{"paper_id":"2c6fb7ce-2f97-4f67-a7ce-e6e9ecbdde78","body_text":"Fasudil alleviates lipopolysaccharides-triggered damage to BEAS-2B cells and human lung organoids by inducing CLDN4 expression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Fasudil alleviates lipopolysaccharides-triggered damage to BEAS-2B cells and human lung organoids by inducing CLDN4 expression Chenghang Jiang, Liming Xu, Tianpeng Wang, Shengang Zhou, Gaoxiang Li, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5481369/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Fasudil, a well-known selective ROCK inhibitor, is commonly used to treat cerebral vasospasm. Recent research suggests that Fasudil may also have therapeutic potential for lung conditions such as pulmonary hypertension and acute lung injury (ALI). However, the specific mechanisms by which Fasudil protects lung tissues, especially lung epithelial cells, remain unclear. In this study, we examined the impact of Fasudil on the viability, apoptosis, and reactive oxygen species (ROS) levels in human lung epithelial cell line BEAS-2B and human lung organoids (HLOs) exposed to lipopolysaccharides (LPS). Our results show that Fasudil significantly enhances cell viability, reduces apoptosis, and decreases ROS levels in BEAS-2B cells and HLOs induced by LPS. At the molecular level, Fasudil increases the expression of CLDN4 in these cells and organoids, and the protective effects of Fasudil against LPS-induced damage are diminished in the absence of CLDN4. These findings identify CLDN4 as a key mediator of Fasudil’s protective effects on lung epithelial cells and organoids. Our study improves the understanding of Fasudil’s therapeutic mechanisms and highlights the potential for using Fasudil and/or targeting CLDN4 in the treatment of lung conditions like ALI. Acute lung injury Lipopolysaccharides Fasudil CLDN4 BEAS-2B cell Human lung organoid Oxidative stress Apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Acute lung injury (ALI) is marked by progressive hypoxemia and dyspnea, significantly contributing to the mortality of critically ill patients and making it a leading cause of death (Matthay, Zemans et al. 2019, Mokrá 2020). Risk factors for ALI include lung infection, sepsis, trauma, and more (Johnson and Matthay 2010). Pathologically, ALI leads to the breakdown of the alveolar-capillary membrane and the transepithelial infiltration of neutrophils, resulting in increased secretion of proinflammatory cytokines and an uncontrolled inflammatory response (Nova, Skovierova et al. 2019). Although advances in protective lung ventilation and supportive care have reduced ALI mortality in recent years (Matuschak and Lechner 2010), the development of effective pharmacologic interventions remains limited, impeding the efficacy of ALI treatment. Fasudil (Fas), also known as (±)-5-(1,4-Diazepane-1-sulfonyl) isoquinoline, is a potent and selective inhibitor of Rho-associated protein kinase (ROCK) (Zhao, Zhou et al. 2006). ROCK, a downstream effector of the small GTPase Rho, participates in a variety of cellular functions, including motility, proliferation, and apoptosis (Julian and Olson 2014). Clinically, Fas is used to treat a range of conditions, especially those involving vascular dysfunction and neuroprotection (Huang, Wu et al. 2018, Wang, Song et al. 2022), and also shows potential as an anti-cancer agent (Zhao, Zhang et al. 2019, Huo, Su et al. 2020). Additionally, Fas has demonstrated efficacy in mitigating ALI in animal models (Wang, Kong et al. 2019, Abedi, Hayes et al. 2020). However, the precise mechanisms of Fas's protective effects, particularly in lung epithelial cells, remain incompletely understood. In our research, we first established an in vitro ALI cell model by exposing the BEAS-2B cells with lipopolysaccharides (LPS). We then evaluated the impact of Fas on the viability, apoptosis, and reactive oxygen species (ROS) levels in LPS-treated BEAS-2B cells. We also investigated whether CLDN4, an intercellular tight junction molecule, was involved in the protective mechanisms mediated by Fas in LPS-induced BEAS-2B cells. Additionally, we assess the influence of the Fasudil-CLDN4 axis in LPS-induced human lung organoids (HLOs). Materials and methods Cell culture and LPS treatment BEAS-2B cells, obtained from American Type Culture Collection (CRL-3588), were cultured in DMEM (11965092, Gibco) supplemented with 10% fetal bovine serum (FBS, A5670701, Gibco) and a penicillin-streptomycin solution (15140122, Gibco). A humidified incubator with 5% CO 2 was used to maintain the cells. For LPS (tlrl-pbSlps, InvivoGen) treatment, the cells were incubated with specified concentrations of LPS for 24 hours. For Fas (S1573, Selleck) treatment, the cells were subjected to varying concentrations of PBS-diluted Fasudil for a duration of 24 hours. shRNAs and lentivirus transfection The control and CLDN4-targeting shRNAs were inserted into the PLKO.1-TRC-puro plasmid, resulting in plasmids named shNC and shCLDN4, respectively. These plasmids were then sequenced to verify the accuracy of the inserted DNA fragments before further experiments. The primers for plasmid construction are detailed below: shCLDN4-F: 5’- CCGGGCAACATTGTCACCTCGCAGACTCGAGTCTGCGAGGTGACAATGTTGCTTTTT-3’, shCLDN4-R: 5’- AATTAAAAAGCAACATTGTCACCTCGCAGACTCGAGTCTGCGAGGTGACAATGTTGC-3’; shNC-F: 5’- CCGGTTCTCCGAACGTGTCACGTTTCTCGAGAAACGTGACACGTTCGGAGAATTTTT-3’, shNC-R: 5’- AATTAAAAATTCTCCGAACGTGTCACGTTTCTCGAGAAACGTGACACGTTCGGAGAA-3’. Plasmid construction was completed, followed by lentivirus preparation. Briefly, 293T cells (CRL-3216, ATCC) were inoculated in 10 cm cell culture dishes, and the medium was changed to serum-free medium 2 h before transfection. Take a sterilized centrifuge tube and add 9 µg of shNCh or shCLDN4 plasmid, 6 ug of psPAX2 plasmid, and 3 ug of pMD2.G plasmid, and mix with 500 ul of Opti-MEM (31985070, Gibco). Another centrifuge tube was filled with 500 ul of Opti-MEM and 60 µL of ExFect Transfection Reagent (T101-01/02, Vazyme) and incubated for 5 min at room temperature, then the liquid in the two centrifuge tubes was mixed and allowed to stand at room temperature for 20 min. After 8 h, the medium containing the transfection mixture was discarded, 10 mL of cell culture medium containing 10% FBS was added, and the cells were further incubated at 37°C with 5% CO 2 for 48 h. The supernatant was collected as the lentivirus solution. The optimized multiplicity of infection (MOI) was 20. The cells or HLOs were cultured with either control or shCLDN4 lentivirus for 24 hours before further experiments. CCK-8 assay CCK-8 was used to determine cell viability. BEAS-2B cells were placed in 96-well plates with a density of 2,000 cells per well and incubated overnight. The cells were subsequently exposed to specified doses of LPS and/or Fas for a duration of 24 hours. After administering the treatment, each well received 10 µL of CCK-8 solution (HY-K0301, MCE), and the plates were incubated at 37°C for a duration of 1.5 hours. The OD 450 values were measured using a Flexstation3 microplate reader (Molecular Devices, USA). Annexin V/PI assay To assess cell apoptosis, cells were stained using Annexin V/PI according to the instructions provided with the Apoptosis Detection Kit (V13242, Invitrogen). BEAS-2B cells were grown in 6-well plates and subjected to treatments as outlined in the experimental protocol. Following treatment, the cells were collected, centrifuged, and then resuspended in staining buffer. Next, the Annexin V/PI mixture was added to the cell suspension. This mixture was then incubated for 10 minutes in darkness. Following staining, the cells were analyzed using a NovoCyte 1300 flow cytometer (Agilent Technologies, USA). Data processing was conducted using NovoExpress® software (version 1.4.1, Agilent Technologies). qPCR Total RNA was extracted using the TRIzol reagent (15596026, Invitrogen, USA) and subsequently converted to cDNA using HiScript® II Q RT SuperMix (R223-01, Vazyme, China). Quantitative PCR (qPCR) was carried out using a QuantStudio 6 system (Thermo Fisher Scientific, USA) and SYBR Green Master Mix (Q111-02, Vazyme). Gene expression levels were quantified utilizing the comparative 2 −ΔΔCt approach. The primers utilized for the qPCR are detailed as follows: CLDN4-qF: 5’-GGGGCAAGTGTACCAACTG-3’, CLDN4-qR: 5’-GACACCGGCACTATCACCA-3’; 18S-qF: 5’-CGACGACCCATTCGAACGTCT-3’, 18S-qR: 5’-CTCTCCGGAATCGAACCCTGA-3; CXCR4-qF: 5’-ACGCCACCAACAGTCAGAG-3’, CXCR4-qR: 5’- AGTCGGGAATAGTCAGCAGGA-3’; SOX17-qF: 5’- GTGGACCGCACGGAATTTG-3’, SOX17-qR: 5’- GGAGATTCACACCGGAGTCA-3’; FOXA2-qF: 5’- GGAGCAGCTACTATGCAGAGC-3’, FOXA2-qR: 5’-CGTGTTCATGCCGTTCATCC-3’; SOX2-qF: 5’- TACAGCATGTCCTACTCGCAG-3’, SOX2-qR: 5’- GAGGAAGAGGTAACCACAGGG-3’; NKX2-1-qF: 5’- AGCACACGACTCCGTTCTC-3’, NKX2-1-qR: 5’- GCCCACTTTCTTGTAGCTTTCC-3’; AGER-qF: 5’- CGTGTCTACCAGATTCCT-3’, AGER-qR: 5’- CATGTCCCCACCTTATTG-3’; SP-B-qF: 5’- GCAACGTCCTCCCCTTGAAG-3’, SP-B-qR: 5’- AGTCAGTCTGGTTCTGGAAGTAG-3’; SP-C-qF: 5’- CCCACAAGTTCTACAAAGCCA-3’, SP-C-qR: 5’- TCCCGAAGAGGCGTCTCTG-3’; KRT5-qF: 5’- AGGAGTTGGACCAGTCAACAT-3’, KRT5-qR: 5’- TGGAGTAGTAGCTTCCACTGC-3’; MUC5AC-qF: 5’- CCATTGCTATTATGCCCTGTGT-3’, MUC5AC-qR: 5’- TGGTGGACGGACAGTCACT-3’; SCGB3A2-qF: 5’- TGGAGGGGCTAAGGAAGTGT-3’, SCGB3A2-qR: 5’- ACCAAGTGTGATAGCGCCTC-3’. Western blot BEAS-2B cells were washed with PBS and disrupted using RIPA buffer (89901, Thermo Scientific) enriched with protease inhibitors (78420, Thermo Scientific). Protein concentrations were determined with a Pierce™ BCA Protein Assay Kits (23227, Thermo Scientific). Then, 20 µg of protein samples were separated by SDS-PAGE and transferred onto PVDF membranes. The membranes were treated with 5% nonfat milk to block non-specific binding and then incubated at 4°C with the appropriate primary antibodies. Following this, the membranes were treated with secondary antibodies for 2 hours at room temperature. After three more rinses with TBST, the membranes were exposed to ECL reagent (KF8003, Affinity). The signals were visualized and captured using a ChemiDoc imaging system (BioRad, USA). Band intensities were measured using ImageJ software (NIH, USA) and normalized against β-actin, which served as the internal control. The antibodies employed in the Western Blot analysis, along with their dilutions, are detailed in Table 1 . Table 1 Western blot antibody information. Target/antibody name Species Manufacture Catalog# Dilution Bax Mouse Immunoway, China YM3619 1:500 Bcl2 Proteintech, China 60178-1-Ig Claudin-4 Rabbit Immunoway YT0951 C-Caspase 3 Proteintech 19677-1-AP NRF2 80593-1-RR HO-1 10701-1-AP β-actin 20536-1-AP 1:1000 HRP-Anti-Mouse IgG Goat SA00001-1 1:10000 HRP-Anti-Rabbit IgG SA00001-2 Malondialdehyde (MDA), GSH/GSSG, superoxide dismutase (SOD), and nitric oxide (NO) levels evaluation MDA, GSH/GSSG, SOD, and NO levels