{"paper_id":"2b146668-e29e-4f3d-9f30-0fabf03a2eaf","body_text":"Chemerin Promotes Proliferation of Cardiac Fibroblasts via CMKLR1/PI3k/Akt/NF-κB Signaling Pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Chemerin Promotes Proliferation of Cardiac Fibroblasts via CMKLR1/PI3k/Akt/NF-κB Signaling Pathway Rui Cai, Ruifeng Cao, Yan Liu, Nuoqi Zhang, Yang Zhang, Yaling Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4142000/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background :Chemerin expression has been documented to be increased in patients with heart failure (HF), animal models of myocardial fibrosis (MF), and proliferation of cardiac fibroblasts (CFs). However, the mechanisms underlying the chemerin high-proliferation processes in CFs remain unknown. The aim of this study was to elucidate the effects and mechanisms on chemerin that promote the proliferation of CFs. Methods : CFs were isolated from 3-day-old Sprague-Dawley (SD) rats and cultured. They were identified by immunofluorescence. Aldosterone-induced proliferation model of CFs. The role of chemerin on the proliferation of CFs were determined by EdU. PI3k/Akt/NF-κB signal transduction was inhibited by pretreatment with the PI3k/Akt/NF-κB inhibitor LY294002 and PDTC. real-time quantitative PCR（RT-qPCR）and Western blotting were used to test the expression of relevant genes. Results: By immunofluorescence staining of vimentin, the extracted cells can be identified as CFs. Aldosterone induces the proliferation of CFs, we found that aldosterone promoted upregulation of chemerin, CMKLR1 and PCNA expression. And then we found that CMKLR1 expression was upregulated in CFs in response to exogenous chemerin stimulation, whereas the exogenous chemerin significantly promoted the proliferation of CFs. Mechanistically, exogenous chemerin increased the phosphorylated PI3k/Akt and NF-κB levels in CFs. Alternatively, blockade of PI3k/Akt and NF-κB inhibited the promoting proliferation effects of chemerin. Conclusions : Our study found that chemerin promoted the proliferation of CFs through upregulation of CMKLR1 receptors. We also found that chemerin promotes the proliferation of CFs via the PI3k/Akt/NF-κB signaling pathway. Chemerin is expected to be a target for therapy against myocardial fibrosis. chemerin CMKLR1 PI3k/Akt NF-κB cardiac fibroblasts myocardial fibrosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Heart failure (HF) is a disease with high morbidity, hospitalization and mortality. It is a growing public health problem that places a significant financial burden on the healthcare system[1]. HF is a complex clinical syndrome characterized by ventricular remodeling, cardiac dysfunction, and hemodynamic abnormalities. Myocardial fibrosis (MF) can lead to myocardial remodeling, making it an important pathological feature of HF[2]. Slowing the development of MF is an optimized strategy for reducing the risk of death from heart failure. Numerous basic and clinical studies had shown that the pathogenesis of MF was closely related to the renin-angiotensin-aldosterone system. In recent years, aldosterone had been found to play an important role in promoting MF[3]. Our previous study[4] found that aldosterone promoted CFs proliferation and collagen deposition. Aldosterone-induced inflammation of myocardial tissue was characterized by the high expression of inflammatory factors prior to mononuclear macrophage infiltration and fibrosis[5]. Inflammatory factors were important early features of aldosterone- induced MF [3]. Chemerin was a recently discovered adipokine that had been shown to be closely linked to inflammation, obesity, metabolic syndrome and cardiovascular disease[6]. The main function of chemerin was originally described as a regulator of glucolipid metabolic processes and inflammatory responses[7]. Research revealed that chemerin plays an important role in the inflammation, hypertrophy, pyroptosis and fibrosis that occurs in the heart tissue of rats with dilated cardiomyopathy[8]. In patients with type 2 diabetes, elevated serum chemerin levels had been associated with heart failure[9]. While chemerin had been shown to induce apoptosis of murine cardiomyocytes through inflammatory processes[10]. These results suggested that chemerin played an important role in heart failure by triggering cardiac inflammation. CFs are enmeshed in the endomysial interstitial matrix that surrounds cardiomyocytes and represent the most abundant interstitial cells in the adult mammalian heart. Activated CFs are the main effector cells in MF[11].Our previous study revealed that chemerin and CMKLR1 are expressed in cardiomyocytes and CFs of rats. Meanwhile, our previous study indicated that aldosterone upregulates chemerin in CFs[4]. Chemerin can trigger heart inflammation. But it is not known whether it can also promote the proliferation of CFs. The PI3k/Akt and NF-κB signaling pathways played important roles in the cardiovascular system, making them a promising target for the treatment and prevention of heart failure[12]. Ben et al. found that chemerin regulates endothelial cell survival and neovascular stability via the PI3k/Akt signaling pathway[13]. The PI3k/Akt and NF-κB signaling pathways worked together to cause H2O2-induced cardiomyocyte damage[14]. However, it was still unknown that the PI3k/Akt and NF-κB pathways played an important role in chemerin-inducing myocardial fibrosis. Therefore, we hypothesized that chemerin promotes the proliferation of CFs via the CMKLR1/PI3k/Akt/NF-κB signaling pathway and may be involved in MF. Our results will provide new data on the molecular mechanisms of chemerin leading to MF and cardiac remodeling. Materials and methods Animals Two hundred Sprague-Dawley (SD) rats (3 days old) were obtained from the Laboratory Animal Center of Hebei Medical University (Shijiazhuang, Hebei, China). The animal study was approved by the Ethics Committee of Hebei Medical University and conducted in accordance with an institutional policy of Hebei Medical University. Cardiac fibroblast culture CFs were isolated from 3-day-old SD rats. First, the tissue at the cardiac apex of the SD rat was isolated and infused in 10 ml of phosphate-buffered saline (PBS) (Sigma Aldrich, St. Louis, MO) containing 0.05% trypsin (Sigma Aldrich, St. Louis, MO) and collagenase II (BioFroxx,CN) mixture for 5 minutes in the incubator at 37°C. The process was repeated 6–8 times to obtain single cells. Isolated cells were pooled, the cells were then resuspended and filtered through a 75 µm cell strainer and then centrifuged at 1000 rpm for 5 minutes. The cell pellet was resuspended in growth medium containing Dulbecco's Modified Eagle's Medium (DMEM) (Gibco, CN), 10% fetal bovine serum (CN), and 1% biantibody and incubated in a humidified atmosphere with 5% CO2 at 37°C for 2 h. This allowed the CFs to bind preferentially to the dish, the non-adherent cells were discarded, the medium was changed and placed in the incubator until they were completely confluent. Cells were passaged with 0.05% trypsin-EDTA (Sigma Aldrich, St. Louis, MO). Second or third passage cardiac fibroblasts were used for experiments. Immunofluorescence staining Immunofluorescence staining was used to identify fibroblasts. After digestion, CFs were added to DMEM medium and resuspended, and the density was adjusted to 5 × 105 cells/mL. CFs were then seeded in 6-well plates at 37°C in the incubator. When the cells were about 80% confluent. The bottom of the plate was washed three times with PBS for one minute and then fixed first with 4% paraformaldehyde at room temperature for 20 minutes and then with 0.1% Triton X-100 in PBS at room temperature for 15 minutes. CFs were finally blocked with 5% bovine serum albumin (BSA) solution and incubated with anti-vimentin antibody (1:200, TA600392, ORIGEE, US) at 4℃overnight in the dark. Subsequently, CFs were stained with 4`,6-diamidino- 2-phenylindole (DAPI) for 10 min and washed three times with PBS, and immunofluorescence analysis was performed using a confocal microscope (Zeiss, White Plains, NY, USA) under 400℃ performed × magnification. EdU Staining A EdU Cell Proliferation Kit with Alexa Fluro 488 was used for the cell proliferation assay. CFs are seeded in 6-well plates (5×10 4 cells/well) to evenly distribute the cell monolayer with 3 replicates per group of samples.Place in the cell culture incubator and incubate adherent for 24 h, then aspirate the old medium and add the working solution.After 24 hours of dosing treatment, 10 µM EdU is added to each well and incubated for 2 hours, followed by fixation and washing.The nuclei were stained with Hoechst33342 for 10 min.Finally, the field of view was randomly obtained under an inverted fluorescence