{"paper_id":"2b4dc51e-9736-456e-9778-5d5e2bf25f48","body_text":"Review Tool reports\nUNDERSTANDING AND CONTEXTUALIZING THE REPORTS\nReaders of these automated manuscript Review Tool reports are encouraged to use them to support them in performing their \nown assessment and ‘health check’ on a preprint prior to it completing peer review.\nHowever, these should only be used as a guide, read within the overall context of the article itself, and should never replace \nfull peer review. Please ensure you read the article fully alongside these and familiarize yourself with the tools and how they \nwork, using the links provided below.\nThese reports are published under the terms of the Creative Commons Attribution License\nSCISCORE® REPORTS: MDAR CHECKLIST FOR AUTHORS AND SCISCORE CORE REPORT\nSciScore® (https://sciscore.com) scans the methodology section of an article for important scientific rigour criteria and key \nbiological resources and highlights if these are accessible or have problems associated. The Materials, Design, Analysis, and \nReporting (MDAR) report and Core report generated from this are included here for transparency and can be cited \nindependently using the DOI below.\n•    Information on the MDAR report: https://sciscore.com/reports/MDAR-Report.php\n•    Information on the Core report: https://sciscore.com/reports/Core-Report.php\nHow to cite the SciScore reports for this article:\nZachariah A, Krishnankutty SP , Manazhi J, Omanakuttan V , Santosh S, et al. SciScore reports for: Lack of detection of SARS- \nCoV-2 in Wildlife from Kerala, India in 2020-21. Access Microbiology. 2023. https://doi.org/10.1099/acmi.0.000686.v1.1\nITHENTICATE® REPORT\niThenticate® (https://www.ithenticate.com) checks the submitted article against an extensive database of articles from the \ninternet and scholarly publications and highlights where similar sentences or phrases have been used previously, including in \nthe author’s own published work. Each individual match is given a percentage score based on how much it overlaps with the \npreviously existing work, and an overall similarity score is given. The report generated from this are included here for \ntransparency and can be cited independently using the DOI below.\n•    FAQs: https://www.ithenticate.com/products/faqs\n•    Help pages: https://help.turnitin.com/ithenticate/ithenticate-user/ithenticate-user.htm#TheSimilarityReport\nHow to cite the iThenticate report for this article:\nZachariah A, Krishnankutty SP , Manazhi J, Omanakuttan V , Santosh S, et al. iThenticate report for: Lack of detection of SARS- \nCoV-2 in Wildlife from Kerala, India in 2020-21. Access Microbiology. 2023. https://doi.org/10.1099/acmi.0.000686.v1.2\n\nSciScore: 2\nWhat's this?\nDocument Identifier: 2277_64c8ce2fb91d65.94943320\nSciScore Report\nBelow you will find your SciScore report containing three tables. Your score is calculated based on\nadherence to scientific rigor criteria (Table 1) and identification of key biological resources (Table 2).\nTable 3 contains statistical tests and oligonucleotides but is not scored. If SciScore makes any mistakes,\nplease contact us  to help us learn and improve.\nTable 1: Rigor Adherence Table\nEthics\nIACUC: Ethical approval was granted by the University of Nottingham School of Veterinary Medicine and\nScience Committee for Animal Research and Ethics (CARE).\nField Sample Permit: Permission for Field work in Forest Areas for Scientific Research and sample collection\nwas as per the permit number KFDHQ- 1979/ 2021-CWW / WL 10 issued by the Chief Wildlife Warden,\nKerala state, India.\nInclusion and Exclusion Criteria\nnot detected.\nAttrition\nnot detected.\nSex as a biological variable\nnot detected.\nSubject Demographics\nAge: not detected.\nWeight: not detected.\nRandomization\nnot detected.\nBlinding\nnot detected.\nPower Analysis\nnot detected.\nReplication\nnot required.