were measured using MDA Colorimetric Assay Kit (EEA015, Invitrogen), Glutathione Colorimetric Assay Kit (EIAGSHC, Invitrogen), SOD Colorimetric Activity Assay Kit (EIASODC, Invitrogen), and Nitric Oxide Assay Kit (EMSNO, Invitrogen), respectively. All assays were conducted in accordance with the manufacturer's guidelines. ROS level detection ROS levels were quantified using a ROS Fluorometric Assay Kit (EEA019, Invitrogen) following the manufacturer's guidelines. BEAS-2B cells, after the specified treatments, were resuspended in serum-free medium to achieve a density of 1.0×10 6 cells/mL. Afterwards, the cells were treated with DCFH-DA and maintained at 37°C for 20 minutes in complete darkness, with intermittent inversion. The cells were rinsed with serum-free medium to eliminate any unbound DCFH-DA, resuspended in PBS, and analyzed using flow cytometry. Immunohistochemistry (IHC) and immunofluorescence (IF) For IHC, HLOs were fixed with 4% paraformaldehyde (PFA), embedded in paraffin, and sliced into sections 5 µm thick. These sections were subsequently dewaxed and rehydrated. Antigen retrieval was performed, followed by treatment with 3% H 2 O 2 . The slices were treated with 0.2% Triton X-100 in PBS for permeabilization and subsequently blocked with 1% BSA. They were then incubated overnight at 4°C with a Ki-67 antibody (ab15580, Abcam, UK, 1:500). Subsequently, the sections were treated with HRP-conjugated goat anti-rabbit IgG (SA00001-2, Proteintech, China, 1:1000) and incubated at room temperature for one hour. Following another wash, the sections underwent staining with DAB working solution (34002, Thermo Scientific), were counterstained with hematoxylin, and subsequently mounted for examination. Images were captured using an IX73 inverted microscope (OLYMPUS, Japan), and Ki-67 positive cells were quantified with Image-Pro Plus 6.0 (Media Cybernetics, USA). For IF, HLOs were fixed with 4% PFA, embedded in OCT, and sectioned into 10 µm thick slices using a cryostat. The slides were washed three times with PBST and blocked using 1% BSA for one hour. The slides were treated with primary antibody solutions overnight at 4°C. Next, the slides were treated with a secondary antibody solution for 1 hour at room temperature. Finally, the slides were counterstained with DAPI, mounted, and observed using LSM 900 confocal microscopy (Zeiss, Germany). The antibodies employed for IF are listed below: anti-KRT5 (A2662, Abclonal, China, 1:100), anti-AGER (16346-1-AP, Proteintech, 1:100), anti-SP-C (A1835, Abclonal, 1:100), and FITC-conjugated Goat Anti-Rabbit IgG (AS001, Abclonal, 1:100). Establishment of HLO The human embryonic stem cell (hESC) line H1 (IMV-L001, Immocell Biotechnology) was used to induce HLO, and the specific induction procedure was performed according to the Induction of Differentiated Lung-like Organs Kit (IM-H522, Immocell Biotechnology). Statistical analysis Statistical analyses and chart generation were conducted using GraphPad Prism software (version 8.0). Data are presented as mean ± standard deviation (SD). The Shapiro-Wilk test was applied to evaluate normality of the data distribution. For comparisons between two groups, unpaired two-tailed Student's t-tests were employed. For comparisons involving three or more groups, one-way analysis of variance (ANOVA) was utilized. Statistical significance was established at a p-value of less than 0.05. Results Fas protects BEAS-2B cells from LPS-induced damage To validate the influence of Fas on lung epithelial cells under LPS-triggered ALI, we first treated BEAS-2B cells, a commonly used lung epithelial cell line (Kinnula, Yankaskas et al. 1994), to varying concentrations of LPS. The CCK-8 assay results indicated that 4 µg/mL LPS significantly reduced the viability of cells (Figure S1 A). Given the relatively modest reduction in viability at this concentration, we opted to use 10 µg/mL LPS for subsequent experiments. Consistent with the decreased viability, LPS-treated BEAS-2B cells exhibited increased apoptosis compared to the PBS-treated control group (Mock), as shown by Annexin V/PI staining (Figure S1 B and C). Additionally, DCF-DA staining demonstrated a significant increase in ROS levels in BEAS-2B cells following LPS treatment (Figure S1 D and E). These findings confirmed the successful establishment of an LPS-induced ALI cellular model. Next, we optimized the concentration of Fas to use on BEAS-2B cells, aiming for an effective dose without significantly impacting cell viability. The CCK-8 assay results indicated that 80 µM Fas notably reduced BEAS-2B cell viability (Figure S1 F). Therefore, we selected 40 µM Fas for subsequent assays. To assess the impact of Fas on BEAS-2B cells treated with LPS, we conducted Annexin V/PI staining to evaluate apoptosis. The results showed that Fas significantly reduced the additional apoptosis induced by LPS (Fig. 1 A and B). Moreover, Fas treatment improved the impaired viability of LPS-treated BEAS-2B cells (Fig. 1 C). Fas also alleviated the oxidative stress induced by LPS, as evidenced by reduced ROS, MDA, and GSSG levels, and increased GSH and SOD levels (Fig. 1 D-J). Furthermore, Fas treatment restored the level of NO, a protective molecule secreted by lung epithelial cells in response to LPS-induced injury (Su, Day et al. 1996), in LPS-treated BEAS-2B cells (Fig. 1 K). Overall, these findings indicate that Fas has a protective influence on BEAS-2B cells exposed to LPS. Fas induces CLDN4 expression and represses apoptosis and ROS-related genes in LPS-treated BEAS-2B cells To understand how Fas protects BEAS-2B cells, we focused on CLDN4, a gene known to be stimulated during ALI and to regulate the function of the alveolar epithelial barrier (Wray, Mao et al. 2009). Surprisingly, both qPCR and Western blot analyses showed that LPS suppressed CLDN4 expression in BEAS-2B cells, while Fas treatment restored its levels (Fig. 2 A and B). Given that Fas alleviates apoptosis and oxidative stress in LPS-treated cells, we also examined genes involved in controlling apoptosis and ROS levels. Western blot data demonstrated that Fas treatment reduced the expression of pro-apoptotic factors Bax and cleaved Caspase 3 (C-Caspase 3), which were upregulated by LPS, and rescued the expression of the anti-apoptotic factor Bcl2, which was downregulated by LPS. Additionally, Fas inhibited the LPS-induced expression of NRF2 and HO-1 (Fig. 2 B), key regulators of intracellular ROS levels (Zhang, Ding et al. 2019, Jin, Botchway et al. 2021). These findings suggest that Fas mitigates apoptosis and ROS levels in BEAS-2B cells induced by LPS, potentially through the restoration of CLDN4 expression. CLDN4 deficiency mitigates the protective effect of Fas on LPS-treated BEAS-2B cells To investigate whether CLDN4 mediates Fas's protective effect in BEAS-2B cells induced by LPS, we knocked down CLDN4. qPCR data confirmed that CLDN4 expression was effectively reduced in BEAS-2B cells transfected with shCLDN4 (Fig. 3 A). Annexin V/PI staining revealed that the anti-apoptotic impact of Fas on BEAS-2B induced by LPS was abolished when CLDN4 was deficient (Fig. 3 B and C). Similarly, the CCK-8 assay showed that, in the absence of sufficient CLDN4, Fas could not enhance the viability of BEAS-2B cells (Fig. 3 D). Furthermore, Fas failed to alleviate oxidative stress in CLDN4-deficient cells, as evidenced by DCF-DA, MDA, GSH, GSSG, and SOD assays (Fig. 3 E-K). Additionally, the induction effect of Fas on NO synthesis was nullified upon CLDN4 knockdown (Fig. 3 L). At the molecular level, knocking down CLDN4 in LPS-treated BEAS-2B cells reduced the impact of Fas on the expression of Bax, Bcl2, cleaved Caspase 3, NRF2, and HO-1 (Fig. 4 ). Taken together, these results collectively suggest that CLDN4 is a critical effector downstream of Fas, protecting BEAS-2B cells from LPS-induced injury. CLDN4 deficiency attenuates the impact of Fas on LPS-treated HLOs To further confirm the role of the Fas-CLDN4 axis in LPS-induced ALI, we used an HLO model. HLOs were established from hESCs using a modified stepwise differentiation method (Chen, Feng et al. 2018, Zhao, Wu et al. 2023) (Figure S2). Specific markers for each stage of differentiation were confirmed by qPCR, showing successful identification of DE markers CXCR4 and SOX17, AFE markers FOXA2 and SOX2, LPC marker NKX2-1, and HLO markers KRT5, MUC5AC, SCGB3A2, AGER, SP-B, and SP-C (Green, Chen et al. 2011, Ikonomou, Herriges et al. 2020, Leibel, McVicar et al. 2020, Liang, Xiao et al. 2020) (Figure S3A-E). H&E staining confirmed that the HLOs exhibited airway epithelium morphology (Figure S3F), and IF results showed robust expression of AGER, KRT5, and SP-C (Figure S3G). These findings validated the successful establishment of HLOs from hESCs. HLOs were then infected with lentivirus carrying shNC or shCLDN4 and treated with 50 µg/mL LPS and/or 40 µM Fas. After 24 hours, HLOs were collected for analysis. IHC assays indicated that LPS significantly repressed proliferation within HLOs, while Fas reversed this anti-proliferative effect. However, this reversal by Fas was abolished when CLDN4 was depleted (Fig. 5 A and B). The size of HLOs, reduced by LPS, was counteracted by Fas in a CLDN4-dependent manner (Fig. 5 C). LPS treatment also increased ROS, MDA, and GSSG levels, and reduced GSH, SOD, and NO levels in HLOs. Fas mitigated these effects of LPS, and knockdown of CLDN4 nullified the protective effect of Fas (Fig. 5 D-K). Western blot analysis confirmed effective CLDN4 knockdown. Similar to its effect on BEAS-2B cells, LPS increased Bax, cleaved Caspase 3, NRF2, and HO-1 levels, and decreased Bcl2 expression in HLOs. Fas counteracted these LPS effects, relying on sufficient CLDN4 presence (Fig. 6 ). These observations suggest that the Fas-CLDN4 axis also protects HLOs from LPS-induced injury. Discussion ROCK is crucial in mediating vasoconstriction and vascular remodeling, which are key processes in the development of pulmonary hypertension (Montagnoli, da Silva et al. 2021). As a well-recognized selective ROCK inhibitor, Fas exhibits a protective effect on lung tissues from ALI-triggered injury. However, its effects on lung epithelial cells have remained unclear. Our research reveals that Fas alleviates LPS-induced damage in BEAS-2B cells and HLOs, indicating its potential impact on various pulmonary cell types beyond vascular cells. To investigate the underlying mechanisms, we focused on CLDN4, a crucial component of epithelial cell tight junctions (Gunzel and Yu 2013). CLDN4 is involved in regulating cell adhesion and polarity and is abnormally expressed in various cancers, affecting cell proliferation, apoptosis, and migration (Breed, Hicks et al. 2019, Fujiwara-Tani, Mori et al. 2023). Our findings consistently demonstrate that CLDN4 is a key mediator in enhancing the viability