microscope, and the positive rate of EdU staining was calculated. Real-time quantitative PCR (RT-qPCR) Total mRNA from treated CFs was extracted using the TransZol Up Plus RNA Kit (TransGen, CN). Reverse transcription was performed using Hiscript III RT SuperMix for qPCR (+ gDNA Wiper). Of the obtained cDNA, 20 ng was provided for RT-PCR using ChamQ Universal SYBR qPCR Master Mix according to the manufacturer's instructions (Vazyme). The relative mRNA levels of chemerin, CMKLR1, and PCNA were estimated and normalized with actin mRNA levels. The sequences of the PCR primers were as follows in Table 1 . The reaction parameters were as follows: 95℃ for 30 seconds, followed by 40 cycles of 95℃ for 10 seconds, then 60℃ for 10 seconds. Relative expression levels were calculated using the 2-ΔΔCT method. Table 1 Primers for RT-PCR. Gene Forward primer (5’-3’) Reverse primer (5’-3’) chemerin CGGTGTGGACAGTGCTGATGAC TCCGCTTCCTCCCATTTGGTTTG CMKLR1 GCACCAGCCACGGGAAGATAAC GATCAGGAAGCCACAGAGGAAGC PCNA CGGCGTGAACCTACAGAGCATG GCAGCGGTATGTGTCGAAGCC Western blot CFs proteins were extracted using the Nuclear Protein and Cell Cytoplasmic Protein Extraction Kit (No. P0027) and the protein concentration was determined. First, the SDS-PAGE gel was prepared, then the protein sample was carefully added to the gel wells for electrophoresis and then onto the membrane transfer membrane. Membranes were incubated overnight in primary antibody and washed three times in 0.1% Tween-20. TBS and then incubated in secondary antibody (1:1000) for one hour at room temperature, followed by five washes. The immunoreactive proteins were detected using an enhanced chemiluminescence system. The antibodies are listed in Table 2 . Table 2 Antibodies for Western blot Dilution Product code Brand anti-Akt antibody 1: 1000 4685 Cst Anti-phospho-Akt antibody 1: 1000 4060 Cst anti-PI3k antibody 1: 1000 4257 Cst Anti-phospho-PI3k antibody 1: 1000 130868 Absin anti-NF-κB antibody 1: 1000 8242 Cst Anti-phospho-NF-κB antibody 1: 1000 3033 Cst anti-PCNA antibody 1: 1000 AF0239 Affinity anti-Actin antibody 1: 10000 AB0035 Abways Statistics The SPSS 27.0 version for Windows was used for the statistical analyses. Data were displayed as mean ± standard error of the mean (SEM). Statistical analyzes were carried out using the Student t test. p < 0.05 was considered significant. Results Immunofluorescence identification of CFs. The cell nucleus of CFs stained blue with DAPI in immunofluorescence images (Fig. 1 A); Green is the vimentin in the CFs (Fig. 1 B); Complex diagram of DAPI and vimentin staining (Fig. 1 C). The expression of chemerin, CMKLR1 and PCNA were increased in aldosterone-induced CFs multiplicative model. CFs were incubated at a concentration of 1*10 − 7 mol/L aldosterone for 24 hours[4], then the mRNA and protein expression levels of chemerin, CMKLR1 and PCNA were measured. The mRNA levels of chemerin, CMKLR1 and PCNA were significantly higher in the aldosterone group than in the control group (**p < 0.01, *p < 0.05, Fig. 2 A). The same results were confirmed by Western blot analysis (**p < 0.01, Figs. 2 B, C, D, E).The effect of aldosterone on CFs proliferation was examined by EdU. The results showed that aldosterone significantly promoted the proliferation of CFs as compared with the control group(***p < 0.001, Figs. 2 E,F). Chemerin promoted proliferation of CFs by upregulating the CMKLR1 receptors. CFs were treated with different concentrations of exogenous chemerin. The expression of CMKLR1 and PCNA was significantly increased in different chemerin concentration groups after 24 hours compared to the control group (**p < 0.01, *p < 0.05, Figs. 3 A,B,C). To further elucidate whether the chemerin promotes the proliferation of CFs, we conducted the EdU assay. As shown in Figs. 3 chemerin can significantly promote the proliferation of CFs measured by EdU compared to control group (50 ng/ml, 150 ng/ml, all **p < 0.01;100 ng/ml, *p < 0.05༛100 ng/ml, ***p < 0.001 Figs. 3 D,E). Chemerin mediated CFs proliferation by activating the PI3k/Akt/ NF-κB signaling pathway To investigate the possible mechanism of chemerin-induced phenotypic changes in CFs, the key regulatory proteins in PI3k/Akt and NF-κB signaling pathways were analyzed by western blot. The ratios of p-PI3k/PI3k, p-Akt/Akt and p-NF-κB/NF-κB were significantly increased in the chemerin group compared to the control group (*p < 0.05, Figs. 4 A,B,C,D ). However, these ratios were decreased by LY294002, which was an inhibitor of PI3k/Akt signaling, compared to the chemerin group (##p < 0.01, Figs. 4 A,B,C,D). Furthermore, LY294002 can inhibit the expression of PCNA induced by chemerin (*p < 0.05 vs. control group, ##p < 0.05 vs. chemerin group, Figs. 4 A,E).Similarly, The proliferation promoting effect of chemerin on CFs can be decreased by LY294002(*p < 0.05 vs. control group,#p < 0.05 vs. chemerin group, Figs. 4 F,G). The NF-κB signaling inhibitor PDTC only reduced the p-NF-κB/NF-κB ratio compared to the chemerin group (##p < 0.01, Figs. 5 A,D). There was no significant difference in p-PI3k/PI3k and p-Akt/Akt ratios compared to the chemerin group. (Figs. 5 A,B,C)。 Discussion In recent years, scientists' interest has been increasingly drawn to chemerin, which has recently been viewed as a vital protein with pleiotropic influence on the human organism [ 15 ] . Therefore, the correct concentration of chemerin was certainly important for the proper functioning of the body. It has been confirmed that extremely higher serum levels of chemerin not only cause disorders of lipid metabolism and carbohydrate catabolism, but also promote increased insulin resistance and the risk of diseases caused by cardiovascular disorders [ 16 ] . Evidence from several clinical studies suggests that circulating chemerin levels are associated with cardiovascular disease [ 17 – 19 ] . Xiang Zhou et al. found that chemerin could be a useful indicator for predicting MACEs in patients with chronic heart failure [ 6 ] . Yebin Xie et al. found that chemerin and CMKLR1 expression were upregulated in serum, left ventricular myocardium and cardiomyocytes of rats with dilated cardiomyopathy [ 8 ] . The interaction between chemerin and its receptors was important for various cellular and signalling mechanisms in the cardiovascular, nervous, and reproductive systems. CMKLR-1 is the main chemerin receptor, and the chemerin/CMKLR1 axis promoteed chemotaxis of natural killers (NK), macrophages, and dendritic cells [ 20 ] . Our early study found that aldosterone upregulates chemerin in CFs [ 4 ] . In this study, the expression of chemerin and CMKLR1 was increased in the aldosterone-induced multiplicative CF model. Therefore, we speculated that chemerin is associated with the proliferation of CFs, thereby promoting the development of myocardial fibrosis. We then confirmed our suspicion by administering it to chemerin in vitro. We found that CMKLR1 mRNA and protein were highly expressed in CFs and were also increased with increasing chemerin concentrations. PCNA was used in our study to assess CF proliferation. PCNA, first detected in late G1, was essential for cell cycle regulation [ 21 ] . At the optimal concentration of chemokin (100 ng/ml), PCNA expression was highest in CFs. Finally, we certified that chemerin promoted the proliferation of CFs through upregulation of CMKLR1 receptors. The PI3k/Akt signaling pathway played an important role in the cardiovascular system, such as cell survival, myocardial hypertrophy, myocardial contraction, electrophysiology and energy metabolism [ 22 , 23 ] . Liu et al. found that apelin-13-induced rat vascular smooth muscle cell proliferation was closely related to the PI3k/Akt-ERK1/2 signaling pathway [ 24 ] . Endostatin was activated at least partially by ros-dependent PI3k/Akt to stimulate proliferation and migration of adult rat CFs [ 25 ] . These showed that PI3k/Akt may be involved in the proliferation of CFs in myocardial fibrosis. Some studies had also demonstrated the intrinsic connection between chemerin and the PI3k/Akt signaling pathway. Yamamoto et al. It was reported that chemerin significantly stimulated the phosphorylation of Akt. LY294002 inhibited the migration of chemerin-induced CFs [ 26 ] .NF-κB was an important transcription factor in inflammatory responses and regulateed a variety of genes that were crucial for the development and progression of cardiovascular inflammation [ 27 ] . Cheshire et al. demonstrated the importance of cytokine-induced synergistic activation of NF-кB in proinflammatory states [ 28 ] . Recently, it was believed that deciphering NF- κB linked multiple signaling crosstalk was crucial for identifying new therapeutic targets in combating atherosclerosis and related pathologies. Activation