{"paper_id":"2d2bea01-1f48-4b7f-a19e-c71c676af4bb","body_text":"Dual activity of Minnelide chemosensitize basal/triple negative breast cancer stem cells and reprograms immunosuppressive tumor microenvironment | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Dual activity of Minnelide chemosensitize basal/triple negative breast cancer stem cells and reprograms immunosuppressive tumor microenvironment Hasan Korkaya, Fulya Koksalar Alkan, Ahmet Caglayan, Hilmi Alkan, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3959342/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Triple negative breast cancer (TNBC) subtype is characterized with higher EMT/stemness properties and immune suppressive tumor microenvironment (TME). Women with advanced TNBC exhibit aggressive disease and have limited treatment options. Although immune suppressive TME is implicated in driving aggressive properties of basal/TNBC subtype and therapy resistance, effectively targeting it remains a challenge. Minnelide, a prodrug of triptolide currently being tested in clinical trials, has shown anti-tumorigenic activity in multiple malignancies via targeting super enhancers, Myc and anti-apoptotic pathways such as HSP70. Distinct super-enhancer landscape drives cancer stem cells (CSC) in TNBC subtype while inducing immune suppressive TME. We show that Minnelide selectively targets CSCs in human and murine TNBC cell lines compared to cell lines of luminal subtype by targeting Myc and HSP70. Minnelide in combination with cyclophosphamide significantly reduces the tumor growth and eliminates metastasis by reprogramming the tumor microenvironment and enhancing cytotoxic T cell infiltration in 4T1 tumor-bearing mice. Resection of residual tumors following the combination treatment leads to complete eradication of disseminated tumor cells as all mice are free of local and distant recurrences. All control mice showed recurrences within 3 weeks of post-resection while single Minnelide treatment delayed recurrence and one mouse was free of tumor. We provide evidence that Minnelide targets tumor intrinsic pathways and reprograms the immune suppressive microenvironment. Our studies also suggest that Minnelide in combination with cyclophosphamide may lead to durable responses in patients with basal/TNBC subtype warranting its clinical investigation. Health sciences/Diseases/Cancer/Breast cancer Biological sciences/Cancer/Cancer microenvironment Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Among American women, breast cancer is the most common malignancy, after skin cancer. Metastatic breast cancer is the leading cause of cancer-related death among women. Women with the basal/TNBC subtype constitute 15–20% of breast cancer patients and are often diagnosed with aggressive/metastatic disease 1 . Basal/TNBC tumors exhibit an epithelial mesenchymal transition (EMT) phenotype and cancer stem cell (CSC) properties 2 , which contribute to metastasis and treatment resistance 3 – 5 . In addition, the immunosuppressive tumor microenvironment (TME) in TNBC has been implicated in the failure to respond to conventional and targeted therapies 6 . Thus, an improved understanding of the mechanism by which immunosuppressive TME contributes to therapy resistance will lead to the development of alternative therapeutics. Minnelide, a prodrug of triptolide, has shown anti-tumorigenic activities in multiple malignancies by targeting super-enhancers (SE) and anti-apoptotic pathways, such as heat shock protein 70 (HSP70) signaling 7 8 . This small-molecule inhibitor covalently bound to the XPB subunit of transcription factor II H (TFIIH) super-enhancer complex regulates many targets, including c-Myc 9 . Genomics studies have revealed a distinct SE landscape in basal/TNBC compared with other subtypes of breast cancer 10 . Consistent with this notion, transcriptional SEs have been implicated in cancer stemness programs for number of malignancies, including breast cancer 11 . Minnelide targets CD133 + tumor initiating cells in syngeneic models of pancreatic ductal adenocarcinoma 12 . Other modes of anti-tumorigenic activities of Minnelide include targeting HSP70 signaling has been shown to be a major target in multiple malignancies 13 . We previously reported that the TNFAIP3(A20)/HSP70 signaling axis is selectively upregulated in TNBCs in response to cytotoxic agents 14 suggesting the therapeutic utility of Minnelide for this subtype. However, the antitumorigenic activity of triptolide has also been reported in luminal breast cancer subtype via different mechanisms, such as downregulation of ERα signaling and lysosome-mediated cell death 15 . In addition to their tumor intrinsic role, epigenetic regulators are implicated in the reprogramming of stromal/immune cells within the tumor microenvironment 16 and several inhibitors of epigenetic modifying enzymes are being tested in preclinical and early phase clinical trials to improve the efficacy of immune checkpoint inhibitors (ICI) in solid tumors 17 . Super-enhancers have been shown to drive immune evasion by controlling the expression of genes such as PD-L1/PD-L2 and TGFβ which are critical players in immune suppression 18 . Consistent with this notion, triptolide effectively suppressed IFN-γ-driven PD-L1 expression in breast cancer cell lines 19 . Minnelide in combination with low-dose gemcitabine and paclitaxel exhibited enhanced therapeutic activity by reducing stromal collagen content in pancreatic cancer 20 . Furthermore, embryonic reprogramming transcription factors such as Oct4 and Sox2 induce a bromodomain (BRD)-dependent immunosuppressive microenvironment in glioblastoma stem-like cells 21 . Overall, studies thus far suggest a wide range of anti-tumorigenic activities of Minnelide in preclinical studies of multiple malignancies 22 . Given its promising preclinical activity 23 , Minnelide is now currently being evaluated in Phase II clinical trials (NCT04896073) in patients with advanced refractory pancreatic carcinoma 24 . At least 16 weeks of stable disease as an endpoint was intended as per the response evaluation criteria in solid tumors (RESIST). Scientific exploratory end points include evaluation of Myc expression and accessibility of loci for Myc gene in pre- and post-treatment tumors and profiling of circulating immune cell populations in patients’ blood 24 . We therefore reasoned that Minnelide may exhibit dual activity by targeting tumor intrinsic pathways and reprogramming the immune microenvironment in the TNBC subtype, which is characterized by an immunosuppressive TME 6 . Our studies provide evidence that Minnelide targets CSCs by inhibiting multiple tumor intrinsic signaling pathways such as A20/HSP70, Myc, Vimentin and BRD4, which have been widely implicated in driving aggressive properties of the TNBC subtype. Minnelide sensitizes tumors to cyclophosphamide (CTX) in syngeneic mice, eradicating disseminated tumor cells following resection of residual tumors. This may be due to the reprogramming of the tumor microenvironment, which leads to enhanced cytotoxic T cell infiltration and improved overall outcomes. Materials and Methods Cell lines and reagents 4T1, AT-3, E0771, EMT6, J774A.1, Raw264.7, MCF7, MDA-MB-231, Sum-159 and ZR-75-1cell lines were purchased from American Type Culture Collection (ATCC). All cell lines were tested for mycoplasma contamination by PCR analyses using a Universal Mycoplasma Detection Kit (30-1012K ™ , ATCC). The 4T1 cell line is infected with luciferase-expressing lentivirus, and stable cell lines were generated to monitor tumor growth in live animals and tissues. 4T1, 4T1-Luc, EMT6, MCF-7 and ZR-75-1 cell lines were maintained in RPMI1640 supplemented with 10% fetal bovine serum, and antibiotic/antimycotic 10,000U/ml. E0771 cell line was maintained in DMEM supplemented with 10% fetal bovine serum, and antibiotic/antimycotic 10,000U/ml. The MDA-MB-231 cell line was maintained in DMEM supplemented with 5% fetal bovine serum, and antibiotic/antimycotic 10,000U/ml. Sum-159 cells were maintained in Ham’s F12 supplemented with 5% fetal bovine serum, 5mg/ml insulin, 1mg/ml hydrocortisone, and antibiotic/antimycotic 10,000U/ml). Raw264.7 cell line was maintained in DMEM supplemented with 10% fetal bovine serum. Minnelide (HY-124584, MCE) was resuspended in DMSO for in vitro assays and 10% DMSO in 90% (20% SBE-β-CD (HY-17031, MCE)) in saline to obtain a clear solution, as described by the manufacturer. Vehicle controls were used at corresponding concentrations for each experiment. Cyclophosphamide (CTX) was resuspended in saline. Recombinant mouse IL-4 (404-ML/CF, R&D Systems) and recombinant human TGF-beta1 (240-B-010/CF, R&D Systems) were used at the indicated concentrations. LPS was purchased from Sigma-Aldrich and resuspended in cell culture medium to induce macrophage differentiation. In vitro studies A cell proliferation assay from Promega (G3580) was used to assess the cytotoxicity and proliferation of cells in the presence of Minnelide. Briefly, 1,000 cells were seeded in a 96-well plate and treated with increased doses of Minnelide the next day. A set of wells were maintained with medium only for background subtraction. 20µl of MTS solution were added to each well and incubated for 2 h at 37°C and the absorbance was recorded at 490nm. Experiment was repeated 2 independent times in triplicates. Flow cytometry was performed using Annexin V Binding buffer (422201, BioLegend). Briefly, cells were treated with Minnelide for 48 h. After collecting the cells, 100,000 cells were resuspended in Annexin V Binding buffer and stained with fluorochrome conjugated Annexin V antibody (640920, 640945, BioLegend) and 7-AAD (420404, BioLegend) or DAPI (564907, BD Biosciences). Murine mammary cancer stem cells were analyzed by flow cytometry using CD24(138504 BioLegend, 1:100), CD29 (102216, BioLegend, 1:100). The samples were analyzed using a NovoCyte Quanteon Flow Cytometer CyTEK Northern Lights Full Spectrum cytometer. Experiments were repeated 3 independent times. Immune profiling assays of monocyte and macrophage cell lines were performed using fluorescent conjugated antibodies CD11b (101243, BioLegend 1:250), CD11c (117353, BioLegend, 1:250), Ly6C (128018, BioLegend, 1:250), Ly6G (127624, BioLegend, 1:250), CD86 (105011, BioLegend, 1:250). The viability dye Zombie Aqua (423102, BioLegend, 1:500) were chosen according to antibody/fluorochrome compatibility of panel. The samples were analyzed using a NovoCyte Quanteon Flow Cytometer CyTEK Northern Lights Full Spectrum cytometer. Protein modeling, preparation, and receptor grid generation The NBD domain of Hsc70 pertaining to Bos taurus (PDB ID: 3HSC) containing ADP nucleotide was present in the protein database (PDB), yet the structure of the whole protein was not available. The amino acid similarity between the NBD domains of Bos taurus Hsc70 and human Hsp70 proteins was 88.542%. Therefore, the full structure of the human Hsp70 was modeled using the crystal structure of the bacterial Hsp70, DnaK (PDB ID:2KHO) and NBD of Hsc70 belonging to Bos taurus using Swiss-Models program. The Protein preparation module in Maestro molecular modeling package (Maestro, 2018) was used for protein preparation. Crystal structure of human HSP70 complexed with VER-155008 was downloaded from protein data bank (PDB ID: 4IO8) and aligned with the modeled HSP70 3D structure. The co-crystallized ligand (VER-155008) is merged to the HSP70 and ligand-bound model protein structure is saved. The PROPKA 25 (pH, 7) and OPLS3 force field 26 were used for protonation states, structural optimization and minimization, respectively. Furthermore, receptor grid generation in Glide 3 was used to generate the grid boxes at the active site of merged ligand. Ligand preparation LigPrep module (Ligprep, 2018) of Maestro molecular modeling with the OPLS3 forcefield 26 was used for preparation of ligands. Epik 27 module in Ligprep was used to assign potential ionization states at pH 7. 3D geometry optimization and energy minimization were performed to generate the 3D structures of the ligands. OPLS3 forcefield 2 was used for energy minimization, by choosing standard energy function and RMSD cut off of 0.01 Å for the generation of low energy conformations. Mouse tumor implantation All animal procedures were performed in accordance with the Institutional Animal Care and Use Committee (IACUC) at Augusta University (AU). The animal protocol for the procedures conducted in this study was approved by the Laboratory of Animal Services (LAS) at AU. All mice were housed at room temperature with 50–70% humidity, and 12/12 hour light/dark cycle. Animals were housed as maximum as 5 mice per cage during the experiments. BALB/c female mice (5 weeks old) were purchased from The Jackson Laboratory. A total of 50,000 4T1-Luc cells were implanted into the 4th mammary fat pads of mice in a 50/50% media/Matrigel (Corning) mixture. For the in vivo studies, mice were treated with Minnelide (0.5mg/kg, daily, i.p.) and/or cyclophosphamide (Sigma Aldrich) (150mg/kg, weekly, i.p.). For the survival experiments, tumors were resected by the third week of 4T1-Luc mammary fat pat injection. Animals were followed up for primary tumor and/or metastatic growth by weekly bioluminescence imaging using AMI (Spectral Instruments Imaging), and images were analyzed using Aura software. Total number of 32 mice were used. 5 mice were used for control group and treated with vehicle. 5 mice were used for CTX and Minnelide groups. 6 mice were used for CTX and Minnelide combinational treatment group. For the resection experiments, 3 mice in control, 4 mice in Minnelide and 4 mice in CTX and Minnelide combination group were used. Minnelide treatment started on day 3 and CTX treatment started on day 7 after 4T1-Luc mammary fat pad injection. PBMCs from tail vein during the tumor growth and resected tumor and organs at the endpoint of each experiment were tested for immune cell markers as described in Flow Cytometry methods. Flow Cytometry For immune profiling, single-cell suspensions were prepared from blood, spleen, lungs, and tumors. Lung and tumor tissues were dissociated and digested with collagenase/hyaluronidase (07912, STEMCELL Technologies, USA). The spleens were smashed on a cell strainer with a syringe plunger. For blood and each organ, red blood cells were lysed using 1X RBC Lysis Buffer (10X, 420302, BioLegend). Single cell suspensions has been maintained in 2% FBS-in PBS until staining. Flow cytometry based immune profiling of MDSCs and T cells was performed using fluorescent conjugated antibodies against CD45 (103155, BioLegend, 1:250) CD11b (101243, BioLegend 1:250), CD11c (117330, BioLegend, 1:250), Ly6C (128018, BioLegend, 1:250), Ly6G (127624, BioLegend, 1:250) and CD86 (105011, BioLegend, 1:250). The viability dyes Zombie Aqua (423102, Biolegend, 1:500) and Zombie Violet(423114, Biolegend, 1:500) were chosen according to the panels for each immune profiling assays. Samples were analyzed using a NovoCyte Quanteon Flow Cytometer and a CyTEK Northern Lights Full Spectrum Cytometer. Data analysis was performed using FlowJo v.10. RT-PCR and Western Blot analysis Total RNA was extracted using the RNeasy Mini Kit (74536, Qiagen) and 500ng of RNA was used to make cDNA using the iScript cDNA Synthesis Kit (1708891, BioRad). For RT-PCR analysis, gene-specific primers ordered from KiCqStart SYBR Green Primers (Millipore Sigma) were used. Cebpd (F—5’-ATCACTTAAAGATGTTCCTGC − 3’, R—5’- TGTCTTCACTTTAATGCTCG − 3’), Ifnar1 (F—5’- CTAAGATAAGCATGGAGAAGG-3’, R—5’- AATCCAGATCGTGGAAAAAC-3’), Il1b (F—5’-GGATGATGATGATAACCTGC-3’, R—5’-CATGGAGAATATCACTTGTTGG-3’), Il4 (F—5’-CTGGATTCATCGATAAGCTG − 3’, R—5’- TTTGCATGATGCTCTTTAGG − 3’), Il6 (F—5’-AAGAAATGATGGATGCTACC-3’, R—5’-GAGTTTCTGTATCTCTCTGAAG-3), Il10 (F—5’-CAGGACTTTAAGGGTTACTTG − 3’, R—5’-ATTTTCACAGGGGAGAAATC − 3) and Tlr4 (F—5’-GATCAGAAACTCAGCAAAGTC − 3’, R—5’-TGTTTCAATTTCACACCTGG − 3’). Relative gene expression at the mRNA level was normalized against the internal control ACTB (F—5′-GATGTATGAAGGCTTTGGTC-3′, R—5′-TGTGCACTTTTATTGGTCTC-3′) gene (ΔCt = Ct (target gene) − Ct (internal control gene)). Relative fold change was measured using the 2 −ΔΔCt formula and compared with the control cells. Means and differences with 95% confidence intervals were obtained using GraphPad Prism 10 (GraphPad Software Inc.). Two-tailed Student’s t test was used for unpaired analysis to compare the average expression between conditions. Statistical significance was set at p < 0.05 were For Western Blot analysis, cells were lysed in Pierce RIPA Buffer (89901, 78440 Thermo Scientific). 