and survival of LPS-treated BEAS-2B cells by Fas. Interestingly, while ALI generally stimulates CLDN4 expression in lung epithelial cells (Rokkam, Lafemina et al. 2011), our data indicate that LPS represses CLDN4 levels in both BEAS-2B cells and HLOs. CLDN4 expression is regulated by multiple mechanisms, including the methylation status of its promoter, which is linked to dysregulation in various cancers (Boireau, Buchert et al. 2007, Kwon, Kim et al. 2010, Maesaka, Kuwada et al. 2022). Secreted signaling molecules like TGF-β and HIF1α also influence CLDN4 expression in different contexts (Rachakonda, Vu et al. 2016, Liu, Zhang et al. 2022). Additionally, inflammation can modulate CLDN4 expression through cytokines such as TNF-α and IL-18 (Yang, Cheon et al. 2015, Fujiwara-Tani, Sasaki et al. 2018). Thus, the suppressive impact of LPS on CLDN4 expression in our models is likely due to its pro-inflammatory nature, whereas elevated CLDN4 expression in other ALI contexts might involve other mechanisms like JNK pathway activation (Wray, Mao et al. 2009). The mechanism by which Fas increases CLDN4 expression appears complex. As a ROCK inhibitor, Fas should theoretically block the ROCK/JNK pathway, potentially decreasing CLDN4 expression. However, the increased CLDN4 expression observed may result from a reduction in cytokine secretion, which overrides the disrupted ROCK/JNK pathway. Further research is needed to explore this hypothesis. CLDN4 is also present in endothelial cells, and Fas has been shown to suppress pro-inflammatory cytokine expression in rat pulmonary microvascular endothelial cells exposed to LPS (Liu, Pan et al. 2022). Given Fas's recognized role in endothelial cells, it would be interesting to examine whether the Fas-CLDN4 axis also protects pulmonary endothelial cells from LPS-induced injury. It is noteworthy that our conclusions are based on in vitro experiments, and ALI animal models are necessary to support these findings. Conclusion In summary, our data reveal the crucial role of CLDN4 in facilitating the protective effects of Fas on BEAS-2B cells and HLOs induced by LPS. This study enhances the understanding of Fas’s pharmacological mechanisms and the function of CLDN4, highlighting the therapeutic potential of utilizing Fas to treat ALI. Declarations Competing interests: The authors declare that they have no conflict of interest. Consent to participate: N/A Consent to publication: N/A Ethical approval: N/A Funding This work was supported by the Zhejiang Province Medical and Health Science and Technology Plan Project (2023KY016) and Zhejiang Province Traditional Chinese Medicine Science and Technology Plan Project (2023ZL245). Author Contribution Competing interests: The authors declare that they have no conflict of interest.Consent to participate: N/AConsent to publication: N/AEthical approval: N/A Data availability statement All data supporting the conclusion of this study have been included in the manuscript and the supplemental files and are available from the corresponding author upon reasonable request. References Abedi, F., A. W. Hayes, R. Reiter and G. Karimi (2020). \"Acute lung injury: The therapeutic role of Rho kinase inhibitors.\" Pharmacological Research 155 : 104736. Boireau, S., M. Buchert, M. S. Samuel, J. Pannequin, J. L. Ryan, A. Choquet, H. Chapuis, X. Rebillard, C. Avancès, M. Ernst, D. Joubert, N. Mottet and F. Hollande (2007). \"DNA-methylation-dependent alterations of claudin-4 expression in human bladder carcinoma.\" Carcinogenesis 28 (2): 246-258. Breed, C., D. A. Hicks, P. G. Webb, C. E. Galimanis, B. G. Bitler, K. Behbakht and H. K. Baumgartner (2019). \"Ovarian Tumor Cell Expression of Claudin-4 Reduces Apoptotic Response to Paclitaxel.\" Mol Cancer Res 17 (3): 741-750. Chen, Y., J. Feng, S. Zhao, L. Han, H. Yang, Y. Lin and Z. Rong (2018). \"Long-Term Engraftment Promotes Differentiation of Alveolar Epithelial Cells from Human Embryonic Stem Cell Derived Lung Organoids.\" Stem Cells and Development 27 (19): 1339-1349. Fujiwara-Tani, R., S. Mori, R. Ogata, R. Sasaki, A. Ikemoto, S. Kishi, M. Kondoh and H. Kuniyasu (2023). \"Claudin-4: A New Molecular Target for Epithelial Cancer Therapy.\" International Journal of Molecular Sciences 24 (6): 5494. Fujiwara-Tani, R., T. Sasaki, Y. Luo, K. Goto, I. Kawahara, Y. Nishiguchi, S. Kishi, S. Mori, H. Ohmori, M. Kondoh and H. Kuniyasu (2018). \"Anti-claudin-4 extracellular domain antibody enhances the antitumoral effects of chemotherapeutic and antibody drugs in colorectal cancer.\" Oncotarget 9 (100): 37367-37378. Green, M. D., A. Chen, M. C. Nostro, S. L. d'Souza, C. Schaniel, I. R. Lemischka, V. Gouon-Evans, G. Keller and H. W. Snoeck (2011). \"Generation of anterior foregut endoderm from human embryonic and induced pluripotent stem cells.\" Nat Biotechnol 29 (3): 267-272. Gunzel, D. and A. S. Yu (2013). \"Claudins and the modulation of tight junction permeability.\" Physiol Rev 93 (2): 525-569. Huang, Y. Y., J. M. Wu, T. Su, S. Y. Zhang and X. J. Lin (2018). \"Fasudil, a Rho-Kinase Inhibitor, Exerts Cardioprotective Function in Animal Models of Myocardial Ischemia/Reperfusion Injury: A Meta-Analysis and Review of Preclinical Evidence and Possible Mechanisms.\" Front Pharmacol 9 : 1083. Huo, Z., Y. Su, Y. Dong, Y. Zheng, Q. Zhang, Y. Duan and G. Wang (2020). \"Rho-kinase inhibition by Fasudil promotes tumor maturation and apoptosis in small-cell lung cancer.\" Am J Transl Res 12 (8): 4354-4370. Ikonomou, L., M. J. Herriges, S. L. Lewandowski, R. Marsland, 3rd, C. Villacorta-Martin, I. S. Caballero, D. B. Frank, R. M. Sanghrajka, K. Dame, M. M. Kandula, J. Hicks-Berthet, M. L. Lawton, C. Christodoulou, A. J. Fabian, E. Kolaczyk, X. Varelas, E. E. Morrisey, J. M. Shannon, P. Mehta and D. N. Kotton (2020). \"The in vivo genetic program of murine primordial lung epithelial progenitors.\" Nat Commun 11 (1): 635. Jin, W., B. O. A. Botchway and X. Liu (2021). \"Curcumin Can Activate the Nrf2/HO-1 Signaling Pathway and Scavenge Free Radicals in Spinal Cord Injury Treatment.\" Neurorehabilitation and Neural Repair 35 (7): 576-584. Johnson, E. R. and M. A. Matthay (2010). \"Acute lung injury: epidemiology, pathogenesis, and treatment.\" J Aerosol Med Pulm Drug Deliv 23 (4): 243-252. Julian, L. and M. F. Olson (2014). \"Rho-associated coiled-coil containing kinases (ROCK): structure, regulation, and functions.\" Small GTPases 5 : e29846. Kinnula, V. L., J. R. Yankaskas, L. Chang, I. Virtanen, A. Linnala, B. H. Kang and J. D. Crapo (1994). \"Primary and immortalized (BEAS 2B) human bronchial epithelial cells have significant antioxidative capacity in vitro.\" Am J Respir Cell Mol Biol 11 (5): 568-576. Kwon, M. J., S. S. Kim, Y. L. Choi, H. S. Jung, C. Balch, S. H. Kim, Y. S. Song, V. E. Marquez, K. P. Nephew and Y. K. Shin (2010). \"Derepression of CLDN3 and CLDN4 during ovarian tumorigenesis is associated with loss of repressive histone modifications.\" Carcinogenesis 31 (6): 974-983. Leibel, S. L., R. N. McVicar, A. M. Winquist, W. D. Niles and E. Y. Snyder (2020). \"Generation of Complete Multi-Cell Type Lung Organoids From Human Embryonic and Patient-Specific Induced Pluripotent Stem Cells for Infectious Disease Modeling and Therapeutics Validation.\" Curr Protoc Stem Cell Biol 54 (1): e118. Liang, R., X. Xiao, L. Luo, T. Chen, H. Yang, W. Wang, Y. Zhang and Z. Wang (2020). \"Efficient Definitive Endoderm Differentiation from Human Parthenogenetic Embryonic Stem Cells Induced by Activin A and Wnt3a.\" Ann Clin Lab Sci 50 (4): 468-473. Liu, H., Z. Pan, X. Ma, J. Cui, J. Gao, Q. Miao, Z. Zhu, X. Chen and S. Su (2022). \"ROCK inhibitor fasudil reduces the expression of inflammatory factors in LPS-induced rat pulmonary microvascular endothelial cells via ROS/NF-κB pathway.\" BMC Pharmacol Toxicol 23 (1): 24. Liu, H., Z. Zhang, S. Zhou, X. Liu, G. Li, B. Song and W. Xu (2022). \"Claudin-1/4 as directly target gene of HIF-1α can feedback regulating HIF-1α by PI3K-AKT-mTOR and impact the proliferation of esophageal squamous cell though Rho GTPase and p-JNK pathway.\" Cancer Gene Ther 29 (6): 665-682. Maesaka, F., M. Kuwada, S. Horii, S. Kishi, R. Fujiwara-Tani, S. Mori, K. Fujii, T. Mori, H. Ohmori, T. Owari, M. Miyake, Y. Nakai, N. Tanaka, U. K. Bhawal, Y. Luo, M. Kondoh, K. Fujimoto and H. Kuniyasu (2022). \"Hypomethylation of CLDN4 Gene Promoter Is Associated with Malignant Phenotype in Urinary Bladder Cancer.\" Int J Mol Sci 23 (12). Matthay, M. A., R. L. Zemans, G. A. Zimmerman, Y. M. Arabi, J. R. Beitler, A. Mercat, M. Herridge, A. G. Randolph and C. S. Calfee (2019). \"Acute respiratory distress syndrome.\" Nature Reviews Disease Primers 5 (1): 18. Matuschak, G. M. and A. J. Lechner (2010). \"Acute lung injury and the acute respiratory distress syndrome: pathophysiology and treatment.\" Mo Med 107 (4): 252-258. Mokrá, D. (2020). \"Acute lung injury - from pathophysiology to treatment.\" Physiol Res 69 (Suppl 3): S353-s366. Montagnoli, T. L., J. S. da Silva, S. Z. Sudo, A. D. Santos, G. F. Gomide, M. P. L. de Sá and G. Zapata-Sudo (2021). \"ROCK Inhibition as Potential Target for Treatment of Pulmonary Hypertension.\" Cells 10 (7). Nova, Z., H. Skovierova and A. Calkovska (2019). \"Alveolar-Capillary Membrane-Related Pulmonary Cells as a Target in Endotoxin-Induced Acute Lung Injury.\" International Journal of Molecular Sciences 20 (4): 831. Rachakonda, G., T. Vu, L. Jin, D. Samanta and P. K. Datta (2016). \"Role of TGF-β-induced Claudin-4 expression through c-Jun signaling in non-small cell lung cancer.\" Cell Signal 28 (10): 1537-1544. Rokkam, D., M. J. Lafemina, J. W. Lee, M. A. Matthay and J. A. Frank (2011). \"Claudin-4 levels are associated with intact alveolar fluid clearance in human lungs.\" Am J Pathol 179 (3): 1081-1087. Su, W. Y., B. J. Day, B. H. Kang, J. D. Crapo, Y. C. Huang and L. Y. Chang (1996). \"Lung epithelial cell-released nitric oxide protects against PMN-mediated cell injury.\" Am J Physiol 271 (4 Pt 1): L581-586. Wang, J., H. Kong, J. Xu, Y. Wang, H. Wang and W. Xie (2019). \"Fasudil alleviates LPS-induced lung injury by restoring aquaporin 5 expression and inhibiting inflammation in lungs.\" The Journal of Biomedical Research 33 (3): 156-163. Wang, Q., L. J. Song, Z. B. Ding, Z. Chai, J. Z. Yu, B. G. Xiao and C. G. Ma (2022). \"Advantages of Rho-associated kinases and their inhibitor fasudil for the treatment of neurodegenerative diseases.\" Neural Regen Res 17 (12): 2623-2631. Wray, C., Y. Mao, J. Pan, A. Chandrasena, F. Piasta and J. A. Frank (2009). \"Claudin-4 augments alveolar epithelial barrier function and is induced in acute lung injury.\" Am J Physiol Lung Cell Mol Physiol 297 (2): L219-227. Yang, Y., S. Cheon, M. K. Jung, S. B. Song, D. Kim, H. J. Kim, H. Park, S. I. Bang and D. Cho (2015). \"Interleukin-18 enhances breast cancer cell migration via down-regulation of claudin-12 and induction of the p38 MAPK pathway.