of NF-кB signaling involved and influenced multiple signaling cascades, including MAPK and PI3K/Akt signaling pathways [ 29 – 32 ] . Experiments by Georgios K. demonstrated the involvement of MAPK and PI3K/Akt signaling pathways in chemerin-induced NF-κB activation [ 33 ] . It had been shown that PI3k/Akt can regulate NF-κB activation through IkB kinase complexes upstream of the signal [ 34 ] . However, it was not yet known whether the PI3k/Akt and NF-κB signaling pathways play an important role in chemerin-inducing myocardial fibrosis. In this study we found that chemerin increased the phosphorylation levels of the PI3k/Akt and NF-κB pathway. LY294002 not only inhibited the phosphorylation levels of PI3k, Akt and NF-κB, but also inhibited the expression of PCNA, that induced by chemerin. PDTC only inhibited the phosphorylation level NF-κB and the expression of PCNA. There was no significant change in PI3k and Akt activity. Therefore, our study demonstrated the involvement of PI3K/Akt pathway in chemerin induced NF-κB activation. However, further research is needed to elucidate the interactions between these complex regulatory pathways.Finally, the present study revealed that chemerin promotes cardiac fibroblast proliferation via the CMKLR1/PI3k/Akt/NF-κB signaling pathway. The main results are as follows: 1) The expression of chemerin, CMKLR1 and PCNA was increased in the multiplicative aldosterone- induced CFs model. 2)Chemerin promoted the proliferation of CFs by upregulating CMKLR1 receptors. 3) Chemerin mediated CFs proliferation through activation of the PI3k/AKT/NF-κB signaling pathway. A limitation of this study was the lack of clinical evidence and in vivo animal data. Robust in vivo testing must be performed to fully understand the proliferation properties of chemerin in CFs. Our data provided novel insights into chemerin CFs biology pertinent to myocardial fibrosis. Conclusion We revealed that chemerin promoted proliferation of CFs by upregulating the CMKLR1 receptors. We also found chemerin promoted proliferation of CFs through the PI3k/Akt/NF-κB signaling pathway. Chemerin will be expected to be a target for anti-myocardial fibrosis therapy. Declarations Acknowledgements Not applicable. Author’s contributions RuiCai:Writingoriginaldraft,Software,conception,studydesign,execution; RuifengCao:Software,conception; YanLiu:studydesign; NuoqiZhang:execution.; Yang Zhang:execution; Yaling Wang:Writing - review & Editing. Funding Hebei Provincial Natural Science Foundation Precision Medicine Joint Fund Cultivation Project（H2021206141） Data Availability The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Ethics approval and consent to participate The animal study was approved by the Ethics Committee of Hebei Medical University and conducted in accordance with an institutional policy of Hebei Medical University. Consent for publication Not applicable. Competing interests All authors declare that they have no conflict of interests. References SAIRA RAFAQAT. Adipokines and Their Role in Heart Failure: A Literature Review. J Innov Cardiac Rhythm Manage. 2023;14(11):5657–69. Kong WKF, Bax JJ, Delgado V. Left ventricular myocardial fibrosis: a marker of bad prognosis in symptomatic severe aortic stenosis. Eur Heart J. 2020;41:1915. Zhuang F, Ge Q, Qian J, et al. Antifibrotic Effect of a Novel Selective 11β-HSD2 Inhibitor (WZ51) in a rat Model of Myocardial Fibrosis. Front Pharmacol. 2021;12:629818. Wang YL, Jin X, Qiao L, et al. Aldosterone upregulates chemerin via chemokinelike receptor 1-Rho-ROCK-JNK signaling in cardiac fibroblasts[J]. Int J Clin Exp Med. 2017;10(4):6756–62. Fuller PJ, Yang J, Young MJ. Mechanisms of mineralocorticoid receptor signaling. Vitam Horm. 2019;109:37–68. Xiang Zhou Y, Tao Y, Chen, et al. Serum Chemerin as a Novel Prognostic Indicator in Chronic Heart Failure. J Am Heart Assoc. 2019;8:e012091. Helfer G, Wu QF. Chemerin: a multifaceted adipokine involved in metabolic disorders. J Endocrinol. 2018;238:R79–94. Xie Y, Huang Y, Ling X, et al. Chemerin/CMKLR1 Axis Promotes Inflammation and Pyroptosis by Activating NLRP3 Inflammasome in Diabetic Cardiomyopathy Rat. Front Physiol. 2020;11:381. Zhou X, Tao Y, Chen Y, Xu W, Qian Z, Lu X. Serum chemerin as a Novel prognostic indicator in chronic heart failure. J Am Heart Assoc. 2019;8:e012091. Rodriguez-Penas D, Feijoo-Bandin S, Garcia-Rua V, Mosquera-Leal A, Duran D, Varela A. et a. The adipokine chemerin induces apoptosis in cardiomyocytes. Cell Physiol Biochem 2015, 37, 176–92. Ping Kong P, Christia, Nikolaos G, Frangogiannis. The Pathogenesis of Cardiac Fibrosis. Cell Mol Life Sci 2014 Febr, 71(4): 549–74. Qin W, Cao L, Massey IY. Role of PI3k/Akt signaling pathway in cardiac fibrosis[J]. Mol Cell Biochem. 2021;476(11):4045–59. Ben DC, Mandi K, Frye M, et al. Chemerin regulates normal angiogenesis and hypoxia-driven neovascularization[J]. Angiogenesis. 2022;25(2):159–79. Li Y, Xia J, Jiang N, et al. Corin protects H(2)O(2)-induced apoptosis through PI3k/AKT and NF-kappaB pathway in cardiomyocytes[J]. Biomed Pharmacother. 2018;97:594–9. Xin S, Cheng Y, Zhang G et al. Chemerin in inflammatory diseases. j.cca.2021,517: 41–7. Jiang H, Ye XP, Yang ZY, et al. Aldosterone directly affects apelin expression and secretion in adipocytes[J]. J Mol Endocrinol. 2013;51(1):37–48. Ji Q, Lin Y, Liang Z, Yu K, Liu Y, Fang Z, et al. Chemerin Is a Novel Biomarker of Acute Coronary Syndrome but Not of Stable Angina Pectoris. Cardiovasc Diabetol. 2014;13:145. Zhang G, Xiao M, Zhang L, Zhao Y, Yang Q. Association of Serum Chemerin Concentrations with the Presence of Atrial Fibrillation. Ann Clin Biochem. 2017;54:342–7. Wójcik M, Kozioł-Kozakowska A, Januś D. Furtak,A.,Małek,A.,Sztefko,K.,etal. Circulating Chemerin Level May Be Associated with Early Vascular Pathology in Obese Children without Overt Arterial Hypertension - Preliminary Results. J Pediatr Endocrinol Metab. 2020;33:729–34. Mirjana T, Macvanin M, Rizzo J, Radovanovic, et al. Role of Chemerin in Cardiovascular Diseases. Biomedicines. 2022;10:2970. Strzalka W, Ziemienowicz A. Proliferating cell nuclear antigen (PCNA): a key factor in DNA replication and cell cycle regulation[J]. Ann Bot. 2011;107(7):1127–40. Crackower MA, Oudit GY, Kozieradzki I, et al. Regulation of myocardial contractility and cell size by distinct PI3k-PTEN signaling pathways[J]. Cell. 2002;110(6):737–49. McMullen JR, Shioi T, Zhang L, et al. Phosphoinositide 3-kinase(p110alpha) plays a critical role for the induction of physiological, but not pathological, cardiac hypertrophy[J]. Proc Natl Acad Sci U S A. 2003;100(21):12355–60. Liu C, Su T, Li F, et al. PI3k/Akt signaling transduction pathway is involved in rat vascular smooth muscle cell proliferation induced by apelin-13[J]. Acta Biochim Biophys Sin (Shanghai). 2010;42(6):396–402. Okada M, Oba Y, Yamawaki H. Endostatin stimulates proliferation and migration of adult rat cardiac fibroblasts through PI3k/Akt pathway[J]. Eur J Pharmacol. 2015;750:20–6. Yamamoto A, Sagara A, Otani K, et al. Chemerin-9 stimulates migration in rat cardiac fibroblasts in vitro[J]. Eur J Pharmacol. 2021;912:174566. Dimitriadis G, Kyrou I, Randeva H. Polycystic Ovary Syndrome as a Proinflammatory State: The Role of Adipokines. Curr Pharm Des. 2016;22:5535–46. Cheshire JL, Baldwin AS Jr.. Synergistic activation of NF-kappaB by tumor necrosis factor alpha and gamma interferon via enhanced I kappaB alpha degradation and de novo I kappaBbeta degradation. Mol Cell Biol. 1997;17:6746–54. Hsieh HL, Wu CB, Sun CC, Liao CH, Lau YT, Yang CM. Sphingosine-1-phosphate induces COX-2 expression via PI3K/Akt and p42/p44 MAPK pathways in rat vascular smooth muscle cells. J Cell Physiol. 2006;207:757–66. Wallén NH, Held C, Rehnqvist N, Hjemdahl P. Elevated serum intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 among patients with stable angina pectoris who suffer cardiovascular death or non-fatal acute myocardial infarction. Eur Heart J. 1999;20:1039–43. Blankenberg S, Barbaux S, Tiret L. Adhesion molecules and atherosclerosis. Atherosclerosis. 2003;170:191–203. Hart R, Greaves DR. Chemerin Contributes to Inflammation by Promoting Macrophage Adhesion to VCAM-1 and Fibronectin through Clustering of VLA-4 and VLA-5. J Immunol. 2010;185:3728–39. Georgios K, Dimitriadis J, Kaur R, Adya, et al. Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion. Oncotarget. 2018;9:16678–90. Bhattacharyya S, Sen P, Wallet M, et al. Immunoregulation of dendritic cells by IL-10 is mediated through suppression of the PI3k/Akt pathway and of IkappaB kinase activity[J]. Blood. 2004;104(4):1100–9. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4142000\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":284036728,\"identity\":\"0a6d6cf1-0dfc-402c-b507-00b9b5a818ba\",\"order_by\":0,\"name\":\"Rui Cai\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"the second Hospital of Hebei Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Rui\",\"middleName\":\"\",\"lastName\":\"Cai\",\"suffix\":\"\"},{\"id\":284036729,\"identity\":\"d74f2561-c95f-4801-88c1-38b40442e885\",\"order_by\":1,\"name\":\"Ruifeng Cao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"the second Hospital of Hebei Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ruifeng\",\"middleName\":\"\",\"lastName\":\"Cao\",\"suffix\":\"\"},{\"id\":284036730,\"identity\":\"d3093f21-a8db-46aa-9f15-7a80479b9029\",\"order_by\":2,\"name\":\"Yan Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"the second Hospital of Hebei Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yan\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":284036731,\"identity\":\"126a73c7-f8cb-4aa3-a2eb-850e340e1a3a\",\"order_by\":3,\"name\":\"Nuoqi Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hebei Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Nuoqi\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":284036732,\"identity\":\"0d686b88-01e4-40eb-8a31-4cb128cf3fdb\",\"order_by\":4,\"name\":\"Yang Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"the second Hospital of Hebei Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yang\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":284036733,\"identity\":\"9e798602-4c66-419f-bdf2-42ec832ace23\",\"order_by\":5,\"name\":\"Yaling Wang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABLklEQVRIie3RwUqEQBjA8ZEFT6ZXRcgeYURwCYxeZUSwi7ELQdeMBU/S2T33Au4l6OYysHuRvE7YYbeFfQEhLBZq1AqDWerYYf7gx+j4YxAB4PH+ZYMw+1zBdioqELv7jPV6k9AnCAAt+QP5WnUEkl8IXM6v8fgNG0PldrZ6rZ2RVU4Wz48ROJQJEqoxg+RuiKc32LxPthdmjPzju6fFmXUeAUsjaKAnDJJRchCXQkpyWwcIQ5sEtk6JmxIkDiQGKdYtOf0mVjJ6acjVXkLoKVJdumkRdwSqgdgQBPcQjTSnhO9eSkT6Lb4PVeIPreBBNaf5eqIziFx4uJJ2/kla4NmqdhyoJN52E1w6hrz05hWDHGV0CBEdKvqxoYL+L+tntE939FIy1j6Px+PxAPgARiN2WgbJG94AAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"the second Hospital of Hebei Medical University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Yaling\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-03-21 08:42:23\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4142000/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4142000/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":53881019,\"identity\":\"4fa4044f-5f2c-4675-911c-7550b0440c3b\",\"added_by\":\"auto\",\"created_at\":\"2024-04-01 17:50:35\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":358448,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eImmunofluorescence identification of CFs in SD rats.(A)The nucleus were stained with DAPI; (B)Green is the vimentin in the CFs; (C)DAPI and Vimentin staining complex diagram; Scale bar = 50 μm.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4142000/v1/3924f7bcc3208c11ae9b8afc.png\"},{\"id\":53881022,\"identity\":\"2e0fdac6-9cab-4c79-9a9e-7107db4c770a\",\"added_by\":\"auto\",\"created_at\":\"2024-04-01 17:50:35\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":170062,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe mRNA and protein expression levels of chemerin,CMKLR1 and PCNA are upregulated in aldosterone induced CFs. \\u003cstrong\\u003e(A)\\u003c/strong\\u003eThe mRNA expression levels of chemerin,CMKLR1 and PCNA ( **p \\u0026lt; 0.01 vs. the control group; *p\\u0026lt;0.05 vs. the control group). \\u003cstrong\\u003e(B–E)\\u003c/strong\\u003eWestern blot expression levels of chemerin, CMKLR1and PCNA ( **p \\u0026lt; 0.01vs. the control group). \\u003cstrong\\u003e(F and G)\\u003c/strong\\u003eAldosterone treats the cells for 24 h, EdU to detect cell proliferation, scale bar 100 µm.( ***P \\u0026lt; 0.001vs. the control group).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4142000/v1/14be2e75e76a5f52af89a736.png\"},{\"id\":53881017,\"identity\":\"384b6dec-dcc7-4289-bb95-874477dc412a\",\"added_by\":\"auto\",\"created_at\":\"2024-04-01 17:50:34\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":175520,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eChemerin promoted proliferation of CFs by upregulating the CMKLR1 receptors. CFs were stimulated with different concentrations of chemerin. The protein expression of CMKLR1\\u003cstrong\\u003e(A,B)\\u003c/strong\\u003e and PCNA\\u003cstrong\\u003e (A,C)\\u003c/strong\\u003e in CFs dealing with chemerin after 24 h( **p \\u0026lt; 0.01 vs. the control group ,*p\\u0026lt;0.05 vs. the control group). Chemerin treats the cells for 24 h, EdU to detect cell proliferation\\u003cstrong\\u003e(D,E)\\u003c/strong\\u003e, scale bar 100 µm. ( *p＜0.05 vs. the control group; **p＜0.01 vs. the control group; ***P \\u0026lt; 0.001 vs. the control group)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4142000/v1/a88b3e375983ac0fcfe40b1e.png\"},{\"id\":53881011,\"identity\":\"9d1dac1b-7d83-4473-8a88-20397c14afe6\",\"added_by\":\"auto\",\"created_at\":\"2024-04-01 17:50:32\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":148612,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eChemerin mediated CFs proliferation via the PI3k/AKT and NF-κB signaling pathway. CFs were pretreated with LY294002 (20 µM) 30 min prior to chemerin treatment (100 ng/ml). \\u003cstrong\\u003e(A-D)\\u003c/strong\\u003eWestern blot analysis of p-PI3K/PI3K, p-AKT/AKT and p-NF-κB/NF-κB expression in CFs after stimulation by chemerin with or without LY294002 pretreatment for 24 h(*p ＜ 0.05 vs. the control group; ##p ＜ 0.01 vs. the chemerin group). \\u003cstrong\\u003e(A,E)\\u003c/strong\\u003eWestern blot analysis of PCNA expression in chemerin-treated cells with or without LY294002 pretreatment for 24 h. (*p ＜ 0.05 vs. the control group; ##p ＜ 0.01 vs. the chemerin group). \\u003cstrong\\u003e(E,F)\\u003c/strong\\u003eCFs proliferation was measured by an EdU staining assay after 24 h of treatment (scale bars, 100μm) *p ＜ 0.05 vs. the control group; #p ＜ 0.05 vs. the chemerin group).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4142000/v1/77f3798fc7229f6ecda65a49.png\"},{\"id\":53881010,\"identity\":\"3307280e-d333-435e-b4e9-70be92651517\",\"added_by\":\"auto\",\"created_at\":\"2024-04-01 17:50:32\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":62266,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eNF-κB may be a downstream pathway of PI3/AKT. CFs were pretreated with PDTC (100 µM) 30 min prior to chemerin treatment (100 ng/ml). Western blot analysis of p-PI3k/PI3k(A,C), p-AKT/AKT(A,D) and p-NF-κB/NF-κB(A,B) expression in CFs after stimulation by chemerin with or without PDTC pretreatment for 24 h. (*p＜0.05 vs. the control group; **p＜0.01 vs. the control group;##p＜0.01 vs. the chemerin group)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4142000/v1/cd0f8b4fa8c0dadd19c1bedb.png\"},{\"id\":55532856,\"identity\":\"dcf49407-8f40-4ac2-916b-c23d4d753bc3\",\"added_by\":\"auto\",\"created_at\":\"2024-04-29 16:00:48\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1149870,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4142000/v1/d03d10ed-0e2c-4cd3-acd0-f0cc4d98ba93.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Chemerin Promotes Proliferation of Cardiac Fibroblasts via CMKLR1/PI3k/Akt/NF-κB Signaling Pathway\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eHeart failure (HF) is a disease with high morbidity, hospitalization and mortality. It is a growing public health problem that places a significant financial burden on the healthcare system[1]. HF is a complex clinical syndrome characterized by ventricular remodeling, cardiac dysfunction, and hemodynamic abnormalities. Myocardial fibrosis (MF) can lead to myocardial remodeling, making it an important pathological feature of HF[2]. Slowing the development of MF is an optimized strategy for reducing the risk of death from heart failure.\\u003c/p\\u003e \\u003cp\\u003eNumerous basic and clinical studies had shown that the pathogenesis of MF was closely related to the renin-angiotensin-aldosterone system. In recent years, aldosterone had been found to play an important role in promoting MF[3]. Our previous study[4] found that aldosterone promoted CFs proliferation and collagen deposition. Aldosterone-induced inflammation of myocardial tissue was characterized by the high expression of inflammatory factors prior to mononuclear macrophage infiltration and fibrosis[5]. Inflammatory factors were important early features of aldosterone- induced MF [3].