{"paper_id":"2c402a20-8ec9-49b9-bdf2-bda1f5eab9b4","body_text":"Development and Validation of RT-LAMP for Detecting Yellow Fever Virus in Non- Human Primates Samples from Brazil | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Development and Validation of RT-LAMP for Detecting Yellow Fever Virus in Non- Human Primates Samples from Brazil Sabrina F. Cardoso, Andre Akira Gonzaga Yoshikawa, Iara Carolini Pinheiro, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4674680/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Sep, 2024 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Monitoring yellow fever in non-human primates (NHPs) is an early warning system for sylvatic yellow fever outbreaks, aiding in preventing human cases. However, current diagnostic tests for this disease, primarily relying on RT-qPCR, are complex and costly. Therefore, there is a critical need for simpler and more cost-effective methods to detect yellow fever virus (YFV) infection in NHPs, enabling early identification of viral circulation. In this study, an RT-LAMP assay for detecting YFV in NHP samples was developed and validated. Two sets of RT-LAMP primers targeting the YFV NS5 and E genes were designed and tested together with a third primer set to the NS1 locus using NHP tissue samples from Southern Brazil. The results were visualized by colorimetry and compared to the RT-qPCR test. Standardization and validation of the RT-LAMP assay demonstrated 100% sensitivity and specificity compared to RT-qPCR, with a detection limit of 12 PFU/mL. Additionally, the cross-reactivity test with other flaviviruses confirmed a specificity of 100%. Our newly developed RT-LAMP diagnostic test for YFV in NHP samples will significantly contribute to yellow fever monitoring efforts, providing a simpler and more accessible method for viral early detection. This advancement holds promise for enhancing surveillance and ultimately preventing the spread of yellow fever. Biological sciences/Microbiology/Infectious disease diagnostics Biological sciences/Molecular biology Diagnosis Yellow Fever Virus Yellow Fever RT-LAMP Figures Figure 1 Figure 2 Figure 3 Figure 4 INTRODUCTION Yellow fever (YF) is a reemerging, zoonotic, mosquito-borne infectious disease that affects humans and non-human primates (NHP) 1,2 . The etiological agent of the disease is the yellow fever virus (YFV), a member of the Flavivirus genus, which also includes well-known viruses such as the Dengue virus (DENV) and Zika virus (ZIKV) 3 . The YFV has a single-stranded, positive-sense RNA genome, approximately 11.000 nucleotides long. This genome encodes a polyprotein that contains three viral structural proteins: capsid (C), membrane (M), and envelope (E), and seven non-structural proteins (NS) (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5) 4,5 . There are seven known YFV genotypes: five in Africa (West Africa I and II, East Africa, East/Central Africa, and Angola) and two in the Americas (South America I and II), with the South American genotypes derived from the West African ones 6 . In Brazil, South America I is the predominant genotype, consisting of five distinct lineages (1A-1E). Until the mid-1990s, the ancient lineages (1A, 1B, and 1C) co-circulated in South America but were replaced by the current ones, 1D and 1E 6,7 . The YF is sustained through two fundamental cycles: urban and sylvatic. In the urban cycle, Aedes aegypti transmits the virus to humans, while in the sylvatic cycle, various mosquito species, particularly those of the genera Haemagogus and Sabethes , play a crucial role in South America's transmission. The NHP serves as the primary sylvatic host for YFV and acts as a virus-amplifying and highly susceptible host 2 . In recent years, the re-emergence of YFV has significantly impacted public health in Brazil. Since 2002, YFV has expanded its circulation, spreading from the East towards the South of Brazil. During these outbreaks, thousands of NHP deaths were documented, and over 2100 human cases were reported, with a case fatality rate of approximately 30% 8 . The focus of yellow fever surveillance in Brazil is centered on three key areas: monitoring human cases, entomology, and epizootics in NHP 9 . Epizootic events involving YF are crucial for predicting and identifying human cases of the disease 10 . Therefore, NHP surveillance aims to reduce the morbidity and mortality associated with the disease by investigating suspected epizootics, identifying YFV circulation, and preventing its transmission to humans 9 . However, YFV detection is hampered because it is conducted in a few national reference laboratories far from the NHP epizootic sites, limiting detailed spatiotemporal tracking of YFV incidence in Brazilian microregions 8 . The gold standard for detecting YFV RNA is molecular diagnostics using reverse transcriptase followed by polymerase chain reaction (RT-qPCR) 11 . However, this method is costly, and requires specialized equipment and skilled personnel, making it incompatible with point-of-care (POC) applications 12 . Consequently, such analyses are usually performed in central reference laboratories, thereby prolonging the diagnostic process 11,13 . The loop-mediated isothermal amplification technique (LAMP) 14 is a valuable, rapid, sensitive, and cost-effective alternative to the gold standard RT-qPCR for monitoring diseases. This nucleic acid amplification method works under isothermal conditions, with results visible to the naked eye. It also allows RNA sequence amplification through RT-LAMP 15,16 . In this study, an RT-LAMP molecular assay for YFV diagnostics in NHP tissues was developed and validated. This diagnostic pipeline aids in early virus detection, especially in municipalities experiencing epizootics, facilitating the prompt initiation of prophylactic measures 11 . MATERIALS AND METHODS Collection of NHP tissue samples The biological samples analyzed in this study were obtained from NHP epizootics events in municipalities within the Southern region of Santa Catarina State (Southern Brazil). The specimens were collected by the Santa Catarina State Epidemiological Surveillance Service (Fig. 1 ). The state government collected tissue fragments from NHP carcasses, stored them in cryotubes, froze them, and transported them to the Central Public Health Laboratory (LACEN/SC), and subsequently to the FIOCRUZ reference laboratory (Carlos Chagas Institute, PR - Brazil) for official YFV molecular diagnosis by RT-qPCR technique. Simultaneously, approximately 0.5 cm 2 pieces of tissue were collected for this study, preserved in RNAlater™ stabilization solution (Invitrogen - Thermo Fisher Scientific, Waltham, MA, USA), and stored at -20ºC until the moment of viral RNA extraction. A total of 12 NHP epizootics, sampled between March 2021 and February 2022, were processed and analyzed. In each collection, tissues from five types were obtained: spleen, heart, liver, lung, and kidney, resulting in a total of 60 tissues analyzed. Epidemiological data for each NHP sample are detailed in Table 1 . Table 1 Epidemiological data summary for Non-Human Primate (NHP) samples. Municipality: location where the sample was collected. Collection date: date of sample collection. SINAN number: identification number in the National Notifiable Diseases Information System. Host: species of the host. RT-qPCR: results of the RT-qPCR test from the FIOCRUZ reference laboratory (Carlos Chagas Institute, PR - Brazil). Tissues from five types (spleen, heart, liver, lung, and kidney) were obtained in each of the 12 collections, totaling 60 tissues analyzed. The RT-qPCR results were consistent across all tissues in each collection. Municipality Collection date SINAN number Host RT-qPCR Result Rio Fortuna 03/03/2021 4563807 Allouatta genus Detectable 08/03/2021 4563814 Allouatta genus Detectable 16/03/2021 4563818 Allouatta genus Detectable Santa Rosa de Lima 05/03/2021 1414470 Allouatta genus Detectable Braço do Norte 06/03/2021 5069209 Allouatta genus Detectable 31/03/2021 5069214 Callithrix genus Not detectable São Martinho 13/03/2021 4606986 Allouatta genus Detectable 17/03/2021 4606990 Allouatta genus Detectable 06/04/2021 5175026 Allouatta genus Detectable Pedras Grandes 23/11/2021 3229070 Allouatta genus Detectable 24/11/2021 3229071 Allouatta genus Detectable Laguna 19/02/2022 8285928 Cepajus genus Not detectable Primer design for YFV Around 50 complete YFV genomes from GenBank were analyzed to identify conserved genomic regions for primer design. These genomes, obtained from Brazilian isolates (Table S1 ), were realigned using the Clustal Omega multiple sequence alignment tool ( https://www.ebi.ac.uk/tools/msa/clustalo ). The software NEB LAMP Primer Design Tool v1.4.1 ( https://lamp.neb.com ) was used to design two primer sets for YFV RT-LAMP amplification, based on the NS5 and E gene nucleotide sequences. The designed primer sets contained: forward primer (F3), backward primer (B3), forward inner primer (FIP), and backward inner primer (BIP). A TTTT linker sequence was included between the two components of FIP (F1c/F2) and BIP (B1c/B2), as this has been reported to improve the reaction by increasing hybridization sensitivity 17 . The YFV designed primers were compared with the available NS5 and E genes Flavivirus sequences (from DENV and ZIKV) to avoid cross-reaction. Viral RNA extraction Viral RNA was extracted from NHP tissue fragments weighing between 10–30 mg each. The samples were placed in Eppendorf tubes with 600 µl of lysis solution - Monarch® Total RNA MiniPrep kit (New England BioLabs). After maceration for homogeneity, RNA extraction was performed following the manufacturer's instructions. The RNA was eluted in 50 µl of nuclease-free water and stored at -80ºC. RNA quantification was performed using the Qubit™ RNA BR Assay Kit (Q10210) and Qubit™ 4 fluorometer Invitrogen™ (Thermo