20µg of each protein in 4X Laemmli Sample Buffer (1610747, Bio-Rad) was boiled at 95°C for 5 min and subjected to SDS-PAGE. Proteins were transferred to a polyvinylidene fluoride (PVDF) membrane (1620177, Bio-Rad) using a semi-dry Trans-Blot (Bio-Rad). Blots were first incubated in TBS blocking buffer containing 2% non-fat dry milk or 2% BSA (for phosphor-specific antibodies) for 1 h at room temperature and then incubated with the respective primary antibodies diluted in TBS-T (containing 0.1% Tween20 and 2% BSA) overnight at 4°C in the dark. Blots were washed and incubated with appropriate secondary antibodies in TBS-T and detected using Clarity Western ECL Substrate (1705061, Bio-Rad). Antibodies against cMyc (ab32072, Abcam), vimentin (5741, Cell Signaling Technology), A20/TNFAIP3 (NBP1-77533, Novus), HSP70/72(ADI-SPA-810-F, Enzo Life Sciences), Brd4 (ab128874, Abcam), and ß-actin (664803, BioLegend). All antibodies were used at 1:1000 dilution. Uncropped scans of the blots are provided in supplementary figures. Statistical Analysis. The statistical analysis applied to each graph is indicated in the figure legends. Briefly, Unpaired two-tailed t-tests were applied to determine the significance between two treatment groups, and one-way analyses variance (ANOVA) was used for variance analysis between the control and every other group. In vitro experiments were repeated in three different time points and were indicated with the mean ± SD. For survival percentiles, the data were submitted to Kaplan-Meier curve tests and differences between two groups were submitted to the log-rank test. All statistical analyses were performed using GraphPad Prism (version 10). Results Minnelide suppresses cell proliferation in human and murine TNBC cell lines in a dose dependent manner We first assessed the effect of Minnelide on cell viability in multiple human and murine breast cancer cell lines representing TNBC or the luminal subtype. We treated human breast cancer cell lines MDA-MB231, Sum159, MCF7 and ZR-75-1) and murine breast cancer cell lines (4T1, AT3, EMT6 and E00771) with increasing doses of Minnelide ranging from 25nM to 1µM for 48 h and assessed cell viability using the CellTiter 96 Aqueous One Solution. Although Minnelide significantly reduced cell viability in all breast cancer cell lines in vitro (Fig. 1 A-D), TNBC cell lines exhibited a dose-dependent reduction in viability upon treatment with increasing doses of Minnelide (Fig. 1 A and C) with the exception that the 4T1 cell line required relatively higher doses of the drug (Fig. 1 C, left panel). In contrast, luminal breast cancer cell lines appeared to show a non-specific toxicity in response to treatment (Fig. 1 B and D). Brightfield images of the cell lines at the time of the viability assay support the dose-dependent activity of Minnelide on TNBC and non-TNBC cell lines (Supplementary Fig. S1 A-D). Minnelide specifically targets CSC population in TNBC cell lines by inducing apoptotic cell death Given the distinct super-enhancer landscape in the human TNBC subtype 10 as well as its role in reprogramming of the CSC phenotype 28 , we investigated whether Minnelide can specifically target the CSC population. MDA-MB231, SUM159 and MCF7 cell lines were treated with increasing doses of Minnelide for 48 h and subjected to flow cytometry analyses to evaluate apoptotic cell death. Minnelide treatment induced significant apoptotic cell death in all the three cell lines (Fig. 2 A-C). Next, we examined the CSC population assessed suing the CD44 + CD24 − phenotype 29 in these cell lines after 72 h treatment with the indicated doses of Minnelide. There was a dose-dependent and significant reduction in the CSC population in both TNBC cell lines, MDA-MB231 and Sum159 (Fig. 2 D and E). In contrast, the CSC population was unexpectedly increased in the luminal MCF7 cell line despite significant apoptotic cell death (Fig. 1 F). We further evaluated the activity of Minnelide in murine breast cancer cell lines, 4T1 and EMT6. The murine 4T1 tumor model is a well-characterized representative of the human TNBC subtype 30 , which constitutes a high CSC population and exhibit aggressive/metastatic properties compared with the less invasive EMT6 tumor model 31 32 . As expected, Minnelide induced a dose-dependent induction of apoptotic cell death and concomitant reduction of the CSC population defined by CD24 + CD29 + phenotype in 4T1 tumor cells after 48- and 72-hours treatment respectively (Fig. 3 A and B). However, Minnelide induced nonspecific toxicity in EMT6 tumor cells as there was massive cell death at 75nM and higher doses while there was no activity with lower doses of the drug (Fig. 3 C). Moreover, the CSC population in EMT6 cells was not significantly changed upon Minnelide treatment despite significant cell death (Fig. 3 D). Together our in vitro data provide evidence of the specificity of Minnelide for the basal-like/TNBC subtype. Minnelide targets HSP70 and Myc pathways in basal/TNBC subtype The broad anti-tumorigenic activity of Minnelide has been attributed to its ability to target multiple signaling pathways 22 . Although it was shown to target XBP subunit of the transcription factor II H (TFIIH)-BRD4 super-enhancer complex, specific protein-ligand complex was not shown for HSP70 binding. We performed a molecular docking algorithm by using the Glide/XP program and determined the specific binding site of Minnelide on HSP70 (Supplemental Fig. S2). We previously reported that the A20/HSP70 signaling pathway is specifically activated in TNBCs 14 . Myc expression was determined to be the main target for clinical evaluation in currently ongoing Phase II trial 24 . Therefore, we examined the activity of Minnelide in targeting A20/HSP70 and Vimentin in MDA-MB231, 4T1, and EMT6 cell lines. TGFβ is a well-established factor for driving EMT and CSC phenotypes 33 and is highly expressed by the immunosuppressive myeloid cell population 34 . Minnelide suppressed TGFβ-induced HSP70 and A20 expression, in addition to inhibiting the expression of the mesenchymal marker, vimentin (Fig. 4 A and B). Next, we evaluated the effect of Minnelide on Myc and Brd4 expression. The latter is required for Myc expression 35 . Although they were not responsive to TGFβ stimulation in either cell line, Minnelide effectively inhibited Myc and Brd4 expression (Fig. 4 A and B). In contrast, the EMT6 cell line was poorly responsive to TGFβ stimulation, and neither the expression levels of the indicated proteins were significantly changed or had notable Minnelide effect (Fig. 4 C). Interestingly, Myc was inhibited at higher doses in EMT6 cells (Fig. 4 C). Our study suggests that Myc is one of the main targets of Minnelide. Unprocessed raw data for each western blot analysis are provided in Supplementary Fig. S3A-C. Myc expression is higher in basal-like/ER-negative breast tumors and predict poor overall survival Myc is one of the most frequently activated oncogenes and central drivers in multiple cancers, including breast cancer 36 . Although Myc alterations include frequent amplification, overexpression and rare mutations, it has been shown that high mRNA expression, not amplification, predicts poor overall survival in patients with breast cancer 37 . Furthermore, a renewed interest in targeting Myc with new-generation inhibitors is under preclinical development 38 39 as well as in phase I clinical trials 40 . Using TCGA data set, we showed that Myc alterations were substantially higher in basal-like (59%) and ER-negative (48%) than in ER-positive (20%) breast cancers (Fig. 4 D). As expected, elevated Myc mRNA expression predicted poorer overall survival in women with basal-like/ER-negative breast cancer (Fig. 4 E and F). However, this was not predictive in patients with ER-positive tumors (Fig. 4 G). Altogether these data confirmed the significance of Myc protein in basal-like/ER-negative tumors. Minnelide in combination with cyclophosphamide suppress tumor growth and eliminate metastasis by targeting CSCs and enhancing cytotoxic T cell infiltration The murine 4T1 tumor model is a well-established TNBC subtype that generates spontaneous metastasis in the lungs and other tissues by inducing an immunosuppressive pre-metastatic niche 30 41 . To evaluate the in vivo activity of Minnelide, we treated 4T1 tumor-bearing mice with Minnelide (0.5mg/kg daily), or CTX (150mg/kg weekly), or a combination of both drugs for 5 week. Although Minnelide alone had a modest activity in reducing tumor growth in 4T1 tumor-bearing mice, when combined with CTX, it significantly reduced tumor growth, compared to the single Minnelide or CTX treatments (Fig. 5 A). As expected, reduced tumor growth was concordant with reduced spleen size in the respective animals (Fig. 5 B). Next, we determined the impact of the combination therapy on spontaneous metastasis in the treated mice. Although single Minnelide or CTX modestly reduced spontaneous metastasis, combination of the two eliminated metastasis in the lungs and spleens as ex-vivo images by bioluminescence showed no signals (Fig. 5 C and D). When analyzing residual tumors, we found that the CSC population was significantly reduced by the combination of Minnelide and CTX (Fig. 5 E), suggesting it’s in vivo activity on tumor cells. We previously reported that cytotoxic T cells (CTL) were characterized by CD8 + Ly6C + phenotype in BALB/c mice 31 and; therefore, we analyzed immune cells in residual tumors and spleens from treated mice. There was significantly higher CTL infiltration in residual tumors and spleens that were treated with a combination of Minnelide and CTX (Fig. 5 F and G). The granulocytic subset of myeloid derived suppressor cell (gMDSC) population, defined by the CD11b + Ly6C int phenotype, was also reduced in mice treated with combination therapy (Fig. 5 H). Neoadjuvant combination therapy with Minnelide plus cyclophosphamide eliminates residual 4T1 tumors in syngeneic mice Our lab previously demonstrated in a 4T1 tumor model that mice show local and distant recurrences following the resection of primary tumors 31 41 . Consistent with our data (Fig. 5 A and B), it has been widely reported that standard of care chemotherapeutics, including CTX, show modest activity in eliminating disseminated 4T1 tumor cells 42 . Therefore, we investigated the therapeutic potential of Minnelide plus CTX in a neoadjuvant setting to target disseminated 4T1 tumor cells. We treated 4T1 tumor-bearing mice with Minnelide (0.5mg/kg/daily) alone or in combination with CTX for 2 weeks in neoadjuvant setting before resecting the residual tumors, and then continued the treatment for another 3 weeks. Control mice developed local and distant recurrences within three weeks post-resection and were sacrificed (Fig. 6 A). Minnelide alone modestly reduced relapse after surgery, and one mouse completely cleared residual tumors (Fig. 6 B). In contrast, the combination of Minnelide and CTX therapy eliminated residual tumors in all mice that were free of local and distant recurrences for up to 6 months (Fig. 6 C). We next evaluated circulating MDSCs in control and treated mice one-week after resection. Peripheral blood mononuclear cells (PBMCs) from mice treated with Minnelide plus cyclophosphamide contained substantially lower levels of monocytic and granulocytic MDSCs than those from Minnelide treated or control mice (Fig. 6 D-F). Minnelide induces a distinct polarization of monocytes towards CD11c + CD86 + phenotype To further examine the effect of Minnelide on myeloid cell population, we utilized monocyte/macrophage cell line, RAW264.7 (called RAW4 hereafter) which is widely used to induce macrophage polarization in response to various factors including IL-4, IL-13 and LPS 43 44 . RAW4 cells, under normal culture conditions, are mainly CD11b positive (> 95%) and roughly half of these (54%) express both CD11b and CD11c surface markers (CD11b + CD11c + ), while small fraction of cells (~ 1%) are characterized by single CD11c + phenotype (Fig. 7 A). As previously reported, IL-4 effectively polarize these populations towards single Cd11b + phenotype (~ 87%) reducing the CD11b + CD11c + phenotype from 54.1–7.84% whereas LPS increased the CD11b + CD11c + population from 54.1–69.2% (Fig. 7 A blue boxes). Consistent with the literature, IL-4 enriched CD11b + Ly6G + subset which were effectively depleted by Minnelide (Supplementary Fig. 4A and B). In addition, Minnelide treatment not only effectively polarized the RAW4 cells towards single CD11c + phenotype (37.2%) compared to the control (1.05%), but it also reversed the effect of IL-4 or LPS treatment increasing the CD11c + subset from 0.27–17.7% and 1.15–6.54% respectively (Fig. 7 A red boxes and B). TCGA data analyses showed that higher CD11c (ITGAX) expression predicted better survival among patients with breast cancer (Supplementary Fig. S5). Because the CD86 surface marker is upregulated during dendritic cell maturation and type I macrophage polarization 45 46 , we examined whether Minnelide could expand this CD86 + subset in RAW4 cells. Although CD11b + CD86 + population was reduced (data not shown), there was a substantial expansion of the CD11c + CD86 + subset (from 33.7–63.5%) upon Minnelide treatment compared to that in the control (Fig. 7 C red boxes and D). As expected, IL-4 treatment significantly reduced this CD11c + CD86 + subset to 6.79% from 33.7% in the control whereas LPS had no effect (Fig. 7 C red boxes and D). When treated in combination, Minnelide reversed the effect of IL-4 on the CD11c + CD86 + s phenotype increasing it to 62.8% from 6.79% in the single IL-4 treatment (Fig. 7 C red boxes and D). Furthermore, Minnelide was able to reverse IL-4 or LPS-induced expression of cytokines, IL-1B , IL-4 , IL-6 , IL-10 and TLR4 which drive the polarization of myeloid cells towards immunosuppressive macrophages and MDSCs (Fig. 7 E). Consistent with this notion, the transcription factor, CCAAT/enhancer-binding protein delta ( CEBPδ ) involved in macrophage differentiation 47 , was also suppressed by Minnelide (Fig. 7 F). Interestingly, Minnelide induced the upregulation of type I interferon receptor ( IFNAR1 ), which has been shown to restrict the acquisition of immunosuppressive activity in myeloid progenitors 48 , which is in line with its downregulation by IL-4 or LPS (Fig. 7 G). Discussion The standard of care chemotherapeutics remains the mainstream treatment for patients with the basal/TNBC subtype 1 despite the early clinical development of molecularly targeted therapeutics 49 . Although cytotoxic agents have shown significant benefits in the neo-adjuvant setting and in extending the life of patients, the majority of those relapse and develop more aggressive disease. Similarly, although 4T1 tumors, classified as murine TNBC 30 , respond to neoadjuvant CTX treatment in syngeneic mice by significantly reducing tumor size, the standard of care chemotherapeutics including CTX fail to eliminate disseminated tumor cells 42 . The aggressive properties of basal/TNBC subtype are attributed to their heterogeneity and phenotypic (EMT/CSC) plasticity 32 as well as their ability to drive an immunosuppressive tumor microenvironment 6 . Therefore, therapeutics designed to target both tumor intrinsic pathways and TME are expected to improve disease outcome in patients with the basal/TNBC subtype. Minnelide, has shown promising preclinical activity against multiple malignancies 7 8 23 , is currently being evaluated in Phase II clinical trial (NCT04896073) for patients with advanced refractory pancreatic carcinoma 24 . Therefore, we evaluated the activity of Minnelide in a series of human and murine breast cancer cell lines and demonstrated that Minnelide induces dose dependent apoptotic cell death specifically in basal/TNBC cell lines. Because Minnelide targets transcriptional super enhancers (BRD4), Myc and HSP70, which are all implicated in cancer stemness of basal/TNBC 10 11 14 28 , we reasoned that it may target CSC subsets in these cell lines. Minnelide effectively depleted CSC population in human (MDA-MB231 and SUM159) and murine TNBC (4T1) cell lines, while having no significant effect on CSC from luminal MCF7 or murine EMT6 cell lines. Consistent with our findings, Minnelide has been shown to target CD133 + tumor-initiating cells in pancreatic ductal adenocarcinoma 12 . The anti-tumorigenic activity of Minnelide is attributed to its unique ability to target multiple oncogenic signaling molecules, including the HSP70 signaling pathway, in multiple malignancies 13 . Moreover, we previously demonstrated that upregulation of the A20/HSP70 pathway expanded the CSC population in the TNBC subtype in response to TNFα 14 . As expected, Minnelide mediated depletion of CSCs in TNBC may be mediated by targeting the A20/HSP70 signaling axis. Minnelide binds to the XBP subunit of the transcription factor II H (TFIIH)-BRD4 super-enhancer complex that regulates many targets, including c-Myc expression 9 . It was also reported that the anti-tumor activity of BRD4 inhibitor in TNBC was shown to be mediated by the downregulation of Myc expression 50 . Thus, the scientific exploratory end points included the evaluation of Myc expression and accessibility of loci for the Myc gene in pre- and post-treatment tumors 24 . Although Myc was not induced by TGFβ, Minnelide most effectively inhibited Myc expression in both MDA-MB231 and 4T1 TNBC cell lines, and moderately downregulated Myc expression in EMT6 cells. This is significant because Myc is widely implicated oncogene in approximately 70% of malignancies and play a role in therapeutic resistance 50 . Furthermore, Myc gene alterations and overexpression were significantly higher in Basal-like and ER-negative breast cancer subtypes than the luminal subtype. Although, it was considered “undraggable” until recently 51 , new generation small molecule inhibitors of Myc are in preclinical development and early clinical trials 40 . Consistent with our data, Myc inhibition also depleted CSC populations in the TNBC subtype 52 . To the best of our knowledge, this is the first study to demonstrate significant inhibition of Myc by Minnelide in TNBC subtype. Preclinical studies and ongoing clinical trials suggest that