\n\nTable 2: Key Resources Table\nYour Sentences REAGENT or\nRESOURCE\nSOURCE IDENTIFIER\n\nOther Entities Detected\nYour Sentences Recognized Entity\nOligonucleotides\nCAGCACAATGAAGATCAAGATCAT CPrimers were F:\nCAGCACAATGAAGATCAAGATCAT C\nand R: CGGACTCATCGTACTCCTGCTT\n7.4Data Summary Demographic information\nfor the samples described is presented in full\nin the supplementary information. CGGACTCATCGTACTCCTGCTT\nSciScore is an automated tool that is designed to assist expert reviewers by finding and presenting\nformulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is\nnot a substitute for expert review. SciScore also checks for the presence and correctness of several\nunique identifiers, including RRIDs (research resource identifiers) in the manuscript, detects sentences\nthat appear to be missing RRIDs, and can even suggest RRIDs under certain circumstances. All RRID\nsuggestions should be verified; only the author can know whether the suggestions are correct.\nFor a full description of scored criteria and tips for improving your score, please see https://\nwww.scicrunch.com/sciscorereport-faq\n\nMaterials Design Analysis Reporting (MDAR) Checklist for Authors\nThe MDAR framework establishes a minimum set of requirements in transparent reporting applicable to studies\nin the life sciences (see Statement of Task: doi:10.31222/osf.oio/9sm4x.). The MDAR checklist is a tool for\nauthors, editors and others seeking to adopt the MDAR framework for transparent reporting in manuscripts\nand other outputs. Please refer to the MDAR Elaboration Document for additional context for the MDAR\nframework.\nReport provided by SciScore | August 01, 2023 | Based on DocumentID 2277_64c8ce2fb91d65.94943320\n\nMaterials\nAntibodies Yes (indicate where provided: page no/section/legend) n/a\nFor commercial reagents, provide supplier name,\ncatalogue number and RRID, if available\nNo antibodes detected.\nPlease add identifiers for all resources where possible\nCell Materials Yes (indicate where provided: page no/section/legend) n/a\nCell lines: Provide species information, strain.\nProvide accession number in repository OR supplier\nname, catalog number, clone number, OR RRID\nNo cell lines detected\nPlease add identifiers for all resources where possible\nPrimary cultures: Provide species, strain, sex of\norigin, genetic modification status.\nNot currently checked by SciScore\nExperimental Animals Yes (indicate where provided: page no/section/legend) n/a\nLaboratory animals: Provide species, strain, sex,\nage, genetic modification status. Provide accession\nnumber in repository OR supplier name, catalog\nnumber, clone number, OR RRID\nNo organisms detected\nPlease add identifiers for all resources where possible\nAnimal observed in or captured from the field: \nProvide species, sex and age where possible\nNot currently checked by SciScore\nModel organisms: Provide Accession number in\nrepository (where relevant) OR RRID\nSee laboratory animals section for information.\nPlants and microbes Yes (indicate where provided: page no/section/legend) n/a\nPlants: provide species and strain, unique accession\nnumber if available, and source (including location for\ncollected wild specimens)\nNot currently checked by SciScore\nMicrobes: provide species and strain, unique\naccession number if available, and source\nNot currently checked by SciScore\nHuman research participants Yes (indicate where provided: page no/section/legend) n/a\nIdentify authority granting ethics approval (IRB or\nequivalent committee(s), provide reference number for\napproval.\nNot detected.\nProvide statement confirming informed consent\nobtained from study participants.\nNot detected.\nReport on age and sex for all study participants. Age:not detected.\nSex:not detected.\nReport provided by SciScore | August 01, 2023 | Based on DocumentID 2277_64c8ce2fb91d65.94943320\n\nDesign\nStudy protocol Yes (indicate where provided: page no/section/legend) n/a\nFor clinical trials, provide the trial registration number\nOR cite DOI in manuscript.