\\u003c/p\\u003e \\u003cp\\u003eChemerin was a recently discovered adipokine that had been shown to be closely linked to inflammation, obesity, metabolic syndrome and cardiovascular disease[6]. The main function of chemerin was originally described as a regulator of glucolipid metabolic processes and inflammatory responses[7]. Research revealed that chemerin plays an important role in the inflammation, hypertrophy, pyroptosis and fibrosis that occurs in the heart tissue of rats with dilated cardiomyopathy[8]. In patients with type 2 diabetes, elevated serum chemerin levels had been associated with heart failure[9]. While chemerin had been shown to induce apoptosis of murine cardiomyocytes through inflammatory processes[10]. These results suggested that chemerin played an important role in heart failure by triggering cardiac inflammation.\\u003c/p\\u003e \\u003cp\\u003eCFs are enmeshed in the endomysial interstitial matrix that surrounds cardiomyocytes and represent the most abundant interstitial cells in the adult mammalian heart. Activated CFs are the main effector cells in MF[11].Our previous study revealed that chemerin and CMKLR1 are expressed in cardiomyocytes and CFs of rats. Meanwhile, our previous study indicated that aldosterone upregulates chemerin in CFs[4]. Chemerin can trigger heart inflammation. But it is not known whether it can also promote the proliferation of CFs.\\u003c/p\\u003e \\u003cp\\u003eThe PI3k/Akt and NF-κB signaling pathways played important roles in the cardiovascular system, making them a promising target for the treatment and prevention of heart failure[12]. Ben et al. found that chemerin regulates endothelial cell survival and neovascular stability via the PI3k/Akt signaling pathway[13]. The PI3k/Akt and NF-κB signaling pathways worked together to cause H2O2-induced cardiomyocyte damage[14]. However, it was still unknown that the PI3k/Akt and NF-κB pathways played an important role in chemerin-inducing myocardial fibrosis.\\u003c/p\\u003e \\u003cp\\u003eTherefore, we hypothesized that chemerin promotes the proliferation of CFs via the CMKLR1/PI3k/Akt/NF-κB signaling pathway and may be involved in MF. Our results will provide new data on the molecular mechanisms of chemerin leading to MF and cardiac remodeling.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cp\\u003eAnimals\\u003c/p\\u003e\\n\\u003cp\\u003eTwo hundred Sprague-Dawley (SD) rats (3 days old) were obtained from the Laboratory Animal Center of Hebei Medical University (Shijiazhuang, Hebei, China). The animal study was approved by the Ethics Committee of Hebei Medical University and conducted in accordance with an institutional policy of Hebei Medical University.\\u003c/p\\u003e\\n\\u003cp\\u003eCardiac fibroblast culture\\u003c/p\\u003e\\n\\u003cp\\u003eCFs were isolated from 3-day-old SD rats. First, the tissue at the cardiac apex of the SD rat was isolated and infused in 10 ml of phosphate-buffered saline (PBS) (Sigma Aldrich, St. Louis, MO) containing 0.05% trypsin (Sigma Aldrich, St. Louis, MO) and collagenase II (BioFroxx,CN) mixture for 5 minutes in the incubator at 37\\u0026deg;C. The process was repeated 6\\u0026ndash;8 times to obtain single cells. Isolated cells were pooled, the cells were then resuspended and filtered through a 75 \\u0026micro;m cell strainer and then centrifuged at 1000 rpm for 5 minutes. The cell pellet was resuspended in growth medium containing Dulbecco\\u0026apos;s Modified Eagle\\u0026apos;s Medium (DMEM) (Gibco, CN), 10% fetal bovine serum (CN), and 1% biantibody and incubated in a humidified atmosphere with 5% CO2 at 37\\u0026deg;C for 2 h. This allowed the CFs to bind preferentially to the dish, the non-adherent cells were discarded, the medium was changed and placed in the incubator until they were completely confluent. Cells were passaged with 0.05% trypsin-EDTA (Sigma Aldrich, St. Louis, MO). Second or third passage cardiac fibroblasts were used for experiments.\\u003c/p\\u003e\\n\\u003cp\\u003eImmunofluorescence staining\\u003c/p\\u003e\\n\\u003cp\\u003eImmunofluorescence staining was used to identify fibroblasts. After digestion, CFs were added to DMEM medium and resuspended, and the density was adjusted to 5 \\u0026times; 105 cells/mL. CFs were then seeded in 6-well plates at 37\\u0026deg;C in the incubator. When the cells were about 80% confluent. The bottom of the plate was washed three times with PBS for one minute and then fixed first with 4% paraformaldehyde at room temperature for 20 minutes and then with 0.1% Triton X-100 in PBS at room temperature for 15 minutes. CFs were finally blocked with 5% bovine serum albumin (BSA) solution and incubated with anti-vimentin antibody (1:200, TA600392, ORIGEE, US) at 4℃overnight in the dark. Subsequently, CFs were stained with 4`,6-diamidino- 2-phenylindole (DAPI) for 10 min and washed three times with PBS, and immunofluorescence analysis was performed using a confocal microscope (Zeiss, White Plains, NY, USA) under 400℃ performed \\u0026times; magnification.\\u003c/p\\u003e\\n\\u003cp\\u003eEdU Staining\\u003c/p\\u003e\\n\\u003cp\\u003eA EdU Cell Proliferation Kit with Alexa Fluro 488 was used for the cell proliferation assay. CFs are seeded in 6-well plates (5\\u0026times;10 4 cells/well) to evenly distribute the cell monolayer with 3 replicates per group of samples.Place in the cell culture incubator and incubate adherent for 24 h, then aspirate the old medium and add the working solution.After 24 hours of dosing treatment, 10 \\u0026micro;M EdU is added to each well and incubated for 2 hours, followed by fixation and washing.The nuclei were stained with Hoechst33342 for 10 min.Finally, the field of view was randomly obtained under an inverted fluorescence microscope, and the positive rate of EdU staining was calculated.\\u003c/p\\u003e\\n\\u003cp\\u003eReal-time quantitative PCR (RT-qPCR)\\u003c/p\\u003e\\n\\u003cp\\u003eTotal mRNA from treated CFs was extracted using the TransZol Up Plus RNA Kit (TransGen, CN). Reverse transcription was performed using Hiscript III RT SuperMix for qPCR (+\\u0026thinsp;gDNA Wiper). Of the obtained cDNA, 20 ng was provided for RT-PCR using ChamQ Universal SYBR qPCR Master Mix according to the manufacturer\\u0026apos;s instructions (Vazyme). The relative mRNA levels of chemerin, CMKLR1, and PCNA were estimated and normalized with actin mRNA levels. The sequences of the PCR primers were as follows in Table \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. The reaction parameters were as follows: 95℃ for 30 seconds, followed by 40 cycles of 95℃ for 10 seconds, then 60℃ for 10 seconds. Relative expression levels were calculated using the 2-\\u0026Delta;\\u0026Delta;CT method.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003ctable id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\n \\u003ccaption language=\\\"En\\\"\\u003e\\n \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\n \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\n \\u003cp\\u003ePrimers for RT-PCR.\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003c/caption\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGene\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eForward primer (5\\u0026rsquo;-3\\u0026rsquo;)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eReverse primer (5\\u0026rsquo;-3\\u0026rsquo;)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003echemerin\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCGGTGTGGACAGTGCTGATGAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eTCCGCTTCCTCCCATTTGGTTTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCMKLR1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGCACCAGCCACGGGAAGATAAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGATCAGGAAGCCACAGAGGAAGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003ePCNA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCGGCGTGAACCTACAGAGCATG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGCAGCGGTATGTGTCGAAGCC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWestern blot\\u003c/p\\u003e\\n\\u003cp\\u003eCFs proteins were extracted using the Nuclear Protein and Cell Cytoplasmic Protein Extraction Kit (No. P0027) and the protein concentration was determined. First, the SDS-PAGE gel was prepared, then the protein sample was carefully added to the gel wells for electrophoresis and then onto the membrane transfer membrane. Membranes were incubated overnight in primary antibody and washed three times in 0.1% Tween-20. TBS and then incubated in secondary antibody (1:1000) for one hour at room temperature, followed by five washes. The immunoreactive proteins were detected using an enhanced chemiluminescence system. The antibodies are listed in Table \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e.