Fischer Scientific). RT-LAMP reaction The RT-LAMP assay used three primer sets targeting NS1 (described by Nunes et al 13 ), NS5, and E genes specifically designed in this study (Table 2 ). All primers were resuspended in nuclease-free water and combined to make a 10x primer mix as follows for each set: FIP and BIP (16 µM each), F3 and B3 (2 µM each), LF and LB (4 µM each). The RT-LAMP reaction contained 12.5 µL of 2X WarmStart® Colorimetric LAMP Master Mix (New England BioLabs, Protocol M1800), 2.5 µL from each of the 10x primer mixes, 4 µl of target RNA, and RNase-free water totaling 25 µl. The reactions were carried out in 0.2 mL microtubes and incubated in a dry bath (Kasvi) at 65ºC for 40 minutes. Results were visually interpreted, with pink indicating negative and yellow indicating positive results, and recorded using a smartphone camera. Table 2 Sequences of primers used in RT-LAMP assays. *Primer NS1 designed by Nunes et al, 2015. *ACTB Primer designed by Zang et al, 2020. Target Primers Sequence (5' → 3') NS1 * F3 TCCACACCYTGGAGRCAYTR B3 GYCCATCACAGYYGCCRTCA FIP GRCCTCCGATTGAYCTCGGCTTTARTGTGARTGGCCRCTGAC BIP GGTYCAGACRAACGGACCTTGGTTTYCCTGGGCAAGCTTCTCT LF CTTCAACTGATGTTCCAATCGTATG LB ATGCAGGTRCCACTAGAAGTGA NS5 F3 GAACAGTGGAAGACTGCCAA B3 CAGCCACATGTACCAGATGG FIP GCTGATGCARCCGTCGTTCYTCTTTTTGAAGCTGTCCAAGATCCGA BIP GGCAGGTGCCGRACTTGTGTTTTTCGCCTTTCCAAACTCTGACA E F3 TTYATTGAGGGGGTGCATGG B3 CAAGTGGGCTTCACCAGTG FIP GTCYAGTGAAGGCTTGTCRGGGTTTTTGGGTTTCAGCCACYTTG BIP TGCCATTGATGGACCYGCTGARTTTTGGGGCACTTGTCATTGATCT ACTB * F3 AGTACCCCATCGAGCACG B3 AGCCTGGATAGCAACGTACA FIP GAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA BIP CTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC LF TGTGGTGCCAGATTTTCTCCA LB CGAGAAGATGACCCAGATCATGT Analytical specificity of RT-LAMP assays To evaluate the specificity of the RT-LAMP assay for YFV detection, different flaviviruses RNA were tested, including Dengue (DENV-1: DV1 BR90; DENV-2: ICC 265; DENV-3: DV3 BR98; DENV-4: TVT 360) and Zika viruses (ZIKV: BR 2015/15261). Tests were performed in ten independent replicates per protocol, in addition to positive control containing YFV RNA (vaccine strain 17D), and negative controls using nuclease-free water instead of RNA. Furthermore, RT-LAMP assays were conducted to detect YFV in samples containing other flaviviruses. Different pools of RNA were tested, one set containing RNA from DENV1-4, ZIKV, and YFV, and another set containing RNA from DENV1-4 and ZIKV, but excluding YFV. These RT-LAMP assays were performed in independent triplicates. Analytical sensitivity of RT-LAMP assays To evaluate the sensitivity (detection limit) of the RT-LAMP assay for YFV, a ten-fold dilution series of RNA extracted from the supernatant of YFV-infected Vero cells (strain ES-504) was used, with titers ranging from 1.2 x 10 6 to 1.2 x 10 − 3 PFU/mL. After dilution, the samples were tested directly in RT-LAMP, with a negative control included. The assays were conducted in five separate runs and analyzed using probit regression with MedCalc Statistical Software version 19.2.6 (MedCalc Software bv, Ostend, Belgium; www.medcalc.org ; 2020). Evaluation and validation of RT-LAMP assays with NHP tissue samples To validate RT-LAMP for diagnosing YFV in NHP tissues, 60 viscera samples were tested (Table 1 ). All RT-LAMP assays with NHP tissue samples were performed in triplicates. The same assays were also repeated using the endogenous control β-actin from vertebrates as described by Zhang et al. 18 , with some modifications. Each RT-LAMP assay included a negative control (using nuclease-free water instead of RNA) and a positive control containing YFV RNA (vaccine strain 17D). We compared our RT-LAMP results with RT-qPCR assays official results from the national health authority performed at ICC/FIOCRUZ reference laboratory (Carlos Chagas Institute, PR - Brazil) to assess accuracy, sensitivity, and specificity (unpublished data). RESULTS Assessment of RT-LAMP primer for YFV with NHP tissues Each primer set (Table 2 ) was individually tested with NHP tissue samples. The NS5 and E primers, specifically designed for YFV detection in Brazil, effectively identified the virus in the samples. Despite Nunes et al.’s primer 13 targeting the NS1 gene failing to amplify the recent Southern Brazilian circulating YFV strains, it successfully amplified the YFV vaccine strain 17D used as a positive control. Thus, we chose to keep this primer in the protocol due to its ability to amplify strains from other regions of the world. Next, the combination of all three sets of primers (NS5, E, and NS1) was tested in a single RT-LAMP reaction. The assay time was optimized to 40 minutes, compared to the 50 minutes required when each set of primers was evaluated individually. The RT-LAMP results matched the RT-qPCR assays conducted by the national health authorities at FIOCRUZ in the analysis of 60 different tissues from 12 NHP epizootics events. Out of the 60 NHP samples tested with RT-qPCR, 10 were negative, and the remaining 50 were positive (Table 1 ), consistent with the RT-LAMP assay results conducted with three replicates of each tissue sample (Fig. 2 ), showing 100% sensitivity, specificity, and accuracy. All 60 samples tested positive with the RT-LAMP assay targeting the vertebrate endogenous control β-actin. Analytical specificity and sensitivity assessment of RT-LAMP assays The RT-LAMP assay for YFV detection showed no cross-reaction with other viruses from the Flavivirus genus (DENV1-4 and ZIKV). The results were negative across all ten replicates of the analyzed viruses (Fig. 3 ). Additionally, an RT-LAMP assay was conducted to detect YFV in samples containing other flaviviruses, testing pools including RNA from DENV1-4, ZIKV, and YFV, and pools with the same set of viruses, but excluding YFV. Positive results were only observed in experiments involving pools containing YFV. Conversely, samples from pools without YFV yielded negative results across all three replicates (Figure S1 ). Notably, no amplification was detected in negative controls containing water, whereas positive controls containing YFV RNA consistently exhibited amplification. Serial dilutions of YFV (strain ES-504) were used to test the sensitivity (limit of detection) of the RT-LAMP assay for diagnosing YFV. A concentration of 1.2 x 10 1 PFU/mL demonstrated 100% positive performance (Fig. 4 a), while the probit regression analysis resulted in a limit of detection (within 95% reliability) of 2,4 PFU/mL (p < 0,0001) (Fig. 4 b). When considering the orange results as positive (Fig. 4 a), the limit of detection of the assay was 1,2x10 − 1 PFU/mL, and the probit regression analysis resulted in a limit of detection (within 95% reliability) of 5x10 − 1 (p < 0,0001) (Fig. 4 c). DISCUSSION Labor-intensive techniques (e.g.: RT-qPCR) impede early detection of YFV in NHP, humans, and mosquitoes, delaying the implementation of YF surveillance programs due to the need for specialized equipment and skilled technicians 19 . In this study, RT-LAMP assays using three primers targeting different molecular regions (NS1, NS5, and E) streamline YFV detection, reducing processing time compared to RT-qPCR, and overcoming limitations in early YFV detection through both molecular and serological methods 20,21 . Initial experiments revealed that the NS1 primer for YFV 13 failed to amplify South American strains (Accession numbers: OP508651.1, OP508679.1, OP508678.1, OP508680.1, OP508683.1, OP508684.1, OP508652.1) from a recent outbreak in Southern Brazil (2019 to 2021). This failure was due to genetic polymorphisms at the primer binding site, as it was originally designed based on older strains from Bolivia, Colombia, Ecuador, French Guiana, Panama, Peru, Trinidad, Venezuela, the vaccine strain, and Brazil that circulated between 1980 and 2002 13 . Indeed, Meagher et al (2018) 22 noted that the NS1 region is not completely conserved across YFV lineages from Africa, the 17D vaccine strain, and South America. To tackle this, in this study new degenerate primers targeting conserved NS5 and E regions of the YFV genome were designed to broaden coverage across multiple virus strains, enhancing test robustness and sensitivity 22 . These, alongside the NS1 primer 13 , were employed in RT-LAMP reactions for specific YFV RNA detection. Therefore, it is recommended to periodically review the YFV diagnostic primers used in both RT-qPCR or RT-LAMP assays to identify mutations and reduce the risk of false negatives. Several molecular diagnostic protocols for YFV have been proposed 13,19,20,21,23 , yet none have been evaluated using field-collected samples from NHP tissues. Despite Nunes et al.’s (2011) 21 findings, which demonstrated higher sensitivity in detecting YFV in experimentally infected hamster liver samples (by PCR and RT-qPCR techniques), the RT-LAMP assay showed potential in detecting YFV across all NHP samples, even in tissues such as lung, heart, and kidney, which are commonly known to have low YFV viral loads 2 . The limit of detection identified in this study is found to be equivalent to 12 PFU/mL (Fig. 4 a-b), a result like that demonstrated by Nunes et al 13 of 19 PFU/mL using RT-LAMP, and equivalent to those observed using RT-qPCR (9 PFU/mL) 21 . Following Astari et al 24 findings, which interpret orange results as indicative of amplification, the assay's detection limit might be even lower than 12 PFU/mL (Fig. 4 c). Also, our study found no cross-reaction with other arboviruses, including DENV1-4 and ZIKV, indicating the specificity of the RT-LAMP assay for YFV detection, mitigating a common potential limitation of Flavivirus diagnostic 25 . Even when other flaviviruses were present in a pooled experiment (DENV1-4 + ZIKV + YFV), the RT-LAMP assay showed high sensitivity, with no interference in YFV detection. Additionally, in the absence of YFV in a flavivirus