{"paper_id":"2b2b44bb-4864-40ce-9bf9-77ebc6100ad4","body_text":"Adipose-derived mesenchymal stem cell-conditioned medium accelerates wound healing in a rat model of full-thickness skin defects | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Adipose-derived mesenchymal stem cell-conditioned medium accelerates wound healing in a rat model of full-thickness skin defects Long Huang, Huimin He, Zhongbao Lin, Haiyun Liu, Xiankun Lin, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4759395/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Considering that the therapeutic function of adipose tissue-derived mesenchymal stem cells (ADSCs) on skin wounds is closely related to their paracrine effect, this study was designed to investigate the therapeutic effect of ADSC conditioned medium (ACM) on type 2 diabetic (T2D) skin wound healing. Methods: The effect of ACM on HUVEC viability and angiogenesis was firstly evaluated by CCK 8 assay and q-PCR analysis, respectively. Next, a T2D rat model was induced by the combination of high fat diet and streptozotocin. Following by the establishment of full-thickness skin defects in T2D rats, ACM or serum free cultured medium was daily injected around the wound edge sfor 7 days. Afterwards, the skin wound healing rate was analyzed, and the skin tissues were assessed by histopathological examination. The mRNA levels of TNF-α, IL-1β, IL-6, and COX-2, as well as IL-12 and IFN-γ were evaluated by q-PCR analysis. Additionally, the transcriptome sequencing and immunohistochemistry were used to reveal the potential mechanism of ACM for T2D skin wound healing. Results: Our data showed that ACM promoted cell proliferation and angiogenesis, and up-regulated the mRNA expression of EGF, bFGF, VEGF, and KDR in HUVECs. The in vivo data indicated that ACM could accelerate T2D skin wound healing rate by inhibiting the mRNA levels of TNF-α, IL-1β, IL-6, and COX-2, as well as IL-12 and IFN-γ in vivo. Particularly, we also found that ACM could down-regulate TNF and chemokine signaling. Conclusions: ACM could effectively promote vascular cell angiogenesis, accelerate skin wound regeneration by suppressing excessive inflammation in T2D rats, which is closely related to down-regulation of TNF and chemokine signaling pathways. Adipose tissue-derived mesenchymal stem cells conditioned medium type 2 diabetes skin wound and regeneration Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Skin wound healing is a complex process involving multiple stages, such as hemostasis, inflammation, angiogenesis, and remodeling, which requires the coordinated effort of various cell types and signaling pathways [ 1 , 2 ] . There are several factors, such as ischemia, diabetes, age, nutrition, hormones, obesity, infection, smoking, alcoholism, and radiation and chemotherapy, which can influence one or more stages of this process, resulting in improper or impaired wound healing [ 3 ] . Among them, diabetic wounds are the most common type of difficult-to-heal wounds, primarily due to the widespread prevalence of diabetes [ 4 ] . Given the excellent immunorugulation, multidirectional differentiation ability, and paracrine function, adipose-derived mesenchymal stem cells (ADSCs) have emerged as a novel promising for treating diabetic wounds both in preclinical and clinical studies [ 5 – 7 ] . However, the effectiveness of ADSCs in repairing chronic wounds is limited by the low cell engraftment efficiency due to the dramatic changes ranging from suitable expansion conditions in vitro to challenging microenvironment (e.g, hypoxia, oxidative stress, etc) in vivo [ 8 ] . Therefore, further research is needed to improve the efficacy of ADSC therapy for diabetic wound healing. Recently, increasing evidences suggest that paracrine function of ADSCs plays a leading role in skin wound regeneration [ 9 ] . In particular, instead of mesenchymal stem cells (MSCs), using MSC conditioned medium or secretome, also provides a therapeutic potential for reducing irradiated skin injures [ 10 ] , and scar fibrosis [ 11 , 12 ] . More importantly, this cell-free strategy effectively avoids the limitation of low cell engraftment of MSCs for wound healing. In this study, we investigated whether ADSC conditioned medium (ACM) can be used to accelerating diabetic wound healing in rats. To achieve this purpose, we evaluated the therapeutic effect of ACM on skin wounds both in vitro and in vivo, as well as the potential mechanism of ACM on diabetic wound healing. The results suggest that ACM may offer a promising strategy to promote diabetic wound recovery. Methods Animals Twenty adult male Sprague-Dawley (SD) rats weighing 180–200 grams each were obtained from the Shanghai Slack Laboratory Animal Center (License Number: SCXK hu 2022-0004). All rats were housed in a standard specific pathogen free (SPF) barrier environment at 20–26 ℃, 40%-70% humidity with 12 h/12 h light-dark cycle. All animal experiments were approved by Experimental Animal Ethics Center of Mengchao Hepatobiliary Hospital of Fujian Medical University (MCHH-AEC-2022-08). All experiments were designed and reported in accordance with the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines 2.0. Preparation of ADSC conditioned medium The isolation and culture of ADSCs were carried out according to previously published methods [ 13 – 15 ] . Briefly, adipose tissues were obtained from the inguinal region of male SD rats (n = 5) and washed with PBS solution. The tissues were then cut into small fragments and digested with 0.1% type I collagenase, followed by neutralization with α-MEM containing 10% FBS. Subsequently, the cells were cultured at a density of 1×10 6 cells/mL in T-75 plates. ADSCs at passage 3 were collected and cultured at a density of 2×10 6 cells per 10 cm-plate. After overnight cell adhesion, the cultured ADSCs were washed with PBS solution to remove residual serum, and then replaced with serum-free medium (YOCON, China) for 48 hours. After the incubation, the conditioned medium was collected and centrifuged at 3000 g for 5 minutes to remove any cell debris. Furthermore, the ADSC conditioned medium was concentrated using ultrafiltration with a tangential flow filtration capsule (Pall, USA) containing a 3-kDa molecular weight cut-off membrane, following the manufacturer's instructions. Finally, the concentration of ADSC conditioned medium were analyzed by a BCA assay kit (TransGen Biotech, China), and store at -80 ℃. HUVEC culture Human umbilical vein endothelial cell (HUVEC) line was obtained from National Institutes for Food and Drug Control (Beijing, China), and cultured with RPMI 1640 containing 10% FBS. Cell viability assay HUVECs were cultured at a density of 1×10 4 cells per well in 96-well plates. After overnight cell adhesion, the cell supernatants were removed and replaced with 1 µg/mL ADSC conditioned medium, while those cells treated with serum-free medium were used as the negative control. After 24 h or 48 h incubation, the cell viability was evaluated using CCK-8 assay kit (TransGen Biotech, China), according to the manufacturer's instructions. Quantitative real-time PCR analysis Total RNA was collected using a TRIzol reagent kit (TransGen Biotech, China) following the manufacturer's instructions. Afterwards, mRNA was reversely transcribed into cDNA using a cDNA synthesis kit (Roche, Germany). The quantitative real-time PCR analysis was performed in an ABI step one plus real-time PCR system (Carlsbad, USA), the PCR conditions were as follows: 95°C for 15 sec, 60°C for 30 sec, 70°C for 30 sec, repeating 40 cycles. The primer sequence was described in Table 1 . The 2 −△△Ct formula was used to analyze the relative gene expression. Table 1 The primer sequences Gene Forward primer Reverse primer TNF-α CAGAGGGAAGAGTTCCCCAG CCTTGGTCTGGTAGGAGACG IL-1β CACCTCTCAAGCAGAGCACAG GGGTTCCATGGTGAAGTCAAC IL-6 CACTGGTCTTTTGGAGTTTGAG GGACTTTTGTACTCATCTGCAC COX-2 CGGAGGAGAAGTGGGGTTTAGGAT TGGGAGGCACTTGCGTTGATGG IL-12 AGTTCTTCGTCCGCATCCAG CTTGCACGCAGAT ATTCGCC IFN-γ CAACCCACAGATCCAGCACA TCAGCACCGACTCCTTTTCC VEGF CCCAGAAGTTGGACGAAAA TGAGTTGGGAGGAGGATG EGF ACACGGAGGGAGGCTACA GTAGCCTCCCTCCGTGTT bFGF CGCACCCTATCCCTTCACA CAACGACCAGCCTTCCAC KDR ACTCCTCCTCATTCAGCG GGGTCCCACAACTTCTCA β-actin GTGGACA TCCGCAA AGAC AAAGGGTGTAACGC AACTA Diabetic skin injured model and ACM treatment The type 2 diabetic (T2D) model was established as previous method [ 13 ] . Briefly, the SD rats (n = 10) were fed with a high-fat diet (HFD) containing 66.5% normal chow, 20% sucrose, 10% lard, 2% cholesterol and 1.5% cholate. After HFD for 4 weeks, all rats were administrated with 25 mg/kg STZ by intraperitoneal injection, twice/week for 2 weeks. The STZ-treated rats with a nonfasting blood glucose ≥ 11.1 mmol/L were considered as successful establishment of T2D model. Next, the T2D rats were anesthetized with 40 mg/kg pentobarbital sodium, and a 1-cm diameter full-thickness skin defect were performed according to previous method [ 16 ] . After that, the rats were randomly (random table method) divided into model and ACM group (n = 5/group), and all rats were housed separately. The rats in ACM group were daily treated with 100 µL ACM intradermically around the wound edges for 7 days, while the model rats were daily treated with equal volume of serum-free medium. The normal rats (n = 5) were used as the negative control. After ACM for 12 days, all rats were euthanized with 100 mg/kg pentobarbital sodium, and the wounds were harvested for further evaluation. Histological examination Tissue tissues were collected and fixed in 4% paraformaldehyde for 24 hours, then paraffin embedded and sectioned into slices. Tissue sections were evaluated with hematoxylin and eosin (HE) staining and Masson staining, respectively. Finally, the