{"paper_id":"2b051046-b598-4c4d-b62a-03d6edffbbec","body_text":"Effect of Small Nuclear RNA 64 (SNORA64) on... | F1000Research <!-- --> <!-- --> <!-- This is commented out to fix display problems on mobile devices. We may use it again once we implement a responsive design that supports native device resolutions. --> \"use strict\";function _typeof(t){return(_typeof=\"function\"==typeof Symbol&&\"symbol\"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&\"function\"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?\"symbol\":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement(\"iframe\");r.style.cssText=\"display:none\",r.name=\"__tcfapiLocator\",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&\"boolean\"==typeof n[3]&&(e=n[3],\"function\"==typeof n[2]&&n[2](\"set\",!0)):\"ping\"===n[0]?\"function\"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:\"stub\"}):o.push(n)},n.addEventListener(\"message\",(function(t){var e=\"string\"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n=\"object\"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,\"*\")}),n.parameter)}),!1))};\"undefined\"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:[\"bam.nr-data.net\"]}}; ;NREUM.loader_config={accountID:\"438030\",trustKey:\"438030\",agentID:\"772317073\",licenseKey:\"97f8f67f26\",applicationID:\"772317073\"} ;NREUM.info={beacon:\"bam.nr-data.net\",errorBeacon:\"bam.nr-data.net\",licenseKey:\"97f8f67f26\",applicationID:\"772317073\",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{\"use strict\";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error(\"All info objects require an agent identifier!\");if(!a[e])throw new Error(\"Info for \".concat(e,\" was never set\"));return a[e]}function c(e,t){if(!e)throw new Error(\"All info objects require an agent identifier!\");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],\"info\")}var u=r(7056);const d=()=>{const e={blockSelector:\"[data-nr-block]\",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:\"*\",maskAllInputs:!0,get blockClass(){return\"nr-block\"},get ignoreClass(){return\"nr-ignore\"},get maskTextClass(){return\"nr-mask\"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=\",\".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error(\"All configuration objects require an agent identifier!\");if(!f[e])throw new Error(\"Configuration for \".concat(e,\" was never set\"));return f[e]}function h(e,t){if(!e)throw new Error(\"All configuration objects require an agent identifier!\");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],\"config\")}function g(e,t){if(!e)throw new Error(\"All configuration objects require an agent identifier!\");var r=l(e);if(r){for(var n=t.split(\".\"),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||\"object\"!=typeof e)return(0,n.Z)(\"Setting a Configurable requires an object as input\");if(!t||\"object\"!=typeof t)return(0,n.Z)(\"Setting a Configurable requires a model to set its initial properties\");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{\"object\"==typeof e[a]&&\"object\"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)(\"An error occurred while setting a property of a Configurable\",e)}return r}catch(e){(0,n.Z)(\"An error occured while setting a Configurable\",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n=\"1.236.0\",i=\"PROD\",o=\"CDN\"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n=\"undefined\"!=typeof window&&!!window.document,i=\"undefined\"!=typeof WorkerGlobalScope&&(\"undefined\"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||\"undefined\"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:\"undefined\"!=typeof WorkerGlobalScope&&(\"undefined\"!=typeof self&&self instanceof WorkerGlobalScope&&self||\"undefined\"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=\"\"+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&\"undefined\"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\\s](\\d+\\.\\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:\"\",ee:void 0};class o{constructor(e){try{if(\"object\"!=typeof e)return(0,n.Z)(\"shared context requires an object as input\");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)(\"An error occured while setting SharedContext\",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:\"\",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:\"feature\";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s=\"nr@context\";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&\"object\"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;f<d;f++)s[f].apply(a,r);var l=T()[c[e]];return l&&l.push([p,e,r,a]),a}}function b(e,t){n[e]=w(e).concat(t)}function y(e,t){var r=n[e];if(r)for(var i=0;i {r.d(t,{E:()=>n,p:()=>i});var n=r(2177).ee.get(\"handle\");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o=\"feature\"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener(\"test\",null,e),n._A.removeEventListener(\"test\",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i=\"xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx\";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split(\"\").map((e=>\"x\"===e?o(t,++r).toString(16):\"y\"===e?(3&o()|8).toString(16):e)).join(\"\")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n=\"NRBA\",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||\"\").indexOf(\"data:\"))return{protocol:\"data\"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement(\"a\"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split(\"://\");!o.port&&a[1]&&(o.port=a[1].split(\"/\")[0].split(\"@\").pop().split(\":\")[1]),o.port&&\"0\"!==o.port||(o.port=\"https\"===a[0]?\"443\":\"80\"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],\"/\"!