Minnelide sensitizes cancer cells to conventional chemotherapy 8 20 23 . In line with this evidence, we demonstrated that although it showed a modest in vivo activity, it effectively sensitized 4T1 tumors to cyclophosphamide. Increased tumor infiltration and systemic expansion of cytotoxic T cells in mice treated with combination therapy also indicated that Minnelide may reprogram the immunosuppressive TME. This is supported by a significant reduction in gMDSCs, which we previously demonstrated to drive pulmonary metastasis in 4T1 tumor-bearing mice 32 . We and others have reported that 4T1 tumors quickly relapse after surgical resection of primary tumors due to disseminated tumor cells 32 and conventional chemotherapeutics fail to eliminate these disseminated tumor cells 42 . Women with TNBC show a pathological complete response to platinum based agents in the neoadjuvant setting; however, high residual disease burden post-surgery is correlated with a higher risk of recurrence and death 53 . Surprisingly, the combination of Minnelide with cyclophosphamide effectively eliminated these residual tumors following surgery and mice were free of local and metastatic recurrences for up to 6-months. Complete elimination of gMDSCs in mice treated with Minnelide in combination with cyclophosphamide suggested reprogramming of the microenvironment towards anti-tumorigenic immunity. This is consistent with a previous report that Minnelide targets pro-tumorigenic stroma, a hallmark of pancreatic carcinoma 20 . Despite the overwhelming evidence of clinical significance, targeting or reprogramming immunosuppressive macrophages/MDSCs has been challenging, in part due to their phenotypic and functional heterogeneity 46 . Among the cytokines, IL-4 has been well characterized to polarize myeloid cells towards type II macrophages/MDSCs. Owing to its significance, the therapeutic utility of targeting IL-4Rα has been explored in preclinical and early clinical trials. It was recently shown that IL-4Rα targeting antibody, dupilumab effectively reduced circulating monocytes and expanded tumor-infiltrating CD8 T cells 43 . Minnelide effectively reversed the IL-4 induced phenotypic polarization of RAW4 cells towards CD11c + CD86 + phenotype which is primarily expressed by mature dendritic cells (DCs). Therefore, we postulate that DCs with CD11c + CD86 + phenotype within the tumor microenvironment may function as antigen-presenting cells, driving the infiltration and activation of cytotoxic T cells. This is supported by a previous study suggesting that DCs with CD11c + CD86 + phenotype are capable of migrating to tumor-draining lymph nodes for proper antigen presentation 45 . Moreover, the CD86 marker is also expressed during anti-tumorigenic type I macrophage polarization 46 . In conclusion, we provide ample evidence that Minnelide targets tumor intrinsic pathways while reprogramming the immunosuppressive microenvironment and enhancing T cell infiltration in syngeneic mice. Our findings provide significant promise for its clinical utility and thus warrant further investigation in clinical settings. Authors’ Disclosures Authors declare no conflict of interest relevant to the studies presented in this manuscript. Authors’ Contributions H. Korkaya : Conceptualization, experimental design, resources, supervision, data analyses and curation, validation, funding acquisition, project administration, writing the original draft and review and editing. F. Koksalar Alkan : Experimental design, data collection, supervision, analyses and curation, manuscript writing, review and editing. A.B. Caglayan : Experimental design, data collection, analyses and curation, manuscript writing, review and editing. HK. Alkan : Data collection, validation, analysis and curation. E. Benson : Data collection, analysis and curation. Y.E. Gunduz, O. Sensoy, S. Durdagi, E. Zarbaliyev, A. Shull, A. Chadli, H. Shi : Resources, data curation, manuscript review and editing. H. Assad : Clinical perspective, manuscript review and editing. G. Ozturk : Resources, data curation, critical review and editing of the manuscript. Declarations Acknowledgements We acknowledge the Augusta University Flow Cytometry Core Facility and the Microscopy, Imaging and Cytometry Resources Core (MICR) at Wayne State University for the flow cytometry support. MICR is supported in part by the NIH Center grant P30 CA22453 to the Karmanos Cancer Institute and R50 CA251068-01 to Kamiar Moin, Wayne State University. This study was supported by the National Institute of Health NCI grant R01CA251676 and Karmanos Cancer Institute Startup fund to H. Korkaya. References Dent R, Trudeau M, Pritchard KI, et al. Triple-negative breast cancer: clinical features and patterns of recurrence. Clin Cancer Res 2007;13(15 Pt 1):4429–34. doi: 13/15/4429 [pii] 10.1158/1078 – 0432.CCR-06-3045 [published Online First: 2007/08/03] Prat A, Parker JS, Karginova O, et al. Phenotypic and molecular characterization of the claudin-low intrinsic subtype of breast cancer. Breast Cancer Res 2010;12(5):R68. doi: bcr2635 [pii]10. 1186/bcr2635 [published Online First: 2010/09/04] Lee E, Ouzounova M, Piranlioglu R, et al. The pleiotropic effects of TNFalpha in breast cancer subtypes is regulated by TNFAIP3/A20. Oncogene 2018 doi: 10.1038/s41388-018-0472-0 [published Online First: 2018/09/01] Korkaya H, Kim GI, Davis A, et al. Activation of an IL6 inflammatory loop mediates trastuzumab resistance in HER2 + breast cancer by expanding the cancer stem cell population. Mol Cell 2012;47(4):570–84. doi: 10.1016/j.molcel.2012.06.014 S1097-2765(12)00509-6 [pii] [published Online First: 2012/07/24] Dalerba P, Cho RW, Clarke MF. Cancer stem cells: models and concepts. Annu Rev Med 2007;58:267–84. Keren L, Bosse M, Marquez D, et al. A Structured Tumor-Immune Microenvironment in Triple Negative Breast Cancer Revealed by Multiplexed Ion Beam Imaging. Cell 2018;174(6):1373-87 e19. doi: 10.1016/j.cell.2018.08.039 Noel P, Hussein S, Ng S, et al. Triptolide targets super-enhancer networks in pancreatic cancer cells and cancer-associated fibroblasts. Oncogenesis 2020;9(11):100. doi: 10.1038/s41389-020-00285-9 [published Online First: 20201109] Hou ZY, Tong XP, Peng YB, et al. Broad targeting of triptolide to resistance and sensitization for cancer therapy. Biomed Pharmacother 2018;104:771–80. doi: 10.1016/j.biopha.2018.05.088 [published Online First: 20180529] Titov DV, Gilman B, He QL, et al. XPB, a subunit of TFIIH, is a target of the natural product triptolide. Nat Chem Biol 2011;7(3):182–8. doi: 10.1038/nchembio.522 [published Online First: 20110130] Huang H, Hu J, Maryam A, et al. Defining super-enhancer landscape in triple-negative breast cancer by multiomic profiling. Nat Commun 2021;12(1):2242. doi: 10.1038/s41467-021-22445-0 [published Online First: 20210414] Dong J, Li J, Li Y, et al. Transcriptional super-enhancers control cancer stemness and metastasis genes in squamous cell carcinoma. Nat Commun 2021;12(1):3974. doi: 10.1038/s41467-021-24137-1 [published Online First: 20210625] Banerjee S, Nomura A, Sangwan V, et al. CD133 + tumor initiating cells in a syngenic murine model of pancreatic cancer respond to Minnelide. Clin Cancer Res 2014;20(9):2388–99. doi: 10.1158/1078-0432.CCR-13-2947 [published Online First: 20140314] Phillips PA, Dudeja V, McCarroll JA, et al. Triptolide induces pancreatic cancer cell death via inhibition of heat shock protein 70. Cancer Res 2007;67(19):9407–16. doi: 10.1158/0008-5472.CAN-07-1077 Lee E, Ouzounova M, Piranlioglu R, et al. The pleiotropic effects of TNFalpha in breast cancer subtypes is regulated by TNFAIP3/A20. Oncogene 2019;38(4):469 – 82. doi: 10.1038/s41388-018-0472-0 [published Online First: 20180830] Li H, Pan GF, Jiang ZZ, et al. Triptolide inhibits human breast cancer MCF-7 cell growth via downregulation of the ERalpha-mediated signaling pathway. Acta Pharmacol Sin 2015;36(5):606–13. doi: 10.1038/aps.2014.162 [published Online First: 20150413] Yang J, Xu J, Wang W, et al. Epigenetic regulation in the tumor microenvironment: molecular mechanisms and therapeutic targets. Signal Transduct Target Ther 2023;8(1):210. doi: 10.1038/s41392-023-01480-x [published Online First: 20230522] Sun H, Huang B, Cao J, et al. Editorial: Epigenetic Regulation and Tumor Immunotherapy. Front Oncol 2022;12:893157. doi: 10.3389/fonc.2022.893157 [published Online First: 20220505] Xu Y, Wu Y, Zhang S, et al. A Tumor-Specific Super-Enhancer Drives Immune Evasion by Guiding Synchronous Expression of PD-L1 and PD-L2. Cell reports 2019;29(11):3435-47 e4. doi: 10.1016/j.celrep.2019.10.093 Liang M, Fu J. Triptolide inhibits interferon-gamma-induced programmed death-1-ligand 1 surface expression in breast cancer cells. Cancer Lett 2008;270(2):337–41. doi: 10.1016/j.canlet.2008.05.025 [published Online First: 20080624] Modi S, Giri B, Gupta VK, et al. Minnelide synergizes with conventional chemotherapy by targeting both cancer and associated stroma components in pancreatic cancer. Cancer Lett 2022;537:215591. doi: 10.1016/j.canlet.2022.215591 [published Online First: 20220407] Ma T, Hu C, Lal B, et al. Reprogramming Transcription Factors Oct4 and Sox2 Induce a BRD-Dependent Immunosuppressive Transcriptome in GBM-Propagating Cells. Cancer Res 2021;81(9):2457–69. doi: 10.1158/0008-5472.CAN-20-2489 [published Online First: 20210211] Noel P, Von Hoff DD, Saluja AK, et al. Triptolide and Its Derivatives as Cancer Therapies. Trends Pharmacol Sci 2019;40(5):327–41. doi: 10.1016/j.tips.2019.03.002 [published Online First: 20190408] Chugh R, Sangwan V, Patil SP, et al. A preclinical evaluation of Minnelide as a therapeutic agent against pancreatic cancer. Sci Transl Med 2012;4(156):156ra39. doi: 10.1126/scitranslmed.3004334 Skorupan N, Ahmad MI, Steinberg SM, et al. A phase II trial of the super-enhancer inhibitor Minnelide in advanced refractory adenosquamous carcinoma of the pancreas. Future Oncol 2022;18(20):2475–81. doi: 10.2217/fon-2021-1609 [published Online First: 20220510] Olsson MH, Sondergaard CR, Rostkowski M, et al. PROPKA3: Consistent Treatment of Internal and Surface Residues in Empirical pKa Predictions. J Chem Theory Comput 2011;7(2):525–37. doi: 10.1021/ct100578z [published Online First: 20110106] Harder E, Damm W, Maple J, et al. OPLS3: A Force Field Providing Broad Coverage of Drug-like Small Molecules and Proteins. J Chem Theory Comput 2016;12(1):281–96. doi: 10.1021/acs.jctc.5b00864 [published Online First: 20151201] Johnston RC, Yao K, Kaplan Z, et al. Epik: pK(a) and Protonation State Prediction through Machine Learning. J Chem Theory Comput 2023;19(8):2380–88. doi: 10.1021/acs.jctc.3c00044 [published Online First: 20230406] Maryam A, Chin YR. ANLN Enhances Triple-Negative Breast Cancer Stemness Through TWIST1 and BMP2 and Promotes its Spheroid Growth. Front Mol Biosci 2021;8:700973. doi: 10.3389/fmolb.2021.700973 [published Online First: 20210701] Al-Hajj M, Wicha MS, Benito-Hernandez A, et al. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 2003;100(7):3983–8. doi: 10.1073/pnas.0530291100 0530291100 [pii] [published Online First: 2003/03/12] Kaur P, Nagaraja GM, Zheng H, et al. A mouse model for triple-negative breast cancer tumor-initiating cells (TNBC-TICs) exhibits similar aggressive phenotype to the human disease. BMC Cancer 2012;12:120. doi: 10.1186/1471-2407-12-120 Piranlioglu R, Lee E, Ouzounova M, et al. Primary tumor-induced immunity eradicates disseminated tumor cells in syngeneic mouse model. Nat Commun 2019;10(1):1430. doi: 10.1038/s41467-019-09015-1 [published Online First: 2019/03/31] Ouzounova M, Lee E, Piranlioglu R, et al. Monocytic and granulocytic myeloid derived suppressor cells differentially regulate spatiotemporal tumour plasticity during metastatic cascade. Nature communications 2017;8:14979. Mani SA, Guo W, Liao MJ, et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 2008;133(4):704–15. doi: S0092-8674(08)00444-3 [pii] 10.1016/j.cell.2008.03.027 [published Online First: 2008/05/20] Batlle E, Massague J. Transforming Growth Factor-beta Signaling in Immunity and Cancer. Immunity 2019;50(4):924–40. doi: 10.1016/j.immuni.2019.03.024 Kotekar A, Singh AK, Devaiah BN. BRD4 and MYC: power couple in transcription and disease. FEBS J 2023;290(20):4820–42. doi: 10.1111/febs.16580 [published Online First: 20220803] Pelengaris S, Khan M, Evan G. c-MYC: more than just a matter of life and death. Nat Rev Cancer 2002;2(10):764–76. doi: 10.1038/nrc904 Katsuta E, Yan L, Takeshita T, et al. High MYC mRNA Expression Is More Clinically Relevant than MYC DNA Amplification in Triple-Negative Breast Cancer. Int J Mol Sci 2019;21(1) doi: 10.3390/ijms21010217 [published Online First: 20191228] Tang M, O'Grady S, Crown J, et al. MYC as a therapeutic target for the treatment of triple-negative breast cancer: preclinical investigations with the novel MYC inhibitor, MYCi975. Breast Cancer Res Treat 2022;195(2):105–15. doi: 10.1007/s10549-022-06673-6 [published Online First: 20220730] Wu X, Nelson M, Basu M, et al. MYC oncogene is associated with suppression of tumor immunity and targeting Myc induces tumor cell immunogenicity for therapeutic whole cell vaccination. Journal for immunotherapy of cancer 2021;9(3) doi: 10.1136/jitc-2020-001388 Whitfield JR, Soucek L. The long journey to bring a Myc inhibitor to the clinic. J Cell Biol 2021;220(8) doi: 10.1083/jcb.202103090 [published Online First: 20210623] Ouzounova M, Lee E, Piranlioglu R, et al. Monocytic and granulocytic myeloid derived suppressor cells differentially regulate spatiotemporal tumour plasticity during metastatic cascade. Nat Commun 2017;8:14979. doi: 10.1038/ncomms14979 Orecchioni S, Talarico G, Labanca V, et al. Vinorelbine, cyclophosphamide and 5-FU effects on the circulating and intratumoural landscape of immune cells improve anti-PD-L1 efficacy in preclinical models of breast cancer and lymphoma. Br J Cancer 2018;118(10):1329–36. doi: 10.1038/s41416-018-0076-z [published Online First: 20180426] LaMarche NM, Hegde S, Park MD, et al. An IL-4 signalling axis in bone marrow drives pro-tumorigenic myelopoiesis. Nature 2024;625(7993):166–74. doi: 10.1038/s41586-023-06797-9 [published Online First: 20231206] Yang Y, Sun D, Zhou J, et al. LPS expands MDSCs by inhibiting apoptosis through the regulation of the GATA2/let-7e axis. Immunol Cell Biol 2019;97(2):142–51. doi: 10.1111/imcb.12204 [published Online First: 20181021] Del Prete A, Salvi V, Soriani A, et al. Dendritic cell subsets in cancer immunity and tumor antigen sensing. Cell Mol Immunol 2023;20(5):432–47. doi: 10.1038/s41423-023-00990-6 [published Online First: 20230322] Ma RY, Black A, Qian BZ. Macrophage diversity in cancer revisited in the era of single-cell omics. Trends Immunol 2022;43(7):546–63. doi: 10.1016/j.it.2022.04.008 [published Online First: 20220609] Jauch-Speer SL, Herrera-Rivero M, Ludwig N, et al. C/EBPdelta-induced epigenetic changes control the dynamic gene transcription of S100a8 and S100a9. Elife 2022;11 doi: 10.7554/eLife.75594 [published Online First: 20220511] Alicea-Torres K, Sanseviero E, Gui J, et al. Immune suppressive activity of myeloid-derived suppressor cells in cancer requires inactivation of the type I interferon pathway. Nat Commun 2021;12(1):1717. doi: 10.1038/s41467-021-22033-2 [published Online First: 20210319] Marra A, Trapani D, Viale G, et al. Practical classification of triple-negative breast cancer: intratumoral heterogeneity, mechanisms of drug resistance, and novel therapies. NPJ Breast Cancer 2020;6:54. doi: 10.1038/s41523-020-00197-2 [published Online First: 20201016] Pang Y, Bai G, Zhao J, et al. The BRD4 inhibitor JQ1 suppresses tumor growth by reducing c-Myc expression in endometrial cancer. J Transl Med 2022;20(1):336. doi: 10.1186/s12967-022-03545-x [published Online First: 20220728] Llombart V, Mansour MR. Therapeutic targeting of \"undruggable\" MYC. EBioMedicine 2022;75:103756. doi: 10.1016/j.ebiom.2021.103756 [published Online First: 20211220] Yang A, Qin S, Schulte BA, et al. MYC Inhibition Depletes Cancer Stem-like Cells in Triple-Negative Breast Cancer. Cancer Res 2017;77(23):6641–50. doi: 10.1158/0008-5472.CAN-16-3452 [published Online First: 20170926] Bianchini G, Balko JM, Mayer IA, et al. Triple-negative breast cancer: challenges and opportunities of a heterogeneous disease. Nat Rev Clin Oncol 2016;13(11):674–90. doi: 10.1038/nrclinonc.2016.66 [published Online First: 20160517] Additional Declarations There is NO conflict of interest to disclose. Supplementary Files SuppFigsAlkanetal.