histological examination was performed using an ortho-microscope (Zeiss, Germany). RNA sequencing The total RNA of skin tissues was subjected to polyA-selected RNA-sequencing by the Illumina HiSeq X10 platform. Using the DESeq2 package, RNA-seq analysis was used to determine the different gene (DEG) expression among three groups: normal vs model, ACM vs model. False discovery rate (FDR) < 0.05 and fold change of ≥ 2, or ≤ 2 were the principles for DEG screening. Gene ontology (GO) analysis was used to analyze gene functions of DEGs, and the kyoto encyclopedia of genes and genomes (KEGG) analysis was used to tartet the DEGs enrichment pathway. Immunohistochemistry The skin wound sections were drenched in a citrate antigen retrieval solution (Beyotime Institute of Biotechnology, China) and heat-treated in pressure cooker for 2 minutes, natural cooling to RT and washing with PBS buffer for 3 times. Following incubation with 3% H 2 O 2 for 10 minutes, and then the sections were blocked with 5% BSA for 30 minutes. After that, the sections were incubated with TNF-α, NF-κB, p-NF-κB, MAPK, p-MAPK, CXCL1, CXCL2, and CXCL8 primary antibody at a dilution of 1:200, overnight at 4°C, respectively. After washing with PBS for 3 times, the sections were incubated with secondary antibody at RT for another 2 hours, and finally stained with DAB. The samples were observed using an ortho-microscope (Zeiss, Germany). Statistical analysis All quantitative data were expressed as the mean ± standard deviation. GraphPad Prism version 9.0 (GraphPad Software, USA) was used for statistical analysis. The ANOVA was used to evaluate the significant differences among three independent groups; while the two-tailed paired sample Student’s t-tests were used to evaluate the significant differences between two groups. P < 0.05 was considered as statistical difference. Results ACM promotes HUVEC angiogenesis and proliferation in vitro The impaired skin wound healing in diabetic individuals is largely attributed to diabetic angiopathy, which is characterized by dysfunction and impairment of the arteries throughout the body [ 17 ] . We therefore investigated the effect of ACM on angiogenesis and proliferation of vascular cells in vitro. After incubation with ACM for 24 or 48 hours, the HUVEC viability was significantly increased (Fig. 1 A), suggesting that ACM promoted HUVEC proliferation. After 5 days of continuous ACM incubation, HUVECs showed vascular-like morphological changes (Fig. 1 B), and the expression of genes associated with angiogenesis, including EGF, bFGF, VEGF, and KDR, was significantly up-regulated after ACM treatment (Fig. 1 C), implying that ACM could promote HUVEC angiogenesis in vitro. ACM accelerates T2D skin wound healing In the light of the potential therapeutic effect of ACM for angiogenesis in vascular cells, we next conducted a T2D skin wound model to confirm the therapeutic function of ACM. As shown in Fig. 2 A and 2 B, the skin wound healing rate of T2D rats was significantly improved by the continuous ACM treatment for 12 days as compared to those in the model group. Moreover, the increased tissue regeneration and decreased inflammatory infiltration were also observed in the ACM group compared to those in model group (Fig. 2 C). Therefore, these data suggested that ACM could accelerate T2D skin wound healing. ACM inhibits T2D skin wound inflammation Given the excessive inflammation is the typical characteristic of skin wounds [ 18 ] , we further analyzed the inflammatory genes in T2D skin wound tissues. As shown in Fig. 3 , the mRNA expression of TNF-α, IL-1β, IL-6, COX-2, IL-12 and IFN-γ was significantly increased in T2D skin wound as compared to those in normal rats, indicating the excessive inflammation occurred in the T2D skin wounds; while the mRNA expression of TNF-α, IL-1β, IL-6, COX-2, IL-12 and IFN-γ was effectively decreased after ACM treatment when compared with in the model groups, suggesting that ACM could inhibit excessive inflammation in T2D skin wounds. ACM promotes T2D skin wound healing by targeting TNF and chemokine signaling pathway The potential molecular mechanism of ACM on accelerating T2D skin wound healing was further explored by RNA sequencing. The volcano plot data showed that the expression of 10655 genes was different between normal and model groups (Normal vs Model), and the expression of 5287 genes was different between ACM and Model group (ACM vs Model), the 4269 genes were the common differential genes of this two panels (Fig. 4 A-C). Gene Ontology (GO) annotation and pathway enrichment analysis showed that the up-regulation of TNF signaling and chemokine signaling was observed in the model group (compared with normal group), while down-regulation of TNF signaling and chemokine signaling was clearly observed in ACM group as compared with model groups, suggesting that potential molecular mechanism of ACM on T2D skin wound healing is targeting in TNF signaling and chemokine signaling pathway. To confirm the RNA sequencing results, we further evaluated the protein expression of main regulars in TNF signaling and chemokine signaling. As shown in Fig. 5 , the TNF signaling related proteins, including TNF-α, NF-κB, p-NF-κB, MAPK, and p-MAPK, and the chemokine signaling related proteins, including CXCL1, CXCL2, and CXCL8, were all down-regulated by ACM treatment in T2D skin wounds, suggesting that ACM accelerated T2D skin wound healing via down-regulation of TNF signaling and chemokine signaling. Discussion Angiogenesis is an essential part of skin wound regeneration, and it is also prone to be injured by the diabetes status [ 19 ] , excessive inflammation [ 20 ] , oxidative stress and other chronic wound conditions [ 21 ] . Given the excellent performance of MSCs on promoting vasculogenesis through paracrine factors (e.g., VEGF, EGF, and bFGF) [ 22 ] , MSC secretome or conditioned medium provides a new strategy for accelerating angiogenesis of skin wounds [ 23 ] . Since the advantages of abundant sources and easier accessibility of adipose tissues [ 24 ] , the adipose tissue-derived MSC conditioned medium (ACM) was used to confirm the beneficial effect on angiogenesis in the current study. As expect, ACM effectively promoted HUVEC proliferation and angiogenesis. In particular, ACM also up-regulated the expression of VEGF, EGF, bFGF, and KDR in HUVECs. Therefore, these data suggests that ACM contributes to cutaneous wound regeneration. Considering T2D accounts for more than 90% of diabetes cases [ 25 ] , a T2D skin wound injured rat model was next used to reveal the therapeutic effect of ACM on skin wounds. Significantly, we found that ACM could promote skin wound healing rate. It is well known that the excessive inflammation is caused by the crosstalk of various immune cells, including neutrophils [ 26 ] , macrophages [ 27 ] , and lymphocytes [ 28 ] , which is also characterized by the high expression of various pro-inflammatory factors, including TNF-α, IL-1β, IL-6, and COX-2, as well as IL-12 and IFN-γ [ 29 – 31 ] . In this study, we proved that these pro-inflammatory factors were high expressed in skin wounds, which means the excessive inflammation occurred in T2D rats. More importantly, we found that ACM could reduce the excessive inflammation. In particular, the transcriptome sequencing data further confirmed that ACM accelerates T2D skin wound healing is closely related to the the down-regulation of TNF signaling and chemokine signaling pathway. Taken together, the ACM provides a new promising strategy for accelerating T2D skin wound healing, which is partly through TNF signaling and chemokine signaling pathway. Given the fact that MSC conditioned medium or secretome has a complex composition, including extracellular vesicles (containing various types of lipids, proteins and nucleic acids) and effector molecules (e.g., PGE2, IDO, etc.) [ 32 – 34 ] , the enhancement of ACM in skin wound regeneration may involve in multiple targets and pathways. Further studies should be focused on the different components and targets of ACM on the therapeutic role in T2D skin wound repair, to verify more detail mechanism. Furthermore, before proceeding with further clinical trials or applications, it is crucial to ensure strict control over the large-scale production, stability, and quality considerations related to ACM production. Here, we showed that ACM could enhance vascular proliferation and angiogenesis, promote skin wound healing in type 2 diabetes, and inhibit the inflammatory response. The mechanism may involve the downregulation of the TNF pathway and chemokine pathway. Conclusion In conclusion, our study has shown that ACM can significantly accelerate the healing of diabetic skin wounds by promoting vascular remodeling and suppressing inflammation through the TNF pathway and chemokine pathway. Abbreviations ACM Adipose-derived mesenchymal stem cell-conditioned medium ADSC Adipose-derived mesenchymal stem cell bFGF Basic fibroblast growth factor COX-2 Cyclooxygenase-2 CXCL 1 C-X-C chemokine ligand 1 CXCL 2 C-X-C chemokine ligand 2 CXCL 8 C-X-C chemokine ligand 8 EGF Epidermal growth factor FBS Fetal bovine serum HUVEC Human umbilical vein endothelial cell IFN-γ Interferonγ IL-1β Interleukin 1β IL-6 Interleukin 6 IL-12 Interleukin 12 KDR Kinase insert domain receptor MAPK Motogen-activated protein kinase MSC Mesenchymal stem cell NF-κB Nuclear factor-κB T2D Type 2 diabetic TNF-α Tumor necrosis factorα VEGF Vascular endothelial growth factor Declarations Author information Authors and Affiliations 1 Department of Critical Care Medicine, Shengli Clinical Medical College of Fujian Fuzhou University Affiliated Provincial Hospital, Fuzhou 350001, P. R. China. 2 Department of Obstetrics and Gynecology, Jin'an District Hospital, Fuzhou 350001, P. R. China. 