195\\u003c/span\\u003e\\u003cspan address=\\\"10.1210/endocr/bqaa195\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eS. Akaeda \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;Retinoblastoma protein promotes uterine epithelial cell cycle arrest and necroptosis for embryo invasion,\\u0026rdquo; EMBO Rep, vol. 22, no. 2, Feb. 2021, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.15252/embr.202050927\\u003c/span\\u003e\\u003cspan address=\\\"10.15252/embr.202050927\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eM. K\\u0026ouml;bel, B. M. Ronnett, N. Singh, R. A. Soslow, C. B. Gilks, and W. G. McCluggage, \\u0026ldquo;Interpretation of P53 Immunohistochemistry in Endometrial Carcinomas: Toward Increased Reproducibility,\\u0026rdquo; \\u003cem\\u003eInternational Journal of Gynecological Pathology\\u003c/em\\u003e, vol. 38, no. Supplement 1, pp. S123\\u0026ndash;S131, Jan. 2019, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1097/PGP.0000000000000488\\u003c/span\\u003e\\u003cspan address=\\\"10.1097/PGP.0000000000000488\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eK. W. Thiel \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;\\u003cem\\u003eTP53\\u003c/em\\u003e Sequencing and p53 Immunohistochemistry Predict Outcomes When Bevacizumab Is Added to Frontline Chemotherapy in Endometrial Cancer: An NRG Oncology/Gynecologic Oncology Group Study,\\u0026rdquo; \\u003cem\\u003eJournal of Clinical Oncology\\u003c/em\\u003e, vol. 40, no. 28, pp. 3289\\u0026ndash;3300, Oct. 2022, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1200/JCO.21.02506\\u003c/span\\u003e\\u003cspan address=\\\"10.1200/JCO.21.02506\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eR. Murali \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;High-grade Endometrial Carcinomas: Morphologic and Immunohistochemical Features, Diagnostic Challenges and Recommendations,\\u0026rdquo; \\u003cem\\u003eInternational Journal of Gynecological Pathology\\u003c/em\\u003e, vol. 38, no. Supplement 1, pp. S40\\u0026ndash;S63, Jan. 2019, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1097/PGP.0000000000000491\\u003c/span\\u003e\\u003cspan address=\\\"10.1097/PGP.0000000000000491\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eM. Gebril, A. Aboelmaaty, O. Al Balah, T. Taha, A. Abbassy, and M. A. H. Elnoury, \\u0026ldquo;Bio-modulated mice epithelial endometrial organoids by low-level laser therapy serves as an invitro model for endometrial regeneration,\\u0026rdquo; \\u003cem\\u003eReprod Biol\\u003c/em\\u003e, vol. 21, no. 4, Dec. 2021, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.repbio.2021.100564\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.repbio.2021.100564\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eP. Bajwa \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;Overactive mTOR signaling leads to endometrial hyperplasia in aged women and mice,\\u0026rdquo; Oncotarget, vol. 8, no. 5, pp. 7265\\u0026ndash;7275, Jan. 2017, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.18632/oncotarget.13919\\u003c/span\\u003e\\u003cspan address=\\\"10.18632/oncotarget.13919\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eS. Uxa, P. Castillo-Binder, R. Kohler, K. Stangner, G. A. M\\u0026uuml;ller, and K. Engeland, \\u0026ldquo;Ki-67 gene expression,\\u0026rdquo; \\u003cem\\u003eCell Death Differ\\u003c/em\\u003e, vol. 28, no. 12, pp. 3357\\u0026ndash;3370, Dec. 2021, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41418-021-00823-x\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41418-021-00823-x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJ. Feinberg \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;Ten-Year Comparison Study of Type 1 and 2 Endometrial Cancers: Risk Factors and Outcomes,\\u0026rdquo; Gynecol Obstet Invest, vol. 84, no. 3, pp. 290\\u0026ndash;297, 2019, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1159/000493132\\u003c/span\\u003e\\u003cspan address=\\\"10.1159/000493132\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. Jamieson, E. F. Thompson, J. Huvila, C. B. Gilks, and J. N. McAlpine, \\u0026ldquo;p53abn Endometrial Cancer: understanding the most aggressive endometrial cancers in the era of molecular classification,\\u0026rdquo; \\u003cem\\u003eInternational Journal of Gynecologic Cancer\\u003c/em\\u003e, vol. 31, no. 6, pp. 907\\u0026ndash;913, Jun. 2021, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1136/ijgc-2020-002256\\u003c/span\\u003e\\u003cspan address=\\\"10.1136/ijgc-2020-002256\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eR. L. Siegel, K. D. Miller, N. S. Wagle, and A. Jemal, \\u0026ldquo;Cancer statistics, 2023,\\u0026rdquo; CA Cancer J Clin, vol. 73, no. 1, pp. 17\\u0026ndash;48, Jan. 2023, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3322/caac.21763\\u003c/span\\u003e\\u003cspan address=\\\"10.3322/caac.21763\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eL. Vermij \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;p53 immunohistochemistry in endometrial cancer: clinical and molecular correlates in the PORTEC-3 trial,\\u0026rdquo; \\u003cem\\u003eModern