pool, no amplification occurred, confirming the specificity of the primers designed for YFV detection. The RT-LAMP assay developed for NHPs is expected to detect YFV in humans and mosquitoes, as the primers were designed based on prevalent strains in these groups. It exhibits 100% specificity and sensitivity (Fig. 2 , Table 1 ), comparable to the RT-qPCR technique 21 , making it a reliable, cost-effective, and user-friendly alternative for YFV molecular diagnosis. It addresses critical gaps present in other protocols 20,21 , offering easily interpretable results without sophisticated equipment. Our goal is to improve surveillance of NHP epizootics, humans, and mosquitoes, to enable a prompt response to prevent human YFV outbreaks. CONCLUSION Early detection of Yellow Fever in the NHP can assist in the prevention of human epidemics. However, the current diagnostic method (RT-qPCR) is costly, time-consuming, and requires trained personnel, making it impractical for monitoring. New diagnostic technologies should be fast, cheap, sensitive, and usable in decentralized settings. In this study, an RT-LAMP assay for YFV diagnosis was developed with a 40-minute incubation time, requiring no trained technicians or expensive equipment. The results are visible to the naked eye, reducing process time. The assay showed 100% specificity and sensitivity, proving robust and reliable for YF diagnosis. Declarations ACKNOWLEDGEMENTS The authors would like to thank the Directorate of Epidemiological Surveillance of the State of Santa Catarina (DIVE/SC), Brazil, for collecting the NHP tissue samples, and LACEN/SC for sharing the RT-qPCR official results. AUTHOR´S CONTRIBUTION SFC drafted the manuscript and collected the NHP tissue samples; SFC, ANP, AAGY, ICP, and LDRP participated in data generation and analysis; AAGY helped with primer design, experimental design, and molecular analysis; LWG, DCL, MSASN, and DSM helped with all project logistics and molecular analyzes; ANP and LDPR helped in the paper drafting by critically reading the original manuscript; ANP and LDPR were the principal investigators, participated in its design and coordination. All authors read and approved the final manuscript. DATA AVAILABILITY The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request. CONFLICT OF INTERESTS The authors declare that they have no competing interests. This paper is part of the Ph.D. thesis of Sabrina Fernandes Cardoso from the Graduation Program of Cell and Developmental Biology (PPGBCD) at the Biological Sciences Center (CCB) at the Federal University of Santa Catarina (UFSC). References McArthur, D. B. Emerging infectious diseases. Nurs. Clin. North. Am. 54, 297–311 (2019). Vasconcelos, P. F. C. Febre amarela [Yellow Fever]. Rev. Soc. Bras. Med. Trop. 36, 275–293 (2003). Mukhopadhyay, S., Kuhn, R. J., Rossmann, M. G. A. Structural perspective of the flavivirus life cycle. Nat. Rev. Microbiol. 3, 13–22 (2005). Domingo, C., Patel, P., Linke, S., Achazi K., Niedrig, M. Molecular diagnosis of flaviviruses. Future. Virol. 6, 1059–1074 (2011). Chambers. T.J., Hahn, C.S., Galler, R., Rice, C.M. Flavivirus genome organization, expression and replication. Annu. Rev. Microbiol. 44, 649–688 (1990). Silva, N. I. O. et al . Recent sylvatic yellow fever virus transmission in Brazil: the news from an old disease. Virol J. 17, 9–20 (2020). Mir, D. et al . Phylodynamics of yellow fever virus in the Americas: new insights into the origin of the 2017 Brazilian outbreak. Sci Rep. 7, 7385 (2017). Giovanetti, M. et al . Genomic epidemiology unveils the dynamics and spatial corridor behind the yellow fever virus outbreak in Southern Brazil. Sci. Adv. 9, eadg9204 (2023). Ministério da Saúde. Secretaria de Vigilância em Saúde. Departamento de Vigilância das Doenças Transmissíveis. Guia de Vigilância de Epizootias em Primatas não Humanos e Entomologia Aplicada à Vigilância da Febre Amarela. Brasília, v2, (2014). Moreno, E. S. et al . Yellow fever epizootics in non-human primates, São Paulo state, Brazil, 2008–2009. Rev. Inst. Med. Trop. Sao Paulo. 55, 45–50 (2013). Ministério da Saúde. Secretaria de Atenção à Saúde. Febre amarela: guia para profissionais de saúde. Ministério da Saúde, Secretaria de Atenção à Saúde, 1. ed. Brasília: Ministério da Saúde, 67 (2017). Diego, J. G. B. et al. A simple, affordable, rapid, stabilized, colorimetric, versatile RT-LAMP assay to detect SARS-CoV-2. Diagnostics (Basel). 11, 438 (2021). Nunes, M. R. T. et al . Analysis of a Reverse Transcription Loop-mediated Isothermal Amplification (RT-LAMP) for yellow fever diagnostic. J. Virol. Methods. 226, 40–51 (2015). Notomi, T. et al . Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, E63 (2000). Mori, Y., Notomi, T. Loop-mediated isothermal amplification (LAMP): a rapid, accurate, and cost-effective diagnostic method for infectious diseases. J. Infect. Chemother. 15, 62–69 (2009). Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes. 16, 223–229 (2002). Torres, C. et al . LAVA: an open-source approach to designing LAMP (loop-mediated isothermal amplification) DNA signatures. BMC Bioinformatics. 12, 240 (2011). Zhang, Y. et al . Enhancing colorimetric loop-mediated isothermal amplification speed and sensitivity with guanidine chloride. Biotechniques. 69, 178–185 (2020). Domingo, C. et al . Advanced Yellow Fever Virus Genome Detection in Point-of-Care Facilities and Reference Laboratories. J. Clin. Microbiol. 50, 4054–4060 (2012). Domingo, C. et al . First international external quality assessment study on molecular and serological methods for yellow fever diagnosis. PLoS One. 7, e36291 (2012). Nunes, M. R. et al . Evaluation of two molecular methods for the detection of yellow fever virus genome. J. Virol. Methods. 174, 29–34 (2011). Meagher, R. J., Priye, A., Light, Y. K., Huang, C., Wang, E. Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA. Analyst. 16, 143, 1924–1933 (2018). Kwallah, A. O. et al . A real-time reverse transcription loop-mediated isothermal amplification assay for the rapid detection of yellow fever virus. J. Virol. Methods. 193, 23–27 (2013). Astari, D. E. et al . Development of a reverse transcription loop-mediated isothermal amplification assay with novel quantitative pH biosensor readout method for SARS-CoV-2 detection. APMIS. https://doi.org/10.1111/apm.13415 (2024). Silva, S., J., R. et al . Development and Validation of Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) for Rapid Detection of ZIKV in Mosquito Samples from Brazil. Sci. Rep. 9, 4494 (2019). Additional Declarations No competing interests reported. Supplementary Files SUPPLEMENTARYINFORMATION.pdf Cite Share Download PDF Status: Published Journal Publication published 28 Sep, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 16 Aug, 2024 Reviews received at journal 13 Aug, 2024 Reviews received at journal 18 Jul, 2024 Reviewers agreed at journal 08 Jul, 2024 Reviewers agreed at journal 08 Jul, 2024 Reviewers invited by journal 07 Jul, 2024 Editor assigned by journal 07 Jul, 2024 Editor invited by journal 03 Jul, 2024 Submission checks completed at journal 03 Jul, 2024 First submitted to journal 02 Jul, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4674680\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":330673756,\"identity\":\"b1b68b31-099a-4263-b5b4-6de3a135f429\",\"order_by\":0,\"name\":\"Sabrina F. Cardoso\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Cell Biology, Embryology, and Genetics, Federal University of Santa Catarina (UFSC)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sabrina\",\"middleName\":\"F.\",\"lastName\":\"Cardoso\",\"suffix\":\"\"},{\"id\":330673758,\"identity\":\"fdcf2dc6-31d6-44a5-95a2-2a80228fb637\",\"order_by\":1,\"name\":\"Andre Akira Gonzaga Yoshikawa\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Cell Biology, Embryology, and Genetics, Federal University of Santa Catarina (UFSC)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Andre\",\"middleName\":\"Akira Gonzaga\",\"lastName\":\"Yoshikawa\",\"suffix\":\"\"},{\"id\":330673759,\"identity\":\"731f77db-429f-4af1-a649-4473b1c87a3b\",\"order_by\":2,\"name\":\"Iara Carolini Pinheiro\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Cell Biology, Embryology, and Genetics, Federal University of Santa Catarina (UFSC)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Iara\",\"middleName\":\"Carolini\",\"lastName\":\"Pinheiro\",\"suffix\":\"\"},{\"id\":330673763,\"identity\":\"c2f83b90-aa63-4195-9c5d-8ae54b821014\",\"order_by\":3,\"name\":\"Lucilene Wildner Granella\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Microbiology, Immunology and Parasitology, Federal University of Santa Catarina (UFSC)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lucilene\",\"middleName\":\"Wildner\",\"lastName\":\"Granella\",\"suffix\":\"\"},{\"id\":330673765,\"identity\":\"1e35d093-ea69-49d6-bcfa-9fc32219f330\",\"order_by\":4,\"name\":\"Dinair Couto-Lima\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hematozoan Transmitting Mosquito Laboratory, Oswaldo Cruz Institute, Oswaldo Foundation Cruz\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dinair\",\"middleName\":\"\",\"lastName\":\"Couto-Lima\",\"suffix\":\"\"},{\"id\":330673768,\"identity\":\"9d647a82-c5b3-4642-a12e-1ccea65ce269\",\"order_by\":5,\"name\":\"Maycon Sebastião Alberto Santos Neves\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hematozoan Transmitting Mosquito Laboratory, Oswaldo Cruz Institute, Oswaldo Foundation Cruz\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Maycon\",\"middleName\":\"Sebastião Alberto Santos\",\"lastName\":\"Neves\",\"suffix\":\"\"},{\"id\":330673772,\"identity\":\"33a570b3-a33c-43a3-b0bd-4c1b14c4a33c\",\"order_by\":6,\"name\":\"Daniel Santos Mansur\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Microbiology, Immunology and Parasitology, Federal University of Santa Catarina (UFSC)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Daniel\",\"middleName\":\"Santos\",\"lastName\":\"Mansur\",\"suffix\":\"\"},{\"id\":330673777,\"identity\":\"a7dbcbc6-a9ae-48e4-a436-b4f23bd0b341\",\"order_by\":7,\"name\":\"André N. Pitaluga\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Oswaldo Cruz Institute (IOC), FIOCRUZ\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"André\",\"middleName\":\"N.