==o.pathname.charAt(0)&&(o.pathname=\"/\"+o.pathname);var s=!t.protocol||\":\"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),\"/\"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){\"function\"==typeof console.warn&&(console.warn(\"New Relic: \".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&\"object\"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)(\"feat-\"+t,[],void 0,e,r):(0,i.p)(\"block-\"+t,[],void 0,e,r),(0,i.p)(\"rumresp-\"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)(\"feat-\"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)(\"rumresp-\"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if(\"object\"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit(\"internal-error\",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return\"undefined\"==typeof document||\"complete\"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)(\"load\",e,t)}function a(e){if(i())return e();(0,n.iz)(\"DOMContentLoaded\",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:\"bam.nr-data.net\",errorBeacon:\"bam.nr-data.net\"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)(\"visibilitychange\",(function(){if(t)return void(\"hidden\"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i=\"nr@original\";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n=\"\");var a,s,c,u=\"-\"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,\"fetch\",y),t.on(y+\"end\",(function(e,r){var n=this;if(r){var i=r.headers.get(\"content-length\");null!==i&&(n.rxSize=i),t.emit(y+\"done\",[null,r],n)}else t.emit(y+\"done\",[e],n)})),t}const O={},j=[\"pushState\",\"replaceState\"];function S(e){const t=function(e){return(e||n.ee).get(\"history\")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,\"-\")),t}var P=r(3239);const C={},R=[\"appendChild\",\"insertBefore\",\"replaceChild\"];function I(e){const t=function(e){return(e||n.ee).get(\"jsonp\")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\\.([^.]+)/,a=/^(\\w+)(\\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,\"dom-\"),t.on(\"dom-start\",(function(e){!function(e){if(!e||\"string\"!=typeof e.nodeName||\"script\"!==e.nodeName.toLowerCase())return;if(\"function\"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if(\"function\"!=typeof u.parent[u.key])return;var d={};function f(){t.emit(\"jsonp-end\",[],d),e.removeEventListener(\"load\",f,(0,P.m$)(!1)),e.removeEventListener(\"error\",l,(0,P.m$)(!1))}function l(){t.emit(\"jsonp-error\",[],d),t.emit(\"jsonp-end\",[],d),e.removeEventListener(\"load\",f,(0,P.m$)(!1)),e.removeEventListener(\"error\",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],\"cb-\",d),e.addEventListener(\"load\",f,(0,P.m$)(!1)),e.addEventListener(\"error\",l,(0,P.m$)(!1)),t.emit(\"new-jsonp\",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get(\"mutation\")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,\"fn-\")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get(\"promise\")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,\"executor-\",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,\"name\",{value:\"Promise\"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),[\"all\",\"race\"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a(\"all\"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit(\"propagate\",[null,!i],o,!1,!1),i=i||!e}}}})),[\"resolve\",\"reject\"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit(\"propagate\",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,[\"onreadystatechange\"],\"fn-\",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit(\"xhr-resolved\",[],e)),i.inPlace(e,f,\"fn-\",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,\"-xhr-\",E),r.on(\"send-xhr-start\",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on(\"open-xhr-start\",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on(\"fn-end\",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i=\"nr@seenError\"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i=\"sm\",o=\"cm\",a=\"storeSupportabilityMetrics\",s=\"storeEventMetrics\"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i=\"firstbyte\",o=\"domcontent\",a=\"windowload\"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i=\"bstResource\",o=\"resource\",a=\"-start\",s=\"-end\",c=\"fn\"+a,u=\"fn\"+s,d=\"pushState\"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=[\"click\",\"submit\",\"keypress\",\"keydown\",\"keyup\",\"change\"],a=999,s=\"fn-start\",c=\"fn-end\",u=\"cb-start\",d=\"api-ixn-\",f=\"remaining\",l=\"interaction\",h=\"spaNode\",g=\"jsonpNode\",p=\"fetch-start\",m=\"fetch-done\",v=\"fetch-body-\",b=\"jsonp-end\",y=n.Yu.ST,w=\"-start\",x=\"-end\",A=\"-body\",E=\"cb\"+x,T=\"jsTime\",_=\"fetch\"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();[\"setErrorHandler\",\"finished\",\"addToTrace\",\"inlineHit\",\"addRelease\",\"addPageAction\",\"setCurrentRouteName\",\"setPageViewName\",\"setCustomAttribute\",\"interaction\",\"noticeError\",\"setUserId\"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,\"api\");const h={};var g=a.ee.get(e),p=g.get(\"tracer\"),m=\"api-\",v=m+\"ixn-\";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?\"session\":void 0)(t,r)}function y(){}[\"setErrorHandler\",\"finished\",\"addToTrace\",\"inlineHit\",\"addRelease\"].forEach((e=>h[e]=x(m,e,!0,\"api\"))),h.addPageAction=x(m,\"addPageAction\",!0,n.D.pageAction),h.setCurrentRouteName=x(m,\"routeName\",!0,n.D.spa),h.setPageViewName=function(t,r){if(\"string\"==typeof t)return\"/\"!==t.charAt(0)&&(t=\"/\"+t),(0,i.OP)(e).customTransaction=(r||\"http://custom.transaction\")+t,x(m,\"setPageViewName\",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if(\"string\"==typeof e){if([\"string\",\"number\"].includes(typeof t)||null===t)return b(e,t,\"setCustomAttribute\",r);(0,f.Z)(\"Failed to execute setCustomAttribute.