3 Shengli Clinical Medical College of Fujian Medical University; Department of Emergency, Fujian Provincial Hospital; Fuzhou University Affiliated Provincial Hospital; Fujian Provincial Key Laboratory of Emergency Medicine, Fuzhou 350001, P. R. China. 4 The United Innovation of Mengchao Hepatobiliary Technology Key Laboratory of Fujian Province, Mengchao Hepatobiliary Hospital of Fujian Medical University, Fuzhou 350028, P. R. China. 5 Department of Anesthesiology, Shengli Clinical Medical College of Fujian Fuzhou University Affiliated Provincial Hospital, Fuzhou 350001, P. R. China. Contributions Long Huang and Naishun Liao participated in study design and drafted the manuscript. Huimin He and Zhongbao Lin participated in isolation and culture of ADSCs, and ACM collection. Huimin He and Haiyun Liu performed the animal study, q-PCR analysis and cell proliferation assay. Xiankun Lin participated in histologic section. Long Huang and Naishun Liao performed the data analysis. Xiaodan Wu, Naishun Liao, Long Huang and Huimin He participated in proof-read the manuscript. Xiaodan Wu and Long Huang participated in financial support. All authors read and approved the final manuscript. Corresponding authors Correspondence to Naishun Liao or Xiaodan Wu. Ethics approval and consent to participate All animal experiments were approved by the Animal Ethics Committee of Mengchao Hepatobiliary Hospital of Fujian Medical University (Title, ACM for skin wound healing; NO., MCHH-AEC-2022-08; Date, Dec 12, 2022), and all procedures were performed in accordance with the guidelines. Consent for publication All authors have reviewed the manuscript and approved its submission for publication. Competing interests The authors declare that they have no competing interests. Funding This study was supported by Scientific Foundation of Fujian Health Department (Grant No. 2020QNB006), the Startup Fund for Scientific Research, Fujian Medical University (Grant No. 2020QH1139), and the Natural Science Foundation of China (Grant No. 82271238) Acknowledgements The authors declare that they have not used Artificial Intelligence in this study. Availability of data and materials The data sets supporting the results of this article are included within the article. The raw sequencing data in this article has been deposited at Genome Sequencing Achieve database ( https://ngdc.cncb.ac.cn/ ) under the accession number of CRA017979. References Freedman BR, Hwang C, Talbot S, Hibler B, Matoori S, Mooney DJ. Breakthrough treatments for accelerated wound healing. Sci Adv. 2023;9:eade7007. Martin P, Nunan R. Cellular and molecular mechanisms of repair in acute and chronic wound healing. Br J Dermatol. 2015;173:370–8. Guo S, Dipietro LA. Factors affecting wound healing. J Dent Res. 2010;89:219–29. Souza Ade, Santo GE, Amaral GO, Sousa KSJ, Parisi JR, Achilles RB, et al. Electrospun skin dressings for diabetic wound treatment: a systematic review. J Diabetes Metab Disord. 2023;23:49–71. Yan D, Song Y, Zhang B, Cao G, Zhou H, Li H, et al. Progress and application of adipose-derived stem cells in the treatment of diabetes and its complications. Stem Cell Res Ther. 2024;15:3. Carstens MH, Quintana FJ, Calderwood ST, Sevilla JP, Ríos AB, Rivera CM, et al. Treatment of chronic diabetic foot ulcers with adipose-derived stromal vascular fraction cell injections: Safety and evidence of efficacy at 1 year. Stem Cells Transl Med. 2021;10:1138–47. Huerta CT, Voza FA, Ortiz YY, Liu ZJ, Velazquez OC. Mesenchymal stem cell-based therapy for non-healing wounds due to chronic limb-threatening ischemia: A review of preclinical and clinical studies. Front Cardiovasc Med. 2023;10:1113982. Yu S, Yu S, Liu H, Liao N, Liu X. Enhancing mesenchymal stem cell survival and homing capability to improve cell engraftment efficacy for liver diseases. Stem Cell Res Ther. 2023;14:235. Ma H, Siu WS, Leung PC. The potential of MSC-based cell-free therapy in wound healing-a thorough literature review. Int J Mol Sci. 2023;24:9356. Lin Z, Shibuya Y, Imai Y, Oshima J, Sasaki M, Sasaki K, et al. Therapeutic potential of adipose-derived stem cell-conditioned medium and extracellular vesicles in an in vitro radiation-induced skin injury model. Int J Mol Sci. 2023;24:17214. Zhang C, Wang T, Zhang L, Chen P, Tang S, Chen A, et al. Combination of lyophilized adipose-derived stem cell concentrated conditioned medium and polysaccharide hydrogel in the inhibition of hypertrophic scarring. Stem Cell Res Ther. 2021;12:23. Wang M, Zhao J, Li J, Meng M, Zhu M. Insights into the role of adipose-derived stem cells and secretome: potential biology and clinical applications in hypertrophic scarring. Stem Cell Res Ther. 2024;15:137. Liao N, Zheng Y, Xie H, Zhao B, Zeng Y, Liu X, et al. Adipose tissue-derived stem cells ameliorate hyperglycemia, insulin resistance and liver fibrosis in the type 2 diabetic rats. Stem Cell Res Ther. 2017;8:286. Liao N, Pan F, Wang Y, Zheng Y, Xu B, Chen W, et al. Adipose tissue-derived stem cells promote the reversion of non-alcoholic fatty liver disease: An in vivo study. Int J Mol Med. 2016;37:1389–96. Liao N, Shi Y, Wang Y, Liao F, Zhao B, Zheng Y, et al. Antioxidant preconditioning improves therapeutic outcomes of adipose tissue-derived mesenchymal stem cells through enhancing intrahepatic engraftment efficiency in a mouse liver fibrosis model. Stem Cell Res Ther. 2020;11:237. Hur W, Lee HY, Min HS, Wufuer M, Lee CW, Hur JA, et al. Regeneration of full-thickness skin defects by differentiated adipose-derived stem cells into fibroblast-like cells by fibroblast-conditioned medium. Stem Cell Res Ther. 2017;8:92. Jin W, Chen X, Kong L, Huang C. Gene therapy targeting inflammatory pericytes corrects angiopathy during diabetic wound healing. Front Immunol. 2022;13:960925. Huang C, Dong L, Zhao B, Lu Y, Huang S, Yuan Z, et al. Anti-inflammatory hydrogel dressings and skin wound healing. Clin Transl Med. 2022;12:e1094. Fan R, Zhao J, Yi L, Yuan J, McCarthy A, Li B, et al. Anti-inflammatory peptide-conjugated silk fibroin/cryogel hybrid dual fiber scaffold with hierarchical structure promotes healing of chronic wounds. Adv Mater. 2024;36:e2307328. Guo Y, Ma M, Liu Z, Lv L, Pan X, Liu Q, et al. Chronic poor healing wounds of post cesarean scar diverticulum: Altered angiogenesis and immunobiology. J Reprod Immunol. 2023;157:103929. De Wolde SD, Hulskes RH, Weenink RP, Hollmann MW, Van Hulst RA. The effects of hyperbaric oxygenation on oxidative stress, inflammation and angiogenesis. Biomolecules. 2021;11:1210. Guillamat-Prats R. The role of MSC in wound healing, scarring and regeneration. Cells. 2021;10:1729. Hade MD, Suire CN, Mossell J, Suo Z. Extracellular vesicles: Emerging frontiers in wound healing. Med Res Rev. 2022;42:2102–25. Bunnell BA. Adipose tissue-derived mesenchymal stem cells. Cells. 2021;10:3433. Edlitz Y, Segal E. Prediction of type 2 diabetes mellitus onset using logistic regression-based scorecards. Elife. 2022;11:e71862. Zhu S, Yu Y, Ren Y, Xu L, Wang H, Ling X, et al. The emerging roles of neutrophil extracellular traps in wound healing. Cell Death Dis. 2021;12:984. Lv D, Cao X, Zhong L, Dong Y, Xu Z, Rong Y, et al. Targeting phenylpyruvate restrains excessive NLRP3 inflammasome activation and pathological inflammation in diabetic wound healing. Cell Rep Med. 2023;4:101129. Baltzis D, Eleftheriadou I, Veves A. Pathogenesis and treatment of impaired wound healing in diabetes mellitus: new insights. Adv Ther. 2014;31:817–36. Quagliariello V, De Laurentiis M, Rea D, Barbieri A, Monti MG, Carbone A, et al. The SGLT-2 inhibitor empagliflozin improves myocardial strain, reduces cardiac fibrosis and pro-inflammatory cytokines in non-diabetic mice treated with doxorubicin. Cardiovasc Diabetol. 2021;20:150. Acosta JB, del Barco DG, Vera DC, Savigne W, Lopez-Saura P, Guillen Nieto G, et al. The pro-inflammatory environment in recalcitrant diabetic foot wounds. Int Wound J. 2008;5:530–9. Schürmann C, Goren I, Linke A, Pfeilschifter J, Frank S. Deregulated unfolded protein response in chronic wounds of diabetic ob/ob mice: a potential connection to inflammatory and angiogenic disorders in diabetes-impaired wound healing. Biochem Biophys Res Commun. 2014;446:195–200. Kota DJ, Prabhakara KS, Toledano-Furman N, Bhattarai D, Chen Q, DiCarlo B, et al. Prostaglandin E2 indicates therapeutic efficacy of mesenchymal stem cells in experimental traumatic brain injury. Stem Cells. 2017;35:1416–30. Maughon TS, Shen X, Huang D, Michael AOA, Shockey WA, Andrews SH, et al. Metabolomics and cytokine profiling of mesenchymal stromal cells identify markers predictive of T-cell suppression. Cytotherapy. 2022;24:137–48. Zhao H, Li Z, Wang Y, Zhou K, Li H, Bi S, et al. Bioengineered MSC-derived exosomes in skin wound repair and regeneration. Front Cell Dev Biol. 2023;11:1029671. Supplementary Files ARRIVEguidelines2.0authorchecklist.