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3959342\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":274162574,\"identity\":\"72b1b561-83f0-4745-afaf-0bf21f768c8b\",\"order_by\":0,\"name\":\"Hasan Korkaya\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA70lEQVRIiWNgGAWjYBACCQYGZhCdwM9DshbJHpK1GJwhVotke+9jg59tdnnGZw4/+3Sj5o6cfAPzsY9f8GiR5jlunNjbllxsdrbNeHbOsWfGBgfYkmfL4NEiJ5HGfIC3jTlx23kGY+YctsOJGxh4jJklCGg5+LetPnFzP/tn5px/hxPnNxDQIg3UkszbBjSct8eYORfIaDjAY8z4AZ/3e44xG8ucO54448yZYubcvsPGBofZkpnx6GCQON7GLPmmrDqxvyd9M3POt8Ny8u3Nhxl/4NMDAoxsyDygFcyEk8IfdDMI2jIKRsEoGAUjCQAA4DNLNw9CCEcAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Wayne State University School of Medicine\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Hasan\",\"middleName\":\"\",\"lastName\":\"Korkaya\",\"suffix\":\"\"},{\"id\":274162575,\"identity\":\"393fc7b4-dba2-40c2-9fdb-00190ecc0288\",\"order_by\":1,\"name\":\"Fulya Koksalar Alkan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Fulya\",\"middleName\":\"Koksalar\",\"lastName\":\"Alkan\",\"suffix\":\"\"},{\"id\":274162576,\"identity\":\"9f150e27-f989-4cd1-91bb-20d3318dc5ad\",\"order_by\":2,\"name\":\"Ahmet Caglayan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ahmet\",\"middleName\":\"\",\"lastName\":\"Caglayan\",\"suffix\":\"\"},{\"id\":274162577,\"identity\":\"9b60c024-f6b4-4c9d-b095-076e57f19028\",\"order_by\":3,\"name\":\"Hilmi Alkan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hilmi\",\"middleName\":\"\",\"lastName\":\"Alkan\",\"suffix\":\"\"},{\"id\":274162578,\"identity\":\"0ec66ada-886e-4a82-9c08-f55b339b3d73\",\"order_by\":4,\"name\":\"Elayne Benson\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Elayne\",\"middleName\":\"\",\"lastName\":\"Benson\",\"suffix\":\"\"},{\"id\":274162579,\"identity\":\"6025f41b-55b0-451d-8185-97ac9822a056\",\"order_by\":5,\"name\":\"Yunus Gunduz\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yunus\",\"middleName\":\"\",\"lastName\":\"Gunduz\",\"suffix\":\"\"},{\"id\":274162580,\"identity\":\"b8cb091b-cb22-4f32-bcd4-daa3aab9a14a\",\"order_by\":6,\"name\":\"Ozge Sensoy\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ozge\",\"middleName\":\"\",\"lastName\":\"Sensoy\",\"suffix\":\"\"},{\"id\":274162581,\"identity\":\"76394e43-dc00-4265-9ebc-76d6c4e1fcc0\",\"order_by\":7,\"name\":\"Serdar Durdagi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Serdar\",\"middleName\":\"\",\"lastName\":\"Durdagi\",\"suffix\":\"\"},{\"id\":274162582,\"identity\":\"6681365b-7305-49f8-be05-ec724f240283\",\"order_by\":8,\"name\":\"Elbrus Zarbaliyev\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Elbrus\",\"middleName\":\"\",\"lastName\":\"Zarbaliyev\",\"suffix\":\"\"},{\"id\":274162583,\"identity\":\"7a07c49f-2687-4753-b404-72aacb70f999\",\"order_by\":9,\"name\":\"Gregory Dyson\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Gregory\",\"middleName\":\"\",\"lastName\":\"Dyson\",\"suffix\":\"\"},{\"id\":274162584,\"identity\":\"f74ea5e9-4680-4221-a8f9-43a2a74fb26a\",\"order_by\":10,\"name\":\"Hadeel Assad\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hadeel\",\"middleName\":\"\",\"lastName\":\"Assad\",\"suffix\":\"\"},{\"id\":274162585,\"identity\":\"a84330da-da44-4737-88f9-3aa76b641468\",\"order_by\":11,\"name\":\"Austin Shull\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Presbyterian College\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Austin\",\"middleName\":\"\",\"lastName\":\"Shull\",\"suffix\":\"\"},{\"id\":274162586,\"identity\":\"11d19622-ce70-4287-ad50-3ed61c520b88\",\"order_by\":12,\"name\":\"Ahmed Chadli\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Augusta University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ahmed\",\"middleName\":\"\",\"lastName\":\"Chadli\",\"suffix\":\"\"},{\"id\":274162587,\"identity\":\"23a8f2f2-a483-48b1-abe4-f375d64a6b53\",\"order_by\":13,\"name\":\"Huidong Shi\",\"email\":\"\",\"orcid\":\"https://orcid.org/0000-0003-1137-3390\",\"institution\":\"Augusta University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Huidong\",\"middleName\":\"\",\"lastName\":\"Shi\",\"suffix\":\"\"},{\"id\":274162588,\"identity\":\"b8e47cd0-25d5-4aa7-b544-f8744804b44e\",\"order_by\":14,\"name\":\"Gurkan Ozturk\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Gurkan\",\"middleName\":\"\",\"lastName\":\"Ozturk\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-02-15 18:00:08\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3959342/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3959342/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":51511899,\"identity\":\"8d9f8422-2082-4515-9018-8f065a825a51\",\"added_by\":\"auto\",\"created_at\":\"2024-02-22 21:11:05\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":31779,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMinnelide activity on tumor cell proliferation of human and murine breast cancer cell lines: \\u003c/strong\\u003eHuman breast cancer cell lines, MDA-MB231, Sum159, ZR75-1, MCF7 AND murine breast cancer cell lines, EMT6, E00771, AT3 and 4T1 were incubated with indicated doses of Minnelide for 48 hours and cell viability was measured by MTT assay. \\u003cstrong\\u003eA-D. \\u003c/strong\\u003eMinnelide reduces proliferation in a dose dependent manner in TNBC lines and luminal subtype. Experiments were done 2 independent times in triplicate and cell viability was shown in percentages (± SD).One-Way ANOVA is used to compare test groups to control. \\u0026nbsp;*P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, ****P \\u0026lt; 0.0001.​\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Slide1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3959342/v1/ee406742f156174e7edafb5f.png\"},{\"id\":51511900,\"identity\":\"0ca28f11-1c7a-4038-a22f-cdc2e3a09617\",\"added_by\":\"auto\",\"created_at\":\"2024-02-22 21:11:05\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":86114,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMinnelide significantly reduces CSC population in MDA-MB231 via inducing apoptotic cell death. \\u003c/strong\\u003eBreast cancer cell lines, MDA-MB-231 and MCF7 were incubated with indicated doses of Minnelide for 48 hours and apoptotic cell death and CSC population was evaluated by flow cytometer. \\u003cstrong\\u003eA, B, \\u003c/strong\\u003eMinnelide induces a dose dependent cytotoxic cell death particularly in CSC \\u003cstrong\\u003e(d, e) \\u003c/strong\\u003epopulation of MDA-MB231 and Sum159 TNBC cell lines in vitro. \\u003cstrong\\u003eC, F,\\u003c/strong\\u003e Minnelide had no activity on the CSC population of luminal MCF7 cell lines while it induced a significant apoptotic cell death in these cells with increasing doses of Minnelide. Experiments were done in triplicates and values were shown in percentages (± SD). \\u0026nbsp;One-Way ANOVA is used to compare test groups to control. *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, ****P \\u0026lt; 0.0001.​\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Slide2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3959342/v1/793658dd3d1c66bbc1c5e85b.png\"},{\"id\":51511898,\"identity\":\"d18bea4a-7c0a-464f-b827-9c31a34d8221\",\"added_by\":\"auto\",\"created_at\":\"2024-02-22 21:11:05\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":161319,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMinnelide targets CSC population in murine 4T1 tumor cells. \\u003c/strong\\u003eMurine 4T1 and EMT6 tumor cells were incubated with indicated doses of Minnelide for 48 hours and apoptotic cell death and CSC population was evaluated by flow cytometer. \\u003cstrong\\u003eA, B. \\u003c/strong\\u003eMinnelide induces a dose dependent apoptotic cell death in 4T1 cells in vitro in addition to the reduced capacity of cancer stemness. \\u003cstrong\\u003eC, D.\\u003c/strong\\u003e Apoptotic cell death was increased by the increasing doses of minnelide while CSC population is not affected in vitro in EMT6 cells for 48 hours. Experiments were done in triplicates and values were shown in percentages (± SD). \\u0026nbsp;One-Way ANOVA is used to compare test groups to control. *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001.​\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Slide3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3959342/v1/412ea51e8608c2ed816776e0.png\"},{\"id\":51511902,\"identity\":\"30305622-8b27-432a-ba02-2f8783c8390f\",\"added_by\":\"auto\",\"created_at\":\"2024-02-22 21:11:05\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":155500,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMinnelide suppresses TGFb-induced upregulation of signaling pathways. A-C,\\u003c/strong\\u003eProtein expression of HSP70/72, A20, Vimentin, MYC and BRD4 was shown in human\\u003cstrong\\u003e \\u003c/strong\\u003eMDA-MB-231 and murine 4T1 and EMT6 cell lines treated with increased dose of Minnelide in the presence and absence of recombinant human TGFb. Experiments were done in duplicates. \\u003cstrong\\u003eD,\\u003c/strong\\u003e TCGA data showing the genetic alterations of \\u003cem\\u003emyc\\u003c/em\\u003e in Basal-like, ER- and ER+ breast cancer subtypes. \\u003cstrong\\u003eE-G, \\u003c/strong\\u003eKaplan-Meier TCGA data showing the association between the Myc expression levels and survival rates among the patients with high gene expression (red) in Basal-like, ER- and ER+ breast cancer compared to patients with low expression (blue), respectively.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Slide4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3959342/v1/565a0869fde692037fb9d72a.png\"},{\"id\":51511901,\"identity\":\"dc424ac2-0ffc-49d3-9485-b4b37ba450b3\",\"added_by\":\"auto\",\"created_at\":\"2024-02-22 21:11:05\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":119577,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMinnelide in combination with CTX significantly reduces tumor growth and metastasis by reducing gMDSCs and enhancing T cell infiltration in 4T1 tumor bearing mice. \\u003c/strong\\u003eMice bearing 4T1 tumors were treated with single minnelide (n=5, 0.5mg/kg, daily), single CTX (n=5, 150mg/kg, weekly) and in combination (n=6) for 5 weeks compared to controls (n=5). \\u003cstrong\\u003eA, \\u003c/strong\\u003eSize of primary tumors and their\\u003cstrong\\u003e \\u003c/strong\\u003eweights at the end point of the experiment. \\u003cstrong\\u003eB, \\u003c/strong\\u003eSize of matching spleens their weights at the end point of the experiment. \\u003cstrong\\u003eC\\u003c/strong\\u003e, Bioluminescent imagings of lungs from each treatment group compared to controls. \\u003cstrong\\u003eD, \\u003c/strong\\u003ebioluminescent imaging of spleens from each treatment group compared to controls. \\u003cstrong\\u003eE,\\u003c/strong\\u003e Reduced cancer stemness in the tumors of \\u0026nbsp;combination group measured by flow cytometry (n=3 per group). \\u0026nbsp;\\u003cstrong\\u003eF, \\u003c/strong\\u003eIncreased tumor infiltrating CTLs (CD8a+Ly6C+) in the tumors of combination group determined by flow cytometry (n=3 per group). \\u003cstrong\\u003eG,\\u003c/strong\\u003e increased systemic CTLs from the spleens of combination group (n=3 per group) \\u003cstrong\\u003eH, \\u003c/strong\\u003eLow gMDSC (CD11b+Ly6Cint) levels in the tumors of combination group(n=5). \\u0026nbsp;Values were shown in percentages (± SD). One-Way ANOVA is used to compare test groups to control and t-test was applied between the conditions. *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001.​\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Slide5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3959342/v1/9ef675453a2fa19aef8c95af.png\"},{\"id\":51511904,\"identity\":\"81e83738-ed18-49a8-94d6-36fbaa9acb67\",\"added_by\":\"auto\",\"created_at\":\"2024-02-22 21:11:05\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":239638,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMinnelide\\u0026nbsp;in combination with CTX eliminates residual 4T1 tumors following surgery in syngeneic mouse model.\\u0026nbsp;\\u003c/strong\\u003eMice\\u0026nbsp;bearing 4T1 tumors were treated with\\u0026nbsp;\\u0026nbsp;minnelide\\u0026nbsp;(0.5mg/kg) daily for 3 weeks and primary tumors were resected, and treatment continued\\u0026nbsp;another 2 weeks.\\u0026nbsp;\\u003cstrong\\u003eA-C.\\u0026nbsp;\\u003c/strong\\u003eMinnelide\\u0026nbsp;alone significantly reduced the relapse after surgery, and it eliminated all residual tumors when combined\\u0026nbsp;with CTX.\\u0026nbsp;\\u003cstrong\\u003eD. S\\u003c/strong\\u003eurvival rates of 4T1 tumor bearing mice before and after the resections.\\u0026nbsp;\\u003cstrong\\u003eE\\u003c/strong\\u003e. Staining for Ly6C\\u003csup\\u003eHI\\u003c/sup\\u003e\\u0026nbsp;and Ly6C\\u003csup\\u003eINT\\u003c/sup\\u003e\\u0026nbsp;among CD11b+\\u0026nbsp;myeloid cells from circulating MDSCs from control (n=2), single\\u0026nbsp;Minnelide\\u0026nbsp;(n=3) and combination (n=3) groups were measure by flow\\u0026nbsp;cytometry one week after the resection surgery.\\u0026nbsp;\\u003cstrong\\u003eF\\u003c/strong\\u003e. Bar graphs for immunosuppressive MDSCs showing lowering effects in combination group\\u0026nbsp;compared to control and\\u0026nbsp;Minnelide. Values were shown in\\u0026nbsp;percentages\\u0026nbsp;(± SD).\\u0026nbsp; One-Way\\u0026nbsp;ANOVA\\u0026nbsp;is used to compare test groups\\u0026nbsp;to\\u0026nbsp;control. *P \\u0026lt; 0.05.\\u003cbr\\u003e\\n\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Slide6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3959342/v1/27ee1f125ed0d441b584d2a7.png\"},{\"id\":51511903,\"identity\":\"f6af6c7e-c844-42d9-b61b-d03632b5f6b7\",\"added_by\":\"auto\",\"created_at\":\"2024-02-22 21:11:05\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":92565,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMinnelide induces monocyte-driven CD11c expansion in monocyte/macrophage-like cells \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003ein vitro\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e. \\u003c/strong\\u003eRaw264.7 cells were treated with IL-4 (10ng/ml), LPS (500ng/ml) in the presence or absence of Minnelide (100 uM) for 96 hours \\u003cem\\u003ein vitro\\u003c/em\\u003e. \\u003cstrong\\u003eA. \\u003c/strong\\u003eStaining for CD11c and CD11b among live cells from 4 days of culture with indicated differentiating factors were measure by flow cytometer. Experiments were done in triplicates. \\u003cstrong\\u003eB.\\u003c/strong\\u003e Bar graphs for monocyte-driven differentiation to CD11c+ cells among CD11b- cells were increased by Minnelide. One-Way ANOVA applied for values compared to control and t-test was applied between the conditions. *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, ****P \\u0026lt; 0.0001. \\u003cstrong\\u003eC. \\u003c/strong\\u003eStaining for CD11c and CD86 among live cells from 4 days of culture with indicated differentiating factors were measured by flow cytometer. Experiments were done in triplicates. \\u003cstrong\\u003eD. \\u003c/strong\\u003eBar graphs for CD11c+CD86+ cells were increased by Minnelide. \\u003cstrong\\u003eE. \\u003c/strong\\u003eExpressions of immune activates genes on differentiated monocytes. Experiments were done in 2 independent times in triplicate and values were shown in log scale (± SD). One-Way ANOVA is used to compare test groups to control and t-test was applied between the conditions. *P \\u0026lt; 0.05, **P \\u0026lt; 0.01, ***P \\u0026lt; 0.001, ****P \\u0026lt; 0.0001.​\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Slide7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3959342/v1/78fdb53414eea7b9968c2ec7.png\"},{\"id\":52268400,\"identity\":\"6ea841a2-3341-4e28-81ec-389357c06df7\",\"added_by\":\"auto\",\"created_at\":\"2024-03-08 12:40:13\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1502860,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3959342/v1/24ce46e2-505a-435d-b70d-2847bf01e93a.pdf\"},{\"id\":51511906,\"identity\":\"b373d259-5c6c-4f09-9f0c-a9f938952e22\",\"added_by\":\"auto\",\"created_at\":\"2024-02-22 21:11:05\",\"extension\":\"pdf\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":4785372,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SuppFigsAlkanetal.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3959342/v1/63fb039c343b271d566c2575.pdf\"}],\"financialInterests\":\"There is \\u003cb\\u003eNO\\u003c/b\\u003e conflict of interest to disclose.