\\u003c/p\\u003e\\n\\u003cdiv class=\\\"gridtable\\\"\\u003e\\n \\u003ctable id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e\\n \\u003ccaption language=\\\"En\\\"\\u003e\\n \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e\\n \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\n \\u003cp\\u003eAntibodies for Western blot\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003c/caption\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eDilution\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eProduct code\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eBrand\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eanti-Akt antibody\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1: 1000\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e4685\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCst\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAnti-phospho-Akt antibody\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1: 1000\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e4060\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCst\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eanti-PI3k antibody\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1: 1000\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e4257\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCst\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAnti-phospho-PI3k antibody\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1: 1000\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e130868\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAbsin\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eanti-NF-\\u0026kappa;B antibody\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1: 1000\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e8242\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCst\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAnti-phospho-NF-\\u0026kappa;B antibody\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1: 1000\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e3033\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eCst\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eanti-PCNA antibody\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1: 1000\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAF0239\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAffinity\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eanti-Actin antibody\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e1: 10000\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAB0035\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eAbways\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n \\u003c/table\\u003e\\n\\u003c/div\\u003e\\n\\u003cp\\u003eStatistics\\u003c/p\\u003e\\n\\u003cp\\u003eThe SPSS 27.0 version for Windows was used for the statistical analyses. Data were displayed as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard error of the mean (SEM). Statistical analyzes were carried out using the Student t test. p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered significant.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003eImmunofluorescence identification of CFs.\\u003c/p\\u003e \\u003cp\\u003eThe cell nucleus of CFs stained blue with DAPI in immunofluorescence images (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA); Green is the vimentin in the CFs (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB); Complex diagram of DAPI and vimentin staining (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe expression of chemerin, CMKLR1 and PCNA were increased in aldosterone-induced CFs multiplicative model.\\u003c/p\\u003e \\u003cp\\u003eCFs were incubated at a concentration of 1*10\\u0026thinsp;\\u0026minus;\\u0026thinsp;7 mol/L aldosterone for 24 hours[4], then the mRNA and protein expression levels of chemerin, CMKLR1 and PCNA were measured. The mRNA levels of chemerin, CMKLR1 and PCNA were significantly higher in the aldosterone group than in the control group (**p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, *p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). The same results were confirmed by Western blot analysis (**p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB, C, D, E).The effect of aldosterone on CFs proliferation was examined by EdU. The results showed that aldosterone significantly promoted the proliferation of CFs as compared with the control group(***p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE,F).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eChemerin promoted proliferation of CFs by upregulating the CMKLR1 receptors.\\u003c/p\\u003e \\u003cp\\u003eCFs were treated with different concentrations of exogenous chemerin. The expression of CMKLR1 and PCNA was significantly increased in different chemerin concentration groups after 24 hours compared to the control group (**p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, *p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA,B,C). To further elucidate whether the chemerin promotes the proliferation of CFs, we conducted the EdU assay. As shown in Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e chemerin can significantly promote the proliferation of CFs measured by EdU compared to control group (50 ng/ml, 150 ng/ml, all **p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01;100 ng/ml, *p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05༛100 ng/ml, ***p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001 Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD,E).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eChemerin mediated CFs proliferation by activating the PI3k/Akt/ NF-κB signaling pathway\\u003c/p\\u003e \\u003cp\\u003eTo investigate the possible mechanism of chemerin-induced phenotypic changes in CFs, the key regulatory proteins in PI3k/Akt and NF-κB signaling pathways were analyzed by western blot. The ratios of p-PI3k/PI3k, p-Akt/Akt and p-NF-κB/NF-κB were significantly increased in the chemerin group compared to the control group (*p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA,B,C,D ). However, these ratios were decreased by LY294002, which was an inhibitor of PI3k/Akt signaling, compared to the chemerin group (##p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA,B,C,D). Furthermore, LY294002 can inhibit the expression of PCNA induced by chemerin (*p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 vs. control group, ##p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 vs. chemerin group, Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA,E).Similarly, The proliferation promoting effect of chemerin on CFs can be decreased by LY294002(*p \\u0026lt; 0.05 vs. control group,#p \\u0026lt; 0.05 vs. chemerin group, Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eF,G).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe NF-κB signaling inhibitor PDTC only reduced the p-NF-κB/NF-κB ratio compared to the chemerin group (##p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA,D). There was no significant difference in p-PI3k/PI3k and p-Akt/Akt ratios compared to the chemerin group. (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA,B,C)。\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eIn recent years, scientists' interest has been increasingly drawn to chemerin, which has recently been viewed as a vital protein with pleiotropic influence on the human organism\\u003csup\\u003e[\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]\\u003c/sup\\u003e. Therefore, the correct concentration of chemerin was certainly important for the proper functioning of the body. It has been confirmed that extremely higher serum levels of chemerin not only cause disorders of lipid metabolism and carbohydrate catabolism, but also promote increased insulin resistance and the risk of diseases caused by cardiovascular disorders\\u003csup\\u003e[\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]\\u003c/sup\\u003e. Evidence from several clinical studies suggests that circulating chemerin levels are associated with cardiovascular disease\\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR18\\\" citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]\\u003c/sup\\u003e. Xiang Zhou et al. found that chemerin could be a useful indicator for predicting MACEs in patients with chronic heart failure\\u003csup\\u003e[\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]\\u003c/sup\\u003e. Yebin Xie et al. found that chemerin and CMKLR1 expression were upregulated in serum, left ventricular myocardium and cardiomyocytes of rats with dilated cardiomyopathy\\u003csup\\u003e[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]\\u003c/sup\\u003e. The interaction between chemerin and its receptors was important for various cellular and signalling mechanisms in the cardiovascular, nervous, and reproductive systems. CMKLR-1 is the main chemerin receptor, and the chemerin/CMKLR1 axis promoteed chemotaxis of natural killers (NK), macrophages, and dendritic cells\\u003csup\\u003e[\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eOur early study found that aldosterone upregulates chemerin in CFs\\u003csup\\u003e[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]\\u003c/sup\\u003e. In this study, the expression of chemerin and CMKLR1 was increased in the aldosterone-induced multiplicative CF model. Therefore, we speculated that chemerin is associated with the proliferation of CFs, thereby promoting the development of myocardial fibrosis. We then confirmed our suspicion by administering it to chemerin in vitro. We found that CMKLR1 mRNA and protein were highly expressed in CFs and were also increased with increasing chemerin concentrations. PCNA was used in our study to assess CF proliferation. PCNA, first detected in late G1, was essential for cell cycle regulation\\u003csup\\u003e[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]\\u003c/sup\\u003e. At the optimal concentration of chemokin (100 ng/ml), PCNA expression was highest in CFs. Finally, we certified that chemerin promoted the proliferation of CFs through upregulation of CMKLR1 receptors.