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4759395\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":336534969,\"identity\":\"c32d870c-56e7-4556-9409-29cb260b1cfa\",\"order_by\":0,\"name\":\"Long Huang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Fujian Provincial Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Long\",\"middleName\":\"\",\"lastName\":\"Huang\",\"suffix\":\"\"},{\"id\":336534970,\"identity\":\"cb29b21d-361c-4e20-9f68-07372a7de2b0\",\"order_by\":1,\"name\":\"Huimin He\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Fujian Provincial Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Huimin\",\"middleName\":\"\",\"lastName\":\"He\",\"suffix\":\"\"},{\"id\":336534971,\"identity\":\"f8e33650-49a0-4f88-acd2-1d8d28965ded\",\"order_by\":2,\"name\":\"Zhongbao Lin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Fujian Provincial Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zhongbao\",\"middleName\":\"\",\"lastName\":\"Lin\",\"suffix\":\"\"},{\"id\":336534972,\"identity\":\"b2c2d466-1eae-4360-bebf-0e313fad936a\",\"order_by\":3,\"name\":\"Haiyun Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Fujian Provincial Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Haiyun\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":336534973,\"identity\":\"12312a01-8169-496b-a834-97dbd799a81e\",\"order_by\":4,\"name\":\"Xiankun Lin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Fujian Provincial Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiankun\",\"middleName\":\"\",\"lastName\":\"Lin\",\"suffix\":\"\"},{\"id\":336534974,\"identity\":\"696243b8-2c5e-44b6-a5d6-9e5e3f974b6a\",\"order_by\":5,\"name\":\"Naishun Liao\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxElEQVRIiWNgGAWjYBACPmYwJcHMz97Y+PADMVrYIFps2CV7DjcbSxClBUKl8RvMSG8T4CFKCzvzw8cFfw5LG0g+bGOQYLCT020g6DA2Y+OZbYeNzaUT2x4UMCQbmx0gqIXBTJq34XCy5ezEdgMJhgOJ2whrYf8mzfPncP2GmwfbJHiI08JjJs3DlsZscIOReC3FxrxtNsySPYnAQDYgwi/8/Mc3Pub5A4rK4w8ffqiwkyOoBQ0YkKZ8FIyCUTAKRgEOAACqLTh93rCcMQAAAABJRU5ErkJggg==\",\"orcid\":\"https://orcid.org/0000-0002-2781-4229\",\"institution\":\"Mengchao Hepatobiliary Hospital of Fujian Medical University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Naishun\",\"middleName\":\"\",\"lastName\":\"Liao\",\"suffix\":\"\"},{\"id\":336534975,\"identity\":\"58fc51f6-72d9-479f-8769-4d6229a99231\",\"order_by\":6,\"name\":\"Xiaodan Wu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Fujian Provincial Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaodan\",\"middleName\":\"\",\"lastName\":\"Wu\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-07-18 02:36:41\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4759395/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4759395/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":63823272,\"identity\":\"d1f8bd50-0e96-4d7e-a773-0dbd18bcd61a\",\"added_by\":\"auto\",\"created_at\":\"2024-09-02 16:29:34\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1780561,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eACM promtes vascular cell proliferation and angiogenesis. A ACM promtes HUVEC proliferation (n = 5 per group; **\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01). B Representative images of HUVECs after ACM treatment (scale bar, 100 μm). C The relative mRNA expression of EGF, bFGF, VEGF, and KDR in HUVECs after ACM treatment (n = 6 per group; **\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01, ***\\u003cem\\u003ep\\u003c/em\\u003e\\u0026lt; 0.001). ACM, adipose-derived mesenchymal stem cell-conditioned medium; bFGF, basic fibroblast growth factor; EGF, epidermal growth factor, HUVEC, human umbilical vein endothelial cell; KDR kinase insert domain receptor; VEGF, vascular endothelial growth factor.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4759395/v1/4c8f1546f85573289ad72641.jpg\"},{\"id\":63823730,\"identity\":\"1d5c4ac5-25b1-4aa8-a2ce-a734bd50459c\",\"added_by\":\"auto\",\"created_at\":\"2024-09-02 16:37:34\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2785103,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eACM accelerates T2D skin wound healing in rats. A The general observation of skin wounds after ACM treatment for 12 days. B The skin wound healing rate after ACM treatment for 12 days (n = 5 per group; *\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05). C The histopathological changes of skin wounds after ACM treatment by HE and Masson staining, respectively (scale bar, 1 mm). ACM, adipose-derived mesenchymal stem cell-conditioned medium; T2D, type 2 diabetic.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4759395/v1/4c273c126e103444b4528e2f.jpg\"},{\"id\":63823729,\"identity\":\"4f95a8f1-6a07-4bfb-bef5-285356e07f71\",\"added_by\":\"auto\",\"created_at\":\"2024-09-02 16:37:34\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":505871,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eACM inhibits T2D skin wound inflammation in rats. The relative mRNA expression of TNF-α (A), IL-1β (B), IL-6 (C), COX-2 (D), IL-12 (E) and IFN-γ (F)in skin wounds. (n = 5 per group; *\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.05, **\\u003cem\\u003ep\\u003c/em\\u003e \\u0026lt; 0.01). ACM, adipose-derived mesenchymal stem cell-conditioned medium; COX-2, cyclooxygenase-2; IFN‐γ, interferon γ; IL-1β, interleukin 1β; IL-6, interleukin 6; IL‐12, interleukin 12; T2D, type 2 diabetic; TNF-α, tumor necrosis factor α.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4759395/v1/8f0198f3936ef55da068ff16.jpg\"},{\"id\":63823274,\"identity\":\"2b14b604-d326-4269-9223-1102406cdd24\",\"added_by\":\"auto\",\"created_at\":\"2024-09-02 16:29:34\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1855525,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe transcriptome sequencing analysis of T2D skin wound tissues in rats. The volcano plot for differential gene expression of normal vs model (A) and ADSC vs model (B) groups. Gray pixel represents a gene where the difference in expression is not significantly different, red and green represent those that are significant. C Venn diagrams exhibited the numbers of the identified genes and the overlay of these identified genes. The gene ontology (GO) annotation and pathway enrichment analysis in normal vs model (D) and ADSC vs model (E) groups. ACM, adipose-derived mesenchymal stem cell-conditioned medium; T2D, type 2 diabetic.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4759395/v1/cecf618dd88a5cb860de5446.jpg\"},{\"id\":63823731,\"identity\":\"b34bc555-dc0a-4389-9c4e-c994500d1fdc\",\"added_by\":\"auto\",\"created_at\":\"2024-09-02 16:37:34\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":3515125,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eACM down-regulates TNF signaling and chemokine signaling in T2D skin wound tissues\\u003c/strong\\u003e. \\u003cstrong\\u003eA\\u003c/strong\\u003e Representative images of TNF-α, NF-κB, p-NF-κB, MAPK, and p-MAPK expression in skin tissues. Scale bars = 200 μm. \\u003cstrong\\u003eB\\u003c/strong\\u003e The relative TNF-α, NF-κB, p-NF-κB, MAPK, and p-MAPK expression. (n = 5 per group; *p \\u0026lt; 0.05, **p \\u0026lt; 0.01). \\u003cstrong\\u003eC\\u003c/strong\\u003e Representative images of CXCL1, CXCL2, and CXCL8 expression in skin tissues. Scale bars = 200 μm. \\u003cstrong\\u003eD\\u003c/strong\\u003e The relative CXCL1, CXCL2, and CXCL8 expression. (n = 5 per group; *p \\u0026lt; 0.05, **p \\u0026lt; 0.01). ACM, adipose-derived mesenchymal stem cell-conditioned medium; CXCL 1, C-X-C chemokine ligand 1; CXCL 2, C-X-C chemokine ligand 2; CXCL 8, C-X-C chemokine ligand 8; MAPK, motogen-activated protein kinase; NF-κB, nuclear factor-κB; T2D, type 2 diabetic; TNF-α, tumor necrosis factor α.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4759395/v1/86baeed7f5f3c133db57122e.jpg\"},{\"id\":63975879,\"identity\":\"d21c1599-2b1b-426a-9eda-67055bbe580f\",\"added_by\":\"auto\",\"created_at\":\"2024-09-04 12:21:02\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":11033024,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4759395/v1/fe6fa2df-8f21-4390-b5d5-d4f01e177951.pdf\"},{\"id\":63823276,\"identity\":\"5a684394-7787-42fa-aeb4-d1c0a8d39dc3\",\"added_by\":\"auto\",\"created_at\":\"2024-09-02 16:29:34\",\"extension\":\"pdf\",\"order_by\":10,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":143499,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"ARRIVEguidelines2.0authorchecklist.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4759395/v1/53b9fd30ed3f3ec77f4a08f8.pdf\"}],\"financialInterests\":\"\",\"formattedTitle\":\"Adipose-derived mesenchymal stem cell-conditioned medium accelerates wound healing in a rat model of full-thickness skin defects\",\"fulltext\":[{\"header\":\"Background\",\"content\":\"\\u003cp\\u003eSkin wound healing is a complex process involving multiple stages, such as hemostasis, inflammation, angiogenesis, and remodeling, which requires the coordinated effort of various cell types and signaling pathways \\u003csup\\u003e[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]\\u003c/sup\\u003e. There are several factors, such as ischemia, diabetes, age, nutrition, hormones, obesity, infection, smoking, alcoholism, and radiation and chemotherapy, which can influence one or more stages of this process, resulting in improper or impaired wound healing \\u003csup\\u003e[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]\\u003c/sup\\u003e. Among them, diabetic wounds are the most common type of difficult-to-heal wounds, primarily due to the widespread prevalence of diabetes \\u003csup\\u003e[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eGiven the excellent immunorugulation, multidirectional differentiation ability, and paracrine function, adipose-derived mesenchymal stem cells (ADSCs) have emerged as a novel promising for treating diabetic wounds both in preclinical and clinical studies \\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR6\\\" citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]\\u003c/sup\\u003e. However, the effectiveness of ADSCs in repairing chronic wounds is limited by the low cell engraftment efficiency due to the dramatic changes ranging from suitable expansion conditions in vitro to challenging microenvironment (e.g, hypoxia, oxidative stress, etc) in vivo \\u003csup\\u003e[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]\\u003c/sup\\u003e. Therefore, further research is needed to improve the efficacy of ADSC therapy for diabetic wound healing. Recently, increasing evidences suggest that paracrine function of ADSCs plays a leading role in skin wound regeneration \\u003csup\\u003e[\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]\\u003c/sup\\u003e. In particular, instead of mesenchymal stem cells (MSCs), using MSC conditioned medium or secretome, also provides a therapeutic potential for reducing irradiated skin injures \\u003csup\\u003e[\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]\\u003c/sup\\u003e, and scar fibrosis \\u003csup\\u003e[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/sup\\u003e. More importantly, this cell-free strategy effectively avoids the limitation of low cell engraftment of MSCs for wound healing.