\" Biochem Biophys Res Commun 459 (3): 379-386. Zhang, X., M. Ding, P. Zhu, H. Huang, Q. Zhuang, J. Shen, Y. Cai, M. Zhao and Q. He (2019). \"New Insights into the Nrf-2/HO-1 Signaling Axis and Its Application in Pediatric Respiratory Diseases.\" Oxid Med Cell Longev 2019 : 3214196. Zhao, J., D. Zhou, J. Guo, Z. Ren, L. Zhou, S. Wang, B. Xu and R. Wang (2006). \"Effect of fasudil hydrochloride, a protein kinase inhibitor, on cerebral vasospasm and delayed cerebral ischemic symptoms after aneurysmal subarachnoid hemorrhage.\" Neurol Med Chir (Tokyo) 46 (9): 421-428. Zhao, S., X. Wu, Z. Tan, Y. Ren, L. Li, J. Ou, Y. Lin, H. Song, L. Feng, D. Seto, J. Wu, Q. Zhang and Z. Rong (2023). \"Generation of Human Embryonic Stem Cell-Derived Lung Organoids for Modeling Infection and Replication Differences between Human Adenovirus Types 3 and 55 and Evaluating Potential Antiviral Drugs.\" Journal of Virology 97 (5): e00209-00223. Zhao, Y., Y. Zhang, M. Vazirinejad Mehdiabad, K. Zhou, Y. Chen, L. Li, J. Guo and C. Xu (2019). \"Enhanced anti-tumor effect of liposomal Fasudil on hepatocellular carcinoma in vitro and in vivo.\" PLoS One 14 (10): e0223232. Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-5481369\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":380156320,\"identity\":\"0bcf2baa-dbb8-4bd0-97fb-fbd08cf5b4fe\",\"order_by\":0,\"name\":\"Chenghang Jiang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chenghang\",\"middleName\":\"\",\"lastName\":\"Jiang\",\"suffix\":\"\"},{\"id\":380156322,\"identity\":\"d5ce3355-4554-4604-a9ae-fac475731b49\",\"order_by\":1,\"name\":\"Liming Xu\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzUlEQVRIiWNgGAWjYFAC5oYDDAYMDPwSEB4xWhghWiRnkKIFTBncIFaLwY3ExkM3Cu7Ybb7dnfiBocI6sYH97AG8WiRnJDYczjF4lrztztnNEgxn0hMbePIS8GrhlwBrOZxsdiN3GwNj2+HEBgkeA7xa2GBajGeAtPwjQgvMFjsDCZCWBiK0SPY8BGtJkLiRu1ki4Vi6cRtPDn4tBseTD3/O+XPYnn9G7sYPH2qsZfvZz+DXAgOJDSAyAeQ7otQDgT2xCkfBKBgFo2AEAgB2J0ncsMhmfQAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Liming\",\"middleName\":\"\",\"lastName\":\"Xu\",\"suffix\":\"\"},{\"id\":380156323,\"identity\":\"e1fc2f77-615a-4de4-a65f-6ec530d3e777\",\"order_by\":2,\"name\":\"Tianpeng Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tianpeng\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":380156325,\"identity\":\"bc6e90b5-48f0-45b0-b64b-3ea61291fec3\",\"order_by\":3,\"name\":\"Shengang Zhou\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shengang\",\"middleName\":\"\",\"lastName\":\"Zhou\",\"suffix\":\"\"},{\"id\":380156326,\"identity\":\"e74c3bf6-61c7-4b3e-a2c9-3b25a4324b16\",\"order_by\":4,\"name\":\"Gaoxiang Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Gaoxiang\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":380156327,\"identity\":\"011a38f6-77e2-4d57-b4c1-ada4da485c42\",\"order_by\":5,\"name\":\"Yueliang Zheng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yueliang\",\"middleName\":\"\",\"lastName\":\"Zheng\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-11-19 08:08:16\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-5481369/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-5481369/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":70342184,\"identity\":\"8a4b167b-da88-404c-a07e-22c59f972a7c\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 10:12:24\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1253507,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eFas alleviates LPS-induced damage in BEAS-2B cells. \\u003c/strong\\u003e(A, B) Annexin V/PI staining showing apoptosis levels in cells with the specified treatments. (C) CCK-8 assay results demonstrating cell viability of BEAS-2B cells with the specified treatments. (D, E) DCF-DA staining indicating ROS levels in BEAS-2B cells with the specified treatments. (F-K) Measurements of MDA (F), GSH (G), GSSG (H), GSH/GSSG ratio (I), SOD (J), and NO (K) levels in cells with the specified treatments.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5481369/v1/9f4268ca2cd54c76cadf771b.png\"},{\"id\":70341200,\"identity\":\"09bf4183-3a71-46ee-8a8b-09b8d0020de6\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 10:04:24\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1094286,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eFas modulates CLDN4 expression and genes linked to apoptosis and ROS levels in LPS-treated BEAS-2B cells. \\u003c/strong\\u003e(A) qPCR data showing mRNA levels of CLDN4 in cells with the specified treatments. (B, C) Western blot analysis demonstrated the protein expression levels of CLDN4, Bax, Bcl2, C-Caspase 3, NRF2, and HO-1 in BEAS-2B cells with the specified treatments.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5481369/v1/e9a1fe45f39b4c04ab58d21b.png\"},{\"id\":70340808,\"identity\":\"2544906a-fad7-49b6-90d3-702d7dbc1ffc\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 09:56:24\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1224817,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eCLDN4 is essential for Fas’s protective effect on LPS-induced BEAS-2B cells. \\u003c/strong\\u003e(A) qPCR data showing mRNA levels of CLDN4 in cells with the specified treatments. (B, C) Annexin V/PI staining indicating apoptosis levels in BEAS-2B cells with the specified treatments. (D) CCK-8 assay results showing relative cell viability of BEAS-2B cells with the specified treatments. (E, F) DCF-DA staining revealing ROS levels in BEAS-2B cells with the specified treatments. (G-L) Measurements of MDA (G), GSH (H), GSSG (I), GSH/GSSG ratio (J), SOD (K), and NO (L) levels in BEAS-2B cells with the specified treatments.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5481369/v1/3ca3a4f433fe62ab0661b3b4.png\"},{\"id\":70341199,\"identity\":\"183bc155-5301-4969-9db4-19aa80ea6721\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 10:04:24\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1191775,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eCLDN4 deficiency disrupts Fas’s regulation of apoptosis and ROS-associated gene expression in LPS-exposed BEAS-2B cells. \\u003c/strong\\u003e(A, B) Western blot analysis demonstrated the protein expression levels of CLDN4, Bax, Bcl2, C-Caspase 3, NRF2, and HO-1 in BEAS-2B cells with the specified treatments.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5481369/v1/c1b7357295ed55a2bf2e71d0.png\"},{\"id\":70340827,\"identity\":\"66e513b9-8379-4338-9106-69db0c96949c\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 09:56:29\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":5273020,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eCLDN4 mediates the protective effect of Fas on LPS-treated HLOs. \\u003c/strong\\u003e(A, B) IHC data showing Ki-67 expression in HLOs with the specified treatments. (C) Measurement of HLO diameter ratios before and after the specified treatments. (D, E) DCF-DA staining indicating ROS levels in HLOs with the specified treatments. (F-J) Levels of MDA (F), GSH (G), GSSG (H), GSH/GSSG ratio (I), SOD (J), and NO (K) in pancreatic tissues from rats with the specified treatments.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5481369/v1/73560b5f166eb8de475f26ec.png\"},{\"id\":70340806,\"identity\":\"8e64013d-5e31-4b68-a5ab-0b161c3cfade\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 09:56:24\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1660075,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eCLDN4 deficiency abolishes Fas’s effects on apoptosis and ROS-related gene expression in LPS-treated HLOs. \\u003c/strong\\u003e(A, B)\\u003cstrong\\u003e \\u003c/strong\\u003eWestern blot analysis demonstrated the protein expression levels of CLDN4, Bax, Bcl2, C-Caspase 3, NRF2, and HO-1 in HLOs with the specified treatments.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5481369/v1/d33e4de0fb19a7787f1fad0b.png\"},{\"id\":78981190,\"identity\":\"eea82c1d-d02f-40c5-a1e5-2379f7d62107\",\"added_by\":\"auto\",\"created_at\":\"2025-03-21 16:16:39\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":12001419,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5481369/v1/323cbbf3-b354-49cc-8bce-999e7195cc90.pdf\"},{\"id\":70340807,\"identity\":\"a5620f0c-0fa4-4603-925d-7eb81630ed45\",\"added_by\":\"auto\",\"created_at\":\"2024-12-02 09:56:24\",\"extension\":\"docx\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":997506,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplementarymaterial.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-5481369/v1/e03ad3eb57acad2320dc8d83.docx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Fasudil alleviates lipopolysaccharides-triggered damage to BEAS-2B cells and human lung organoids by inducing CLDN4 expression\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eAcute lung injury (ALI) is marked by progressive hypoxemia and dyspnea, significantly contributing to the mortality of critically ill patients and making it a leading cause of death (Matthay, Zemans et al. 2019, Mokr\\u0026aacute; 2020). Risk factors for ALI include lung infection, sepsis, trauma, and more (Johnson and Matthay 2010). Pathologically, ALI leads to the breakdown of the alveolar-capillary membrane and the transepithelial infiltration of neutrophils, resulting in increased secretion of proinflammatory cytokines and an uncontrolled inflammatory response (Nova, Skovierova et al. 2019). Although advances in protective lung ventilation and supportive care have reduced ALI mortality in recent years (Matuschak and Lechner 2010), the development of effective pharmacologic interventions remains limited, impeding the efficacy of ALI treatment.\\u003c/p\\u003e \\u003cp\\u003eFasudil (Fas), also known as (\\u0026plusmn;)-5-(1,4-Diazepane-1-sulfonyl) isoquinoline, is a potent and selective inhibitor of Rho-associated protein kinase (ROCK) (Zhao, Zhou et al. 2006). ROCK, a downstream effector of the small GTPase Rho, participates in a variety of cellular functions, including motility, proliferation, and apoptosis (Julian and Olson 2014). Clinically, Fas is used to treat a range of conditions, especially those involving vascular dysfunction and neuroprotection (Huang, Wu et al. 2018, Wang, Song et al. 2022), and also shows potential as an anti-cancer agent (Zhao, Zhang et al. 2019, Huo, Su et al. 2020). Additionally, Fas has demonstrated efficacy in mitigating ALI in animal models (Wang, Kong et al. 2019, Abedi, Hayes et al. 2020). However, the precise mechanisms of Fas's protective effects, particularly in lung epithelial cells, remain incompletely understood.