\",\"lastName\":\"Pitaluga\",\"suffix\":\"\"},{\"id\":330673780,\"identity\":\"9bf4aab1-ddd6-4c0d-9b8e-03b6c3ca2a81\",\"order_by\":8,\"name\":\"Luísa D. P. Rona\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxElEQVRIiWNgGAWjYBACPgbGBiiT+QBDBZAyIKSFDaGFLYHhDHFa4IDHgEgtEsnNH34w3JMzZz/zTeLAHzsGc+kDhLQktkn2MBQbW/bkbpM42JbMYNmXQFgLAw9DQuKGA7nbpD82HGAwOEPQYYnNH/+AtJx/8wzoMOK0NEiDbbmRwyZxgI0YLTwP26RlDBKMDW48M7YA+oXHsoeAFn729Mcf31QkyBmcT354AxhicuY8BLRAAFJcEKdhFIyCUTAKRgF+AAA68D80rWLZ0QAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Department of Cell Biology, Embryology, and Genetics, Federal University of Santa Catarina (UFSC)\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Luísa\",\"middleName\":\"D. P.\",\"lastName\":\"Rona\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-07-02 13:46:14\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4674680/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4674680/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1038/s41598-024-74020-4\",\"type\":\"published\",\"date\":\"2024-09-28T15:57:00+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":61197954,\"identity\":\"21d52d62-8c83-498a-9dd4-d1c917df1dd8\",\"added_by\":\"auto\",\"created_at\":\"2024-07-27 00:36:22\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":550857,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eCollection sites for non-human primate (NHP) tissues in municipalities from the Southern region of Santa Catarina State, Brazil. The left side features a map of Brazil, while the right side provides a magnified view of the red box from the Brazil map, indicating the specific sample collection sites (red triangles). The x and y axes on the right map represent longitude and latitude, respectively. The number of collections from each municipality is shown in parentheses.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"okFigure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4674680/v1/5bfa64536383d4f4d9a36b10.png\"},{\"id\":61197958,\"identity\":\"450244fa-57de-48e7-9e45-3d25e8785c1b\",\"added_by\":\"auto\",\"created_at\":\"2024-07-27 00:36:23\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":7547454,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eYFV detection in NHP tissue samples using RT-LAMP with three primers set (NS5, E, and NS1). Amplification products were visually inspected, with pink indicating negative and yellow indicating positive results. 1 – 50: positive results, 51 – 60: negative results, NC: negative control using nuclease-free water instead of RNA, PC: positive control with YFV RNA (vaccine strain 17D).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"okFigure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4674680/v1/63a0a9bf9d1f3ecdbd08cd4a.png\"},{\"id\":61197955,\"identity\":\"89d2d110-16bf-4adf-9a9e-bfec45692ace\",\"added_by\":\"auto\",\"created_at\":\"2024-07-27 00:36:22\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":5099534,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eRT-LAMP specificity test assay for YFV detection. The RNA of other flaviviruses circulating in Brazil were tested, including Dengue (DENV-1: DV1 BR90; DENV-2: ICC 265; DENV-3: DV3 BR98; DENV-4: DVT 360) and Zika viruses (ZIKV: BR 2015/15261). R1 – R10: ten independent replicates containing \\u003cem\\u003eFlavivirus\\u003c/em\\u003e RNA, PC: positive control containing YFV RNA (vaccine strain 17D), NC: negative control using nuclease-free water instead of RNA. Amplification products were visually inspected, with pink indicating negative and yellow indicating positive results.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"okFigure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4674680/v1/3acbfc4ba6bd0ed39df8542f.png\"},{\"id\":61197957,\"identity\":\"2646cb39-0e0b-473e-ae47-f959c7ed7a49\",\"added_by\":\"auto\",\"created_at\":\"2024-07-27 00:36:23\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":5562047,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSensitivity of YFV RT-LAMP assay. a) Assay colorimetric results of five replicates (1 - 5) and a negative control with water (6) tested with a serial dilution of YFV RNA (10\\u003csup\\u003e6\\u003c/sup\\u003e - 10\\u003csup\\u003e-3\\u003c/sup\\u003e PFU/mL). b) Limit of detection of 10\\u003csup\\u003e1\\u003c/sup\\u003e PFU/mL established through the probit regression analysis and considering only yellow results as positive. c) Limit of detection of 10\\u003csup\\u003e-1\\u003c/sup\\u003e PFU/mL established through the probit regression analysis and considering yellow and orange results\\u0026nbsp;as\\u0026nbsp;positive.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"okFigure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4674680/v1/4bea2f515a5434a0f388875d.png\"},{\"id\":65627114,\"identity\":\"6bcd3bf3-f936-46d1-a9db-fa9ba25b3bfa\",\"added_by\":\"auto\",\"created_at\":\"2024-09-30 16:12:04\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":36524404,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4674680/v1/bee79abf-458d-4bee-b20b-0c06af99a5ae.pdf\"},{\"id\":61197956,\"identity\":\"566b7f53-fa01-40a8-bbb3-7b0c0f89c495\",\"added_by\":\"auto\",\"created_at\":\"2024-07-27 00:36:23\",\"extension\":\"pdf\",\"order_by\":6,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":130847,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SUPPLEMENTARYINFORMATION.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4674680/v1/1efcd21f543b3e9833cb9029.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Development and Validation of RT-LAMP for Detecting Yellow Fever Virus in Non- Human Primates Samples from Brazil\",\"fulltext\":[{\"header\":\"INTRODUCTION\",\"content\":\"\\u003cp\\u003eYellow fever (YF) is a reemerging, zoonotic, mosquito-borne infectious disease that affects humans and non-human primates (NHP)\\u003csup\\u003e1,2\\u003c/sup\\u003e. The etiological agent of the disease is the yellow fever virus (YFV), a member of the \\u003cem\\u003eFlavivirus\\u003c/em\\u003e genus, which also includes well-known viruses such as the Dengue virus (DENV) and Zika virus (ZIKV)\\u003csup\\u003e3\\u003c/sup\\u003e. The YFV has a single-stranded, positive-sense RNA genome, approximately 11.000 nucleotides long. This genome encodes a polyprotein that contains three viral structural proteins: capsid (C), membrane (M), and envelope (E), and seven non-structural proteins (NS) (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5)\\u003csup\\u003e4,5\\u003c/sup\\u003e. There are seven known YFV genotypes: five in Africa (West Africa I and II, East Africa, East/Central Africa, and Angola) and two in the Americas (South America I and II), with the South American genotypes derived from the West African ones\\u003csup\\u003e6\\u003c/sup\\u003e. In Brazil, South America I is the predominant genotype, consisting of five distinct lineages (1A-1E). Until the mid-1990s, the ancient lineages (1A, 1B, and 1C) co-circulated in South America but were replaced by the current ones, 1D and 1E\\u003csup\\u003e6,7\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eThe YF is sustained through two fundamental cycles: urban and sylvatic. In the urban cycle, \\u003cem\\u003eAedes aegypti\\u003c/em\\u003e transmits the virus to humans, while in the sylvatic cycle, various mosquito species, particularly those of the genera \\u003cem\\u003eHaemagogus\\u003c/em\\u003e and \\u003cem\\u003eSabethes\\u003c/em\\u003e, play a crucial role in South America's transmission. The NHP serves as the primary sylvatic host for YFV and acts as a virus-amplifying and highly susceptible host\\u003csup\\u003e2\\u003c/sup\\u003e. In recent years, the re-emergence of YFV has significantly impacted public health in Brazil. Since 2002, YFV has expanded its circulation, spreading from the East towards the South of Brazil. During these outbreaks, thousands of NHP deaths were documented, and over 2100 human cases were reported, with a case fatality rate of approximately 30%\\u003csup\\u003e8\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eThe focus of yellow fever surveillance in Brazil is centered on three key areas: monitoring human cases, entomology, and epizootics in NHP\\u003csup\\u003e9\\u003c/sup\\u003e. Epizootic events involving YF are crucial for predicting and identifying human cases of the disease\\u003csup\\u003e10\\u003c/sup\\u003e. Therefore, NHP surveillance aims to reduce the morbidity and mortality associated with the disease by investigating suspected epizootics, identifying YFV circulation, and preventing its transmission to humans\\u003csup\\u003e9\\u003c/sup\\u003e. However, YFV detection is hampered because it is conducted in a few national reference laboratories far from the NHP epizootic sites, limiting detailed spatiotemporal tracking of YFV incidence in Brazilian microregions\\u003csup\\u003e8\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eThe gold standard for detecting YFV RNA is molecular diagnostics using reverse transcriptase followed by polymerase chain reaction (RT-qPCR)\\u003csup\\u003e11\\u003c/sup\\u003e. However, this method is costly, and requires specialized equipment and skilled personnel, making it incompatible with point-of-care (POC) applications\\u003csup\\u003e12\\u003c/sup\\u003e. Consequently, such analyses are usually performed in central reference laboratories, thereby prolonging the diagnostic process\\u003csup\\u003e11,13\\u003c/sup\\u003e. The loop-mediated isothermal amplification technique (LAMP)\\u003csup\\u003e14\\u003c/sup\\u003e is a valuable, rapid, sensitive, and cost-effective alternative to the gold standard RT-qPCR for monitoring diseases. This nucleic acid amplification method works under isothermal conditions, with results visible to the naked eye. It also allows RNA sequence amplification through RT-LAMP\\u003csup\\u003e15,16\\u003c/sup\\u003e. In this study, an RT-LAMP molecular assay for YFV diagnostics in NHP tissues was developed and validated. This diagnostic pipeline aids in early virus detection, especially in municipalities experiencing epizootics, facilitating the prompt initiation of prophylactic measures\\u003csup\\u003e11\\u003c/sup\\u003e.