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we investigated whether ADSC conditioned medium (ACM) can be used to accelerating diabetic wound healing in rats. To achieve this purpose, we evaluated the therapeutic effect of ACM on skin wounds both in vitro and in vivo, as well as the potential mechanism of ACM on diabetic wound healing. The results suggest that ACM may offer a promising strategy to promote diabetic wound recovery.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAnimals\\u003c/h2\\u003e \\u003cp\\u003eTwenty adult male Sprague-Dawley (SD) rats weighing 180\\u0026ndash;200 grams each were obtained from the Shanghai Slack Laboratory Animal Center (License Number: SCXK hu 2022-0004). All rats were housed in a standard specific pathogen free (SPF) barrier environment at 20\\u0026ndash;26 ℃, 40%-70% humidity with 12 h/12 h light-dark cycle. All animal experiments were approved by Experimental Animal Ethics Center of Mengchao Hepatobiliary Hospital of Fujian Medical University (MCHH-AEC-2022-08). All experiments were designed and reported in accordance with the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines 2.0.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePreparation of ADSC conditioned medium\\u003c/h2\\u003e \\u003cp\\u003eThe isolation and culture of ADSCs were carried out according to previously published methods \\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR14\\\" citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]\\u003c/sup\\u003e. Briefly, adipose tissues were obtained from the inguinal region of male SD rats (n\\u0026thinsp;=\\u0026thinsp;5) and washed with PBS solution. The tissues were then cut into small fragments and digested with 0.1% type I collagenase, followed by neutralization with α-MEM containing 10% FBS. Subsequently, the cells were cultured at a density of 1\\u0026times;10\\u003csup\\u003e6\\u003c/sup\\u003e cells/mL in T-75 plates. ADSCs at passage 3 were collected and cultured at a density of 2\\u0026times;10\\u003csup\\u003e6\\u003c/sup\\u003e cells per 10 cm-plate. After overnight cell adhesion, the cultured ADSCs were washed with PBS solution to remove residual serum, and then replaced with serum-free medium (YOCON, China) for 48 hours. After the incubation, the conditioned medium was collected and centrifuged at 3000 g for 5 minutes to remove any cell debris. Furthermore, the ADSC conditioned medium was concentrated using ultrafiltration with a tangential flow filtration capsule (Pall, USA) containing a 3-kDa molecular weight cut-off membrane, following the manufacturer's instructions. Finally, the concentration of ADSC conditioned medium were analyzed by a BCA assay kit (TransGen Biotech, China), and store at -80 ℃.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eHUVEC culture\\u003c/h2\\u003e \\u003cp\\u003eHuman umbilical vein endothelial cell (HUVEC) line was obtained from National Institutes for Food and Drug Control (Beijing, China), and cultured with RPMI 1640 containing 10% FBS.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell viability assay\\u003c/h2\\u003e \\u003cp\\u003eHUVECs were cultured at a density of 1\\u0026times;10\\u003csup\\u003e4\\u003c/sup\\u003e cells per well in 96-well plates. After overnight cell adhesion, the cell supernatants were removed and replaced with 1 \\u0026micro;g/mL ADSC conditioned medium, while those cells treated with serum-free medium were used as the negative control. After 24 h or 48 h incubation, the cell viability was evaluated using CCK-8 assay kit (TransGen Biotech, China), according to the manufacturer's instructions.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eQuantitative real-time PCR analysis\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA was collected using a TRIzol reagent kit (TransGen Biotech, China) following the manufacturer's instructions. Afterwards, mRNA was reversely transcribed into cDNA using a cDNA synthesis kit (Roche, Germany). The quantitative real-time PCR analysis was performed in an ABI step one plus real-time PCR system (Carlsbad, USA), the PCR conditions were as follows: 95\\u0026deg;C for 15 sec, 60\\u0026deg;C for 30 sec, 70\\u0026deg;C for 30 sec, repeating 40 cycles. The primer sequence was described in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. The 2\\u003csup\\u003e\\u0026minus;△△Ct\\u003c/sup\\u003e formula was used to analyze the relative gene expression.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eThe primer sequences\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGene\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward primer\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eReverse primer\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTNF-α\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCAGAGGGAAGAGTTCCCCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCCTTGGTCTGGTAGGAGACG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIL-1β\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCACCTCTCAAGCAGAGCACAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGGGTTCCATGGTGAAGTCAAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIL-6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCACTGGTCTTTTGGAGTTTGAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGGACTTTTGTACTCATCTGCAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCOX-2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCGGAGGAGAAGTGGGGTTTAGGAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTGGGAGGCACTTGCGTTGATGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIL-12\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAGTTCTTCGTCCGCATCCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCTTGCACGCAGAT ATTCGCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIFN-γ\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCAACCCACAGATCCAGCACA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTCAGCACCGACTCCTTTTCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eVEGF\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCCAGAAGTTGGACGAAAA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTGAGTTGGGAGGAGGATG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eEGF\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eACACGGAGGGAGGCTACA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGTAGCCTCCCTCCGTGTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ebFGF\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCGCACCCTATCCCTTCACA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCAACGACCAGCCTTCCAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eKDR\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eACTCCTCCTCATTCAGCG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGGGTCCCACAACTTCTCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eβ-actin\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGTGGACA TCCGCAA AGAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAAAGGGTGTAACGC AACTA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDiabetic skin injured model and ACM treatment\\u003c/h2\\u003e \\u003cp\\u003eThe type 2 diabetic (T2D) model was established as previous method \\u003csup\\u003e[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]\\u003c/sup\\u003e. Briefly, the SD rats (n\\u0026thinsp;=\\u0026thinsp;10) were fed with a high-fat diet (HFD) containing 66.5% normal chow, 20% sucrose, 10% lard, 2% cholesterol and 1.5% cholate. After HFD for 4 weeks, all rats were administrated with 25 mg/kg STZ by intraperitoneal injection, twice/week for 2 weeks. The STZ-treated rats with a nonfasting blood glucose\\u0026thinsp;\\u0026ge;\\u0026thinsp;11.1 mmol/L were considered as successful establishment of T2D model. Next, the T2D rats were anesthetized with 40 mg/kg pentobarbital sodium, and a 1-cm diameter full-thickness skin defect were performed according to previous method \\u003csup\\u003e[\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]\\u003c/sup\\u003e. After that, the rats were randomly (random table method) divided into model and ACM group (n\\u0026thinsp;=\\u0026thinsp;5/group), and all rats were housed separately. The rats in ACM group were daily treated with 100 \\u0026micro;L ACM intradermically around the wound edges for 7 days, while the model rats were daily treated with equal volume of serum-free medium. The normal rats (n\\u0026thinsp;=\\u0026thinsp;5) were used as the negative control. After ACM for 12 days, all rats were euthanized with 100 mg/kg pentobarbital sodium, and the wounds were harvested for further evaluation.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eHistological examination\\u003c/h2\\u003e \\u003cp\\u003eTissue tissues were collected and fixed in 4% paraformaldehyde for 24 hours, then paraffin embedded and sectioned into slices. Tissue sections were evaluated with hematoxylin and eosin (HE) staining and Masson staining, respectively. Finally, the histological examination was performed using an ortho-microscope (Zeiss, Germany).