\\u003c/p\\u003e \\u003cp\\u003eIn our research, we first established an in vitro ALI cell model by exposing the BEAS-2B cells with lipopolysaccharides (LPS). We then evaluated the impact of Fas on the viability, apoptosis, and reactive oxygen species (ROS) levels in LPS-treated BEAS-2B cells. We also investigated whether CLDN4, an intercellular tight junction molecule, was involved in the protective mechanisms mediated by Fas in LPS-induced BEAS-2B cells. Additionally, we assess the influence of the Fasudil-CLDN4 axis in LPS-induced human lung organoids (HLOs).\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell culture and LPS treatment\\u003c/h2\\u003e \\u003cp\\u003eBEAS-2B cells, obtained from American Type Culture Collection (CRL-3588), were cultured in DMEM (11965092, Gibco) supplemented with 10% fetal bovine serum (FBS, A5670701, Gibco) and a penicillin-streptomycin solution (15140122, Gibco). A humidified incubator with 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e was used to maintain the cells. For LPS (tlrl-pbSlps, InvivoGen) treatment, the cells were incubated with specified concentrations of LPS for 24 hours. For Fas (S1573, Selleck) treatment, the cells were subjected to varying concentrations of PBS-diluted Fasudil for a duration of 24 hours.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eshRNAs and lentivirus transfection\\u003c/h3\\u003e\\n\\u003cp\\u003eThe control and CLDN4-targeting shRNAs were inserted into the PLKO.1-TRC-puro plasmid, resulting in plasmids named shNC and shCLDN4, respectively. These plasmids were then sequenced to verify the accuracy of the inserted DNA fragments before further experiments. The primers for plasmid construction are detailed below: shCLDN4-F: 5\\u0026rsquo;- CCGGGCAACATTGTCACCTCGCAGACTCGAGTCTGCGAGGTGACAATGTTGCTTTTT-3\\u0026rsquo;, shCLDN4-R: 5\\u0026rsquo;- AATTAAAAAGCAACATTGTCACCTCGCAGACTCGAGTCTGCGAGGTGACAATGTTGC-3\\u0026rsquo;; shNC-F: 5\\u0026rsquo;- CCGGTTCTCCGAACGTGTCACGTTTCTCGAGAAACGTGACACGTTCGGAGAATTTTT-3\\u0026rsquo;, shNC-R: 5\\u0026rsquo;- AATTAAAAATTCTCCGAACGTGTCACGTTTCTCGAGAAACGTGACACGTTCGGAGAA-3\\u0026rsquo;. Plasmid construction was completed, followed by lentivirus preparation. Briefly, 293T cells (CRL-3216, ATCC) were inoculated in 10 cm cell culture dishes, and the medium was changed to serum-free medium 2 h before transfection. Take a sterilized centrifuge tube and add 9 \\u0026micro;g of shNCh or shCLDN4 plasmid, 6 ug of psPAX2 plasmid, and 3 ug of pMD2.G plasmid, and mix with 500 ul of Opti-MEM (31985070, Gibco). Another centrifuge tube was filled with 500 ul of Opti-MEM and 60 \\u0026micro;L of ExFect Transfection Reagent (T101-01/02, Vazyme) and incubated for 5 min at room temperature, then the liquid in the two centrifuge tubes was mixed and allowed to stand at room temperature for 20 min. After 8 h, the medium containing the transfection mixture was discarded, 10 mL of cell culture medium containing 10% FBS was added, and the cells were further incubated at 37\\u0026deg;C with 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e for 48 h. The supernatant was collected as the lentivirus solution. The optimized multiplicity of infection (MOI) was 20. The cells or HLOs were cultured with either control or shCLDN4 lentivirus for 24 hours before further experiments.\\u003c/p\\u003e\\n\\u003ch3\\u003eCCK-8 assay\\u003c/h3\\u003e\\n\\u003cp\\u003eCCK-8 was used to determine cell viability. BEAS-2B cells were placed in 96-well plates with a density of 2,000 cells per well and incubated overnight. The cells were subsequently exposed to specified doses of LPS and/or Fas for a duration of 24 hours. After administering the treatment, each well received 10 \\u0026micro;L of CCK-8 solution (HY-K0301, MCE), and the plates were incubated at 37\\u0026deg;C for a duration of 1.5 hours. The OD\\u003csub\\u003e450\\u003c/sub\\u003e values were measured using a Flexstation3 microplate reader (Molecular Devices, USA).\\u003c/p\\u003e\\n\\u003ch3\\u003eAnnexin V/PI assay\\u003c/h3\\u003e\\n\\u003cp\\u003eTo assess cell apoptosis, cells were stained using Annexin V/PI according to the instructions provided with the Apoptosis Detection Kit (V13242, Invitrogen). BEAS-2B cells were grown in 6-well plates and subjected to treatments as outlined in the experimental protocol. Following treatment, the cells were collected, centrifuged, and then resuspended in staining buffer. Next, the Annexin V/PI mixture was added to the cell suspension. This mixture was then incubated for 10 minutes in darkness. Following staining, the cells were analyzed using a NovoCyte 1300 flow cytometer (Agilent Technologies, USA). Data processing was conducted using NovoExpress\\u0026reg; software (version 1.4.1, Agilent Technologies).\\u003c/p\\u003e\\n\\u003ch3\\u003eqPCR\\u003c/h3\\u003e\\n\\u003cp\\u003eTotal RNA was extracted using the TRIzol reagent (15596026, Invitrogen, USA) and subsequently converted to cDNA using HiScript\\u0026reg; II Q RT SuperMix (R223-01, Vazyme, China). Quantitative PCR (qPCR) was carried out using a QuantStudio 6 system (Thermo Fisher Scientific, USA) and SYBR Green Master Mix (Q111-02, Vazyme). Gene expression levels were quantified utilizing the comparative 2\\u003csup\\u003e\\u0026minus;ΔΔCt\\u003c/sup\\u003e approach. The primers utilized for the qPCR are detailed as follows: CLDN4-qF: 5\\u0026rsquo;-GGGGCAAGTGTACCAACTG-3\\u0026rsquo;, CLDN4-qR: 5\\u0026rsquo;-GACACCGGCACTATCACCA-3\\u0026rsquo;; 18S-qF: 5\\u0026rsquo;-CGACGACCCATTCGAACGTCT-3\\u0026rsquo;, 18S-qR: 5\\u0026rsquo;-CTCTCCGGAATCGAACCCTGA-3; CXCR4-qF: 5\\u0026rsquo;-ACGCCACCAACAGTCAGAG-3\\u0026rsquo;, CXCR4-qR: 5\\u0026rsquo;- AGTCGGGAATAGTCAGCAGGA-3\\u0026rsquo;; SOX17-qF: 5\\u0026rsquo;- GTGGACCGCACGGAATTTG-3\\u0026rsquo;, SOX17-qR: 5\\u0026rsquo;- GGAGATTCACACCGGAGTCA-3\\u0026rsquo;; FOXA2-qF: 5\\u0026rsquo;- GGAGCAGCTACTATGCAGAGC-3\\u0026rsquo;, FOXA2-qR: 5\\u0026rsquo;-CGTGTTCATGCCGTTCATCC-3\\u0026rsquo;; SOX2-qF: 5\\u0026rsquo;- TACAGCATGTCCTACTCGCAG-3\\u0026rsquo;, SOX2-qR: 5\\u0026rsquo;- GAGGAAGAGGTAACCACAGGG-3\\u0026rsquo;; NKX2-1-qF: 5\\u0026rsquo;- AGCACACGACTCCGTTCTC-3\\u0026rsquo;, NKX2-1-qR: 5\\u0026rsquo;- GCCCACTTTCTTGTAGCTTTCC-3\\u0026rsquo;; AGER-qF: 5\\u0026rsquo;- CGTGTCTACCAGATTCCT-3\\u0026rsquo;, AGER-qR: 5\\u0026rsquo;- CATGTCCCCACCTTATTG-3\\u0026rsquo;; SP-B-qF: 5\\u0026rsquo;- GCAACGTCCTCCCCTTGAAG-3\\u0026rsquo;, SP-B-qR: 5\\u0026rsquo;- AGTCAGTCTGGTTCTGGAAGTAG-3\\u0026rsquo;; SP-C-qF: 5\\u0026rsquo;- CCCACAAGTTCTACAAAGCCA-3\\u0026rsquo;, SP-C-qR: 5\\u0026rsquo;- TCCCGAAGAGGCGTCTCTG-3\\u0026rsquo;; KRT5-qF: 5\\u0026rsquo;- AGGAGTTGGACCAGTCAACAT-3\\u0026rsquo;, KRT5-qR: 5\\u0026rsquo;- TGGAGTAGTAGCTTCCACTGC-3\\u0026rsquo;; MUC5AC-qF: 5\\u0026rsquo;- CCATTGCTATTATGCCCTGTGT-3\\u0026rsquo;, MUC5AC-qR: 5\\u0026rsquo;- TGGTGGACGGACAGTCACT-3\\u0026rsquo;; SCGB3A2-qF: 5\\u0026rsquo;- TGGAGGGGCTAAGGAAGTGT-3\\u0026rsquo;, SCGB3A2-qR: 5\\u0026rsquo;- ACCAAGTGTGATAGCGCCTC-3\\u0026rsquo;.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eWestern blot\\u003c/h2\\u003e \\u003cp\\u003eBEAS-2B cells were washed with PBS and disrupted using RIPA buffer (89901, Thermo Scientific) enriched with protease inhibitors (78420, Thermo Scientific). Protein concentrations were determined with a Pierce\\u0026trade; BCA Protein Assay Kits (23227, Thermo Scientific). Then, 20 \\u0026micro;g of protein samples were separated by SDS-PAGE and transferred onto PVDF membranes. The membranes were treated with 5% nonfat milk to block non-specific binding and then incubated at 4\\u0026deg;C with the appropriate primary antibodies. Following this, the membranes were treated with secondary antibodies for 2 hours at room temperature. After three more rinses with TBST, the membranes were exposed to ECL reagent (KF8003, Affinity). The signals were visualized and captured using a ChemiDoc imaging system (BioRad, USA). Band intensities were measured using ImageJ software (NIH, USA) and normalized against β-actin, which served as the internal control. The antibodies employed in the Western Blot analysis, along with their dilutions, are detailed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eWestern blot antibody information.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"5\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTarget/antibody name\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eSpecies\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eManufacture\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eCatalog#\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eDilution\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBax\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eMouse\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eImmunoway, China\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eYM3619\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\" morerows=\\\"5\\\" rowspan=\\\"6\\\"\\u003e \\u003cp\\u003e1:500\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBcl2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eProteintech, China\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e60178-1-Ig\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eClaudin-4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\" morerows=\\\"4\\\" rowspan=\\\"5\\\"\\u003e \\u003cp\\u003eRabbit\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eImmunoway\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eYT0951\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eC-Caspase 3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\" morerows=\\\"5\\\" rowspan=\\\"6\\\"\\u003e \\u003cp\\u003eProteintech\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e19677-1-AP\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eNRF2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e80593-1-RR\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHO-1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e10701-1-AP\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eβ-actin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e20536-1-AP\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1:1000\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHRP-Anti-Mouse IgG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003eGoat\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eSA00001-1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\" morerows=\\\"1\\\" rowspan=\\\"2\\\"\\u003e \\u003cp\\u003e1:10000\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eHRP-Anti-Rabbit IgG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eSA00001-2\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eMalondialdehyde (MDA), GSH/GSSG, superoxide dismutase (SOD), and nitric oxide (NO) levels evaluation\\u003c/h3\\u003e\\n\\u003cp\\u003eMDA, GSH/GSSG, SOD, and NO levels were measured using MDA Colorimetric Assay Kit (EEA015, Invitrogen), Glutathione Colorimetric Assay Kit (EIAGSHC, Invitrogen), SOD Colorimetric Activity Assay Kit (EIASODC, Invitrogen), and Nitric Oxide Assay Kit (EMSNO, Invitrogen), respectively. All assays were conducted in accordance with the manufacturer's guidelines.