\\u003c/p\\u003e\"},{\"header\":\"MATERIALS AND METHODS\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003eCollection of NHP tissue samples\\u003c/h2\\u003e\\n \\u003cp\\u003eThe biological samples analyzed in this study were obtained from NHP epizootics events in municipalities within the Southern region of Santa Catarina State (Southern Brazil). The specimens were collected by the Santa Catarina State Epidemiological Surveillance Service (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). The state government collected tissue fragments from NHP carcasses, stored them in cryotubes, froze them, and transported them to the Central Public Health Laboratory (LACEN/SC), and subsequently to the FIOCRUZ reference laboratory (Carlos Chagas Institute, PR - Brazil) for official YFV molecular diagnosis by RT-qPCR technique. Simultaneously, approximately 0.5 cm\\u003csup\\u003e2\\u003c/sup\\u003e pieces of tissue were collected for this study, preserved in RNAlater\\u0026trade; stabilization solution (Invitrogen - Thermo Fisher Scientific, Waltham, MA, USA), and stored at -20\\u0026ordm;C until the moment of viral RNA extraction. A total of 12 NHP epizootics, sampled between March 2021 and February 2022, were processed and analyzed. In each collection, tissues from five types were obtained: spleen, heart, liver, lung, and kidney, resulting in a total of 60 tissues analyzed. Epidemiological data for each NHP sample are detailed in Table \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e\\n \\u003ctable id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\n \\u003ccaption language=\\\"En\\\"\\u003e\\n \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\n \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\n \\u003cp\\u003eEpidemiological data summary for Non-Human Primate (NHP) samples. Municipality: location where the sample was collected. Collection date: date of sample collection. SINAN number: identification number in the National Notifiable Diseases Information System. Host: species of the host. RT-qPCR: results of the RT-qPCR test from the FIOCRUZ reference laboratory (Carlos Chagas Institute, PR - Brazil). Tissues from five types (spleen, heart, liver, lung, and kidney) were obtained in each of the 12 collections, totaling 60 tissues analyzed. The RT-qPCR results were consistent across all tissues in each collection.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003c/caption\\u003e\\n \\u003ccolgroup cols=\\\"5\\\"\\u003e\\u003c/colgroup\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eMunicipality\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCollection date\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eSINAN number\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHost\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eRT-qPCR Result\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\" rowspan=\\\"3\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eRio Fortuna\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e03/03/2021\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e4563807\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eAllouatta genus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eDetectable\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e08/03/2021\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e4563814\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eAllouatta genus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eDetectable\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e16/03/2021\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e4563818\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eAllouatta genus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eDetectable\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eSanta Rosa de Lima\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e05/03/2021\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e1414470\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eAllouatta genus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eDetectable\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eBra\\u0026ccedil;o do Norte\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e06/03/2021\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e5069209\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eAllouatta genus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eDetectable\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e31/03/2021\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e5069214\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eCallithrix genus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eNot detectable\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\" rowspan=\\\"3\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eS\\u0026atilde;o Martinho\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e13/03/2021\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e4606986\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eAllouatta genus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eDetectable\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e17/03/2021\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e4606990\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eAllouatta genus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eDetectable\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e06/04/2021\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e5175026\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eAllouatta genus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eDetectable\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePedras Grandes\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e23/11/2021\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e3229070\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eAllouatta genus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eDetectable\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e24/11/2021\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e3229071\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eAllouatta genus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eDetectable\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eLaguna\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e19/02/2022\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e8285928\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eCepajus genus\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eNot detectable\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n \\u003c/div\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003ePrimer design for YFV\\u003c/h2\\u003e\\n \\u003cp\\u003eAround 50 complete YFV genomes from GenBank were analyzed to identify conserved genomic regions for primer design. These genomes, obtained from Brazilian isolates (Table \\u003cspan class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e), were realigned using the Clustal Omega multiple sequence alignment tool (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.ebi.ac.uk/tools/msa/clustalo\\u003c/span\\u003e\\u003c/span\\u003e). The software NEB LAMP Primer Design Tool v1.4.1 (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://lamp.neb.com\\u003c/span\\u003e\\u003c/span\\u003e) was used to design two primer sets for YFV RT-LAMP amplification, based on the NS5 and E gene nucleotide sequences. The designed primer sets contained: forward primer (F3), backward primer (B3), forward inner primer (FIP), and backward inner primer (BIP). A TTTT linker sequence was included between the two components of FIP (F1c/F2) and BIP (B1c/B2), as this has been reported to improve the reaction by increasing hybridization sensitivity\\u003csup\\u003e17\\u003c/sup\\u003e. The YFV designed primers were compared with the available NS5 and E genes \\u003cem\\u003eFlavivirus\\u003c/em\\u003e sequences (from DENV and ZIKV) to avoid cross-reaction.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003eViral RNA extraction\\u003c/h2\\u003e\\n \\u003cp\\u003eViral RNA was extracted from NHP tissue fragments weighing between 10\\u0026ndash;30 mg each. The samples were placed in Eppendorf tubes with 600 \\u0026micro;l of lysis solution - Monarch\\u0026reg; Total RNA MiniPrep kit (New England BioLabs). After maceration for homogeneity, RNA extraction was performed following the manufacturer\\u0026apos;s instructions. The RNA was eluted in 50 \\u0026micro;l of nuclease-free water and stored at -80\\u0026ordm;C. RNA quantification was performed using the Qubit\\u0026trade; RNA BR Assay Kit (Q10210) and Qubit\\u0026trade; 4 fluorometer Invitrogen\\u0026trade; (Thermo Fischer Scientific).