Pathology\\u003c/em\\u003e, vol. 35, no. 10, pp. 1475\\u0026ndash;1483, Oct. 2022, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41379-022-01102-x\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41379-022-01102-x\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eK. A. Wikenheiser-Brokamp, \\u0026ldquo;Retinoblastoma family proteins: insights gained through genetic manipulation of mice,\\u0026rdquo; \\u003cem\\u003eCellular and Molecular Life Sciences\\u003c/em\\u003e, vol. 63, no. 7\\u0026ndash;8, pp. 767\\u0026ndash;780, Apr. 2006, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00018-005-5487-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00018-005-5487-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eG. Ciriello, M. L. Miller, B. A. Aksoy, Y. Senbabaoglu, N. Schultz, and C. Sander, \\u0026ldquo;Emerging landscape of oncogenic signatures across human cancers,\\u0026rdquo; \\u003cem\\u003eNat Genet\\u003c/em\\u003e, vol. 45, no. 10, pp. 1127\\u0026ndash;1133, Oct. 2013, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/ng.2762\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/ng.2762\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eC. de Martel, M. Plummer, J. Vignat, and S. Franceschi, \\u0026ldquo;Worldwide burden of cancer attributable to HPV by site, country and HPV type,\\u0026rdquo; \\u003cem\\u003eInt J Cancer\\u003c/em\\u003e, vol. 141, no. 4, pp. 664\\u0026ndash;670, Aug. 2017, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/ijc.30716\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/ijc.30716\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eD. A. Levine, \\u0026ldquo;Integrated genomic characterization of endometrial carcinoma,\\u0026rdquo; Nature, vol. 497, no. 7447, pp. 67\\u0026ndash;73, May 2013, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nature12113\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/nature12113\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eC. Deng, P. Zhang, J. Wade Harper, S. J. Elledge, and P. Leder, \\u0026ldquo;Mice Lacking p21CIP1/WAF1 undergo normal development, but are defective in G1 checkpoint control,\\u0026rdquo; \\u003cem\\u003eCell\\u003c/em\\u003e, vol. 82, no. 4, pp. 675\\u0026ndash;684, Aug. 1995, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/0092-8674(95)90039-X\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/0092-8674(95)90039-X\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eC. Lliberos, S. H. Liew, P. Zareie, N. L. La Gruta, A. Mansell, and K. Hutt, \\u0026ldquo;Evaluation of inflammation and follicle depletion during ovarian ageing in mice,\\u0026rdquo; Sci Rep, vol. 11, no. 1, Dec. 2021, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41598-020-79488-4\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41598-020-79488-4\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eM. R. Green and J. Sambrook, \\u0026ldquo;Polymerase chain reaction,\\u0026rdquo; \\u003cem\\u003eCold Spring Harb Protoc\\u003c/em\\u003e, vol. 2019, no. 6, pp. 436\\u0026ndash;456, Jun. 2019, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1101/pdb.top095109\\u003c/span\\u003e\\u003cspan address=\\\"10.1101/pdb.top095109\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. Ouellette, M. Mahendroo, and S. Nallasamy, \\u0026ldquo;Collagen and elastic fiber remodeling in the pregnant mouse myometrium,\\u0026rdquo; \\u003cem\\u003eBiol Reprod\\u003c/em\\u003e, vol. 107, no. 3, pp. 741\\u0026ndash;751, Sep. 2022, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/biolre/ioac102\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/biolre/ioac102\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eM. Matsuo \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;Levonorgestrel Inhibits Embryo Attachment by Eliminating Uterine Induction of Leukemia Inhibitory Factor,\\u0026rdquo; Endocrinology, vol. 161, no. 2, Feb. 2020, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1210/endocr/bqz005\\u003c/span\\u003e\\u003cspan address=\\\"10.1210/endocr/bqz005\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eS. F. Lax, R. J. Kurman, E. S. Pizer, L. Wu, and B. M. Ronnett, \\u0026ldquo;A Binary Architectural Grading System for Uterine Endometrial Endometrioid Carcinoma Has Superior Reproducibility Compared With FIGO Grading and Identifies Subsets of Advance-Stage Tumors With Favorable and Unfavorable Prognosis,\\u0026rdquo; \\u003cem\\u003eAm J Surg Pathol\\u003c/em\\u003e, vol. 24, no. 9, pp. 1201\\u0026ndash;1208, Sep. 2000, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1097/00000478-200009000-00002\\u003c/span\\u003e\\u003cspan address=\\\"10.1097/00000478-200009000-00002\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eT. Hiraoka \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;Differential roles of uterine epithelial and stromal STAT3 coordinate uterine receptivity and embryo attachment,\\u0026rdquo; Sci Rep, vol. 10, no. 1, Dec. 2020, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41598-020-72640-0\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41598-020-72640-0\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eL. F. Sallum \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;WT1, p53 and p16 expression in the diagnosis of low- and high-grade serous ovarian carcinomas and their relation to prognosis,\\u0026rdquo; \\u003cem\\u003eOncotarget\\u003c/em\\u003e, vol. 9, no. 22, pp. 15818\\u0026ndash;15827, Mar. 2018, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.18632/oncotarget.24530\\u003c/span\\u003e\\u003cspan address=\\\"10.18632/oncotarget.24530\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJ. Li, J. Ding, H. Wu, C. Lu, J. Wu, and Q. Luo, \\u0026ldquo;Tat-CIRP Peptide Facilitates Frozen Wound Healing by Ameliorating Inflammation and Promoting Angiogenesis,\\u0026rdquo; \\u003cem\\u003eJ Inflamm Res\\u003c/em\\u003e, vol. Volume 17, pp. 2205\\u0026ndash;2215, Apr. 2024, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.2147/JIR.S450288\\u003c/span\\u003e\\u003cspan address=\\\"10.2147/JIR.S450288\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. Takahashi \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;Downregulation of cytoplasmic DNases is implicated in cytoplasmic DNA accumulation and SASP in senescent cells,\\u0026rdquo; Nat Commun, vol. 9, no. 1, p. 1249, Mar. 2018, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41467-018-03555-8\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41467-018-03555-8\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eR. Roman, M. Molina-Vila, E. Aldeguer, and S. Rodriguez, \\u0026ldquo;Immunohistochemistry with Ventana,\\u0026rdquo; Protoc Exch, 2019, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/protex.2019.023\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/protex.2019.023\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eA. Yemelyanova \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026ldquo;Immunohistochemical staining patterns of p53 can serve as a surrogate marker for TP53 mutations in ovarian carcinoma: an immunohistochemical and nucleotide sequencing analysis,\\u0026rdquo; \\u003cem\\u003eModern Pathology\\u003c/em\\u003e, vol. 24, no. 9, pp. 1248\\u0026ndash;1253, Sep. 2011, doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/modpathol.2011.85\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/modpathol.2011.85\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Endometrial Neoplasm, P53 gene mutations, Rb1 gene mutations.\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6091807/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6091807/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eEndometrial cancer (EC) is the most prevalent invasive malignancy in females and accounts for 6% of malignancies in women worldwide, with reported continued increasing incidence. Recently, many studies proved many mutations in EC and added four main types in the molecular classification of EC. FIGO classification of EC in 2023 was modified to change the staging according to P53 \\u0026amp; POLE mutations. Since P53 \\u0026amp; Rb1 are known cell cycle repressors, we generated our unique mouse model with P53 \\u0026amp; Rb1 deletion (Pgr-\\u003csup\\u003ecre/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e) to study their role in the incidence and onset of EC development. Pgr-\\u003csup\\u003ecre/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice were generated by crossing Pgr-\\u003csup\\u003ecre/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e male and Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e female mice; the incidence, onset, and characteristics of EC were studied histologically and by IHC. We also studied the expression of P53 and Rb1 over a year in women diagnosed with EC after their informed consent to explore a concomitant expression. We found that Pgr-\\u003csup\\u003ecre/+\\u003c/sup\\u003e, P53 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e, Rb1 \\u003csup\\u003eLoxp/Loxp\\u003c/sup\\u003e mice develop endometrial hyperplasia and cancer at a younger age with significant proliferation detected by Ki67 IHC and downregulation of P21 expression. While women had EC, we haven\\u0026rsquo;t statistically significant results regarding the mean age of, no proven mutation, P53 mutation, and the associated P53\\u0026amp;Rb1 mutation cases. We suggest that the double mutation of P53\\u0026amp;Rb1 affects the age of incidence of EC in mice. At the same time, further multicenter studies, including higher sample sizes, are needed to prove or disprove this concept in women.\\u003c/p\\u003e\",\"manuscriptTitle\":\"The association of P53 and Rb1 mutation in endometrial cancer development\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-04-17 08:40:13\",\"doi\":\"10.21203/rs.3.rs-6091807/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"f1f25876-cea9-43e8-a9d6-c5c50d913e97\",\"owner\":[],\"postedDate\":\"April 17th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-06-28T16:38:16+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-04-17 08:40:13\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6091807\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6091807\",\"identity\":\"rs-6091807\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}