\\u003c/p\\u003e\\n\\u003ch3\\u003eROS level detection\\u003c/h3\\u003e\\n\\u003cp\\u003eROS levels were quantified using a ROS Fluorometric Assay Kit (EEA019, Invitrogen) following the manufacturer's guidelines. BEAS-2B cells, after the specified treatments, were resuspended in serum-free medium to achieve a density of 1.0\\u0026times;10\\u003csup\\u003e6\\u003c/sup\\u003e cells/mL. Afterwards, the cells were treated with DCFH-DA and maintained at 37\\u0026deg;C for 20 minutes in complete darkness, with intermittent inversion. The cells were rinsed with serum-free medium to eliminate any unbound DCFH-DA, resuspended in PBS, and analyzed using flow cytometry.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImmunohistochemistry (IHC) and immunofluorescence (IF)\\u003c/h2\\u003e \\u003cp\\u003eFor IHC, HLOs were fixed with 4% paraformaldehyde (PFA), embedded in paraffin, and sliced into sections 5 \\u0026micro;m thick. These sections were subsequently dewaxed and rehydrated. Antigen retrieval was performed, followed by treatment with 3% H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e. The slices were treated with 0.2% Triton X-100 in PBS for permeabilization and subsequently blocked with 1% BSA. They were then incubated overnight at 4\\u0026deg;C with a Ki-67 antibody (ab15580, Abcam, UK, 1:500). Subsequently, the sections were treated with HRP-conjugated goat anti-rabbit IgG (SA00001-2, Proteintech, China, 1:1000) and incubated at room temperature for one hour. Following another wash, the sections underwent staining with DAB working solution (34002, Thermo Scientific), were counterstained with hematoxylin, and subsequently mounted for examination. Images were captured using an IX73 inverted microscope (OLYMPUS, Japan), and Ki-67 positive cells were quantified with Image-Pro Plus 6.0 (Media Cybernetics, USA).\\u003c/p\\u003e \\u003cp\\u003eFor IF, HLOs were fixed with 4% PFA, embedded in OCT, and sectioned into 10 \\u0026micro;m thick slices using a cryostat. The slides were washed three times with PBST and blocked using 1% BSA for one hour. The slides were treated with primary antibody solutions overnight at 4\\u0026deg;C. Next, the slides were treated with a secondary antibody solution for 1 hour at room temperature. Finally, the slides were counterstained with DAPI, mounted, and observed using LSM 900 confocal microscopy (Zeiss, Germany). The antibodies employed for IF are listed below: anti-KRT5 (A2662, Abclonal, China, 1:100), anti-AGER (16346-1-AP, Proteintech, 1:100), anti-SP-C (A1835, Abclonal, 1:100), and FITC-conjugated Goat Anti-Rabbit IgG (AS001, Abclonal, 1:100).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEstablishment of HLO\\u003c/h2\\u003e \\u003cp\\u003eThe human embryonic stem cell (hESC) line H1 (IMV-L001, Immocell Biotechnology) was used to induce HLO, and the specific induction procedure was performed according to the Induction of Differentiated Lung-like Organs Kit (IM-H522, Immocell Biotechnology).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eStatistical analyses and chart generation were conducted using GraphPad Prism software (version 8.0). Data are presented as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation (SD). The Shapiro-Wilk test was applied to evaluate normality of the data distribution. For comparisons between two groups, unpaired two-tailed Student's t-tests were employed. For comparisons involving three or more groups, one-way analysis of variance (ANOVA) was utilized. Statistical significance was established at a p-value of less than 0.05.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eFas protects BEAS-2B cells from LPS-induced damage\\u003c/h2\\u003e \\u003cp\\u003eTo validate the influence of Fas on lung epithelial cells under LPS-triggered ALI, we first treated BEAS-2B cells, a commonly used lung epithelial cell line (Kinnula, Yankaskas et al. 1994), to varying concentrations of LPS. The CCK-8 assay results indicated that 4 \\u0026micro;g/mL LPS significantly reduced the viability of cells (Figure \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003eA). Given the relatively modest reduction in viability at this concentration, we opted to use 10 \\u0026micro;g/mL LPS for subsequent experiments. Consistent with the decreased viability, LPS-treated BEAS-2B cells exhibited increased apoptosis compared to the PBS-treated control group (Mock), as shown by Annexin V/PI staining (Figure \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003eB and C). Additionally, DCF-DA staining demonstrated a significant increase in ROS levels in BEAS-2B cells following LPS treatment (Figure \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003eD and E). These findings confirmed the successful establishment of an LPS-induced ALI cellular model.\\u003c/p\\u003e \\u003cp\\u003eNext, we optimized the concentration of Fas to use on BEAS-2B cells, aiming for an effective dose without significantly impacting cell viability. The CCK-8 assay results indicated that 80 \\u0026micro;M Fas notably reduced BEAS-2B cell viability (Figure \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003eF). Therefore, we selected 40 \\u0026micro;M Fas for subsequent assays.\\u003c/p\\u003e \\u003cp\\u003eTo assess the impact of Fas on BEAS-2B cells treated with LPS, we conducted Annexin V/PI staining to evaluate apoptosis. The results showed that Fas significantly reduced the additional apoptosis induced by LPS (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA and B). Moreover, Fas treatment improved the impaired viability of LPS-treated BEAS-2B cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). Fas also alleviated the oxidative stress induced by LPS, as evidenced by reduced ROS, MDA, and GSSG levels, and increased GSH and SOD levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD-J). Furthermore, Fas treatment restored the level of NO, a protective molecule secreted by lung epithelial cells in response to LPS-induced injury (Su, Day et al. 1996), in LPS-treated BEAS-2B cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eK). Overall, these findings indicate that Fas has a protective influence on BEAS-2B cells exposed to LPS.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eFas induces CLDN4 expression and represses apoptosis and ROS-related genes in LPS-treated BEAS-2B cells\\u003c/h2\\u003e \\u003cp\\u003eTo understand how Fas protects BEAS-2B cells, we focused on CLDN4, a gene known to be stimulated during ALI and to regulate the function of the alveolar epithelial barrier (Wray, Mao et al. 2009). Surprisingly, both qPCR and Western blot analyses showed that LPS suppressed CLDN4 expression in BEAS-2B cells, while Fas treatment restored its levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA and B). Given that Fas alleviates apoptosis and oxidative stress in LPS-treated cells, we also examined genes involved in controlling apoptosis and ROS levels. Western blot data demonstrated that Fas treatment reduced the expression of pro-apoptotic factors Bax and cleaved Caspase 3 (C-Caspase 3), which were upregulated by LPS, and rescued the expression of the anti-apoptotic factor Bcl2, which was downregulated by LPS. Additionally, Fas inhibited the LPS-induced expression of NRF2 and HO-1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB), key regulators of intracellular ROS levels (Zhang, Ding et al. 2019, Jin, Botchway et al. 2021). These findings suggest that Fas mitigates apoptosis and ROS levels in BEAS-2B cells induced by LPS, potentially through the restoration of CLDN4 expression.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCLDN4 deficiency mitigates the protective effect of Fas on LPS-treated BEAS-2B cells\\u003c/h2\\u003e \\u003cp\\u003eTo investigate whether CLDN4 mediates Fas's protective effect in BEAS-2B cells induced by LPS, we knocked down CLDN4. qPCR data confirmed that CLDN4 expression was effectively reduced in BEAS-2B cells transfected with shCLDN4 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). Annexin V/PI staining revealed that the anti-apoptotic impact of Fas on BEAS-2B induced by LPS was abolished when CLDN4 was deficient (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB and C). Similarly, the CCK-8 assay showed that, in the absence of sufficient CLDN4, Fas could not enhance the viability of BEAS-2B cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). Furthermore, Fas failed to alleviate oxidative stress in CLDN4-deficient cells, as evidenced by DCF-DA, MDA, GSH, GSSG, and SOD assays (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eE-K). Additionally, the induction effect of Fas on NO synthesis was nullified upon CLDN4 knockdown (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eL). At the molecular level, knocking down CLDN4 in LPS-treated BEAS-2B cells reduced the impact of Fas on the expression of Bax, Bcl2, cleaved Caspase 3, NRF2, and HO-1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). Taken together, these results collectively suggest that CLDN4 is a critical effector downstream of Fas, protecting BEAS-2B cells from LPS-induced injury.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCLDN4 deficiency attenuates the impact of Fas on LPS-treated HLOs\\u003c/h2\\u003e \\u003cp\\u003eTo further confirm the role of the Fas-CLDN4 axis in LPS-induced ALI, we used an HLO model. HLOs were established from hESCs using a modified stepwise differentiation method (Chen, Feng et al. 2018, Zhao, Wu et al. 2023) (Figure S2). Specific markers for each stage of differentiation were confirmed by qPCR, showing successful identification of DE markers CXCR4 and SOX17, AFE markers FOXA2 and SOX2, LPC marker NKX2-1, and HLO markers KRT5, MUC5AC, SCGB3A2, AGER, SP-B, and SP-C (Green, Chen et al. 2011, Ikonomou, Herriges et al. 2020, Leibel, McVicar et al. 2020, Liang, Xiao et al. 2020) (Figure S3A-E). H\\u0026amp;E staining confirmed that the HLOs exhibited airway epithelium morphology (Figure S3F), and IF results showed robust expression of AGER, KRT5, and SP-C (Figure S3G). These findings validated the successful establishment of HLOs from hESCs.\\u003c/p\\u003e \\u003cp\\u003eHLOs were then infected with lentivirus carrying shNC or shCLDN4 and treated with 50 \\u0026micro;g/mL LPS and/or 40 \\u0026micro;M Fas. After 24 hours, HLOs were collected for analysis. IHC assays indicated that LPS significantly repressed proliferation within HLOs, while Fas reversed this anti-proliferative effect. However, this reversal by Fas was abolished when CLDN4 was depleted (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA and B). The size of HLOs, reduced by LPS, was counteracted by Fas in a CLDN4-dependent manner (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC). LPS treatment also increased ROS, MDA, and GSSG levels, and reduced GSH, SOD, and NO levels in HLOs. Fas mitigated these effects of LPS, and knockdown of CLDN4 nullified the protective effect of Fas (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eD-K).