\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003eRT-LAMP reaction\\u003c/h2\\u003e\\n \\u003cp\\u003eThe RT-LAMP assay used three primer sets targeting NS1 (described by Nunes et al\\u003csup\\u003e13\\u003c/sup\\u003e), NS5, and E genes specifically designed in this study (Table\\u0026nbsp;\\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). All primers were resuspended in nuclease-free water and combined to make a 10x primer mix as follows for each set: FIP and BIP (16 \\u0026micro;M each), F3 and B3 (2 \\u0026micro;M each), LF and LB (4 \\u0026micro;M each). The RT-LAMP reaction contained 12.5 \\u0026micro;L of 2X WarmStart\\u0026reg; Colorimetric LAMP Master Mix (New England BioLabs, Protocol M1800), 2.5 \\u0026micro;L from each of the 10x primer mixes, 4 \\u0026micro;l of target RNA, and RNase-free water totaling 25 \\u0026micro;l. The reactions were carried out in 0.2 mL microtubes and incubated in a dry bath (Kasvi) at 65\\u0026ordm;C for 40 minutes. Results were visually interpreted, with pink indicating negative and yellow indicating positive results, and recorded using a smartphone camera.\\u003c/p\\u003e\\n \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u0026nbsp;\\u003ctable id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e\\n \\u003ccaption language=\\\"En\\\"\\u003e\\n \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e\\n \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\n \\u003cp\\u003eSequences of primers used in RT-LAMP assays. *Primer NS1 designed by Nunes et al, 2015. *ACTB Primer designed by Zang et al, 2020.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003c/caption\\u003e\\n \\u003ccolgroup cols=\\\"10\\\"\\u003e\\u003c/colgroup\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTarget\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\" colspan=\\\"7\\\"\\u003e\\n \\u003cp\\u003ePrimers Sequence (5\\u0026apos; \\u0026rarr; 3\\u0026apos;)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\" rowspan=\\\"6\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNS1\\u003c/strong\\u003e*\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eF3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003eTCCACACCYTGGAGRCAYTR\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eB3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003eGYCCATCACAGYYGCCRTCA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eFIP\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"7\\\"\\u003e\\n \\u003cp\\u003eGRCCTCCGATTGAYCTCGGCTTTARTGTGARTGGCCRCTGAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eBIP\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"8\\\"\\u003e\\n \\u003cp\\u003eGGTYCAGACRAACGGACCTTGGTTTYCCTGGGCAAGCTTCTCT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eLF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"5\\\"\\u003e\\n \\u003cp\\u003eCTTCAACTGATGTTCCAATCGTATG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eLB\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003eATGCAGGTRCCACTAGAAGTGA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\" rowspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNS5\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eF3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003eGAACAGTGGAAGACTGCCAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eB3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003eCAGCCACATGTACCAGATGG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eFIP\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"8\\\"\\u003e\\n \\u003cp\\u003eGCTGATGCARCCGTCGTTCYTCTTTTTGAAGCTGTCCAAGATCCGA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eBIP\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"8\\\"\\u003e\\n \\u003cp\\u003eGGCAGGTGCCGRACTTGTGTTTTTCGCCTTTCCAAACTCTGACA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\" rowspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eE\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eF3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003eTTYATTGAGGGGGTGCATGG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eB3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003eCAAGTGGGCTTCACCAGTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eFIP\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"8\\\"\\u003e\\n \\u003cp\\u003eGTCYAGTGAAGGCTTGTCRGGGTTTTTGGGTTTCAGCCACYTTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eBIP\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"8\\\"\\u003e\\n \\u003cp\\u003eTGCCATTGATGGACCYGCTGARTTTTGGGGCACTTGTCATTGATCT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\" rowspan=\\\"6\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eACTB\\u003c/strong\\u003e*\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eF3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003eAGTACCCCATCGAGCACG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eB3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003eAGCCTGGATAGCAACGTACA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eFIP\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"7\\\"\\u003e\\n \\u003cp\\u003eGAGCCACACGCAGCTCATTGTATCACCAACTGGGACGACA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eBIP\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"7\\\"\\u003e\\n \\u003cp\\u003eCTGAACCCCAAGGCCAACCGGCTGGGGTGTTGAAGGTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eLF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003eTGTGGTGCCAGATTTTCTCCA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eLB\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\" colspan=\\\"4\\\"\\u003e\\n \\u003cp\\u003eCGAGAAGATGACCCAGATCATGT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n \\u003c/div\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003eAnalytical specificity of RT-LAMP assays\\u003c/h2\\u003e\\n \\u003cp\\u003eTo evaluate the specificity of the RT-LAMP assay for YFV detection, different flaviviruses RNA were tested, including Dengue (DENV-1: DV1 BR90; DENV-2: ICC 265; DENV-3: DV3 BR98; DENV-4: TVT 360) and Zika viruses (ZIKV: BR 2015/15261). Tests were performed in ten independent replicates per protocol, in addition to positive control containing YFV RNA (vaccine strain 17D), and negative controls using nuclease-free water instead of RNA.\\u003c/p\\u003e\\n \\u003cp\\u003eFurthermore, RT-LAMP assays were conducted to detect YFV in samples containing other flaviviruses. Different pools of RNA were tested, one set containing RNA from DENV1-4, ZIKV, and YFV, and another set containing RNA from DENV1-4 and ZIKV, but excluding YFV. These RT-LAMP assays were performed in independent triplicates.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003eAnalytical sensitivity of RT-LAMP assays\\u003c/h2\\u003e\\n \\u003cp\\u003eTo evaluate the sensitivity (detection limit) of the RT-LAMP assay for YFV, a ten-fold dilution series of RNA extracted from the supernatant of YFV-infected Vero cells (strain ES-504) was used, with titers ranging from 1.2 x 10\\u003csup\\u003e6\\u003c/sup\\u003e to 1.2 x 10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;3\\u003c/sup\\u003e PFU/mL. After dilution, the samples were tested directly in RT-LAMP, with a negative control included. The assays were conducted in five separate runs and analyzed using probit regression with MedCalc Statistical Software version 19.2.6 (MedCalc Software bv, Ostend, Belgium; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ewww.medcalc.org\\u003c/span\\u003e\\u003c/span\\u003e; 2020).\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003eEvaluation and validation of RT-LAMP assays with NHP tissue samples\\u003c/h2\\u003e\\n \\u003cp\\u003eTo validate RT-LAMP for diagnosing YFV in NHP tissues, 60 viscera samples were tested (Table \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). All RT-LAMP assays with NHP tissue samples were performed in triplicates. The same assays were also repeated using the endogenous control \\u0026beta;-actin from vertebrates as described by Zhang et al.\\u003csup\\u003e18\\u003c/sup\\u003e, with some modifications. Each RT-LAMP assay included a negative control (using nuclease-free water instead of RNA) and a positive control containing YFV RNA (vaccine strain 17D). We compared our RT-LAMP results with RT-qPCR assays official results from the national health authority performed at ICC/FIOCRUZ reference laboratory (Carlos Chagas Institute, PR - Brazil) to assess accuracy, sensitivity, and specificity (unpublished data).\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"RESULTS\",\"content\":\"\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAssessment of RT-LAMP primer for YFV with NHP tissues\\u003c/h2\\u003e \\u003cp\\u003eEach primer set (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e) was individually tested with NHP tissue samples. The NS5 and E primers, specifically designed for YFV detection in Brazil, effectively identified the virus in the samples. Despite Nunes et al.\\u0026rsquo;s primer\\u003csup\\u003e13\\u003c/sup\\u003e targeting the NS1 gene failing to amplify the recent Southern Brazilian circulating YFV strains, it successfully amplified the YFV vaccine strain 17D used as a positive control. Thus, we chose to keep this primer in the protocol due to its ability to amplify strains from other regions of the world. Next, the combination of all three sets of primers (NS5, E, and NS1) was tested in a single RT-LAMP reaction. The assay time was optimized to 40 minutes, compared to the 50 minutes required when each set of primers was evaluated individually. The RT-LAMP results matched the RT-qPCR assays conducted by the national health authorities at FIOCRUZ in the analysis of 60 different tissues from 12 NHP epizootics events. Out of the 60 NHP samples tested with RT-qPCR, 10 were negative, and the remaining 50 were positive (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e), consistent with the RT-LAMP assay results conducted with three replicates of each tissue sample (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e), showing 100% sensitivity, specificity, and accuracy. All 60 samples tested positive with the RT-LAMP assay targeting the vertebrate endogenous control β-actin.