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRNA sequencing\\u003c/h2\\u003e \\u003cp\\u003eThe total RNA of skin tissues was subjected to polyA-selected RNA-sequencing by the Illumina HiSeq X10 platform. Using the DESeq2 package, RNA-seq analysis was used to determine the different gene (DEG) expression among three groups: normal \\u003cem\\u003evs\\u003c/em\\u003e model, ACM \\u003cem\\u003evs\\u003c/em\\u003e model. False discovery rate (FDR)\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 and fold change of \\u0026ge;\\u0026thinsp;2, or \\u0026le;\\u0026thinsp;2 were the principles for DEG screening. Gene ontology (GO) analysis was used to analyze gene functions of DEGs, and the kyoto encyclopedia of genes and genomes (KEGG) analysis was used to tartet the DEGs enrichment pathway.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImmunohistochemistry\\u003c/h2\\u003e \\u003cp\\u003eThe skin wound sections were drenched in a citrate antigen retrieval solution (Beyotime Institute of Biotechnology, China) and heat-treated in pressure cooker for 2 minutes, natural cooling to RT and washing with PBS buffer for 3 times. Following incubation with 3% H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e for 10 minutes, and then the sections were blocked with 5% BSA for 30 minutes. After that, the sections were incubated with TNF-α, NF-κB, p-NF-κB, MAPK, p-MAPK, CXCL1, CXCL2, and CXCL8 primary antibody at a dilution of 1:200, overnight at 4\\u0026deg;C, respectively. After washing with PBS for 3 times, the sections were incubated with secondary antibody at RT for another 2 hours, and finally stained with DAB. The samples were observed using an ortho-microscope (Zeiss, Germany).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eAll quantitative data were expressed as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation. GraphPad Prism version 9.0 (GraphPad Software, USA) was used for statistical analysis. The ANOVA was used to evaluate the significant differences among three independent groups; while the two-tailed paired sample Student\\u0026rsquo;s t-tests were used to evaluate the significant differences between two groups. \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered as statistical difference.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eACM promotes HUVEC angiogenesis and proliferation in vitro\\u003c/h2\\u003e \\u003cp\\u003eThe impaired skin wound healing in diabetic individuals is largely attributed to diabetic angiopathy, which is characterized by dysfunction and impairment of the arteries throughout the body \\u003csup\\u003e[\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]\\u003c/sup\\u003e. We therefore investigated the effect of ACM on angiogenesis and proliferation of vascular cells in vitro. After incubation with ACM for 24 or 48 hours, the HUVEC viability was significantly increased (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA), suggesting that ACM promoted HUVEC proliferation. After 5 days of continuous ACM incubation, HUVECs showed vascular-like morphological changes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB), and the expression of genes associated with angiogenesis, including EGF, bFGF, VEGF, and KDR, was significantly up-regulated after ACM treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC), implying that ACM could promote HUVEC angiogenesis in vitro.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eACM accelerates T2D skin wound healing\\u003c/h2\\u003e \\u003cp\\u003eIn the light of the potential therapeutic effect of ACM for angiogenesis in vascular cells, we next conducted a T2D skin wound model to confirm the therapeutic function of ACM. As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB, the skin wound healing rate of T2D rats was significantly improved by the continuous ACM treatment for 12 days as compared to those in the model group. Moreover, the increased tissue regeneration and decreased inflammatory infiltration were also observed in the ACM group compared to those in model group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC). Therefore, these data suggested that ACM could accelerate T2D skin wound healing.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eACM inhibits T2D skin wound inflammation\\u003c/h2\\u003e \\u003cp\\u003eGiven the excessive inflammation is the typical characteristic of skin wounds \\u003csup\\u003e[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]\\u003c/sup\\u003e, we further analyzed the inflammatory genes in T2D skin wound tissues. As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e, the mRNA expression of TNF-α, IL-1β, IL-6, COX-2, IL-12 and IFN-γ was significantly increased in T2D skin wound as compared to those in normal rats, indicating the excessive inflammation occurred in the T2D skin wounds; while the mRNA expression of TNF-α, IL-1β, IL-6, COX-2, IL-12 and IFN-γ was effectively decreased after ACM treatment when compared with in the model groups, suggesting that ACM could inhibit excessive inflammation in T2D skin wounds.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eACM promotes T2D skin wound healing by targeting TNF and chemokine signaling pathway\\u003c/h2\\u003e \\u003cp\\u003eThe potential molecular mechanism of ACM on accelerating T2D skin wound healing was further explored by RNA sequencing. The volcano plot data showed that the expression of 10655 genes was different between normal and model groups (Normal vs Model), and the expression of 5287 genes was different between ACM and Model group (ACM vs Model), the 4269 genes were the common differential genes of this two panels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA-C). Gene Ontology (GO) annotation and pathway enrichment analysis showed that the up-regulation of TNF signaling and chemokine signaling was observed in the model group (compared with normal group), while down-regulation of TNF signaling and chemokine signaling was clearly observed in ACM group as compared with model groups, suggesting that potential molecular mechanism of ACM on T2D skin wound healing is targeting in TNF signaling and chemokine signaling pathway.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eTo confirm the RNA sequencing results, we further evaluated the protein expression of main regulars in TNF signaling and chemokine signaling. As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e, the TNF signaling related proteins, including TNF-α, NF-κB, p-NF-κB, MAPK, and p-MAPK, and the chemokine signaling related proteins, including CXCL1, CXCL2, and CXCL8, were all down-regulated by ACM treatment in T2D skin wounds, suggesting that ACM accelerated T2D skin wound healing via down-regulation of TNF signaling and chemokine signaling.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eAngiogenesis is an essential part of skin wound regeneration, and it is also prone to be injured by the diabetes status \\u003csup\\u003e[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]\\u003c/sup\\u003e, excessive inflammation \\u003csup\\u003e[\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]\\u003c/sup\\u003e, oxidative stress and other chronic wound conditions \\u003csup\\u003e[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]\\u003c/sup\\u003e. Given the excellent performance of MSCs on promoting vasculogenesis through paracrine factors (e.g., VEGF, EGF, and bFGF) \\u003csup\\u003e[\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]\\u003c/sup\\u003e, MSC secretome or conditioned medium provides a new strategy for accelerating angiogenesis of skin wounds \\u003csup\\u003e[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]\\u003c/sup\\u003e. Since the advantages of abundant sources and easier accessibility of adipose tissues \\u003csup\\u003e[\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]\\u003c/sup\\u003e, the adipose tissue-derived MSC conditioned medium (ACM) was used to confirm the beneficial effect on angiogenesis in the current study. As expect, ACM effectively promoted HUVEC proliferation and angiogenesis. In particular, ACM also up-regulated the expression of VEGF, EGF, bFGF, and KDR in HUVECs. Therefore, these data suggests that ACM contributes to cutaneous wound regeneration.\\u003c/p\\u003e \\u003cp\\u003eConsidering T2D accounts for more than 90% of diabetes cases \\u003csup\\u003e[\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]\\u003c/sup\\u003e, a T2D skin wound injured rat model was next used to reveal the therapeutic effect of ACM on skin wounds. Significantly, we found that ACM could promote skin wound healing rate. It is well known that the excessive inflammation is caused by the crosstalk of various immune cells, including neutrophils \\u003csup\\u003e[\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]\\u003c/sup\\u003e, macrophages \\u003csup\\u003e[\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]\\u003c/sup\\u003e, and lymphocytes \\u003csup\\u003e[\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]\\u003c/sup\\u003e, which is also characterized by the high expression of various pro-inflammatory factors, including TNF-α, IL-1β, IL-6, and COX-2, as well as IL-12 and IFN-γ \\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR30\\\" citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]\\u003c/sup\\u003e. In this study, we proved that these pro-inflammatory factors were high expressed in skin wounds, which means the excessive inflammation occurred in T2D rats. More importantly, we found that ACM could reduce the excessive inflammation. In particular, the transcriptome sequencing data further confirmed that ACM accelerates T2D skin wound healing is closely related to the the down-regulation of TNF signaling and chemokine signaling pathway. Taken together, the ACM provides a new promising strategy for accelerating T2D skin wound healing, which is partly through TNF signaling and chemokine signaling pathway.