\nNot detected.\nLaboratory protocol Yes (indicate where provided: page no/section/legend) n/a\nProvide DOI or other citation details if detailed step-\nby-step protocols are available.\nNot detected.\nExperimental study design (statistics details) Yes (indicate where provided: page no/section/legend) n/a\nState whether and how the following have been done,\nor if they were not carried out\n \nSample size determination not detected.\nRandomization not detected.\nBlinding not detected.\ninclusion/exclusion criteria not detected.\nSample definition and in-laboratory replication Yes (indicate where provided: page no/section/legend) n/a\nState number of times the experiment was replicated\nin laboratory\nNot detected.\nDefine whether data describe technical or biological\nreplicates\nNot detected.\nEthics Yes (indicate where provided: page no/section/legend) n/a\nStudies involving human participants: State details of\nauthority granting ethics approval (IRB or equivalent\ncommittee(s), provide reference number for approval.\nNot detected.\nStudies involving experimental animals: State\ndetails of authority granting ethics approval (IRB or\nequivalent committee(s), provide reference number for\napproval.\nEthical approval was granted by the University of\nNottingham School of Veterinary Medicine and Science\nCommittee for Animal Research and Ethics (CARE).\nStudies involving specimen and field samples: State if\nrelevant permits obtained, provide details of authority\napproving study; if none were required, explain why.\nPermission for Field work in Forest Areas for Scientific\nResearch and sample collection was as per the permit number\nKFDHQ- 1979/ 2021-CWW / WL 10 issued by the Chief\nWildlife Warden, Kerala state, India.\nDual Use Research of Concern (DURC) Yes (indicate where provided: page no/section/legend) n/a\nIf study is subject to dual use research of concern,\nstate the authority granting approval and reference\nnumber for the regulatory approval\nNot currently checked by SciScore\nReport provided by SciScore | August 01, 2023 | Based on DocumentID 2277_64c8ce2fb91d65.94943320\n\nAnalysis\nAttrition Yes (indicate where provided: page no/section/legend) n/a\nState if sample or data point from the analysis is\nexcluded, and whether the criteria for exclusion were\ndetermined and specified in advance.\nnot detected.\nStatistics Yes (indicate where provided: page no/section/legend) n/a\nDescribe statistical tests used and justify choice of\ntests.\nNot detected.\nData availability Yes (indicate where provided: page no/section/legend) n/a\nState whether newly created datasets are available,\nincluding protocols for access or restriction on access.\nNot detected.\nIf data are publicly available, provide accession\nnumber in repository or DOI or URL.\nNot detected.\nIf publicly available data are reused, provide accession\nnumber in repository or DOI or URL, where possible.\nNot detected.\nCode availability Yes (indicate where provided: page no/section/legend) n/a\nFor all newly generated code and software essential\nfor replicating the main findings of the study:\n \nState whether the code or software is available. Not detected.\nIf code is publicly available, provide accession\nnumber in repository, or DOI or URL.\nNot detected.\nReport provided by SciScore | August 01, 2023 | Based on DocumentID 2277_64c8ce2fb91d65.94943320\n\nAnalysis\nAdherence to community standards Yes (indicate where provided: page no/section/legend) n/a\nMDAR framework recommends adoption of\ndiscipline-specific guidelines, established and\nendorsed through community initiatives. Journals have\ntheir own policy about requiring specific guidelines\nand recommendations to complement MDAR.\n \nState if relevant guidelines (eg., ICMJE, MIBBI,\nARRIVE) have been followed, and whether a\nchecklist (eg., CONSORT, PRISMA, ARRIVE) is\nprovided with the manuscript.