\",\"formattedTitle\":\"Dual activity of Minnelide chemosensitize basal/triple negative breast cancer stem cells and reprograms immunosuppressive tumor microenvironment\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eAmong American women, breast cancer is the most common malignancy, after skin cancer. Metastatic breast cancer is the leading cause of cancer-related death among women. Women with the basal/TNBC subtype constitute 15\\u0026ndash;20% of breast cancer patients and are often diagnosed with aggressive/metastatic disease \\u003csup\\u003e\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e\\u003c/sup\\u003e. Basal/TNBC tumors exhibit an epithelial mesenchymal transition (EMT) phenotype and cancer stem cell (CSC) properties \\u003csup\\u003e\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u003c/sup\\u003e, which contribute to metastasis and treatment resistance \\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR4\\\" citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e\\u003c/sup\\u003e. In addition, the immunosuppressive tumor microenvironment (TME) in TNBC has been implicated in the failure to respond to conventional and targeted therapies \\u003csup\\u003e\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u003c/sup\\u003e. Thus, an improved understanding of the mechanism by which immunosuppressive TME contributes to therapy resistance will lead to the development of alternative therapeutics. Minnelide, a prodrug of triptolide, has shown anti-tumorigenic activities in multiple malignancies by targeting super-enhancers (SE) and anti-apoptotic pathways, such as heat shock protein 70 (HSP70) signaling \\u003csup\\u003e\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e\\u003c/sup\\u003e. This small-molecule inhibitor covalently bound to the XPB subunit of transcription factor II H (TFIIH) super-enhancer complex regulates many targets, including \\u003cem\\u003ec-Myc\\u003c/em\\u003e \\u003csup\\u003e\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e\\u003c/sup\\u003e. Genomics studies have revealed a distinct SE landscape in basal/TNBC compared with other subtypes of breast cancer \\u003csup\\u003e\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e\\u003c/sup\\u003e. Consistent with this notion, transcriptional SEs have been implicated in cancer stemness programs for number of malignancies, including breast cancer \\u003csup\\u003e\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e\\u003c/sup\\u003e. Minnelide targets CD133\\u0026thinsp;+\\u0026thinsp;tumor initiating cells in syngeneic models of pancreatic ductal adenocarcinoma \\u003csup\\u003e\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e\\u003c/sup\\u003e. Other modes of anti-tumorigenic activities of Minnelide include targeting HSP70 signaling has been shown to be a major target in multiple malignancies \\u003csup\\u003e\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u003c/sup\\u003e. We previously reported that the TNFAIP3(A20)/HSP70 signaling axis is selectively upregulated in TNBCs in response to cytotoxic agents \\u003csup\\u003e\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u003c/sup\\u003e suggesting the therapeutic utility of Minnelide for this subtype. However, the antitumorigenic activity of triptolide has also been reported in luminal breast cancer subtype via different mechanisms, such as downregulation of ERα signaling and lysosome-mediated cell death \\u003csup\\u003e\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eIn addition to their tumor intrinsic role, epigenetic regulators are implicated in the reprogramming of stromal/immune cells within the tumor microenvironment \\u003csup\\u003e\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e\\u003c/sup\\u003e and several inhibitors of epigenetic modifying enzymes are being tested in preclinical and early phase clinical trials to improve the efficacy of immune checkpoint inhibitors (ICI) in solid tumors \\u003csup\\u003e\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e\\u003c/sup\\u003e. Super-enhancers have been shown to drive immune evasion by controlling the expression of genes such as PD-L1/PD-L2 and TGFβ which are critical players in immune suppression \\u003csup\\u003e\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e\\u003c/sup\\u003e. Consistent with this notion, triptolide effectively suppressed IFN-γ-driven PD-L1 expression in breast cancer cell lines \\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e\\u003c/sup\\u003e. Minnelide in combination with low-dose gemcitabine and paclitaxel exhibited enhanced therapeutic activity by reducing stromal collagen content in pancreatic cancer \\u003csup\\u003e\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e\\u003c/sup\\u003e. Furthermore, embryonic reprogramming transcription factors such as Oct4 and Sox2 induce a bromodomain (BRD)-dependent immunosuppressive microenvironment in glioblastoma stem-like cells \\u003csup\\u003e\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u003c/sup\\u003e. Overall, studies thus far suggest a wide range of anti-tumorigenic activities of Minnelide in preclinical studies of multiple malignancies \\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eGiven its promising preclinical activity \\u003csup\\u003e\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u003c/sup\\u003e, Minnelide is now currently being evaluated in Phase II clinical trials (NCT04896073) in patients with advanced refractory pancreatic carcinoma \\u003csup\\u003e\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e. At least 16 weeks of stable disease as an endpoint was intended as per the response evaluation criteria in solid tumors (RESIST). Scientific exploratory end points include evaluation of \\u003cem\\u003eMyc\\u003c/em\\u003e expression and accessibility of loci for \\u003cem\\u003eMyc\\u003c/em\\u003e gene in pre- and post-treatment tumors and profiling of circulating immune cell populations in patients\\u0026rsquo; blood \\u003csup\\u003e\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eWe therefore reasoned that Minnelide may exhibit dual activity by targeting tumor intrinsic pathways and reprogramming the immune microenvironment in the TNBC subtype, which is characterized by an immunosuppressive TME \\u003csup\\u003e\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u003c/sup\\u003e. Our studies provide evidence that Minnelide targets CSCs by inhibiting multiple tumor intrinsic signaling pathways such as A20/HSP70, Myc, Vimentin and BRD4, which have been widely implicated in driving aggressive properties of the TNBC subtype. Minnelide sensitizes tumors to cyclophosphamide (CTX) in syngeneic mice, eradicating disseminated tumor cells following resection of residual tumors. This may be due to the reprogramming of the tumor microenvironment, which leads to enhanced cytotoxic T cell infiltration and improved overall outcomes.\\u003c/p\\u003e\"},{\"header\":\"Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell lines and reagents\\u003c/h2\\u003e \\u003cp\\u003e4T1, AT-3, E0771, EMT6, J774A.1, Raw264.7, MCF7, MDA-MB-231, Sum-159 and ZR-75-1cell lines were purchased from American Type Culture Collection (ATCC). All cell lines were tested for mycoplasma contamination by PCR analyses using a Universal Mycoplasma Detection Kit (30-1012K\\u003csup\\u003e\\u0026trade;\\u003c/sup\\u003e, ATCC). The 4T1 cell line is infected with luciferase-expressing lentivirus, and stable cell lines were generated to monitor tumor growth in live animals and tissues. 4T1, 4T1-Luc, EMT6, MCF-7 and ZR-75-1 cell lines were maintained in RPMI1640 supplemented with 10% fetal bovine serum, and antibiotic/antimycotic 10,000U/ml. E0771 cell line was maintained in DMEM supplemented with 10% fetal bovine serum, and antibiotic/antimycotic 10,000U/ml. The MDA-MB-231 cell line was maintained in DMEM supplemented with 5% fetal bovine serum, and antibiotic/antimycotic 10,000U/ml. Sum-159 cells were maintained in Ham\\u0026rsquo;s F12 supplemented with 5% fetal bovine serum, 5mg/ml insulin, 1mg/ml hydrocortisone, and antibiotic/antimycotic 10,000U/ml). Raw264.7 cell line was maintained in DMEM supplemented with 10% fetal bovine serum.\\u003c/p\\u003e \\u003cp\\u003eMinnelide (HY-124584, MCE) was resuspended in DMSO for \\u003cem\\u003ein vitro\\u003c/em\\u003e assays and 10% DMSO in 90% (20% SBE-β-CD (HY-17031, MCE)) in saline to obtain a clear solution, as described by the manufacturer. Vehicle controls were used at corresponding concentrations for each experiment. Cyclophosphamide (CTX) was resuspended in saline. Recombinant mouse IL-4 (404-ML/CF, R\\u0026amp;D Systems) and recombinant human TGF-beta1 (240-B-010/CF, R\\u0026amp;D Systems) were used at the indicated concentrations. LPS was purchased from Sigma-Aldrich and resuspended in cell culture medium to induce macrophage differentiation.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eIn vitro\\u003c/b\\u003e \\u003cb\\u003estudies\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eA cell proliferation assay from Promega (G3580) was used to assess the cytotoxicity and proliferation of cells in the presence of Minnelide. Briefly, 1,000 cells were seeded in a 96-well plate and treated with increased doses of Minnelide the next day. A set of wells were maintained with medium only for background subtraction. 20\\u0026micro;l of MTS solution were added to each well and incubated for 2 h at 37\\u0026deg;C and the absorbance was recorded at 490nm. Experiment was repeated 2 independent times in triplicates.\\u003c/p\\u003e \\u003cp\\u003eFlow cytometry was performed using Annexin V Binding buffer (422201, BioLegend). Briefly, cells were treated with Minnelide for 48 h. After collecting the cells, 100,000 cells were resuspended in Annexin V Binding buffer and stained with fluorochrome conjugated Annexin V antibody (640920, 640945, BioLegend) and 7-AAD (420404, BioLegend) or DAPI (564907, BD Biosciences). Murine mammary cancer stem cells were analyzed by flow cytometry using CD24(138504 BioLegend, 1:100), CD29 (102216, BioLegend, 1:100). The samples were analyzed using a NovoCyte Quanteon Flow Cytometer CyTEK Northern Lights Full Spectrum cytometer. Experiments were repeated 3 independent times.\\u003c/p\\u003e \\u003cp\\u003eImmune profiling assays of monocyte and macrophage cell lines were performed using fluorescent conjugated antibodies CD11b (101243, BioLegend 1:250), CD11c (117353, BioLegend, 1:250), Ly6C (128018, BioLegend, 1:250), Ly6G (127624, BioLegend, 1:250), CD86 (105011, BioLegend, 1:250). The viability dye Zombie Aqua (423102, BioLegend, 1:500) were chosen according to antibody/fluorochrome compatibility of panel. The samples were analyzed using a NovoCyte Quanteon Flow Cytometer CyTEK Northern Lights Full Spectrum cytometer.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eProtein modeling, preparation, and receptor grid generation\\u003c/h2\\u003e \\u003cp\\u003eThe NBD domain of Hsc70 pertaining to Bos taurus (PDB ID: 3HSC) containing ADP nucleotide was present in the protein database (PDB), yet the structure of the whole protein was not available. The amino acid similarity between the NBD domains of Bos taurus Hsc70 and human Hsp70 proteins was 88.542%. Therefore, the full structure of the human Hsp70 was modeled using the crystal structure of the bacterial Hsp70, DnaK (PDB ID:2KHO) and NBD of Hsc70 belonging to Bos taurus using Swiss-Models program. The Protein preparation module in Maestro molecular modeling package (Maestro, 2018) was used for protein preparation. Crystal structure of human HSP70 complexed with VER-155008 was downloaded from protein data bank (PDB ID: 4IO8) and aligned with the modeled HSP70 3D structure. The co-crystallized ligand (VER-155008) is merged to the HSP70 and ligand-bound model protein structure is saved. The PROPKA\\u003csup\\u003e\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u003c/sup\\u003e (pH, 7) and OPLS3 force field\\u003csup\\u003e\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e\\u003c/sup\\u003e were used for protonation states, structural optimization and minimization, respectively. Furthermore, receptor grid generation in Glide\\u003csup\\u003e\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u003c/sup\\u003e was used to generate the grid boxes at the active site of merged ligand.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eLigand preparation\\u003c/h2\\u003e \\u003cp\\u003eLigPrep module (Ligprep, 2018) of Maestro molecular modeling with the OPLS3 forcefield\\u003csup\\u003e\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e\\u003c/sup\\u003e was used for preparation of ligands. Epik \\u003csup\\u003e\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e\\u003c/sup\\u003e module in Ligprep was used to assign potential ionization states at pH 7. 3D geometry optimization and energy minimization were performed to generate the 3D structures of the ligands. OPLS3 forcefield\\u003csup\\u003e\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u003c/sup\\u003e was used for energy minimization, by choosing standard energy function and RMSD cut off of 0.01 \\u0026Aring; for the generation of low energy conformations.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMouse tumor implantation\\u003c/h2\\u003e \\u003cp\\u003e All animal procedures were performed in accordance with the Institutional Animal Care and Use Committee (IACUC) at Augusta University (AU). The animal protocol for the procedures conducted in this study was approved by the Laboratory of Animal Services (LAS) at AU. All mice were housed at room temperature with 50\\u0026ndash;70% humidity, and 12/12 hour light/dark cycle. Animals were housed as maximum as 5 mice per cage during the experiments. BALB/c female mice (5 weeks old) were purchased from The Jackson Laboratory. A total of 50,000 4T1-Luc cells were implanted into the 4th mammary fat pads of mice in a 50/50% media/Matrigel (Corning) mixture. For the \\u003cem\\u003ein vivo\\u003c/em\\u003e studies, mice were treated with Minnelide (0.5mg/kg, daily, i.p.) and/or cyclophosphamide (Sigma Aldrich) (150mg/kg, weekly, i.p.). For the survival experiments, tumors were resected by the third week of 4T1-Luc mammary fat pat injection. Animals were followed up for primary tumor and/or metastatic growth by weekly bioluminescence imaging using AMI (Spectral Instruments Imaging), and images were analyzed using Aura software. Total number of 32 mice were used. 5 mice were used for control group and treated with vehicle. 5 mice were used for CTX and Minnelide groups. 6 mice were used for CTX and Minnelide combinational treatment group. For the resection experiments, 3 mice in control, 4 mice in Minnelide and 4 mice in CTX and Minnelide combination group were used. Minnelide treatment started on day 3 and CTX treatment started on day 7 after 4T1-Luc mammary fat pad injection. PBMCs from tail vein during the tumor growth and resected tumor and organs at the endpoint of each experiment were tested for immune cell markers as described in Flow Cytometry methods.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eFlow Cytometry\\u003c/h2\\u003e \\u003cp\\u003eFor immune profiling, single-cell suspensions were prepared from blood, spleen, lungs, and tumors. Lung and tumor tissues were dissociated and digested with collagenase/hyaluronidase (07912, STEMCELL Technologies, USA). The spleens were smashed on a cell strainer with a syringe plunger. For blood and each organ, red blood cells were lysed using 1X RBC Lysis Buffer (10X, 420302, BioLegend). Single cell suspensions has been maintained in 2% FBS-in PBS until staining. Flow cytometry based immune profiling of MDSCs and T cells was performed using fluorescent conjugated antibodies against CD45 (103155, BioLegend, 1:250) CD11b (101243, BioLegend 1:250), CD11c (117330, BioLegend, 1:250), Ly6C (128018, BioLegend, 1:250), Ly6G (127624, BioLegend, 1:250) and CD86 (105011, BioLegend, 1:250). The viability dyes Zombie Aqua (423102, Biolegend, 1:500) and Zombie Violet(423114, Biolegend, 1:500) were chosen according to the panels for each immune profiling assays. Samples were analyzed using a NovoCyte Quanteon Flow Cytometer and a CyTEK Northern Lights Full Spectrum Cytometer. Data analysis was performed using FlowJo v.10.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRT-PCR and Western Blot analysis\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA was extracted using the RNeasy Mini Kit (74536, Qiagen) and 500ng of RNA was used to make cDNA using the iScript cDNA Synthesis Kit (1708891, BioRad). For RT-PCR analysis, gene-specific primers ordered from KiCqStart SYBR Green Primers (Millipore Sigma) were used. Cebpd (F\\u0026mdash;5\\u0026rsquo;-ATCACTTAAAGATGTTCCTGC \\u0026minus;\\u0026thinsp;3\\u0026rsquo;, R\\u0026mdash;5\\u0026rsquo;- TGTCTTCACTTTAATGCTCG \\u0026minus;\\u0026thinsp;3\\u0026rsquo;), Ifnar1 (F\\u0026mdash;5\\u0026rsquo;- CTAAGATAAGCATGGAGAAGG-3\\u0026rsquo;, R\\u0026mdash;5\\u0026rsquo;- AATCCAGATCGTGGAAAAAC-3\\u0026rsquo;), Il1b (F\\u0026mdash;5\\u0026rsquo;-GGATGATGATGATAACCTGC-3\\u0026rsquo;, R\\u0026mdash;5\\u0026rsquo;-CATGGAGAATATCACTTGTTGG-3\\u0026rsquo;), Il4 (F\\u0026mdash;5\\u0026rsquo;-CTGGATTCATCGATAAGCTG \\u0026minus;\\u0026thinsp;3\\u0026rsquo;, R\\u0026mdash;5\\u0026rsquo;- TTTGCATGATGCTCTTTAGG \\u0026minus;\\u0026thinsp;3\\u0026rsquo;), Il6 (F\\u0026mdash;5\\u0026rsquo;-AAGAAATGATGGATGCTACC-3\\u0026rsquo;, R\\u0026mdash;5\\u0026rsquo;-GAGTTTCTGTATCTCTCTGAAG-3), Il10 (F\\u0026mdash;5\\u0026rsquo;-CAGGACTTTAAGGGTTACTTG \\u0026minus;\\u0026thinsp;3\\u0026rsquo;, R\\u0026mdash;5\\u0026rsquo;-ATTTTCACAGGGGAGAAATC \\u0026minus;\\u0026thinsp;3) and Tlr4 (F\\u0026mdash;5\\u0026rsquo;-GATCAGAAACTCAGCAAAGTC \\u0026minus;\\u0026thinsp;3\\u0026rsquo;, R\\u0026mdash;5\\u0026rsquo;-TGTTTCAATTTCACACCTGG \\u0026minus;\\u0026thinsp;3\\u0026rsquo;). Relative gene expression at the mRNA level was normalized against the internal control ACTB (F\\u0026mdash;5\\u0026prime;-GATGTATGAAGGCTTTGGTC-3\\u0026prime;, R\\u0026mdash;5\\u0026prime;-TGTGCACTTTTATTGGTCTC-3\\u0026prime;) gene (ΔCt\\u0026thinsp;=\\u0026thinsp;Ct (target gene)\\u0026thinsp;\\u0026minus;\\u0026thinsp;Ct (internal control gene)). Relative fold change was measured using the 2\\u003csup\\u003e\\u0026minus;ΔΔCt\\u003c/sup\\u003e formula and compared with the control cells. Means and differences with 95% confidence intervals were obtained using GraphPad Prism 10 (GraphPad Software Inc.). Two-tailed Student\\u0026rsquo;s t test was used for unpaired analysis to compare the average expression between conditions. Statistical significance was set at p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 were For Western Blot analysis, cells were lysed in Pierce RIPA Buffer (89901, 78440 Thermo Scientific). 20\\u0026micro;g of each protein in 4X Laemmli Sample Buffer (1610747, Bio-Rad) was boiled at 95\\u0026deg;C for 5 min and subjected to SDS-PAGE. Proteins were transferred to a polyvinylidene fluoride (PVDF) membrane (1620177, Bio-Rad) using a semi-dry Trans-Blot (Bio-Rad). Blots were first incubated in TBS blocking buffer containing 2% non-fat dry milk or 2% BSA (for phosphor-specific antibodies) for 1 h at room temperature and then incubated with the respective primary antibodies diluted in TBS-T (containing 0.1% Tween20 and 2% BSA) overnight at 4\\u0026deg;C in the dark. Blots were washed and incubated with appropriate secondary antibodies in TBS-T and detected using Clarity Western ECL Substrate (1705061, Bio-Rad). Antibodies against cMyc (ab32072, Abcam), vimentin (5741, Cell Signaling Technology), A20/TNFAIP3 (NBP1-77533, Novus), HSP70/72(ADI-SPA-810-F, Enzo Life Sciences), Brd4 (ab128874, Abcam), and \\u0026szlig;-actin (664803, BioLegend). All antibodies were used at 1:1000 dilution. Uncropped scans of the blots are provided in supplementary figures.