\\u003c/p\\u003e \\u003cp\\u003eGiven the fact that MSC conditioned medium or secretome has a complex composition, including extracellular vesicles (containing various types of lipids, proteins and nucleic acids) and effector molecules (e.g., PGE2, IDO, etc.)\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR33\\\" citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]\\u003c/sup\\u003e, the enhancement of ACM in skin wound regeneration may involve in multiple targets and pathways. Further studies should be focused on the different components and targets of ACM on the therapeutic role in T2D skin wound repair, to verify more detail mechanism. Furthermore, before proceeding with further clinical trials or applications, it is crucial to ensure strict control over the large-scale production, stability, and quality considerations related to ACM production.\\u003c/p\\u003e \\u003cp\\u003eHere, we showed that ACM could enhance vascular proliferation and angiogenesis, promote skin wound healing in type 2 diabetes, and inhibit the inflammatory response. The mechanism may involve the downregulation of the TNF pathway and chemokine pathway.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eIn conclusion, our study has shown that ACM can significantly accelerate the healing of diabetic skin wounds by promoting vascular remodeling and suppressing inflammation through the TNF pathway and chemokine pathway.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cdiv class=\\\"DefinitionList\\\"\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eACM\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eAdipose-derived mesenchymal stem cell-conditioned medium\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eADSC\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eAdipose-derived mesenchymal stem cell\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003ebFGF\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eBasic fibroblast growth factor\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eCOX-2\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eCyclooxygenase-2\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eCXCL 1\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eC-X-C chemokine ligand 1\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eCXCL 2\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eC-X-C chemokine ligand 2\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eCXCL 8\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eC-X-C chemokine ligand 8\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eEGF\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eEpidermal growth factor\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eFBS\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eFetal bovine serum\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eHUVEC\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eHuman umbilical vein endothelial cell\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eIFN-γ\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eInterferonγ\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eIL-1β\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eInterleukin 1β\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eIL-6\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eInterleukin 6\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eIL-12\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eInterleukin 12\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eKDR\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eKinase insert domain receptor\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eMAPK\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eMotogen-activated protein kinase\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eMSC\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eMesenchymal stem cell\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eNF-κB\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eNuclear factor-κB\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eT2D\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eType 2 diabetic\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eTNF-α\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eTumor necrosis factorα\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003e\\u003cb\\u003eVEGF\\u003c/b\\u003e\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eVascular endothelial growth factor\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch2\\u003e\\u003cstrong\\u003eAuthor information\\u003c/strong\\u003e\\u003c/h2\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors and Affiliations\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e1\\u003c/sup\\u003eDepartment of Critical Care Medicine, Shengli Clinical Medical College of Fujian Fuzhou University Affiliated Provincial Hospital, Fuzhou 350001, P. R. China.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e2\\u003c/sup\\u003e Department of Obstetrics and Gynecology, Jin'an District Hospital, Fuzhou 350001, P. R. China.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e3\\u003c/sup\\u003eShengli Clinical Medical College of Fujian Medical University; Department of Emergency, Fujian Provincial Hospital; Fuzhou University Affiliated Provincial Hospital; Fujian Provincial Key Laboratory of Emergency Medicine, Fuzhou 350001, P. R. China.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e4\\u003c/sup\\u003eThe United Innovation of Mengchao Hepatobiliary Technology Key Laboratory of Fujian Province, Mengchao Hepatobiliary Hospital of Fujian Medical University, Fuzhou 350028, P. R. China.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003csup\\u003e5\\u003c/sup\\u003eDepartment of Anesthesiology, Shengli Clinical Medical College of Fujian Fuzhou University Affiliated Provincial Hospital, Fuzhou 350001, P. R. China.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eContributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eLong Huang and Naishun Liao participated in study design and drafted the manuscript. Huimin He and Zhongbao Lin participated in isolation and culture of ADSCs, and ACM collection. Huimin He and Haiyun Liu performed the animal study, q-PCR analysis and cell proliferation assay. Xiankun Lin participated in histologic section. Long Huang and Naishun Liao performed the data analysis. Xiaodan Wu, Naishun Liao, Long Huang and Huimin He participated in proof-read the manuscript. Xiaodan Wu and Long Huang participated in financial support. All authors read and approved the final manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCorresponding authors\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCorrespondence to Naishun Liao or Xiaodan Wu.\\u003c/p\\u003e\\n\\u003ch2\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/h2\\u003e\\n\\u003cp\\u003eAll animal experiments were approved by the Animal Ethics Committee of Mengchao Hepatobiliary Hospital of Fujian Medical University (Title, ACM for skin wound healing; NO., MCHH-AEC-2022-08; Date, Dec 12, 2022), and all procedures were performed in accordance with the guidelines.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors have reviewed the manuscript and approved its submission for publication.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e\\n\\u003ch2\\u003eFunding\\u003c/h2\\u003e\\n\\u003cp\\u003eThis study was supported by Scientific Foundation of Fujian Health Department (Grant No. 2020QNB006), the Startup Fund for Scientific Research, Fujian Medical University (Grant No. 2020QH1139), and the Natural Science Foundation of China (Grant No. 82271238)\\u003c/p\\u003e\\n\\u003ch2\\u003eAcknowledgements\\u003c/h2\\u003e\\n\\u003cp\\u003eThe authors declare that they have not used Artificial Intelligence in this study.\\u003c/p\\u003e\\n\\u003ch2\\u003eAvailability of data and materials\\u003c/h2\\u003e\\n\\u003cp\\u003eThe data sets supporting the results of this article are included within the article. The raw sequencing data in this article has been deposited at Genome Sequencing Achieve database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://ngdc.cncb.ac.cn/\\u003c/span\\u003e\\u003c/span\\u003e) under the accession number of CRA017979.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eFreedman BR, Hwang C, Talbot S, Hibler B, Matoori S, Mooney DJ. Breakthrough treatments for accelerated wound healing. Sci Adv. 2023;9:eade7007.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMartin P, Nunan R. Cellular and molecular mechanisms of repair in acute and chronic wound healing. Br J Dermatol. 2015;173:370\\u0026ndash;8.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGuo S, Dipietro LA. Factors affecting wound healing. J Dent Res. 2010;89:219\\u0026ndash;29.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSouza Ade, Santo GE, Amaral GO, Sousa KSJ, Parisi JR, Achilles RB, et al. Electrospun skin dressings for diabetic wound treatment: a systematic review. J Diabetes Metab Disord. 2023;23:49\\u0026ndash;71.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYan D, Song Y, Zhang B, Cao G, Zhou H, Li H, et al. Progress and application of adipose-derived stem cells in the treatment of diabetes and its complications. Stem Cell Res Ther. 2024;15:3.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCarstens MH, Quintana FJ, Calderwood ST, Sevilla JP, R\\u0026iacute;os AB, Rivera CM, et al. Treatment of chronic diabetic foot ulcers with adipose-derived stromal vascular fraction cell injections: Safety and evidence of efficacy at 1 year. Stem Cells Transl Med. 2021;10:1138\\u0026ndash;47.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHuerta CT, Voza FA, Ortiz YY, Liu ZJ, Velazquez OC. Mesenchymal stem cell-based therapy for non-healing wounds due to chronic limb-threatening ischemia: A review of preclinical and clinical studies. Front Cardiovasc Med. 2023;10:1113982.