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eWestern blot analysis confirmed effective CLDN4 knockdown. Similar to its effect on BEAS-2B cells, LPS increased Bax, cleaved Caspase 3, NRF2, and HO-1 levels, and decreased Bcl2 expression in HLOs. Fas counteracted these LPS effects, relying on sufficient CLDN4 presence (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). These observations suggest that the Fas-CLDN4 axis also protects HLOs from LPS-induced injury.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eROCK is crucial in mediating vasoconstriction and vascular remodeling, which are key processes in the development of pulmonary hypertension (Montagnoli, da Silva et al. 2021). As a well-recognized selective ROCK inhibitor, Fas exhibits a protective effect on lung tissues from ALI-triggered injury. However, its effects on lung epithelial cells have remained unclear. Our research reveals that Fas alleviates LPS-induced damage in BEAS-2B cells and HLOs, indicating its potential impact on various pulmonary cell types beyond vascular cells.\\u003c/p\\u003e \\u003cp\\u003eTo investigate the underlying mechanisms, we focused on CLDN4, a crucial component of epithelial cell tight junctions (Gunzel and Yu 2013). CLDN4 is involved in regulating cell adhesion and polarity and is abnormally expressed in various cancers, affecting cell proliferation, apoptosis, and migration (Breed, Hicks et al. 2019, Fujiwara-Tani, Mori et al. 2023). Our findings consistently demonstrate that CLDN4 is a key mediator in enhancing the viability and survival of LPS-treated BEAS-2B cells by Fas.\\u003c/p\\u003e \\u003cp\\u003eInterestingly, while ALI generally stimulates CLDN4 expression in lung epithelial cells (Rokkam, Lafemina et al. 2011), our data indicate that LPS represses CLDN4 levels in both BEAS-2B cells and HLOs. CLDN4 expression is regulated by multiple mechanisms, including the methylation status of its promoter, which is linked to dysregulation in various cancers (Boireau, Buchert et al. 2007, Kwon, Kim et al. 2010, Maesaka, Kuwada et al. 2022). Secreted signaling molecules like TGF-β and HIF1α also influence CLDN4 expression in different contexts (Rachakonda, Vu et al. 2016, Liu, Zhang et al. 2022). Additionally, inflammation can modulate CLDN4 expression through cytokines such as TNF-α and IL-18 (Yang, Cheon et al. 2015, Fujiwara-Tani, Sasaki et al. 2018). Thus, the suppressive impact of LPS on CLDN4 expression in our models is likely due to its pro-inflammatory nature, whereas elevated CLDN4 expression in other ALI contexts might involve other mechanisms like JNK pathway activation (Wray, Mao et al. 2009).\\u003c/p\\u003e \\u003cp\\u003eThe mechanism by which Fas increases CLDN4 expression appears complex. As a ROCK inhibitor, Fas should theoretically block the ROCK/JNK pathway, potentially decreasing CLDN4 expression. However, the increased CLDN4 expression observed may result from a reduction in cytokine secretion, which overrides the disrupted ROCK/JNK pathway. Further research is needed to explore this hypothesis.\\u003c/p\\u003e \\u003cp\\u003eCLDN4 is also present in endothelial cells, and Fas has been shown to suppress pro-inflammatory cytokine expression in rat pulmonary microvascular endothelial cells exposed to LPS (Liu, Pan et al. 2022). Given Fas's recognized role in endothelial cells, it would be interesting to examine whether the Fas-CLDN4 axis also protects pulmonary endothelial cells from LPS-induced injury. It is noteworthy that our conclusions are based on in vitro experiments, and ALI animal models are necessary to support these findings.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eIn summary, our data reveal the crucial role of CLDN4 in facilitating the protective effects of Fas on BEAS-2B cells and HLOs induced by LPS. This study enhances the understanding of Fas\\u0026rsquo;s pharmacological mechanisms and the function of CLDN4, highlighting the therapeutic potential of utilizing Fas to treat ALI.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\" \\u003cp\\u003e \\u003cstrong\\u003eCompeting interests:\\u003c/strong\\u003e \\u003cp\\u003eThe authors declare that they have no conflict of interest.\\u003c/p\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cstrong\\u003eConsent to participate:\\u003c/strong\\u003e \\u003cp\\u003eN/A\\u003c/p\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cstrong\\u003eConsent to publication:\\u003c/strong\\u003e \\u003cp\\u003eN/A\\u003c/p\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cstrong\\u003eEthical approval:\\u003c/strong\\u003e \\u003cp\\u003eN/A\\u003c/p\\u003e \\u003c/p\\u003e\\u003ch2\\u003eFunding\\u003c/h2\\u003e \\u003cp\\u003eThis work was supported by the Zhejiang Province Medical and Health Science and Technology Plan Project (2023KY016) and Zhejiang Province Traditional Chinese Medicine Science and Technology Plan Project (2023ZL245).\\u003c/p\\u003e\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eCompeting interests: The authors declare that they have no conflict of interest.Consent to participate: N/AConsent to publication: N/AEthical approval: N/A\\u003c/p\\u003e\\u003ch2\\u003eData availability statement\\u003c/h2\\u003e \\u003cp\\u003eAll data supporting the conclusion of this study have been included in the manuscript and the supplemental files and are available from the corresponding author upon reasonable request.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eAbedi, F., A. W. Hayes, R. Reiter and G. Karimi (2020). \\u0026quot;Acute lung injury: The therapeutic role of Rho kinase inhibitors.\\u0026quot; \\u003cu\\u003ePharmacological Research\\u003c/u\\u003e \\u003cstrong\\u003e155\\u003c/strong\\u003e: 104736.\\u003c/li\\u003e\\n\\u003cli\\u003eBoireau, S., M. Buchert, M. S. Samuel, J. Pannequin, J. L. Ryan, A. Choquet, H. Chapuis, X. Rebillard, C. Avanc\\u0026egrave;s, M. Ernst, D. Joubert, N. Mottet and F. Hollande (2007). \\u0026quot;DNA-methylation-dependent alterations of claudin-4 expression in human bladder carcinoma.\\u0026quot; \\u003cu\\u003eCarcinogenesis\\u003c/u\\u003e \\u003cstrong\\u003e28\\u003c/strong\\u003e(2): 246-258.\\u003c/li\\u003e\\n\\u003cli\\u003eBreed, C., D. A. Hicks, P. G. Webb, C. E. Galimanis, B. G. Bitler, K. Behbakht and H. K. Baumgartner (2019). \\u0026quot;Ovarian Tumor Cell Expression of Claudin-4 Reduces Apoptotic Response to Paclitaxel.\\u0026quot; \\u003cu\\u003eMol Cancer Res\\u003c/u\\u003e \\u003cstrong\\u003e17\\u003c/strong\\u003e(3): 741-750.\\u003c/li\\u003e\\n\\u003cli\\u003eChen, Y., J. Feng, S. Zhao, L. Han, H. Yang, Y. Lin and Z. Rong (2018). \\u0026quot;Long-Term Engraftment Promotes Differentiation of Alveolar Epithelial Cells from Human Embryonic Stem Cell Derived Lung Organoids.\\u0026quot; \\u003cu\\u003eStem Cells and Development\\u003c/u\\u003e \\u003cstrong\\u003e27\\u003c/strong\\u003e(19): 1339-1349.\\u003c/li\\u003e\\n\\u003cli\\u003eFujiwara-Tani, R., S. Mori, R. Ogata, R. Sasaki, A. Ikemoto, S. Kishi, M. Kondoh and H. Kuniyasu (2023). \\u0026quot;Claudin-4: A New Molecular Target for Epithelial Cancer Therapy.\\u0026quot; \\u003cu\\u003eInternational Journal of Molecular Sciences\\u003c/u\\u003e \\u003cstrong\\u003e24\\u003c/strong\\u003e(6): 5494.\\u003c/li\\u003e\\n\\u003cli\\u003eFujiwara-Tani, R., T. Sasaki, Y. Luo, K. Goto, I. Kawahara, Y. Nishiguchi, S. Kishi, S. Mori, H. Ohmori, M. Kondoh and H. Kuniyasu (2018). \\u0026quot;Anti-claudin-4 extracellular domain antibody enhances the antitumoral effects of chemotherapeutic and antibody drugs in colorectal cancer.\\u0026quot; \\u003cu\\u003eOncotarget\\u003c/u\\u003e \\u003cstrong\\u003e9\\u003c/strong\\u003e(100): 37367-37378.\\u003c/li\\u003e\\n\\u003cli\\u003eGreen, M. D., A. Chen, M. C. Nostro, S. L. d\\u0026apos;Souza, C. Schaniel, I. R. Lemischka, V. Gouon-Evans, G. Keller and H. W. Snoeck (2011). \\u0026quot;Generation of anterior foregut endoderm from human embryonic and induced pluripotent stem cells.\\u0026quot; \\u003cu\\u003eNat Biotechnol\\u003c/u\\u003e \\u003cstrong\\u003e29\\u003c/strong\\u003e(3): 267-272.\\u003c/li\\u003e\\n\\u003cli\\u003eGunzel, D. and A. S. Yu (2013). \\u0026quot;Claudins and the modulation of tight junction permeability.\\u0026quot; \\u003cu\\u003ePhysiol Rev\\u003c/u\\u003e \\u003cstrong\\u003e93\\u003c/strong\\u003e(2): 525-569.\\u003c/li\\u003e\\n\\u003cli\\u003eHuang, Y. Y., J. M. Wu, T. Su, S. Y. Zhang and X. J. Lin (2018). \\u0026quot;Fasudil, a Rho-Kinase Inhibitor, Exerts Cardioprotective Function in Animal Models of Myocardial Ischemia/Reperfusion Injury: A Meta-Analysis and Review of Preclinical Evidence and Possible Mechanisms.\\u0026quot; \\u003cu\\u003eFront Pharmacol\\u003c/u\\u003e \\u003cstrong\\u003e9\\u003c/strong\\u003e: 1083.\\u003c/li\\u003e\\n\\u003cli\\u003eHuo, Z., Y. Su, Y. Dong, Y. Zheng, Q. Zhang, Y. Duan and G. Wang (2020). \\u0026quot;Rho-kinase inhibition by Fasudil promotes tumor maturation and apoptosis in small-cell lung cancer.\\u0026quot; \\u003cu\\u003eAm J Transl Res\\u003c/u\\u003e \\u003cstrong\\u003e12\\u003c/strong\\u003e(8): 4354-4370.\\u003c/li\\u003e\\n\\u003cli\\u003eIkonomou, L., M. J. Herriges, S. L. Lewandowski, R. Marsland, 3rd, C. Villacorta-Martin, I. S. Caballero, D. B. Frank, R. M. Sanghrajka, K. Dame, M. M. Kandula, J. Hicks-Berthet, M. L. Lawton, C. Christodoulou, A. J. Fabian, E. Kolaczyk, X. Varelas, E. E. Morrisey, J. M. Shannon, P. Mehta and D. N. Kotton (2020). \\u0026quot;The in vivo genetic program of murine primordial lung epithelial progenitors.\\u0026quot; \\u003cu\\u003eNat Commun\\u003c/u\\u003e \\u003cstrong\\u003e11\\u003c/strong\\u003e(1): 635.\\u003c/li\\u003e\\n\\u003cli\\u003eJin, W., B. O. A. Botchway and X. Liu (2021). \\u0026quot;Curcumin Can Activate the Nrf2/HO-1 Signaling Pathway and Scavenge Free Radicals in Spinal Cord Injury Treatment.\\u0026quot; \\u003cu\\u003eNeurorehabilitation and Neural Repair\\u003c/u\\u003e \\u003cstrong\\u003e35\\u003c/strong\\u003e(7): 576-584.\\u003c/li\\u003e\\n\\u003cli\\u003eJohnson, E. R. and M. A. Matthay (2010). \\u0026quot;Acute lung injury: epidemiology, pathogenesis, and treatment.\\u0026quot; \\u003cu\\u003eJ Aerosol Med Pulm Drug Deliv\\u003c/u\\u003e \\u003cstrong\\u003e23\\u003c/strong\\u003e(4): 243-252.\\u003c/li\\u003e\\n\\u003cli\\u003eJulian, L. and M. F. Olson (2014). \\u0026quot;Rho-associated coiled-coil containing kinases (ROCK): structure, regulation, and functions.\\u0026quot; \\u003cu\\u003eSmall GTPases\\u003c/u\\u003e \\u003cstrong\\u003e5\\u003c/strong\\u003e: e29846.\\u003c/li\\u003e\\n\\u003cli\\u003eKinnula, V. L., J. R. Yankaskas, L. Chang, I. Virtanen, A. Linnala, B. H. Kang and J. D. Crapo (1994). \\u0026quot;Primary and immortalized (BEAS 2B) human bronchial epithelial cells have significant antioxidative capacity in vitro.