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAnalytical specificity and sensitivity assessment of RT-LAMP assays\\u003c/h2\\u003e \\u003cp\\u003eThe RT-LAMP assay for YFV detection showed no cross-reaction with other viruses from the \\u003cem\\u003eFlavivirus\\u003c/em\\u003e genus (DENV1-4 and ZIKV). The results were negative across all ten replicates of the analyzed viruses (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). Additionally, an RT-LAMP assay was conducted to detect YFV in samples containing other flaviviruses, testing pools including RNA from DENV1-4, ZIKV, and YFV, and pools with the same set of viruses, but excluding YFV. Positive results were only observed in experiments involving pools containing YFV. Conversely, samples from pools without YFV yielded negative results across all three replicates (Figure \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e). Notably, no amplification was detected in negative controls containing water, whereas positive controls containing YFV RNA consistently exhibited amplification.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eSerial dilutions of YFV (strain ES-504) were used to test the sensitivity (limit of detection) of the RT-LAMP assay for diagnosing YFV. A concentration of 1.2 x 10\\u003csup\\u003e1\\u003c/sup\\u003e PFU/mL demonstrated 100% positive performance (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea), while the probit regression analysis resulted in a limit of detection (within 95% reliability) of 2,4 PFU/mL (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0,0001) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eb). When considering the orange results as positive (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea), the limit of detection of the assay was 1,2x10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e PFU/mL, and the probit regression analysis resulted in a limit of detection (within 95% reliability) of 5x10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0,0001) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ec).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"DISCUSSION\",\"content\":\"\\u003cp\\u003eLabor-intensive techniques (e.g.: RT-qPCR) impede early detection of YFV in NHP, humans, and mosquitoes, delaying the implementation of YF surveillance programs due to the need for specialized equipment and skilled technicians\\u003csup\\u003e19\\u003c/sup\\u003e. In this study, RT-LAMP assays using three primers targeting different molecular regions (NS1, NS5, and E) streamline YFV detection, reducing processing time compared to RT-qPCR, and overcoming limitations in early YFV detection through both molecular and serological methods\\u003csup\\u003e20,21\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eInitial experiments revealed that the NS1 primer for YFV\\u003csup\\u003e13\\u003c/sup\\u003e failed to amplify South American strains (Accession numbers: OP508651.1, OP508679.1, OP508678.1, OP508680.1, OP508683.1, OP508684.1, OP508652.1) from a recent outbreak in Southern Brazil (2019 to 2021). This failure was due to genetic polymorphisms at the primer binding site, as it was originally designed based on older strains from Bolivia, Colombia, Ecuador, French Guiana, Panama, Peru, Trinidad, Venezuela, the vaccine strain, and Brazil that circulated between 1980 and 2002\\u003csup\\u003e13\\u003c/sup\\u003e. Indeed, Meagher et al (2018)\\u003csup\\u003e22\\u003c/sup\\u003e noted that the NS1 region is not completely conserved across YFV lineages from Africa, the 17D vaccine strain, and South America. To tackle this, in this study new degenerate primers targeting conserved NS5 and E regions of the YFV genome were designed to broaden coverage across multiple virus strains, enhancing test robustness and sensitivity\\u003csup\\u003e22\\u003c/sup\\u003e. These, alongside the NS1 primer\\u003csup\\u003e13\\u003c/sup\\u003e, were employed in RT-LAMP reactions for specific YFV RNA detection. Therefore, it is recommended to periodically review the YFV diagnostic primers used in both RT-qPCR or RT-LAMP assays to identify mutations and reduce the risk of false negatives.\\u003c/p\\u003e \\u003cp\\u003eSeveral molecular diagnostic protocols for YFV have been proposed\\u003csup\\u003e13,19,20,21,23\\u003c/sup\\u003e, yet none have been evaluated using field-collected samples from NHP tissues. Despite Nunes et al.\\u0026rsquo;s (2011)\\u003csup\\u003e21\\u003c/sup\\u003e findings, which demonstrated higher sensitivity in detecting YFV in experimentally infected hamster liver samples (by PCR and RT-qPCR techniques), the RT-LAMP assay showed potential in detecting YFV across all NHP samples, even in tissues such as lung, heart, and kidney, which are commonly known to have low YFV viral loads\\u003csup\\u003e2\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eThe limit of detection identified in this study is found to be equivalent to 12 PFU/mL (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea-b), a result like that demonstrated by Nunes et al\\u003csup\\u003e13\\u003c/sup\\u003e of 19 PFU/mL using RT-LAMP, and equivalent to those observed using RT-qPCR (9 PFU/mL)\\u003csup\\u003e21\\u003c/sup\\u003e. Following Astari \\u003cem\\u003eet al\\u003c/em\\u003e\\u003csup\\u003e24\\u003c/sup\\u003e findings, which interpret orange results as indicative of amplification, the assay's detection limit might be even lower than 12 PFU/mL (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ec).\\u003c/p\\u003e \\u003cp\\u003eAlso, our study found no cross-reaction with other arboviruses, including DENV1-4 and ZIKV, indicating the specificity of the RT-LAMP assay for YFV detection, mitigating a common potential limitation of \\u003cem\\u003eFlavivirus\\u003c/em\\u003e diagnostic\\u003csup\\u003e25\\u003c/sup\\u003e. Even when other flaviviruses were present in a pooled experiment (DENV1-4\\u0026thinsp;+\\u0026thinsp;ZIKV\\u0026thinsp;+\\u0026thinsp;YFV), the RT-LAMP assay showed high sensitivity, with no interference in YFV detection. Additionally, in the absence of YFV in a flavivirus pool, no amplification occurred, confirming the specificity of the primers designed for YFV detection.\\u003c/p\\u003e \\u003cp\\u003eThe RT-LAMP assay developed for NHPs is expected to detect YFV in humans and mosquitoes, as the primers were designed based on prevalent strains in these groups. It exhibits 100% specificity and sensitivity (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e), comparable to the RT-qPCR technique\\u003csup\\u003e21\\u003c/sup\\u003e, making it a reliable, cost-effective, and user-friendly alternative for YFV molecular diagnosis. It addresses critical gaps present in other protocols\\u003csup\\u003e20,21\\u003c/sup\\u003e, offering easily interpretable results without sophisticated equipment. Our goal is to improve surveillance of NHP epizootics, humans, and mosquitoes, to enable a prompt response to prevent human YFV outbreaks.\\u003c/p\\u003e\"},{\"header\":\"CONCLUSION\",\"content\":\"\\u003cp\\u003eEarly detection of Yellow Fever in the NHP can assist in the prevention of human epidemics. However, the current diagnostic method (RT-qPCR) is costly, time-consuming, and requires trained personnel, making it impractical for monitoring. New diagnostic technologies should be fast, cheap, sensitive, and usable in decentralized settings. In this study, an RT-LAMP assay for YFV diagnosis was developed with a 40-minute incubation time, requiring no trained technicians or expensive equipment. The results are visible to the naked eye, reducing process time. The assay showed 100% specificity and sensitivity, proving robust and reliable for YF diagnosis.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eACKNOWLEDGEMENTS\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors would like to thank the Directorate of Epidemiological Surveillance of the State of Santa Catarina (DIVE/SC), Brazil, for collecting the NHP tissue samples, and LACEN/SC for sharing the RT-qPCR official results.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAUTHOR\\u0026acute;S CONTRIBUTION\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eSFC drafted the manuscript and collected the NHP tissue samples; SFC, ANP, AAGY, ICP, and LDRP participated in data generation and analysis; AAGY helped with primer design, experimental design, and molecular analysis; LWG, DCL, MSASN, and DSM helped with all project logistics and molecular analyzes; ANP and LDPR helped in the paper drafting by critically reading the original manuscript; ANP and LDPR were the principal investigators, participated in its design and coordination. All authors read and approved the final manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDATA AVAILABILITY\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCONFLICT OF INTERESTS\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e\\n\\u003cp\\u003eThis paper is part of the Ph.D. thesis of Sabrina Fernandes Cardoso from the Graduation Program of Cell and Developmental Biology (PPGBCD) at the Biological Sciences Center (CCB) at the Federal University of Santa Catarina (UFSC).\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eMcArthur, D. B. Emerging infectious diseases. Nurs. Clin. North. Am. 54, 297\\u0026ndash;311 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eVasconcelos, P. F. C. Febre amarela [Yellow Fever]. Rev. Soc. Bras. Med. Trop. 36, 275\\u0026ndash;293 (2003).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMukhopadhyay, S., Kuhn, R. J., Rossmann, M. G. A. Structural perspective of the flavivirus life cycle. Nat. Rev. Microbiol. 3, 13\\u0026ndash;22 (2005).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDomingo, C., Patel, P., Linke, S., Achazi K., Niedrig, M. Molecular diagnosis of flaviviruses. Future. Virol. 6, 1059\\u0026ndash;1074 (2011).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChambers. T.J., Hahn, C.S., Galler, R., Rice, C.M. Flavivirus genome organization, expression and replication. Annu. Rev. Microbiol. 44, 649\\u0026ndash;688 (1990).