\\u003c/p\\u003e \\u003cp\\u003eThe PI3k/Akt signaling pathway played an important role in the cardiovascular system, such as cell survival, myocardial hypertrophy, myocardial contraction, electrophysiology and energy metabolism\\u003csup\\u003e[\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]\\u003c/sup\\u003e. Liu et al. found that apelin-13-induced rat vascular smooth muscle cell proliferation was closely related to the PI3k/Akt-ERK1/2 signaling pathway\\u003csup\\u003e[\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]\\u003c/sup\\u003e. Endostatin was activated at least partially by ros-dependent PI3k/Akt to stimulate proliferation and migration of adult rat CFs\\u003csup\\u003e[\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]\\u003c/sup\\u003e. These showed that PI3k/Akt may be involved in the proliferation of CFs in myocardial fibrosis. Some studies had also demonstrated the intrinsic connection between chemerin and the PI3k/Akt signaling pathway. Yamamoto et al. It was reported that chemerin significantly stimulated the phosphorylation of Akt. LY294002 inhibited the migration of chemerin-induced CFs\\u003csup\\u003e[\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]\\u003c/sup\\u003e.NF-κB was an important transcription factor in inflammatory responses and regulateed a variety of genes that were crucial for the development and progression of cardiovascular inflammation\\u003csup\\u003e[\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]\\u003c/sup\\u003e. Cheshire et al. demonstrated the importance of cytokine-induced synergistic activation of NF-кB in proinflammatory states\\u003csup\\u003e[\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]\\u003c/sup\\u003e. Recently, it was believed that deciphering NF- κB linked multiple signaling crosstalk was crucial for identifying new therapeutic targets in combating atherosclerosis and related pathologies. Activation of NF-кB signaling involved and influenced multiple signaling cascades, including MAPK and PI3K/Akt signaling pathways \\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR30 CR31\\\" citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]\\u003c/sup\\u003e. Experiments by Georgios K. demonstrated the involvement of MAPK and PI3K/Akt signaling pathways in chemerin-induced NF-κB activation\\u003csup\\u003e[\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]\\u003c/sup\\u003e. It had been shown that PI3k/Akt can regulate NF-κB activation through IkB kinase complexes upstream of the signal\\u003csup\\u003e[\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]\\u003c/sup\\u003e. However, it was not yet known whether the PI3k/Akt and NF-κB signaling pathways play an important role in chemerin-inducing myocardial fibrosis.\\u003c/p\\u003e \\u003cp\\u003eIn this study we found that chemerin increased the phosphorylation levels of the PI3k/Akt and NF-κB pathway. LY294002 not only inhibited the phosphorylation levels of PI3k, Akt and NF-κB, but also inhibited the expression of PCNA, that induced by chemerin. PDTC only inhibited the phosphorylation level NF-κB and the expression of PCNA. There was no significant change in PI3k and Akt activity. Therefore, our study demonstrated the involvement of PI3K/Akt pathway in chemerin induced NF-κB activation. However, further research is needed to elucidate the interactions between these complex regulatory pathways.Finally, the present study revealed that chemerin promotes cardiac fibroblast proliferation via the CMKLR1/PI3k/Akt/NF-κB signaling pathway. The main results are as follows: 1) The expression of chemerin, CMKLR1 and PCNA was increased in the multiplicative aldosterone- induced CFs model. 2)Chemerin promoted the proliferation of CFs by upregulating CMKLR1 receptors. 3) Chemerin mediated CFs proliferation through activation of the PI3k/AKT/NF-κB signaling pathway.\\u003c/p\\u003e \\u003cp\\u003eA limitation of this study was the lack of clinical evidence and in vivo animal data. Robust in vivo testing must be performed to fully understand the proliferation properties of chemerin in CFs. Our data provided novel insights into chemerin CFs biology pertinent to myocardial fibrosis.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eWe revealed that chemerin promoted proliferation of CFs by upregulating the CMKLR1 receptors. We also found chemerin promoted proliferation of CFs through the PI3k/Akt/NF-κB signaling pathway. Chemerin will be expected to be a target for anti-myocardial fibrosis therapy.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor\\u0026rsquo;s contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eRuiCai:Writingoriginaldraft,Software,conception,studydesign,execution; RuifengCao:Software,conception;\\u003c/p\\u003e\\n\\u003cp\\u003eYanLiu:studydesign;\\u003c/p\\u003e\\n\\u003cp\\u003eNuoqiZhang:execution.;\\u003c/p\\u003e\\n\\u003cp\\u003eYang Zhang:execution;\\u003c/p\\u003e\\n\\u003cp\\u003eYaling Wang:Writing - review \\u0026amp; Editing.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eHebei Provincial Natural Science Foundation Precision Medicine Joint Fund Cultivation Project（H2021206141）\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData Availability\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThe animal study was approved by the Ethics Committee of Hebei Medical University and conducted in accordance with an institutional policy of Hebei Medical University.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll authors declare that they have no conflict of interests.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eSAIRA RAFAQAT. Adipokines and Their Role in Heart Failure: A Literature Review. J Innov Cardiac Rhythm Manage. 2023;14(11):5657\\u0026ndash;69.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKong WKF, Bax JJ, Delgado V. Left ventricular myocardial fibrosis: a marker of bad prognosis in symptomatic severe aortic stenosis. Eur Heart J. 2020;41:1915.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhuang F, Ge Q, Qian J, et al. Antifibrotic Effect of a Novel Selective 11β-HSD2 Inhibitor (WZ51) in a rat Model of Myocardial Fibrosis. Front Pharmacol. 2021;12:629818.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang YL, Jin X, Qiao L, et al. Aldosterone upregulates chemerin via chemokinelike receptor 1-Rho-ROCK-JNK signaling in cardiac fibroblasts[J]. Int J Clin Exp Med. 2017;10(4):6756\\u0026ndash;62.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFuller PJ, Yang J, Young MJ. Mechanisms of mineralocorticoid receptor signaling. Vitam Horm. 2019;109:37\\u0026ndash;68.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXiang Zhou Y, Tao Y, Chen, et al. Serum Chemerin as a Novel Prognostic Indicator in Chronic Heart Failure. J Am Heart Assoc. 2019;8:e012091.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHelfer G, Wu QF. Chemerin: a multifaceted adipokine involved in metabolic disorders. J Endocrinol. 2018;238:R79\\u0026ndash;94.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXie Y, Huang Y, Ling X, et al. Chemerin/CMKLR1 Axis Promotes Inflammation and Pyroptosis by Activating NLRP3 Inflammasome in Diabetic Cardiomyopathy Rat. Front Physiol. 2020;11:381.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhou X, Tao Y, Chen Y, Xu W, Qian Z, Lu X. Serum chemerin as a Novel prognostic indicator in chronic heart failure. J Am Heart Assoc. 2019;8:e012091.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRodriguez-Penas D, Feijoo-Bandin S, Garcia-Rua V, Mosquera-Leal A, Duran D, Varela A. et a. The adipokine chemerin induces apoptosis in cardiomyocytes. Cell Physiol Biochem 2015, 37, 176\\u0026ndash;92.