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical Analysis.\\u003c/h2\\u003e \\u003cp\\u003eThe statistical analysis applied to each graph is indicated in the figure legends. Briefly, Unpaired two-tailed t-tests were applied to determine the significance between two treatment groups, and one-way analyses variance (ANOVA) was used for variance analysis between the control and every other group. In vitro experiments were repeated in three different time points and were indicated with the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD. For survival percentiles, the data were submitted to Kaplan-Meier curve tests and differences between two groups were submitted to the log-rank test. All statistical analyses were performed using GraphPad Prism (version 10).\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003eMinnelide suppresses cell proliferation in human and murine TNBC cell lines in a dose dependent manner\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eWe first assessed the effect of Minnelide on cell viability in multiple human and murine breast cancer cell lines representing TNBC or the luminal subtype. We treated human breast cancer cell lines MDA-MB231, Sum159, MCF7 and ZR-75-1) and murine breast cancer cell lines (4T1, AT3, EMT6 and E00771) with increasing doses of Minnelide ranging from 25nM to 1\\u0026micro;M for 48 h and assessed cell viability using the CellTiter 96 Aqueous One Solution. Although Minnelide significantly reduced cell viability in all breast cancer cell lines in vitro (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA-D), TNBC cell lines exhibited a dose-dependent reduction in viability upon treatment with increasing doses of Minnelide (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA and C) with the exception that the 4T1 cell line required relatively higher doses of the drug (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC, left panel). In contrast, luminal breast cancer cell lines appeared to show a non-specific toxicity in response to treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB and D). Brightfield images of the cell lines at the time of the viability assay support the dose-dependent activity of Minnelide on TNBC and non-TNBC cell lines (Supplementary Fig. \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003eA-D).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMinnelide specifically targets CSC population in TNBC cell lines by inducing apoptotic cell death\\u003c/h2\\u003e \\u003cp\\u003eGiven the distinct super-enhancer landscape in the human TNBC subtype \\u003csup\\u003e\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e\\u003c/sup\\u003e as well as its role in reprogramming of the CSC phenotype \\u003csup\\u003e\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e\\u003c/sup\\u003e, we investigated whether Minnelide can specifically target the CSC population. MDA-MB231, SUM159 and MCF7 cell lines were treated with increasing doses of Minnelide for 48 h and subjected to flow cytometry analyses to evaluate apoptotic cell death. Minnelide treatment induced significant apoptotic cell death in all the three cell lines (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA-C). Next, we examined the CSC population assessed suing the CD44\\u003csup\\u003e+\\u003c/sup\\u003eCD24\\u003csup\\u003e\\u0026minus;\\u003c/sup\\u003e phenotype \\u003csup\\u003e\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e\\u003c/sup\\u003e in these cell lines after 72 h treatment with the indicated doses of Minnelide. There was a dose-dependent and significant reduction in the CSC population in both TNBC cell lines, MDA-MB231 and Sum159 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD and E). In contrast, the CSC population was unexpectedly increased in the luminal MCF7 cell line despite significant apoptotic cell death (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eF). We further evaluated the activity of Minnelide in murine breast cancer cell lines, 4T1 and EMT6. The murine 4T1 tumor model is a well-characterized representative of the human TNBC subtype \\u003csup\\u003e\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e\\u003c/sup\\u003e, which constitutes a high CSC population and exhibit aggressive/metastatic properties compared with the less invasive EMT6 tumor model \\u003csup\\u003e\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e\\u003c/sup\\u003e. As expected, Minnelide induced a dose-dependent induction of apoptotic cell death and concomitant reduction of the CSC population defined by CD24\\u003csup\\u003e+\\u003c/sup\\u003eCD29\\u003csup\\u003e+\\u003c/sup\\u003e phenotype in 4T1 tumor cells after 48- and 72-hours treatment respectively (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA and B). However, Minnelide induced nonspecific toxicity in EMT6 tumor cells as there was massive cell death at 75nM and higher doses while there was no activity with lower doses of the drug (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC). Moreover, the CSC population in EMT6 cells was not significantly changed upon Minnelide treatment despite significant cell death (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). Together our \\u003cem\\u003ein vitro\\u003c/em\\u003e data provide evidence of the specificity of Minnelide for the basal-like/TNBC subtype.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMinnelide targets HSP70 and Myc pathways in basal/TNBC subtype\\u003c/h2\\u003e \\u003cp\\u003eThe broad anti-tumorigenic activity of Minnelide has been attributed to its ability to target multiple signaling pathways \\u003csup\\u003e\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u003c/sup\\u003e. Although it was shown to target XBP subunit of the transcription factor II H (TFIIH)-BRD4 super-enhancer complex, specific protein-ligand complex was not shown for HSP70 binding. We performed a molecular docking algorithm by using the Glide/XP program and determined the specific binding site of Minnelide on HSP70 (Supplemental Fig. S2). We previously reported that the A20/HSP70 signaling pathway is specifically activated in TNBCs \\u003csup\\u003e\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u003c/sup\\u003e. Myc expression was determined to be the main target for clinical evaluation in currently ongoing Phase II trial \\u003csup\\u003e\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e. Therefore, we examined the activity of Minnelide in targeting A20/HSP70 and Vimentin in MDA-MB231, 4T1, and EMT6 cell lines. TGFβ is a well-established factor for driving EMT and CSC phenotypes \\u003csup\\u003e\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e\\u003c/sup\\u003e and is highly expressed by the immunosuppressive myeloid cell population \\u003csup\\u003e\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e\\u003c/sup\\u003e. Minnelide suppressed TGFβ-induced HSP70 and A20 expression, in addition to inhibiting the expression of the mesenchymal marker, vimentin (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA and B). Next, we evaluated the effect of Minnelide on Myc and Brd4 expression. The latter is required for Myc expression \\u003csup\\u003e\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e\\u003c/sup\\u003e. Although they were not responsive to TGFβ stimulation in either cell line, Minnelide effectively inhibited Myc and Brd4 expression (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA and B). In contrast, the EMT6 cell line was poorly responsive to TGFβ stimulation, and neither the expression levels of the indicated proteins were significantly changed or had notable Minnelide effect (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC). Interestingly, Myc was inhibited at higher doses in EMT6 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC). Our study suggests that Myc is one of the main targets of Minnelide. Unprocessed raw data for each western blot analysis are provided in Supplementary Fig. S3A-C.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMyc expression is higher in basal-like/ER-negative breast tumors and predict poor overall survival\\u003c/h2\\u003e \\u003cp\\u003eMyc is one of the most frequently activated oncogenes and central drivers in multiple cancers, including breast cancer \\u003csup\\u003e\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e\\u003c/sup\\u003e. Although Myc alterations include frequent amplification, overexpression and rare mutations, it has been shown that high mRNA expression, not amplification, predicts poor overall survival in patients with breast cancer \\u003csup\\u003e\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e\\u003c/sup\\u003e. Furthermore, a renewed interest in targeting Myc with new-generation inhibitors is under preclinical development \\u003csup\\u003e\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e\\u003c/sup\\u003e as well as in phase I clinical trials \\u003csup\\u003e\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e\\u003c/sup\\u003e. Using TCGA data set, we showed that Myc alterations were substantially higher in basal-like (59%) and ER-negative (48%) than in ER-positive (20%) breast cancers (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eD). As expected, elevated \\u003cem\\u003eMyc\\u003c/em\\u003e mRNA expression predicted poorer overall survival in women with basal-like/ER-negative breast cancer (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eE and F). However, this was not predictive in patients with ER-positive tumors (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eG). Altogether these data confirmed the significance of Myc protein in basal-like/ER-negative tumors.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eMinnelide in combination with cyclophosphamide suppress tumor growth and eliminate metastasis by targeting CSCs and enhancing cytotoxic T cell infiltration\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe murine 4T1 tumor model is a well-established TNBC subtype that generates spontaneous metastasis in the lungs and other tissues by inducing an immunosuppressive pre-metastatic niche \\u003csup\\u003e\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e\\u003c/sup\\u003e. To evaluate the \\u003cem\\u003ein vivo\\u003c/em\\u003e activity of Minnelide, we treated 4T1 tumor-bearing mice with Minnelide (0.5mg/kg daily), or CTX (150mg/kg weekly), or a combination of both drugs for 5 week. Although Minnelide alone had a modest activity in reducing tumor growth in 4T1 tumor-bearing mice, when combined with CTX, it significantly reduced tumor growth, compared to the single Minnelide or CTX treatments (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA). As expected, reduced tumor growth was concordant with reduced spleen size in the respective animals (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB). Next, we determined the impact of the combination therapy on spontaneous metastasis in the treated mice. Although single Minnelide or CTX modestly reduced spontaneous metastasis, combination of the two eliminated metastasis in the lungs and spleens as ex-vivo images by bioluminescence showed no signals (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC and D). When analyzing residual tumors, we found that the CSC population was significantly reduced by the combination of Minnelide and CTX (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eE), suggesting it\\u0026rsquo;s \\u003cem\\u003ein vivo\\u003c/em\\u003e activity on tumor cells. We previously reported that cytotoxic T cells (CTL) were characterized by CD8\\u003csup\\u003e+\\u003c/sup\\u003eLy6C\\u003csup\\u003e+\\u003c/sup\\u003e phenotype in BALB/c mice \\u003csup\\u003e\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e\\u003c/sup\\u003e and; therefore, we analyzed immune cells in residual tumors and spleens from treated mice. There was significantly higher CTL infiltration in residual tumors and spleens that were treated with a combination of Minnelide and CTX (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eF and G). The granulocytic subset of myeloid derived suppressor cell (gMDSC) population, defined by the CD11b\\u003csup\\u003e+\\u003c/sup\\u003eLy6C\\u003csup\\u003eint\\u003c/sup\\u003e phenotype, was also reduced in mice treated with combination therapy (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eH).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eNeoadjuvant combination therapy with Minnelide plus cyclophosphamide eliminates residual 4T1 tumors in syngeneic mice\\u003c/h2\\u003e \\u003cp\\u003eOur lab previously demonstrated in a 4T1 tumor model that mice show local and distant recurrences following the resection of primary tumors \\u003csup\\u003e\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e\\u003c/sup\\u003e. Consistent with our data (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA and B), it has been widely reported that standard of care chemotherapeutics, including CTX, show modest activity in eliminating disseminated 4T1 tumor cells \\u003csup\\u003e\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e\\u003c/sup\\u003e. Therefore, we investigated the therapeutic potential of Minnelide plus CTX in a neoadjuvant setting to target disseminated 4T1 tumor cells. We treated 4T1 tumor-bearing mice with Minnelide (0.5mg/kg/daily) alone or in combination with CTX for 2 weeks in neoadjuvant setting before resecting the residual tumors, and then continued the treatment for another 3 weeks. Control mice developed local and distant recurrences within three weeks post-resection and were sacrificed (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA). Minnelide alone modestly reduced relapse after surgery, and one mouse completely cleared residual tumors (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eB). In contrast, the combination of Minnelide and CTX therapy eliminated residual tumors in all mice that were free of local and distant recurrences for up to 6 months (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eC). We next evaluated circulating MDSCs in control and treated mice one-week after resection. Peripheral blood mononuclear cells (PBMCs) from mice treated with Minnelide plus cyclophosphamide contained substantially lower levels of monocytic and granulocytic MDSCs than those from Minnelide treated or control mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eD-F).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMinnelide induces a distinct polarization of monocytes towards CD11c\\u003csup\\u003e+\\u003c/sup\\u003eCD86\\u003csup\\u003e+\\u003c/sup\\u003e phenotype\\u003c/h2\\u003e \\u003cp\\u003eTo further examine the effect of Minnelide on myeloid cell population, we utilized monocyte/macrophage cell line, RAW264.7 (called RAW4 hereafter) which is widely used to induce macrophage polarization in response to various factors including IL-4, IL-13 and LPS \\u003csup\\u003e\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e \\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e\\u003c/sup\\u003e. RAW4 cells, under normal culture conditions, are mainly CD11b positive (\\u0026gt;\\u0026thinsp;95%) and roughly half of these (54%) express both CD11b and CD11c surface markers (CD11b\\u003csup\\u003e+\\u003c/sup\\u003eCD11c\\u003csup\\u003e+\\u003c/sup\\u003e), while small fraction of cells (~\\u0026thinsp;1%) are characterized by single CD11c\\u003csup\\u003e+\\u003c/sup\\u003e phenotype (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eA). As previously reported, IL-4 effectively polarize these populations towards single Cd11b\\u003csup\\u003e+\\u003c/sup\\u003e phenotype (~\\u0026thinsp;87%) reducing the CD11b\\u003csup\\u003e+\\u003c/sup\\u003eCD11c\\u003csup\\u003e+\\u003c/sup\\u003e phenotype from 54.1\\u0026ndash;7.84% whereas LPS increased the CD11b\\u003csup\\u003e+\\u003c/sup\\u003eCD11c\\u003csup\\u003e+\\u003c/sup\\u003e population from 54.1\\u0026ndash;69.2% (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eA blue boxes). Consistent with the literature, IL-4 enriched CD11b\\u003csup\\u003e+\\u003c/sup\\u003eLy6G\\u003csup\\u003e+\\u003c/sup\\u003e subset which were effectively depleted by Minnelide (Supplementary Fig.