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYu S, Yu S, Liu H, Liao N, Liu X. Enhancing mesenchymal stem cell survival and homing capability to improve cell engraftment efficacy for liver diseases. Stem Cell Res Ther. 2023;14:235.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMa H, Siu WS, Leung PC. The potential of MSC-based cell-free therapy in wound healing-a thorough literature review. Int J Mol Sci. 2023;24:9356.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLin Z, Shibuya Y, Imai Y, Oshima J, Sasaki M, Sasaki K, et al. Therapeutic potential of adipose-derived stem cell-conditioned medium and extracellular vesicles in an in vitro radiation-induced skin injury model. Int J Mol Sci. 2023;24:17214.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang C, Wang T, Zhang L, Chen P, Tang S, Chen A, et al. Combination of lyophilized adipose-derived stem cell concentrated conditioned medium and polysaccharide hydrogel in the inhibition of hypertrophic scarring. Stem Cell Res Ther. 2021;12:23.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang M, Zhao J, Li J, Meng M, Zhu M. Insights into the role of adipose-derived stem cells and secretome: potential biology and clinical applications in hypertrophic scarring. Stem Cell Res Ther. 2024;15:137.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiao N, Zheng Y, Xie H, Zhao B, Zeng Y, Liu X, et al. Adipose tissue-derived stem cells ameliorate hyperglycemia, insulin resistance and liver fibrosis in the type 2 diabetic rats. Stem Cell Res Ther. 2017;8:286.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiao N, Pan F, Wang Y, Zheng Y, Xu B, Chen W, et al. Adipose tissue-derived stem cells promote the reversion of non-alcoholic fatty liver disease: An in vivo study. Int J Mol Med. 2016;37:1389\\u0026ndash;96.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiao N, Shi Y, Wang Y, Liao F, Zhao B, Zheng Y, et al. Antioxidant preconditioning improves therapeutic outcomes of adipose tissue-derived mesenchymal stem cells through enhancing intrahepatic engraftment efficiency in a mouse liver fibrosis model. Stem Cell Res Ther. 2020;11:237.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHur W, Lee HY, Min HS, Wufuer M, Lee CW, Hur JA, et al. Regeneration of full-thickness skin defects by differentiated adipose-derived stem cells into fibroblast-like cells by fibroblast-conditioned medium. Stem Cell Res Ther. 2017;8:92.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJin W, Chen X, Kong L, Huang C. Gene therapy targeting inflammatory pericytes corrects angiopathy during diabetic wound healing. Front Immunol. 2022;13:960925.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHuang C, Dong L, Zhao B, Lu Y, Huang S, Yuan Z, et al. Anti-inflammatory hydrogel dressings and skin wound healing. Clin Transl Med. 2022;12:e1094.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFan R, Zhao J, Yi L, Yuan J, McCarthy A, Li B, et al. Anti-inflammatory peptide-conjugated silk fibroin/cryogel hybrid dual fiber scaffold with hierarchical structure promotes healing of chronic wounds. Adv Mater. 2024;36:e2307328.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGuo Y, Ma M, Liu Z, Lv L, Pan X, Liu Q, et al. Chronic poor healing wounds of post cesarean scar diverticulum: Altered angiogenesis and immunobiology. J Reprod Immunol. 2023;157:103929.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDe Wolde SD, Hulskes RH, Weenink RP, Hollmann MW, Van Hulst RA. The effects of hyperbaric oxygenation on oxidative stress, inflammation and angiogenesis. Biomolecules. 2021;11:1210.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGuillamat-Prats R. The role of MSC in wound healing, scarring and regeneration. Cells. 2021;10:1729.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHade MD, Suire CN, Mossell J, Suo Z. Extracellular vesicles: Emerging frontiers in wound healing. Med Res Rev. 2022;42:2102\\u0026ndash;25.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBunnell BA. Adipose tissue-derived mesenchymal stem cells. Cells. 2021;10:3433.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEdlitz Y, Segal E. Prediction of type 2 diabetes mellitus onset using logistic regression-based scorecards. Elife. 2022;11:e71862.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhu S, Yu Y, Ren Y, Xu L, Wang H, Ling X, et al. The emerging roles of neutrophil extracellular traps in wound healing. Cell Death Dis. 2021;12:984.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLv D, Cao X, Zhong L, Dong Y, Xu Z, Rong Y, et al. Targeting phenylpyruvate restrains excessive NLRP3 inflammasome activation and pathological inflammation in diabetic wound healing. Cell Rep Med. 2023;4:101129.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBaltzis D, Eleftheriadou I, Veves A. Pathogenesis and treatment of impaired wound healing in diabetes mellitus: new insights. Adv Ther. 2014;31:817\\u0026ndash;36.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eQuagliariello V, De Laurentiis M, Rea D, Barbieri A, Monti MG, Carbone A, et al. The SGLT-2 inhibitor empagliflozin improves myocardial strain, reduces cardiac fibrosis and pro-inflammatory cytokines in non-diabetic mice treated with doxorubicin. Cardiovasc Diabetol. 2021;20:150.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAcosta JB, del Barco DG, Vera DC, Savigne W, Lopez-Saura P, Guillen Nieto G, et al. The pro-inflammatory environment in recalcitrant diabetic foot wounds. Int Wound J. 2008;5:530\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSch\\u0026uuml;rmann C, Goren I, Linke A, Pfeilschifter J, Frank S. Deregulated unfolded protein response in chronic wounds of diabetic ob/ob mice: a potential connection to inflammatory and angiogenic disorders in diabetes-impaired wound healing. Biochem Biophys Res Commun. 2014;446:195\\u0026ndash;200.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKota DJ, Prabhakara KS, Toledano-Furman N, Bhattarai D, Chen Q, DiCarlo B, et al. Prostaglandin E2 indicates therapeutic efficacy of mesenchymal stem cells in experimental traumatic brain injury. Stem Cells. 2017;35:1416\\u0026ndash;30.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMaughon TS, Shen X, Huang D, Michael AOA, Shockey WA, Andrews SH, et al. Metabolomics and cytokine profiling of mesenchymal stromal cells identify markers predictive of T-cell suppression. Cytotherapy. 2022;24:137\\u0026ndash;48.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhao H, Li Z, Wang Y, Zhou K, Li H, Bi S, et al. Bioengineered MSC-derived exosomes in skin wound repair and regeneration. Front Cell Dev Biol. 2023;11:1029671.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Adipose tissue-derived mesenchymal stem cells, conditioned medium, type 2 diabetes, skin wound, and regeneration\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4759395/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4759395/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cstrong\\u003eBackground:\\u003c/strong\\u003e Considering that the therapeutic function of adipose tissue-derived mesenchymal stem cells (ADSCs) on skin wounds is closely related to their paracrine effect, this study was designed to investigate the therapeutic effect of ADSC conditioned medium (ACM) on type 2 diabetic (T2D) skin wound healing.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMethods: \\u003c/strong\\u003eThe effect of ACM on HUVEC viability and angiogenesis was firstly evaluated by CCK 8 assay and q-PCR analysis, respectively. Next, a T2D rat model was induced by the combination of high fat diet and streptozotocin. Following by the establishment of full-thickness skin defects in T2D rats, ACM or serum free cultured medium was daily injected around the wound edge sfor 7 days. Afterwards, the skin wound healing rate was analyzed, and the skin tissues were assessed by histopathological examination. The mRNA levels of TNF-α, IL-1β, IL-6, and COX-2, as well as IL-12 and IFN-γ were evaluated by q-PCR analysis. Additionally, the transcriptome sequencing and immunohistochemistry were used to reveal the potential mechanism of ACM for T2D skin wound healing.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eResults: \\u003c/strong\\u003eOur data showed that ACM promoted cell proliferation and angiogenesis, and up-regulated the mRNA expression of EGF, bFGF, VEGF, and KDR in HUVECs. The in vivo data indicated that ACM could accelerate T2D skin wound healing rate by inhibiting the mRNA levels of TNF-α, IL-1β, IL-6, and COX-2, as well as IL-12 and IFN-γ in vivo. Particularly, we also found that ACM could down-regulate TNF and chemokine signaling.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConclusions: \\u003c/strong\\u003eACM could effectively promote vascular cell angiogenesis, accelerate skin wound regeneration by suppressing excessive inflammation in T2D rats, which is closely related to down-regulation of TNF and chemokine signaling pathways.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Adipose-derived mesenchymal stem cell-conditioned medium accelerates wound healing in a rat model of full-thickness skin defects\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-09-02 16:29:30\",\"doi\":\"10.21203/rs.3.rs-4759395/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"68cd2b26-93d6-4db8-9c77-16a26d22758d\",\"owner\":[],\"postedDate\":\"September 2nd, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-09-04T12:12:52+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-09-02 16:29:30\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4759395\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4759395\",\"identity\":\"rs-4759395\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}