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePing Kong P, Christia, Nikolaos G, Frangogiannis. The Pathogenesis of Cardiac Fibrosis. Cell Mol Life Sci 2014 Febr, 71(4): 549\\u0026ndash;74.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eQin W, Cao L, Massey IY. Role of PI3k/Akt signaling pathway in cardiac fibrosis[J]. Mol Cell Biochem. 2021;476(11):4045\\u0026ndash;59.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBen DC, Mandi K, Frye M, et al. Chemerin regulates normal angiogenesis and hypoxia-driven neovascularization[J]. Angiogenesis. 2022;25(2):159\\u0026ndash;79.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi Y, Xia J, Jiang N, et al. Corin protects H(2)O(2)-induced apoptosis through PI3k/AKT and NF-kappaB pathway in cardiomyocytes[J]. Biomed Pharmacother. 2018;97:594\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXin S, Cheng Y, Zhang G et al. Chemerin in inflammatory diseases. j.cca.2021,517: 41\\u0026ndash;7.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJiang H, Ye XP, Yang ZY, et al. Aldosterone directly affects apelin expression and secretion in adipocytes[J]. J Mol Endocrinol. 2013;51(1):37\\u0026ndash;48.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJi Q, Lin Y, Liang Z, Yu K, Liu Y, Fang Z, et al. Chemerin Is a Novel Biomarker of Acute Coronary Syndrome but Not of Stable Angina Pectoris. Cardiovasc Diabetol. 2014;13:145.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang G, Xiao M, Zhang L, Zhao Y, Yang Q. Association of Serum Chemerin Concentrations with the Presence of Atrial Fibrillation. Ann Clin Biochem. 2017;54:342\\u0026ndash;7.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eW\\u0026oacute;jcik M, Kozioł-Kozakowska A, Januś D. Furtak,A.,Małek,A.,Sztefko,K.,etal. Circulating Chemerin Level May Be Associated with Early Vascular Pathology in Obese Children without Overt Arterial Hypertension - Preliminary Results. J Pediatr Endocrinol Metab. 2020;33:729\\u0026ndash;34.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMirjana T, Macvanin M, Rizzo J, Radovanovic, et al. Role of Chemerin in Cardiovascular Diseases. Biomedicines. 2022;10:2970.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eStrzalka W, Ziemienowicz A. Proliferating cell nuclear antigen (PCNA): a key factor in DNA replication and cell cycle regulation[J]. Ann Bot. 2011;107(7):1127\\u0026ndash;40.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCrackower MA, Oudit GY, Kozieradzki I, et al. Regulation of myocardial contractility and cell size by distinct PI3k-PTEN signaling pathways[J]. Cell. 2002;110(6):737\\u0026ndash;49.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMcMullen JR, Shioi T, Zhang L, et al. Phosphoinositide 3-kinase(p110alpha) plays a critical role for the induction of physiological, but not pathological, cardiac hypertrophy[J]. Proc Natl Acad Sci U S A. 2003;100(21):12355\\u0026ndash;60.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu C, Su T, Li F, et al. PI3k/Akt signaling transduction pathway is involved in rat vascular smooth muscle cell proliferation induced by apelin-13[J]. Acta Biochim Biophys Sin (Shanghai). 2010;42(6):396\\u0026ndash;402.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOkada M, Oba Y, Yamawaki H. Endostatin stimulates proliferation and migration of adult rat cardiac fibroblasts through PI3k/Akt pathway[J]. Eur J Pharmacol. 2015;750:20\\u0026ndash;6.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYamamoto A, Sagara A, Otani K, et al. Chemerin-9 stimulates migration in rat cardiac fibroblasts in vitro[J]. Eur J Pharmacol. 2021;912:174566.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDimitriadis G, Kyrou I, Randeva H. Polycystic Ovary Syndrome as a Proinflammatory State: The Role of Adipokines. Curr Pharm Des. 2016;22:5535\\u0026ndash;46.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCheshire JL, Baldwin AS Jr.. Synergistic activation of NF-kappaB by tumor necrosis factor alpha and gamma interferon via enhanced I kappaB alpha degradation and de novo I kappaBbeta degradation. Mol Cell Biol. 1997;17:6746\\u0026ndash;54.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHsieh HL, Wu CB, Sun CC, Liao CH, Lau YT, Yang CM. Sphingosine-1-phosphate induces COX-2 expression via PI3K/Akt and p42/p44 MAPK pathways in rat vascular smooth muscle cells. J Cell Physiol. 2006;207:757\\u0026ndash;66.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWall\\u0026eacute;n NH, Held C, Rehnqvist N, Hjemdahl P. Elevated serum intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 among patients with stable angina pectoris who suffer cardiovascular death or non-fatal acute myocardial infarction. Eur Heart J. 1999;20:1039\\u0026ndash;43.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBlankenberg S, Barbaux S, Tiret L. Adhesion molecules and atherosclerosis. Atherosclerosis. 2003;170:191\\u0026ndash;203.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHart R, Greaves DR. Chemerin Contributes to Inflammation by Promoting Macrophage Adhesion to VCAM-1 and Fibronectin through Clustering of VLA-4 and VLA-5. J Immunol. 2010;185:3728\\u0026ndash;39.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGeorgios K, Dimitriadis J, Kaur R, Adya, et al. Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion. Oncotarget. 2018;9:16678\\u0026ndash;90.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBhattacharyya S, Sen P, Wallet M, et al. Immunoregulation of dendritic cells by IL-10 is mediated through suppression of the PI3k/Akt pathway and of IkappaB kinase activity[J]. Blood. 2004;104(4):1100\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"chemerin, CMKLR1, PI3k/Akt, NF-κB, cardiac fibroblasts, myocardial fibrosis\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4142000/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4142000/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cstrong\\u003eBackground\\u003c/strong\\u003e:Chemerin expression has been documented to be increased in patients with heart failure (HF), animal models of myocardial fibrosis (MF), and proliferation of cardiac fibroblasts (CFs). However, the mechanisms underlying the chemerin high-proliferation processes in CFs remain unknown. The aim of this study was to elucidate the effects and mechanisms on chemerin that promote the proliferation of CFs.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMethods \\u003c/strong\\u003e: CFs were isolated from 3-day-old Sprague-Dawley (SD) rats and cultured. They were identified by immunofluorescence. Aldosterone-induced proliferation model of CFs. The role of chemerin on the proliferation of CFs were determined by EdU. PI3k/Akt/NF-κB signal transduction was inhibited by pretreatment with the PI3k/Akt/NF-κB inhibitor LY294002 and PDTC. real-time quantitative PCR（RT-qPCR）and Western blotting were used to test the expression of relevant genes.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eResults:\\u003c/strong\\u003eBy immunofluorescence staining of vimentin, the extracted cells can be identified as CFs.\\u003c/p\\u003e\\n\\u003cp\\u003eAldosterone induces the proliferation of CFs, we found that aldosterone promoted upregulation of chemerin, CMKLR1 and PCNA expression. And then we found that CMKLR1 expression was upregulated in CFs in response to exogenous chemerin stimulation, whereas the exogenous chemerin significantly promoted the proliferation of CFs. Mechanistically, exogenous chemerin increased the phosphorylated PI3k/Akt and NF-κB levels in CFs. Alternatively, blockade of PI3k/Akt and NF-κB inhibited the promoting proliferation effects of chemerin.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConclusions\\u003c/strong\\u003e: Our study found that chemerin promoted the proliferation of CFs through upregulation of CMKLR1 receptors. We also found that chemerin promotes the proliferation of CFs via the PI3k/Akt/NF-κB signaling pathway. Chemerin is expected to be a target for therapy against myocardial fibrosis.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Chemerin Promotes Proliferation of Cardiac Fibroblasts via CMKLR1/PI3k/Akt/NF-κB Signaling Pathway\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-04-01 17:50:21\",\"doi\":\"10.21203/rs.3.rs-4142000/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"ceab1879-1179-4c72-bcd7-417c10812b0c\",\"owner\":[],\"postedDate\":\"April 1st, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-04-29T14:29:38+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-04-01 17:50:21\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4142000\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4142000\",\"identity\":\"rs-4142000\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}