\\u0026nbsp;4A and B). In addition, Minnelide treatment not only effectively polarized the RAW4 cells towards single CD11c\\u003csup\\u003e+\\u003c/sup\\u003e phenotype (37.2%) compared to the control (1.05%), but it also reversed the effect of IL-4 or LPS treatment increasing the CD11c\\u003csup\\u003e+\\u003c/sup\\u003e subset from 0.27\\u0026ndash;17.7% and 1.15\\u0026ndash;6.54% respectively (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eA red boxes and B). TCGA data analyses showed that higher CD11c (ITGAX) expression predicted better survival among patients with breast cancer (Supplementary Fig. S5). Because the CD86 surface marker is upregulated during dendritic cell maturation and type I macrophage polarization \\u003csup\\u003e\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e\\u003c/sup\\u003e, we examined whether Minnelide could expand this CD86\\u0026thinsp;+\\u0026thinsp;subset in RAW4 cells. Although CD11b\\u003csup\\u003e+\\u003c/sup\\u003eCD86\\u003csup\\u003e+\\u003c/sup\\u003e population was reduced (data not shown), there was a substantial expansion of the CD11c\\u003csup\\u003e+\\u003c/sup\\u003eCD86\\u003csup\\u003e+\\u003c/sup\\u003e subset (from 33.7\\u0026ndash;63.5%) upon Minnelide treatment compared to that in the control (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eC red boxes and D). As expected, IL-4 treatment significantly reduced this CD11c\\u003csup\\u003e+\\u003c/sup\\u003eCD86\\u003csup\\u003e+\\u003c/sup\\u003e subset to 6.79% from 33.7% in the control whereas LPS had no effect (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eC red boxes and D). When treated in combination, Minnelide reversed the effect of IL-4 on the CD11c\\u003csup\\u003e+\\u003c/sup\\u003eCD86\\u003csup\\u003e+\\u003c/sup\\u003es phenotype increasing it to 62.8% from 6.79% in the single IL-4 treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eC red boxes and D). Furthermore, Minnelide was able to reverse IL-4 or LPS-induced expression of cytokines, \\u003cem\\u003eIL-1B\\u003c/em\\u003e, \\u003cem\\u003eIL-4\\u003c/em\\u003e, \\u003cem\\u003eIL-6\\u003c/em\\u003e, \\u003cem\\u003eIL-10\\u003c/em\\u003e and \\u003cem\\u003eTLR4\\u003c/em\\u003e which drive the polarization of myeloid cells towards immunosuppressive macrophages and MDSCs (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eE). Consistent with this notion, the transcription factor, CCAAT/enhancer-binding protein delta (\\u003cem\\u003eCEBPδ\\u003c/em\\u003e) involved in macrophage differentiation \\u003csup\\u003e\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e\\u003c/sup\\u003e, was also suppressed by Minnelide (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eF). Interestingly, Minnelide induced the upregulation of type I interferon receptor (\\u003cem\\u003eIFNAR1\\u003c/em\\u003e), which has been shown to restrict the acquisition of immunosuppressive activity in myeloid progenitors \\u003csup\\u003e\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e\\u003c/sup\\u003e, which is in line with its downregulation by IL-4 or LPS (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eG).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThe standard of care chemotherapeutics remains the mainstream treatment for patients with the basal/TNBC subtype \\u003csup\\u003e\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e\\u003c/sup\\u003e despite the early clinical development of molecularly targeted therapeutics \\u003csup\\u003e\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e\\u003c/sup\\u003e. Although cytotoxic agents have shown significant benefits in the neo-adjuvant setting and in extending the life of patients, the majority of those relapse and develop more aggressive disease. Similarly, although 4T1 tumors, classified as murine TNBC \\u003csup\\u003e\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e\\u003c/sup\\u003e, respond to neoadjuvant CTX treatment in syngeneic mice by significantly reducing tumor size, the standard of care chemotherapeutics including CTX fail to eliminate disseminated tumor cells \\u003csup\\u003e\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e\\u003c/sup\\u003e. The aggressive properties of basal/TNBC subtype are attributed to their heterogeneity and phenotypic (EMT/CSC) plasticity \\u003csup\\u003e\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e\\u003c/sup\\u003e as well as their ability to drive an immunosuppressive tumor microenvironment \\u003csup\\u003e\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u003c/sup\\u003e. Therefore, therapeutics designed to target both tumor intrinsic pathways and TME are expected to improve disease outcome in patients with the basal/TNBC subtype.\\u003c/p\\u003e \\u003cp\\u003eMinnelide, has shown promising preclinical activity against multiple malignancies \\u003csup\\u003e\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u003c/sup\\u003e, is currently being evaluated in Phase II clinical trial (NCT04896073) for patients with advanced refractory pancreatic carcinoma \\u003csup\\u003e\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e. Therefore, we evaluated the activity of Minnelide in a series of human and murine breast cancer cell lines and demonstrated that Minnelide induces dose dependent apoptotic cell death specifically in basal/TNBC cell lines. Because Minnelide targets transcriptional super enhancers (BRD4), Myc and HSP70, which are all implicated in cancer stemness of basal/TNBC \\u003csup\\u003e\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e\\u003c/sup\\u003e, we reasoned that it may target CSC subsets in these cell lines. Minnelide effectively depleted CSC population in human (MDA-MB231 and SUM159) and murine TNBC (4T1) cell lines, while having no significant effect on CSC from luminal MCF7 or murine EMT6 cell lines. Consistent with our findings, Minnelide has been shown to target CD133\\u0026thinsp;+\\u0026thinsp;tumor-initiating cells in pancreatic ductal adenocarcinoma \\u003csup\\u003e\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e\\u003c/sup\\u003e. The anti-tumorigenic activity of Minnelide is attributed to its unique ability to target multiple oncogenic signaling molecules, including the HSP70 signaling pathway, in multiple malignancies \\u003csup\\u003e\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u003c/sup\\u003e. Moreover, we previously demonstrated that upregulation of the A20/HSP70 pathway expanded the CSC population in the TNBC subtype in response to TNFα \\u003csup\\u003e\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u003c/sup\\u003e. As expected, Minnelide mediated depletion of CSCs in TNBC may be mediated by targeting the A20/HSP70 signaling axis.\\u003c/p\\u003e \\u003cp\\u003eMinnelide binds to the XBP subunit of the transcription factor II H (TFIIH)-BRD4 super-enhancer complex that regulates many targets, including \\u003cem\\u003ec-Myc\\u003c/em\\u003e expression \\u003csup\\u003e\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e\\u003c/sup\\u003e. It was also reported that the anti-tumor activity of BRD4 inhibitor in TNBC was shown to be mediated by the downregulation of Myc expression \\u003csup\\u003e\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e\\u003c/sup\\u003e. Thus, the scientific exploratory end points included the evaluation of \\u003cem\\u003eMyc\\u003c/em\\u003e expression and accessibility of loci for the \\u003cem\\u003eMyc\\u003c/em\\u003e gene in pre- and post-treatment tumors \\u003csup\\u003e\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e\\u003c/sup\\u003e. Although Myc was not induced by TGFβ, Minnelide most effectively inhibited Myc expression in both MDA-MB231 and 4T1 TNBC cell lines, and moderately downregulated Myc expression in EMT6 cells. This is significant because Myc is widely implicated oncogene in approximately 70% of malignancies and play a role in therapeutic resistance \\u003csup\\u003e\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e\\u003c/sup\\u003e. Furthermore, Myc gene alterations and overexpression were significantly higher in Basal-like and ER-negative breast cancer subtypes than the luminal subtype. Although, it was considered \\u0026ldquo;undraggable\\u0026rdquo; until recently \\u003csup\\u003e\\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e\\u003c/sup\\u003e, new generation small molecule inhibitors of Myc are in preclinical development and early clinical trials \\u003csup\\u003e\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e\\u003c/sup\\u003e. Consistent with our data, Myc inhibition also depleted CSC populations in the TNBC subtype \\u003csup\\u003e\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e\\u003c/sup\\u003e. To the best of our knowledge, this is the first study to demonstrate significant inhibition of Myc by Minnelide in TNBC subtype. Preclinical studies and ongoing clinical trials suggest that Minnelide sensitizes cancer cells to conventional chemotherapy \\u003csup\\u003e\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e \\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u003c/sup\\u003e. In line with this evidence, we demonstrated that although it showed a modest in vivo activity, it effectively sensitized 4T1 tumors to cyclophosphamide. Increased tumor infiltration and systemic expansion of cytotoxic T cells in mice treated with combination therapy also indicated that Minnelide may reprogram the immunosuppressive TME. This is supported by a significant reduction in gMDSCs, which we previously demonstrated to drive pulmonary metastasis in 4T1 tumor-bearing mice \\u003csup\\u003e\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e\\u003c/sup\\u003e. We and others have reported that 4T1 tumors quickly relapse after surgical resection of primary tumors due to disseminated tumor cells \\u003csup\\u003e\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e\\u003c/sup\\u003e and conventional chemotherapeutics fail to eliminate these disseminated tumor cells \\u003csup\\u003e\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e\\u003c/sup\\u003e. Women with TNBC show a pathological complete response to platinum based agents in the neoadjuvant setting; however, high residual disease burden post-surgery is correlated with a higher risk of recurrence and death \\u003csup\\u003e\\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e\\u003c/sup\\u003e. Surprisingly, the combination of Minnelide with cyclophosphamide effectively eliminated these residual tumors following surgery and mice were free of local and metastatic recurrences for up to 6-months. Complete elimination of gMDSCs in mice treated with Minnelide in combination with cyclophosphamide suggested reprogramming of the microenvironment towards anti-tumorigenic immunity. This is consistent with a previous report that Minnelide targets pro-tumorigenic stroma, a hallmark of pancreatic carcinoma \\u003csup\\u003e\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e\\u003c/sup\\u003e. Despite the overwhelming evidence of clinical significance, targeting or reprogramming immunosuppressive macrophages/MDSCs has been challenging, in part due to their phenotypic and functional heterogeneity \\u003csup\\u003e\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e\\u003c/sup\\u003e. Among the cytokines, IL-4 has been well characterized to polarize myeloid cells towards type II macrophages/MDSCs. Owing to its significance, the therapeutic utility of targeting IL-4Rα has been explored in preclinical and early clinical trials. It was recently shown that IL-4Rα targeting antibody, dupilumab effectively reduced circulating monocytes and expanded tumor-infiltrating CD8 T cells \\u003csup\\u003e\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e\\u003c/sup\\u003e. Minnelide effectively reversed the IL-4 induced phenotypic polarization of RAW4 cells towards CD11c\\u003csup\\u003e+\\u003c/sup\\u003eCD86\\u003csup\\u003e+\\u003c/sup\\u003e phenotype which is primarily expressed by mature dendritic cells (DCs). Therefore, we postulate that DCs with CD11c\\u003csup\\u003e+\\u003c/sup\\u003eCD86\\u003csup\\u003e+\\u003c/sup\\u003e phenotype within the tumor microenvironment may function as antigen-presenting cells, driving the infiltration and activation of cytotoxic T cells. This is supported by a previous study suggesting that DCs with CD11c\\u003csup\\u003e+\\u003c/sup\\u003eCD86\\u003csup\\u003e+\\u003c/sup\\u003e phenotype are capable of migrating to tumor-draining lymph nodes for proper antigen presentation \\u003csup\\u003e\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e\\u003c/sup\\u003e. Moreover, the CD86 marker is also expressed during anti-tumorigenic type I macrophage polarization \\u003csup\\u003e\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eIn conclusion, we provide ample evidence that Minnelide targets tumor intrinsic pathways while reprogramming the immunosuppressive microenvironment and enhancing T cell infiltration in syngeneic mice. Our findings provide significant promise for its clinical utility and thus warrant further investigation in clinical settings.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAuthors\\u0026rsquo; Disclosures\\u003c/h2\\u003e \\u003cp\\u003eAuthors declare no conflict of interest relevant to the studies presented in this manuscript.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAuthors\\u0026rsquo; Contributions\\u003c/h2\\u003e \\u003cp\\u003e\\u003cb\\u003eH. Korkaya\\u003c/b\\u003e: Conceptualization, experimental design, resources, supervision, data analyses and curation, validation, funding acquisition, project administration, writing the original draft and review and editing. \\u003cb\\u003eF. Koksalar Alkan\\u003c/b\\u003e: Experimental design, data collection, supervision, analyses and curation, manuscript writing, review and editing. \\u003cb\\u003eA.B. Caglayan\\u003c/b\\u003e: Experimental design, data collection, analyses and curation, manuscript writing, review and editing. \\u003cb\\u003eHK. Alkan\\u003c/b\\u003e: Data collection, validation, analysis and curation. \\u003cb\\u003eE. Benson\\u003c/b\\u003e: Data collection, analysis and curation. \\u003cb\\u003eY.E. Gunduz, O. Sensoy, S. Durdagi, E. Zarbaliyev, A. Shull, A. Chadli, H. Shi\\u003c/b\\u003e: Resources, data curation, manuscript review and editing. \\u003cb\\u003eH. Assad\\u003c/b\\u003e: Clinical perspective, manuscript review and editing. \\u003cb\\u003eG. Ozturk\\u003c/b\\u003e: Resources, data curation, critical review and editing of the manuscript.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch2\\u003eAcknowledgements\\u003c/h2\\u003e \\u003cp\\u003eWe acknowledge the Augusta University Flow Cytometry Core Facility and the Microscopy, Imaging and Cytometry Resources Core (MICR) at Wayne State University for the flow cytometry support. MICR is supported in part by the NIH Center grant P30 CA22453 to the Karmanos Cancer Institute and R50 CA251068-01 to Kamiar Moin, Wayne State University. This study was supported by the National Institute of Health NCI grant R01CA251676 and Karmanos Cancer Institute Startup fund to H. Korkaya.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eDent R, Trudeau M, Pritchard KI, et al. Triple-negative breast cancer: clinical features and patterns of recurrence. Clin Cancer Res 2007;13(15 Pt 1):4429\\u0026ndash;34. doi: 13/15/4429 [pii] 10.1158/1078\\u0026thinsp;\\u0026ndash;\\u0026thinsp;0432.CCR-06-3045 [published Online First: 2007/08/03]\\u003c/li\\u003e\\n\\u003cli\\u003ePrat A, Parker JS, Karginova O, et al. Phenotypic and molecular characterization of the claudin-low intrinsic subtype of breast cancer. Breast Cancer Res 2010;12(5):R68. doi: bcr2635 [pii]10. 1186/bcr2635 [published Online First: 2010/09/04]\\u003c/li\\u003e\\n\\u003cli\\u003eLee E, Ouzounova M, Piranlioglu R, et al. The pleiotropic effects of TNFalpha in breast cancer subtypes is regulated by TNFAIP3/A20. \\u003cem\\u003eOncogene\\u003c/em\\u003e 2018 doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41388-018-0472-0\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 2018/09/01]\\u003c/li\\u003e\\n\\u003cli\\u003eKorkaya H, Kim GI, Davis A, et al. Activation of an IL6 inflammatory loop mediates trastuzumab resistance in HER2\\u0026thinsp;+\\u0026thinsp;breast cancer by expanding the cancer stem cell population. Mol Cell 2012;47(4):570\\u0026ndash;84. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.molcel.2012.06.014 S1097-2765(12)00509-6\\u003c/span\\u003e\\u003c/span\\u003e [pii] [published Online First: 2012/07/24]\\u003c/li\\u003e\\n\\u003cli\\u003eDalerba P, Cho RW, Clarke MF. Cancer stem cells: models and concepts. Annu Rev Med 2007;58:267\\u0026ndash;84.\\u003c/li\\u003e\\n\\u003cli\\u003eKeren L, Bosse M, Marquez D, et al. A Structured Tumor-Immune Microenvironment in Triple Negative Breast Cancer Revealed by Multiplexed Ion Beam Imaging. \\u003cem\\u003eCell\\u003c/em\\u003e 2018;174(6):1373-87 e19. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.cell.2018.08.039\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\n\\u003cli\\u003eNoel P, Hussein S, Ng S, et al. Triptolide targets super-enhancer networks in pancreatic cancer cells and cancer-associated fibroblasts. Oncogenesis 2020;9(11):100. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41389-020-00285-9\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20201109]\\u003c/li\\u003e\\n\\u003cli\\u003eHou ZY, Tong XP, Peng YB, et al. Broad targeting of triptolide to resistance and sensitization for cancer therapy. Biomed Pharmacother 2018;104:771\\u0026ndash;80. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.biopha.2018.05.088\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20180529]\\u003c/li\\u003e\\n\\u003cli\\u003eTitov DV, Gilman B, He QL, et al. XPB, a subunit of TFIIH, is a target of the natural product triptolide. Nat Chem Biol 2011;7(3):182\\u0026ndash;8. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nchembio.522\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20110130]\\u003c/li\\u003e\\n\\u003cli\\u003eHuang H, Hu J, Maryam A, et al. Defining super-enhancer landscape in triple-negative breast cancer by multiomic profiling. Nat Commun 2021;12(1):2242. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41467-021-22445-0\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20210414]\\u003c/li\\u003e\\n\\u003cli\\u003eDong J, Li J, Li Y, et al. Transcriptional super-enhancers control cancer stemness and metastasis genes in squamous cell carcinoma. Nat Commun 2021;12(1):3974. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41467-021-24137-1\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20210625]\\u003c/li\\u003e\\n\\u003cli\\u003eBanerjee S, Nomura A, Sangwan V, et al. CD133\\u0026thinsp;+\\u0026thinsp;tumor initiating cells in a syngenic murine model of pancreatic cancer respond to Minnelide. Clin Cancer Res 2014;20(9):2388\\u0026ndash;99. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1158/1078-0432.CCR-13-2947\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20140314]\\u003c/li\\u003e\\n\\u003cli\\u003ePhillips PA, Dudeja V, McCarroll JA, et al. Triptolide induces pancreatic cancer cell death via inhibition of heat shock protein 70. Cancer Res 2007;67(19):9407\\u0026ndash;16. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1158/0008-5472.CAN-07-1077\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\n\\u003cli\\u003eLee E, Ouzounova M, Piranlioglu R, et al. The pleiotropic effects of TNFalpha in breast cancer subtypes is regulated by TNFAIP3/A20. \\u003cem\\u003eOncogene\\u003c/em\\u003e 2019;38(4):469\\u0026thinsp;\\u0026ndash;\\u0026thinsp;82. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41388-018-0472-0\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20180830]\\u003c/li\\u003e\\n\\u003cli\\u003eLi H, Pan GF, Jiang ZZ, et al. Triptolide inhibits human breast cancer MCF-7 cell growth via downregulation of the ERalpha-mediated signaling pathway. Acta Pharmacol Sin 2015;36(5):606\\u0026ndash;13. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/aps.2014.162\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20150413]\\u003c/li\\u003e\\n\\u003cli\\u003eYang J, Xu J, Wang W, et al. Epigenetic regulation in the tumor microenvironment: molecular mechanisms and therapeutic targets. Signal Transduct Target Ther 2023;8(1):210. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41392-023-01480-x\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20230522]\\u003c/li\\u003e\\n\\u003cli\\u003eSun H, Huang B, Cao J, et al. Editorial: Epigenetic Regulation and Tumor Immunotherapy. Front Oncol 2022;12:893157. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fonc.2022.893157\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20220505]\\u003c/li\\u003e\\n\\u003cli\\u003eXu Y, Wu Y, Zhang S, et al. A Tumor-Specific Super-Enhancer Drives Immune Evasion by Guiding Synchronous Expression of PD-L1 and PD-L2. \\u003cem\\u003eCell reports\\u003c/em\\u003e 2019;29(11):3435-47 e4. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.celrep.2019.10.093\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\n\\u003cli\\u003eLiang M, Fu J. Triptolide inhibits interferon-gamma-induced programmed death-1-ligand 1 surface expression in breast cancer cells. Cancer Lett 2008;270(2):337\\u0026ndash;41. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.canlet.2008.05.025\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20080624]\\u003c/li\\u003e\\n\\u003cli\\u003eModi S, Giri B, Gupta VK, et al. Minnelide synergizes with conventional chemotherapy by targeting both cancer and associated stroma components in pancreatic cancer. Cancer Lett 2022;537:215591. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.canlet.2022.215591\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20220407]\\u003c/li\\u003e\\n\\u003cli\\u003eMa T, Hu C, Lal B, et al. Reprogramming Transcription Factors Oct4 and Sox2 Induce a BRD-Dependent Immunosuppressive Transcriptome in GBM-Propagating Cells. Cancer Res 2021;81(9):2457\\u0026ndash;69. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1158/0008-5472.CAN-20-2489\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20210211]\\u003c/li\\u003e\\n\\u003cli\\u003eNoel P, Von Hoff DD, Saluja AK, et al. Triptolide and Its Derivatives as Cancer Therapies. Trends Pharmacol Sci 2019;40(5):327\\u0026ndash;41. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.tips.2019.03.002\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20190408]\\u003c/li\\u003e\\n\\u003cli\\u003eChugh R, Sangwan V, Patil SP, et al. A preclinical evaluation of Minnelide as a therapeutic agent against pancreatic cancer. Sci Transl Med 2012;4(156):156ra39. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1126/scitranslmed.3004334\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\n\\u003cli\\u003eSkorupan N, Ahmad MI, Steinberg SM, et al. A phase II trial of the super-enhancer inhibitor Minnelide in advanced refractory adenosquamous carcinoma of the pancreas. Future Oncol 2022;18(20):2475\\u0026ndash;81. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.2217/fon-2021-1609\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20220510]\\u003c/li\\u003e\\n\\u003cli\\u003eOlsson MH, Sondergaard CR, Rostkowski M, et al. PROPKA3: Consistent Treatment of Internal and Surface Residues in Empirical pKa Predictions. J Chem Theory Comput 2011;7(2):525\\u0026ndash;37. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1021/ct100578z\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20110106]\\u003c/li\\u003e\\n\\u003cli\\u003eHarder E, Damm W, Maple J, et al. OPLS3: A Force Field Providing Broad Coverage of Drug-like Small Molecules and Proteins. J Chem Theory Comput 2016;12(1):281\\u0026ndash;96. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1021/acs.jctc.5b00864\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20151201]\\u003c/li\\u003e\\n\\u003cli\\u003eJohnston RC, Yao K, Kaplan Z, et al. Epik: pK(a) and Protonation State Prediction through Machine Learning. J Chem Theory Comput 2023;19(8):2380\\u0026ndash;88. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1021/acs.jctc.3c00044\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20230406]\\u003c/li\\u003e\\n\\u003cli\\u003eMaryam A, Chin YR. ANLN Enhances Triple-Negative Breast Cancer Stemness Through TWIST1 and BMP2 and Promotes its Spheroid Growth. Front Mol Biosci 2021;8:700973. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fmolb.2021.700973\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20210701]\\u003c/li\\u003e\\n\\u003cli\\u003eAl-Hajj M, Wicha MS, Benito-Hernandez A, et al. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 2003;100(7):3983\\u0026ndash;8. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1073/pnas.0530291100\\u003c/span\\u003e\\u003c/span\\u003e 0530291100 [pii] [published Online First: 2003/03/12]\\u003c/li\\u003e\\n\\u003cli\\u003eKaur P, Nagaraja GM, Zheng H, et al. A mouse model for triple-negative breast cancer tumor-initiating cells (TNBC-TICs) exhibits similar aggressive phenotype to the human disease. BMC Cancer 2012;12:120. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/1471-2407-12-120\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\n\\u003cli\\u003ePiranlioglu R, Lee E, Ouzounova M, et al. Primary tumor-induced immunity eradicates disseminated tumor cells in syngeneic mouse model. Nat Commun 2019;10(1):1430. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41467-019-09015-1\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 2019/03/31]\\u003c/li\\u003e\\n\\u003cli\\u003eOuzounova M, Lee E, Piranlioglu R, et al. Monocytic and granulocytic myeloid derived suppressor cells differentially regulate spatiotemporal tumour plasticity during metastatic cascade. Nature communications 2017;8:14979.\\u003c/li\\u003e\\n\\u003cli\\u003eMani SA, Guo W, Liao MJ, et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 2008;133(4):704\\u0026ndash;15. doi: S0092-8674(08)00444-3 [pii] 10.1016/j.cell.2008.03.027 [published Online First: 2008/05/20]\\u003c/li\\u003e\\n\\u003cli\\u003eBatlle E, Massague J. Transforming Growth Factor-beta Signaling in Immunity and Cancer. Immunity 2019;50(4):924\\u0026ndash;40. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.immuni.2019.03.024\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\n\\u003cli\\u003eKotekar A, Singh AK, Devaiah BN. BRD4 and MYC: power couple in transcription and disease. FEBS J 2023;290(20):4820\\u0026ndash;42. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/febs.16580\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20220803]\\u003c/li\\u003e\\n\\u003cli\\u003ePelengaris S, Khan M, Evan G. c-MYC: more than just a matter of life and death. Nat Rev Cancer 2002;2(10):764\\u0026ndash;76. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nrc904\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\n\\u003cli\\u003eKatsuta E, Yan L, Takeshita T, et al. High MYC mRNA Expression Is More Clinically Relevant than MYC DNA Amplification in Triple-Negative Breast Cancer. Int J Mol Sci 2019;21(1) doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3390/ijms21010217\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20191228]\\u003c/li\\u003e\\n\\u003cli\\u003eTang M, O'Grady S, Crown J, et al. MYC as a therapeutic target for the treatment of triple-negative breast cancer: preclinical investigations with the novel MYC inhibitor, MYCi975. Breast Cancer Res Treat 2022;195(2):105\\u0026ndash;15. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s10549-022-06673-6\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20220730]\\u003c/li\\u003e\\n\\u003cli\\u003eWu X, Nelson M, Basu M, et al. MYC oncogene is associated with suppression of tumor immunity and targeting Myc induces tumor cell immunogenicity for therapeutic whole cell vaccination. Journal for immunotherapy of cancer 2021;9(3) doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1136/jitc-2020-001388\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\n\\u003cli\\u003eWhitfield JR, Soucek L. The long journey to bring a Myc inhibitor to the clinic. J Cell Biol 2021;220(8) doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1083/jcb.202103090\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20210623]\\u003c/li\\u003e\\n\\u003cli\\u003eOuzounova M, Lee E, Piranlioglu R, et al. Monocytic and granulocytic myeloid derived suppressor cells differentially regulate spatiotemporal tumour plasticity during metastatic cascade. Nat Commun 2017;8:14979. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/ncomms14979\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\n\\u003cli\\u003eOrecchioni S, Talarico G, Labanca V, et al. Vinorelbine, cyclophosphamide and 5-FU effects on the circulating and intratumoural landscape of immune cells improve anti-PD-L1 efficacy in preclinical models of breast cancer and lymphoma. Br J Cancer 2018;118(10):1329\\u0026ndash;36. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41416-018-0076-z\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20180426]\\u003c/li\\u003e\\n\\u003cli\\u003eLaMarche NM, Hegde S, Park MD, et al. An IL-4 signalling axis in bone marrow drives pro-tumorigenic myelopoiesis. Nature 2024;625(7993):166\\u0026ndash;74. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41586-023-06797-9\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20231206]\\u003c/li\\u003e\\n\\u003cli\\u003eYang Y, Sun D, Zhou J, et al. LPS expands MDSCs by inhibiting apoptosis through the regulation of the GATA2/let-7e axis. Immunol Cell Biol 2019;97(2):142\\u0026ndash;51. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1111/imcb.12204\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20181021]\\u003c/li\\u003e\\n\\u003cli\\u003eDel Prete A, Salvi V, Soriani A, et al. Dendritic cell subsets in cancer immunity and tumor antigen sensing. Cell Mol Immunol 2023;20(5):432\\u0026ndash;47. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41423-023-00990-6\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20230322]\\u003c/li\\u003e\\n\\u003cli\\u003eMa RY, Black A, Qian BZ. Macrophage diversity in cancer revisited in the era of single-cell omics. Trends Immunol 2022;43(7):546\\u0026ndash;63. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.it.2022.04.008\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20220609]\\u003c/li\\u003e\\n\\u003cli\\u003eJauch-Speer SL, Herrera-Rivero M, Ludwig N, et al. C/EBPdelta-induced epigenetic changes control the dynamic gene transcription of S100a8 and S100a9. Elife 2022;11 doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.7554/eLife.75594\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20220511]\\u003c/li\\u003e\\n\\u003cli\\u003eAlicea-Torres K, Sanseviero E, Gui J, et al. Immune suppressive activity of myeloid-derived suppressor cells in cancer requires inactivation of the type I interferon pathway. Nat Commun 2021;12(1):1717. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41467-021-22033-2\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20210319]\\u003c/li\\u003e\\n\\u003cli\\u003eMarra A, Trapani D, Viale G, et al. Practical classification of triple-negative breast cancer: intratumoral heterogeneity, mechanisms of drug resistance, and novel therapies. NPJ Breast Cancer 2020;6:54. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41523-020-00197-2\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20201016]\\u003c/li\\u003e\\n\\u003cli\\u003ePang Y, Bai G, Zhao J, et al. The BRD4 inhibitor JQ1 suppresses tumor growth by reducing c-Myc expression in endometrial cancer. J Transl Med 2022;20(1):336. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s12967-022-03545-x\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20220728]\\u003c/li\\u003e\\n\\u003cli\\u003eLlombart V, Mansour MR. Therapeutic targeting of \\\"undruggable\\\" MYC. \\u003cem\\u003eEBioMedicine\\u003c/em\\u003e 2022;75:103756. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.ebiom.2021.103756\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20211220]\\u003c/li\\u003e\\n\\u003cli\\u003eYang A, Qin S, Schulte BA, et al. MYC Inhibition Depletes Cancer Stem-like Cells in Triple-Negative Breast Cancer. Cancer Res 2017;77(23):6641\\u0026ndash;50. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1158/0008-5472.CAN-16-3452\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20170926]\\u003c/li\\u003e\\n\\u003cli\\u003eBianchini G, Balko JM, Mayer IA, et al. Triple-negative breast cancer: challenges and opportunities of a heterogeneous disease. Nat Rev Clin Oncol 2016;13(11):674\\u0026ndash;90. doi: \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/nrclinonc.2016.66\\u003c/span\\u003e\\u003c/span\\u003e [published Online First: 20160517]\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3959342/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3959342/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eTriple negative breast cancer (TNBC) subtype is characterized with higher EMT/stemness properties and immune suppressive tumor microenvironment (TME). Women with advanced TNBC exhibit aggressive disease and have limited treatment options. Although immune suppressive TME is implicated in driving aggressive properties of basal/TNBC subtype and therapy resistance, effectively targeting it remains a challenge. Minnelide, a prodrug of triptolide currently being tested in clinical trials, has shown anti-tumorigenic activity in multiple malignancies via targeting super enhancers, Myc and anti-apoptotic pathways such as HSP70. Distinct super-enhancer landscape drives cancer stem cells (CSC) in TNBC subtype while inducing immune suppressive TME. We show that Minnelide selectively targets CSCs in human and murine TNBC cell lines compared to cell lines of luminal subtype by targeting Myc and HSP70. Minnelide in combination with cyclophosphamide significantly reduces the tumor growth and eliminates metastasis by reprogramming the tumor microenvironment and enhancing cytotoxic T cell infiltration in 4T1 tumor-bearing mice. Resection of residual tumors following the combination treatment leads to complete eradication of disseminated tumor cells as all mice are free of local and distant recurrences. All control mice showed recurrences within 3 weeks of post-resection while single Minnelide treatment delayed recurrence and one mouse was free of tumor. We provide evidence that Minnelide targets tumor intrinsic pathways and reprograms the immune suppressive microenvironment. Our studies also suggest that Minnelide in combination with cyclophosphamide may lead to durable responses in patients with basal/TNBC subtype warranting its clinical investigation.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Dual activity of Minnelide chemosensitize basal/triple negative breast cancer stem cells and reprograms immunosuppressive tumor microenvironment\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-02-22 21:11:00\",\"doi\":\"10.21203/rs.3.rs-3959342/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"6362e907-99f9-43f8-be23-6833cb205b73\",\"owner\":[],\"postedDate\":\"February 22nd, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":28899300,\"name\":\"Health sciences/Diseases/Cancer/Breast cancer\"},{\"id\":28899301,\"name\":\"Biological sciences/Cancer/Cancer microenvironment\"}],\"tags\":[],\"updatedAt\":\"2024-03-08T12:32:05+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-02-22 21:11:00\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3959342\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3959342\",\"identity\":\"rs-3959342\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}