\\u0026quot; \\u003cu\\u003eAm J Respir Cell Mol Biol\\u003c/u\\u003e \\u003cstrong\\u003e11\\u003c/strong\\u003e(5): 568-576.\\u003c/li\\u003e\\n\\u003cli\\u003eKwon, M. J., S. S. Kim, Y. L. Choi, H. S. Jung, C. Balch, S. H. Kim, Y. S. Song, V. E. Marquez, K. P. Nephew and Y. K. Shin (2010). \\u0026quot;Derepression of CLDN3 and CLDN4 during ovarian tumorigenesis is associated with loss of repressive histone modifications.\\u0026quot; \\u003cu\\u003eCarcinogenesis\\u003c/u\\u003e \\u003cstrong\\u003e31\\u003c/strong\\u003e(6): 974-983.\\u003c/li\\u003e\\n\\u003cli\\u003eLeibel, S. L., R. N. McVicar, A. M. Winquist, W. D. Niles and E. Y. Snyder (2020). \\u0026quot;Generation of Complete Multi-Cell Type Lung Organoids From Human Embryonic and Patient-Specific Induced Pluripotent Stem Cells for Infectious Disease Modeling and Therapeutics Validation.\\u0026quot; \\u003cu\\u003eCurr Protoc Stem Cell Biol\\u003c/u\\u003e \\u003cstrong\\u003e54\\u003c/strong\\u003e(1): e118.\\u003c/li\\u003e\\n\\u003cli\\u003eLiang, R., X. Xiao, L. Luo, T. Chen, H. Yang, W. Wang, Y. Zhang and Z. Wang (2020). \\u0026quot;Efficient Definitive Endoderm Differentiation from Human Parthenogenetic Embryonic Stem Cells Induced by Activin A and Wnt3a.\\u0026quot; \\u003cu\\u003eAnn Clin Lab Sci\\u003c/u\\u003e \\u003cstrong\\u003e50\\u003c/strong\\u003e(4): 468-473.\\u003c/li\\u003e\\n\\u003cli\\u003eLiu, H., Z. Pan, X. Ma, J. Cui, J. Gao, Q. Miao, Z. Zhu, X. Chen and S. Su (2022). \\u0026quot;ROCK inhibitor fasudil reduces the expression of inflammatory factors in LPS-induced rat pulmonary microvascular endothelial cells via ROS/NF-\\u0026kappa;B pathway.\\u0026quot; \\u003cu\\u003eBMC Pharmacol Toxicol\\u003c/u\\u003e \\u003cstrong\\u003e23\\u003c/strong\\u003e(1): 24.\\u003c/li\\u003e\\n\\u003cli\\u003eLiu, H., Z. Zhang, S. Zhou, X. Liu, G. Li, B. Song and W. Xu (2022). \\u0026quot;Claudin-1/4 as directly target gene of HIF-1\\u0026alpha; can feedback regulating HIF-1\\u0026alpha; by PI3K-AKT-mTOR and impact the proliferation of esophageal squamous cell though Rho GTPase and p-JNK pathway.\\u0026quot; \\u003cu\\u003eCancer Gene Ther\\u003c/u\\u003e \\u003cstrong\\u003e29\\u003c/strong\\u003e(6): 665-682.\\u003c/li\\u003e\\n\\u003cli\\u003eMaesaka, F., M. Kuwada, S. Horii, S. Kishi, R. Fujiwara-Tani, S. Mori, K. Fujii, T. Mori, H. Ohmori, T. Owari, M. Miyake, Y. Nakai, N. Tanaka, U. K. Bhawal, Y. Luo, M. Kondoh, K. Fujimoto and H. Kuniyasu (2022). \\u0026quot;Hypomethylation of CLDN4 Gene Promoter Is Associated with Malignant Phenotype in Urinary Bladder Cancer.\\u0026quot; \\u003cu\\u003eInt J Mol Sci\\u003c/u\\u003e \\u003cstrong\\u003e23\\u003c/strong\\u003e(12).\\u003c/li\\u003e\\n\\u003cli\\u003eMatthay, M. A., R. L. Zemans, G. A. Zimmerman, Y. M. Arabi, J. R. Beitler, A. Mercat, M. Herridge, A. G. Randolph and C. S. Calfee (2019). \\u0026quot;Acute respiratory distress syndrome.\\u0026quot; \\u003cu\\u003eNature Reviews Disease Primers\\u003c/u\\u003e \\u003cstrong\\u003e5\\u003c/strong\\u003e(1): 18.\\u003c/li\\u003e\\n\\u003cli\\u003eMatuschak, G. M. and A. J. Lechner (2010). \\u0026quot;Acute lung injury and the acute respiratory distress syndrome: pathophysiology and treatment.\\u0026quot; \\u003cu\\u003eMo Med\\u003c/u\\u003e \\u003cstrong\\u003e107\\u003c/strong\\u003e(4): 252-258.\\u003c/li\\u003e\\n\\u003cli\\u003eMokr\\u0026aacute;, D. (2020). \\u0026quot;Acute lung injury - from pathophysiology to treatment.\\u0026quot; \\u003cu\\u003ePhysiol Res\\u003c/u\\u003e \\u003cstrong\\u003e69\\u003c/strong\\u003e(Suppl 3): S353-s366.\\u003c/li\\u003e\\n\\u003cli\\u003eMontagnoli, T. L., J. S. da Silva, S. Z. Sudo, A. D. Santos, G. F. Gomide, M. P. L. de S\\u0026aacute; and G. Zapata-Sudo (2021). \\u0026quot;ROCK Inhibition as Potential Target for Treatment of Pulmonary Hypertension.\\u0026quot; \\u003cu\\u003eCells\\u003c/u\\u003e \\u003cstrong\\u003e10\\u003c/strong\\u003e(7).\\u003c/li\\u003e\\n\\u003cli\\u003eNova, Z., H. Skovierova and A. Calkovska (2019). \\u0026quot;Alveolar-Capillary Membrane-Related Pulmonary Cells as a Target in Endotoxin-Induced Acute Lung Injury.\\u0026quot; \\u003cu\\u003eInternational Journal of Molecular Sciences\\u003c/u\\u003e \\u003cstrong\\u003e20\\u003c/strong\\u003e(4): 831.\\u003c/li\\u003e\\n\\u003cli\\u003eRachakonda, G., T. Vu, L. Jin, D. Samanta and P. K. Datta (2016). \\u0026quot;Role of TGF-\\u0026beta;-induced Claudin-4 expression through c-Jun signaling in non-small cell lung cancer.\\u0026quot; \\u003cu\\u003eCell Signal\\u003c/u\\u003e \\u003cstrong\\u003e28\\u003c/strong\\u003e(10): 1537-1544.\\u003c/li\\u003e\\n\\u003cli\\u003eRokkam, D., M. J. Lafemina, J. W. Lee, M. A. Matthay and J. A. Frank (2011). \\u0026quot;Claudin-4 levels are associated with intact alveolar fluid clearance in human lungs.\\u0026quot; \\u003cu\\u003eAm J Pathol\\u003c/u\\u003e \\u003cstrong\\u003e179\\u003c/strong\\u003e(3): 1081-1087.\\u003c/li\\u003e\\n\\u003cli\\u003eSu, W. Y., B. J. Day, B. H. Kang, J. D. Crapo, Y. C. Huang and L. Y. Chang (1996). \\u0026quot;Lung epithelial cell-released nitric oxide protects against PMN-mediated cell injury.\\u0026quot; \\u003cu\\u003eAm J Physiol\\u003c/u\\u003e \\u003cstrong\\u003e271\\u003c/strong\\u003e(4 Pt 1): L581-586.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, J., H. Kong, J. Xu, Y. Wang, H. Wang and W. Xie (2019). \\u0026quot;Fasudil alleviates LPS-induced lung injury by restoring aquaporin 5 expression and inhibiting inflammation in lungs.\\u0026quot; \\u003cu\\u003eThe Journal of Biomedical Research\\u003c/u\\u003e \\u003cstrong\\u003e33\\u003c/strong\\u003e(3): 156-163.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, Q., L. J. Song, Z. B. Ding, Z. Chai, J. Z. Yu, B. G. Xiao and C. G. Ma (2022). \\u0026quot;Advantages of Rho-associated kinases and their inhibitor fasudil for the treatment of neurodegenerative diseases.\\u0026quot; \\u003cu\\u003eNeural Regen Res\\u003c/u\\u003e \\u003cstrong\\u003e17\\u003c/strong\\u003e(12): 2623-2631.\\u003c/li\\u003e\\n\\u003cli\\u003eWray, C., Y. Mao, J. Pan, A. Chandrasena, F. Piasta and J. A. Frank (2009). \\u0026quot;Claudin-4 augments alveolar epithelial barrier function and is induced in acute lung injury.\\u0026quot; \\u003cu\\u003eAm J Physiol Lung Cell Mol Physiol\\u003c/u\\u003e \\u003cstrong\\u003e297\\u003c/strong\\u003e(2): L219-227.\\u003c/li\\u003e\\n\\u003cli\\u003eYang, Y., S. Cheon, M. K. Jung, S. B. Song, D. Kim, H. J. Kim, H. Park, S. I. Bang and D. Cho (2015). \\u0026quot;Interleukin-18 enhances breast cancer cell migration via down-regulation of claudin-12 and induction of the p38 MAPK pathway.\\u0026quot; \\u003cu\\u003eBiochem Biophys Res Commun\\u003c/u\\u003e \\u003cstrong\\u003e459\\u003c/strong\\u003e(3): 379-386.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, X., M. Ding, P. Zhu, H. Huang, Q. Zhuang, J. Shen, Y. Cai, M. Zhao and Q. He (2019). \\u0026quot;New Insights into the Nrf-2/HO-1 Signaling Axis and Its Application in Pediatric Respiratory Diseases.\\u0026quot; \\u003cu\\u003eOxid Med Cell Longev\\u003c/u\\u003e \\u003cstrong\\u003e2019\\u003c/strong\\u003e: 3214196.\\u003c/li\\u003e\\n\\u003cli\\u003eZhao, J., D. Zhou, J. Guo, Z. Ren, L. Zhou, S. Wang, B. Xu and R. Wang (2006). \\u0026quot;Effect of fasudil hydrochloride, a protein kinase inhibitor, on cerebral vasospasm and delayed cerebral ischemic symptoms after aneurysmal subarachnoid hemorrhage.\\u0026quot; \\u003cu\\u003eNeurol Med Chir (Tokyo)\\u003c/u\\u003e \\u003cstrong\\u003e46\\u003c/strong\\u003e(9): 421-428.\\u003c/li\\u003e\\n\\u003cli\\u003eZhao, S., X. Wu, Z. Tan, Y. Ren, L. Li, J. Ou, Y. Lin, H. Song, L. Feng, D. Seto, J. Wu, Q. Zhang and Z. Rong (2023). \\u0026quot;Generation of Human Embryonic Stem Cell-Derived Lung Organoids for Modeling Infection and Replication Differences between Human Adenovirus Types 3 and 55 and Evaluating Potential Antiviral Drugs.\\u0026quot; \\u003cu\\u003eJournal of Virology\\u003c/u\\u003e \\u003cstrong\\u003e97\\u003c/strong\\u003e(5): e00209-00223.\\u003c/li\\u003e\\n\\u003cli\\u003eZhao, Y., Y. Zhang, M. Vazirinejad Mehdiabad, K. Zhou, Y. Chen, L. Li, J. Guo and C. Xu (2019). \\u0026quot;Enhanced anti-tumor effect of liposomal Fasudil on hepatocellular carcinoma in vitro and in vivo.\\u0026quot; \\u003cu\\u003ePLoS One\\u003c/u\\u003e \\u003cstrong\\u003e14\\u003c/strong\\u003e(10): e0223232.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Acute lung injury, Lipopolysaccharides, Fasudil, CLDN4, BEAS-2B cell, Human lung organoid, Oxidative stress, Apoptosis\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-5481369/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-5481369/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eFasudil, a well-known selective ROCK inhibitor, is commonly used to treat cerebral vasospasm. Recent research suggests that Fasudil may also have therapeutic potential for lung conditions such as pulmonary hypertension and acute lung injury (ALI). However, the specific mechanisms by which Fasudil protects lung tissues, especially lung epithelial cells, remain unclear. In this study, we examined the impact of Fasudil on the viability, apoptosis, and reactive oxygen species (ROS) levels in human lung epithelial cell line BEAS-2B and human lung organoids (HLOs) exposed to lipopolysaccharides (LPS). Our results show that Fasudil significantly enhances cell viability, reduces apoptosis, and decreases ROS levels in BEAS-2B cells and HLOs induced by LPS. At the molecular level, Fasudil increases the expression of CLDN4 in these cells and organoids, and the protective effects of Fasudil against LPS-induced damage are diminished in the absence of CLDN4. These findings identify CLDN4 as a key mediator of Fasudil\\u0026rsquo;s protective effects on lung epithelial cells and organoids. Our study improves the understanding of Fasudil\\u0026rsquo;s therapeutic mechanisms and highlights the potential for using Fasudil and/or targeting CLDN4 in the treatment of lung conditions like ALI.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Fasudil alleviates lipopolysaccharides-triggered damage to BEAS-2B cells and human lung organoids by inducing CLDN4 expression\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-12-02 09:56:18\",\"doi\":\"10.21203/rs.3.rs-5481369/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"d02019f8-833e-40da-84e9-bf92e60b12e1\",\"owner\":[],\"postedDate\":\"December 2nd, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-03-21T16:08:15+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-12-02 09:56:18\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-5481369\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-5481369\",\"identity\":\"rs-5481369\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}