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSilva, N. I. O. \\u003cem\\u003eet al\\u003c/em\\u003e. Recent sylvatic yellow fever virus transmission in Brazil: the news from an old disease. Virol J. 17, 9\\u0026ndash;20 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMir, D. \\u003cem\\u003eet al\\u003c/em\\u003e. Phylodynamics of yellow fever virus in the Americas: new insights into the origin of the 2017 Brazilian outbreak. Sci Rep. 7, 7385 (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGiovanetti, M. \\u003cem\\u003eet al\\u003c/em\\u003e. Genomic epidemiology unveils the dynamics and spatial corridor behind the yellow fever virus outbreak in Southern Brazil. Sci. Adv. 9, eadg9204 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMinist\\u0026eacute;rio da Sa\\u0026uacute;de. Secretaria de Vigil\\u0026acirc;ncia em Sa\\u0026uacute;de. Departamento de Vigil\\u0026acirc;ncia das Doen\\u0026ccedil;as Transmiss\\u0026iacute;veis. Guia de Vigil\\u0026acirc;ncia de Epizootias em Primatas n\\u0026atilde;o Humanos e Entomologia Aplicada \\u0026agrave; Vigil\\u0026acirc;ncia da Febre Amarela. Bras\\u0026iacute;lia, v2, (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMoreno, E. S. \\u003cem\\u003eet al\\u003c/em\\u003e. Yellow fever epizootics in non-human primates, S\\u0026atilde;o Paulo state, Brazil, 2008\\u0026ndash;2009. Rev. Inst. Med. Trop. Sao Paulo. 55, 45\\u0026ndash;50 (2013).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMinist\\u0026eacute;rio da Sa\\u0026uacute;de. Secretaria de Aten\\u0026ccedil;\\u0026atilde;o \\u0026agrave; Sa\\u0026uacute;de. Febre amarela: guia para profissionais de sa\\u0026uacute;de. Minist\\u0026eacute;rio da Sa\\u0026uacute;de, Secretaria de Aten\\u0026ccedil;\\u0026atilde;o \\u0026agrave; Sa\\u0026uacute;de, 1. ed. Bras\\u0026iacute;lia: Minist\\u0026eacute;rio da Sa\\u0026uacute;de, 67 (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDiego, J. G. B. \\u003cem\\u003eet al.\\u003c/em\\u003e A simple, affordable, rapid, stabilized, colorimetric, versatile RT-LAMP assay to detect SARS-CoV-2. Diagnostics (Basel). 11, 438 (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNunes, M. R. T. \\u003cem\\u003eet al\\u003c/em\\u003e. Analysis of a Reverse Transcription Loop-mediated Isothermal Amplification (RT-LAMP) for yellow fever diagnostic. J. Virol. Methods. 226, 40\\u0026ndash;51 (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNotomi, T. \\u003cem\\u003eet al\\u003c/em\\u003e. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, E63 (2000).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMori, Y., Notomi, T. Loop-mediated isothermal amplification (LAMP): a rapid, accurate, and cost-effective diagnostic method for infectious diseases. J. Infect. Chemother. 15, 62\\u0026ndash;69 (2009).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes. 16, 223\\u0026ndash;229 (2002).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTorres, C. \\u003cem\\u003eet al\\u003c/em\\u003e. LAVA: an open-source approach to designing LAMP (loop-mediated isothermal amplification) DNA signatures. BMC Bioinformatics. 12, 240 (2011).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang, Y. \\u003cem\\u003eet al\\u003c/em\\u003e. Enhancing colorimetric loop-mediated isothermal amplification speed and sensitivity with guanidine chloride. Biotechniques. 69, 178\\u0026ndash;185 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDomingo, C. \\u003cem\\u003eet al\\u003c/em\\u003e. Advanced Yellow Fever Virus Genome Detection in Point-of-Care Facilities and Reference Laboratories. J. Clin. Microbiol. 50, 4054\\u0026ndash;4060 (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDomingo, C. \\u003cem\\u003eet al\\u003c/em\\u003e. First international external quality assessment study on molecular and serological methods for yellow fever diagnosis. PLoS One. 7, e36291 (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNunes, M. R. \\u003cem\\u003eet al\\u003c/em\\u003e. Evaluation of two molecular methods for the detection of yellow fever virus genome. J. Virol. Methods. 174, 29\\u0026ndash;34 (2011).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMeagher, R. J., Priye, A., Light, Y. K., Huang, C., Wang, E. Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA. Analyst. 16, 143, 1924\\u0026ndash;1933 (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKwallah, A. O. \\u003cem\\u003eet al\\u003c/em\\u003e. A real-time reverse transcription loop-mediated isothermal amplification assay for the rapid detection of yellow fever virus. J. Virol. Methods. 193, 23\\u0026ndash;27 (2013).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAstari, D. E. \\u003cem\\u003eet al\\u003c/em\\u003e. Development of a reverse transcription loop-mediated isothermal amplification assay with novel quantitative pH biosensor readout method for SARS-CoV-2 detection. APMIS. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/apm.13415\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/apm.13415\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSilva, S., J., R. \\u003cem\\u003eet al\\u003c/em\\u003e. Development and Validation of Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) for Rapid Detection of ZIKV in Mosquito Samples from Brazil. Sci. Rep. 9, 4494 (2019).\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"scientific-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"scirep\",\"sideBox\":\"Learn more about [Scientific Reports](http://www.nature.com/srep/)\",\"snPcode\":\"\",\"submissionUrl\":\"\",\"title\":\"Scientific Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Scientific Reports\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Diagnosis, Yellow Fever Virus, Yellow Fever, RT-LAMP\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4674680/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4674680/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eMonitoring yellow fever in non-human primates (NHPs) is an early warning system for sylvatic yellow fever outbreaks, aiding in preventing human cases. However, current diagnostic tests for this disease, primarily relying on RT-qPCR, are complex and costly. Therefore, there is a critical need for simpler and more cost-effective methods to detect yellow fever virus (YFV) infection in NHPs, enabling early identification of viral circulation. In this study, an RT-LAMP assay for detecting YFV in NHP samples was developed and validated. Two sets of RT-LAMP primers targeting the YFV NS5 and E genes were designed and tested together with a third primer set to the NS1 locus using NHP tissue samples from Southern Brazil.\\u003c/p\\u003e \\u003cp\\u003eThe results were visualized by colorimetry and compared to the RT-qPCR test. Standardization and validation of the RT-LAMP assay demonstrated 100% sensitivity and specificity compared to RT-qPCR, with a detection limit of 12 PFU/mL. Additionally, the cross-reactivity test with other flaviviruses confirmed a specificity of 100%. Our newly developed RT-LAMP diagnostic test for YFV in NHP samples will significantly contribute to yellow fever monitoring efforts, providing a simpler and more accessible method for viral early detection. This advancement holds promise for enhancing surveillance and ultimately preventing the spread of yellow fever.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Development and Validation of RT-LAMP for Detecting Yellow Fever Virus in Non- Human Primates Samples from Brazil\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-07-27 00:36:18\",\"doi\":\"10.21203/rs.3.rs-4674680/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2024-08-16T08:30:13+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2024-08-14T01:21:09+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2024-07-18T17:17:40+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"23171970548731639471770207455406070221\",\"date\":\"2024-07-08T11:03:27+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"288156216736665802033885825537531366809\",\"date\":\"2024-07-08T11:00:13+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2024-07-07T21:30:44+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2024-07-07T21:26:45+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvited\",\"content\":\"\",\"date\":\"2024-07-03T14:05:09+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2024-07-03T13:55:47+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Scientific Reports\",\"date\":\"2024-07-02T13:45:01+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"scientific-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"scirep\",\"sideBox\":\"Learn more about [Scientific Reports](http://www.nature.com/srep/)\",\"snPcode\":\"\",\"submissionUrl\":\"\",\"title\":\"Scientific Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Scientific Reports\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"aae3dbfe-2be8-446d-a255-0de816cc2228\",\"owner\":[],\"postedDate\":\"July 27th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[{\"id\":35005823,\"name\":\"Biological sciences/Microbiology/Infectious disease diagnostics\"},{\"id\":35005828,\"name\":\"Biological sciences/Molecular biology\"}],\"tags\":[],\"updatedAt\":\"2024-09-30T15:59:46+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-4674680\",\"link\":\"https://doi.org/10.1038/s41598-024-74020-4\",\"journal\":{\"identity\":\"scientific-reports\",\"isVorOnly\":false,\"title\":\"Scientific Reports\"},\"publishedOn\":\"2024-09-28 15:57:00\",\"publishedOnDateReadable\":\"September 28th, 2024\"},\"versionCreatedAt\":\"2024-07-27 00:36:18\",\"video\":\"\",\"vorDoi\":\"10.1038/s41598-024-74020-4\",\"vorDoiUrl\":\"https://doi.org/10.1038/s41598-024-74020-4\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4674680\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4674680\",\"identity\":\"rs-4674680\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}