{"paper_id":"2b39644b-fff2-45fe-b9d3-b09dc3d02187","body_text":"Female infertility is a complex disorder which may be caused by medical conditions including pelvic inflammatory disease, endometriosis, Polycystic Ovary Syndrome (PCOS), premature ovarian failure and uterine fibroids 1 . PCOS is a heterogeneous female endocrine metabolic disorder affecting 5–10% of women characterized by its significantly complex clinical alignments 2 . Endometriosis is a chronic, benign, estrogen-dependent condition characterized by the presence of endometrial tissue outside the uterus cavity associated with pelvic pain and infertility. The pathophysiologic mechanism of endometriosis is unknown and it affects 3–10% of women in reproductive years of their life and 20–50% of women with infertility 3 – 5 . In fact, PCOS and endometriosis appear to have a complex and multifactorial etiology in which a variety of genes interact with environmental factors to produce these conditions. Recent biochemical and genetic studies on the pathogenesis of PCOS and endometriosis were focused on the Single Nucleotide Polymorphisms (SNPs) affecting Oxidative Stress (OS) 6 , 7 . The results of these studies suggest that genetic polymorphisms in antioxidant genes including the SNPs affecting the activities of paraoxonase 1 (PON1) may contribute to female infertility 8 . Serum paraoxonase 1 is an antioxidant calcium-dependent esterase/lactonase, which circulates within High Density Lipoprotein (HDL) particles 9 , 10 . PON1 possesses antioxidant, anti-atherogenic, and anti-inflammatory properties and is involved in hydrolysis of several organophosphorus insecticides and nerve agents, inhibition of Low Density Lipoprotein (LDL) oxidation and increase of macrophage-associated cholesterol efflux 11 . The activities of PON1 are genetically regulated and the PON1 gene polymorphisms have potent influences on its activities. PON1 is a member of a multigene cluster including PON1 , PON2 , and PON3 \n 12 . Among all the SNPs of PON1 gene, −909G/C [rs854572], −162A/G [rs705381], −108C/T [rs705379] in the promoter region and Q192R [rs662], L55M [rs-854560] in the coding region are the most studied polymorphisms 13 , 14 . The L55M polymorphism influences the paraoxonase and arylesterase (ARE) activities and the stability of the protein 15 . In this case-control study, PONase and AREase activities were examined and the association of coding L55M polymorphism with female infertility in Iranian population was investigated. The L55M polymorphism could be a risk factor in determining susceptibility to female infertility.\n\nThis case-control study analyzed a group of 50 infertile females including 20 with endometriosis who were diagnosed by laparoscopy and 30 with PCOS fulfilling the criteria for PCOS 16 , who attended the Isfahan Fertility-Infertility Center and Royan Institute. The control group consisted of 70 healthy age-matched volunteers who visited the clinic for a regular health check-up with proven fertility and no clinical or biochemical hyperandrogenism, no menstrual cycle irregularities, and no history of endometriosis and PCOS. Women from different regions of Iran were referred to this infertility center for check-up and they made the population of this study. There was no evidence of known paraoxonase-affecting diseases such as CHD, liver diseases, atherosclerosis, diabetes, hypertension, cancer and infections in all fertile and infertile females who were not genetically related. Blood sampling was done based on patient consent and an agreement was signed between the University of Isfahan and Isfahan Fertility-Infertility Center. Blood samples were obtained in the morning after overnight fasting and collected in EDTA and heparin coated tubes to analyze PON1 L55M polymorphism and PON1 activities. Blood and serum samples were stored at −20 °C until analysis.\nFor genotype analysis, genomic DNA was extracted from peripheral blood using a salting-out method described by Miller 17 and was stored at −20 °C till genotyping could be performed. Coding L55M (rs 854560) genotyping was carried out using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The primers for SNP were designed using the primer design software Oligo 7 and were listed as follows:\n Forward primer: 5′ TGAATTATTCTGAACCTATTA AAGAAGA 3′ Reverse primer: 5′ AAGACTTAAACTGCCAGTCCT AGA 3′\nForward primer: 5′ TGAATTATTCTGAACCTATTA AAGAAGA 3′\nReverse primer: 5′ AAGACTTAAACTGCCAGTCCT AGA 3′\nPCR was performed in 25 μl reaction mixture containing 2 μl of each forward and reverse primers (10 pM ), 2.5 μl of ×10 solution buffer (20 mM Tris-HCl pH=8.6, 50 mM KCl, Cinnagen Inc, Iran), 0.5 μl of four mixed dNTPs (10 mM , Cinnagen Inc, Iran), 0.75 μl of Mgcl2 (50 mM , Cinnagen Inc, Iran), 0.3 μl of 5 u/μl Taq DNA polymerase (Cinnagene, Co., Iran), and 2 μl (100 ng/μl ) of genomic DNA. The PCR program was as follows: initial denaturation for 4 min at 94 °C followed by 35 cycles of 40 s at 94 °C , 35 s at 54–66 °C , 72 °C for 40 s , and a final extension step of 15 min at 72 °C . The PCR products were run on 2% agarose gel and were visualized by ethidium bromide staining. Moreover, a restriction analysis was performed using 10 units of Hin 1II enzyme (Fermentas, Vilnius, Lithuania) in buffer G (Fermentas) at 37° C for 16 hr . The restriction fragments were analyzed on 2% agarose gels and were visualized through ethidium bromide staining. Digested DNA fragments of 146 and 103 bp were detected in MM homozygotes (restriction site present), an undigested band of 249 bp was detected in LL homozygotes (restriction site absent) and heterozygous genotypes resulted in three different bands (146, 103 and 249 bp ) through PCR-RFLP technique ( Figure 1 ).\nElectrophoresis pattern of PON1 L55M polymorphism using PCR-RFLP and Hin 1II restriction enzyme. I) Undigested PCR products, II) LM (103,146, and 249 bp fragments). III to VII) MM (103, and 146 bp fragments), LL (249 bp fragment), LL, and LM genotype, respectively. M) 100 bp ladder. Numbers are in base pair ( pb ).\nThe serum was isolated by centrifugation at 800 g for 10 min at 4 °C and was immediately frozen at −80 °C in order to determine PON1 activities in blood samples. The PONase activity was measured using paraoxon (Sigma Chem, USA) as substrate and the increase in absorbance at 412 nm was determined, because of 4 -nitrophenol formation. The activity was measured at 25 °C during 3 min after 5 μl of serum were added to each well containing 100 μl of Tris/HCl (100 mMol , pH=8.0) buffer including 2 mMol CaCl 2 and 5.5 mMol of paraoxon. All results are expressed in U/ml which is defined as 1 nmol of 4- nitrophenol formed per minute. Arilesterase activity in serum was determined spectrophotometrically using the phenylacetate (Merck-Schardt) as a synthetic substrate. The reaction started by adding 100 μl of phenylacetate (10 mM ) as substrate solution to wells containing 5 μl of serum (prediluted 1:10) and 1 mM CaCl 2 (Sigma, USA) in 50 mM Tris buffer pH=8. The phenol production was measured during 2 min at 270 nm and pH=8.0. The PON1’s arilesterase activity is expressed as KU/ml which is defined as 1 μmol arilesterase per minute. PON1’s paraoxonase and arilesterase activities were determined in triplicate 18 .\nBriefly, serum PON1 activity (PON1 phenotype) was determined by double substrate method. Phenotype is defined as the activity ratio of PONase activity divided by AREase activity.\nStatistical analyses were performed using SPSS version 16.0 (SPSS, Inc., Chicago, IL, USA) software. The Chi-square distribution ( χ 2 ) was used to evaluate the PON1 genotype frequencies between the patient and the control groups. Multiple comparisons were done by employing one way analysis of variance (ANOVA) followed by a LSD (least significant difference) test. All data are presented as means ± standard deviation (SD). Statistical significance was assessed using the 5% significance level.\n\nThe association between PON1 L55M polymorphism and female infertility in case and control subjects is shown in table 1 . The distribution of genotypes were in Hardy-Weinberg equilibrium (p = 0.45). The results showed that there were significant differences regarding PON1 L55M polymorphism among fertile and infertile groups. The women with a MM genotype (p=0.021; OR=2.55) were statistically associated with infertility in comparison to those with a LM genotype (p=0.039; OR=1.91). There was no association between L55M polymorphism and each infertile group including patients with endometriosis and PCOS separately.\nAssociation between PON1 L55M polymorphism and female infertility\nSignificance difference with 95% confidence interval.\nThe group mean age, body mass index (BMI), and the serum PON1’s paraoxonase and arilesterase activities are presented in table 2 for fertile, PCOs, and endometriosis groups. Paraoxonase enzyme activity was highly variable among different samples. According to LSD test, endometriosis subjects had significantly lower paraoxonase enzyme activity compared to control groups (p=0.0024; CI=95%) ( Table 3 ). No significant difference was found in women with PCOS for both PONase and AREase activity in comparison with control group (p=0.469; CI=95%).\nCharacteristics of cases and control samples (mean±SD)\nAssociation between infertility and paraoxonase enzyme activity\nSignificance difference with 95% confidence interval.\nThe association of PON1 L55M polymorphism with PON1 activities is shown in figure 2 . Significant difference was observed among the genotypes of L55M polymorphism in patient and control groups. Serum PON1 activity was the highest in LL genotype followed by LM and then MM genotype (MM