\nNot currently checked by SciScore\nReport provided by SciScore | August 01, 2023 | Based on DocumentID 2277_64c8ce2fb91d65.94943320\n\nACMI-S-23-00251.pdf\nBy Rachael Tarlinton\nWORD COUNT 5819 TIME SUBMITTED 31-JUL-2023 12:41PM\nPAPER ID 101649106\n\n7\n\n\n7\n1 0\n1 2\n1 9\n\n\n1\n1\n1\n1\n1\n2\n2\n4\n4\n5\n5\n5\n6\n6\n9\n1 4\n1 5\n1 7\n2 1\n2 3\n\n\n1\n2\n4\n1 3\n\n\n1\n2\n8\n\n\n1\n1\n2\n2\n2\n2 0\n\n\n1\n3\n3\n3\n8\n1 8\n2 2\n2 4\n\n\n1\n1\n2\n1 1\n1 6\n\n\n\n\n1\n\n\n\n\n\n\n\n\n\n\n18%\nSIMILARITY INDEX\n1\n2\n3\n4\n5\n6\nACMI-S-23-00251.pdf\nORIGINALITY REPORT\nPRIMARY SOURCES\nTernenge Apaa, Amy J. Withers, Laura McKenzie,\nCeri Staley et al. \" Lack of detection of SARS-CoV-2\nin British wildlife 2020-21 and first description of a stoat ( \",\nCold Spring Harbor Laboratory, 2023\nCrossref Posted Content\norca.cardiff.ac.uk\nInternet\nWendy Puryear, Kaitlin Sawatzki, Nichola Hill, Alexa\nFoss et al. \"Outbreak of Highly Pathogenic Avian\nInfluenza H5N1 in New England Seals\", Cold Spring Harbor\nLaboratory, 2022\nCrossref Posted Content\nhdl.handle.net\nInternet\nSøren Saxmose Nielsen, Julio Alvarez, Dominique\nJoseph Bicout, Paolo Calistri et al. \"SARS ‐ CoV ‐ 2 in\nanimals: susceptibility of animal species, risk for animal and\npublic health, monitoring, prevention and control\", EFSA\nJournal, 2023\nCrossref\nacademic.oup.com\nInternet\n245 words — 7%\n100 words — 3%\n28 words — 1%\n26 words — 1%\n19 words — 1%\n19 words — 1%\n\n7\n8\n9\n10\n11\n12\n13\n14\nouci.dntb.gov.ua\nInternet\nen.wikipedia.org\nInternet\nAshleigh F Porter, Damian F J Purcell, Benjamin P\nHowden, Sebastian Duchene. \"Evolutionary rate\nof SARS-CoV-2 increases during zoonotic infection of farmed\nmink\", Virus Evolution, 2023\nCrossref\npubmed.ncbi.nlm.nih.gov\nInternet\nNobuto Takeuchi, Haruo Suzuki. \"Prophages and\nplasmids display opposite trends in the types of\naccessory genes they carry\", Cold Spring Harbor Laboratory,\n2022\nCrossref Posted Content\nTernenge Apaa, Amy J. Withers, Ceri Staley, Adam\nBlanchard et al. \"Sarbecoviruses of British\nHorseshoe Bats; Sequence Variation and Epidemiology\", Cold\nSpring Harbor Laboratory, 2023\nCrossref Posted Content\nwww.mdpi.com\nInternet\nIshika Gulati, Saif Khan, Garima Gulati, Smita\nRastogi Verma et al. \" SARS-CoV-2 origins: zoonotic\nvs contemporary models \", Biotechnology and Genetic\nEngineering Reviews, 2022\nCrossref\n18 words — 1%\n16 words — < 1%\n15 words — < 1%\n14 words — < 1%\n10 words — < 1%\n10 words — < 1%\n10 words — < 1%\n9 words — < 1%\n\n15\n16\n17\n18\n19\n20\n21\n22\n23\nKait, Rahul, and D. N. Sahi. \"IMPACTS OF\nURBANIZATION ON CARNIVORE MAMMALS IN\nJAMMU AND KASHMIR, INDIA\", Ecoprint An International\nJournal of Ecology, 2011.\nCrossref\nZhiqiang Wu, Yelin Han, Yuyang Wang, Bo Liu et al.\n\"A comprehensive survey of bat sarbecoviruses\nacross China in relation to the origins of SARS-CoV and SARS-\nCoV-2\", National Science Review, 2022\nCrossref\nZinaida Klestova. \"Possible spread of SARS-CoV-2\nin domestic and wild animals and body\ntemperature role\", Virus Research, 2023\nCrossref\nkar.kent.ac.uk\nInternet\nmicrobiologysociety.org\nInternet\npure.eur.nl\nInternet\nCarnivore Behavior Ecology and Evolution, 1989.\nCrossref\ncmr.asm.org\nInternet\nFernando González-Candelas, Marie-Anne Shaw,\nTung Phan, Urmila Kulkarni-Kale et al. \"One year\ninto the pandemic: Short-term evolution of SARS-CoV-2 and\nemergence of new lineages\", Infection, Genetics and Evolution,\n2021\n9 words — < 1%\n9 words — < 1%\n9 words — < 1%\n9 words — < 1%\n9 words — < 1%\n9 words — < 1%\n8 words — < 1%\n8 words — < 1%\n6 words — < 1%\n\n24\nEXCLUDE QUOTES OFF\nEXCLUDE BIBLIOGRAPHY ON\nEXCLUDE SOURCES OFF\nEXCLUDE MATCHES OFF\nCrossref\nnottingham-repository.worktribe.com\nInternet 6 words — < 1%","source_license":"CC-BY-4.0","license_restricted":false}