\\nNon-null value must be a string or number type, but a type of was provided.\"))}else(0,f.Z)(\"Failed to execute setCustomAttribute.\\nName must be a string type, but a type of was provided.\"))},h.setUserId=function(e){if(\"string\"==typeof e||null===e)return b(\"enduser.id\",e,\"setUserId\",!0);(0,f.Z)(\"Failed to execute setUserId.\\nNon-null value must be a string type, but a type of was provided.\"))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a=\"function\"==typeof t;return(0,o.p)(v+\"tracer\",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?\"\":\"no-\")+\"fn-start\",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit(\"fn-err\",[arguments,this,\"string\"==typeof e?new Error(e):e],r),e}finally{p.emit(\"fn-end\",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,[\"API/\"+t+\"/called\"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,\"api\")})).catch((()=>(0,f.Z)(\"Downloading runtime APIs failed...\")))}return[\"actionText\",\"setName\",\"setAttribute\",\"save\",\"ignore\",\"onEnd\",\"getContext\",\"end\",\"get\"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){\"string\"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,[\"API/noticeError/called\"],void 0,n.D.metrics,g),(0,o.p)(\"err\",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,\"api\"),(0,h.Qy)(e,A,\"exposed\"),(0,h.EZ)(\"activatedFeatures\",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:\"ajax\",jserrors:\"jserrors\",metrics:\"metrics\",pageAction:\"page_action\",pageViewEvent:\"page_view_event\",pageViewTiming:\"page_view_timing\",sessionReplay:\"session_replay\",sessionTrace:\"session_trace\",spa:\"spa\"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:\"page_action-aggregate\",147:\"metrics-aggregate\",242:\"session-manager\",317:\"jserrors-aggregate\",348:\"page_view_timing-aggregate\",412:\"lazy-feature-loader\",439:\"async-api\",538:\"recorder\",590:\"session_replay-aggregate\",675:\"compressor\",733:\"session_trace-aggregate\",786:\"page_view_event-aggregate\",873:\"spa-aggregate\",898:\"ajax-aggregate\"}[e]||e)+\".\"+{78:\"ac76d497\",147:\"3dc53903\",148:\"1a20d5fe\",242:\"2a64278a\",317:\"49e41428\",348:\"bd6de33a\",412:\"2f55ce66\",439:\"30bd804e\",538:\"1b18459f\",590:\"cf0efb30\",675:\"ae9f91a8\",733:\"83105561\",786:\"06482edd\",860:\"03a8b7a5\",873:\"e6b09d52\",898:\"998ef92b\"}[e]+\"-1.236.0.min.js\"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t=\"NRBA:\",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName(\"script\"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:\"timeout\",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{\"undefined\"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:\"Module\"}),Object.defineProperty(e,\"__esModule\",{value:!0})},i.j=364,i.p=\"https://js-agent.newrelic.com/\",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&(\"load\"===r.type?\"missing\":r.type),a=r&&r.target&&r.target.src;s.message=\"Loading chunk \"+t+\" failed.\\n(\"+o+\": \"+a+\")\",s.name=\"ChunkLoadError\",s.type=o,s.request=a,n[1](s)}}),\"chunk-\"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,\"\".concat(e,\".enabled\"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,\"privacy.cookies_enabled\");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)(\"A problem occurred when starting up session manager. This page will not start or extend any session.\",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,\"aggregate\");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)(\"Downloading and initializing \".concat(this.featureName,\" failed...\"),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,\"session_trace.enabled\")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),(\"undefined\"==typeof PerformanceNavigationTiming||c.Tt)&&\"undefined\"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)(\"timing\",[\"load\",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if(\"count\"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r=\"\",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean(\"hidden\"===document.visibilityState),(0,N.N)((()=>(0,s.p)(\"docHidden\",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)(\"pagehide\",(()=>(0,s.p)(\"winPagehide\",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem(\"__nr_flags\").split(\",\"),console&&\"function\"==typeof console.log&&(L.console=!0,-1!==R.indexOf(\"dev\")&&(L.dev=!0),-1!==R.indexOf(\"nr_dev\")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on(\"internal-error\",(function(e){z(e.stack)})),L.dev&&H.ee.on(\"fn-err\",(function(e,t,r){z(r.stack)})),L.dev&&(z(\"NR AGENT IN DEVELOPMENT MODE\"),z(\"flags: \"+(0,b.D)(L,(function(e,t){return e})).join(\", \")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on(\"fn-start\",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on(\"fn-err\",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)(\"err\",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on(\"fn-end\",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on(\"internal-error\",(function(t){(0,s.p)(\"ierr\",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener(\"unhandledrejection\",(t=>{const r=function(e){let t=\"Unhandled Promise Rejection: \";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)(\"err\",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){\"function\"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)(\"err\",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)(\"ierr\",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||\"Uncaught error with no additional information\",this.sourceURL=t,this.line=r}let U=1;const q=\"nr@id\";function G(e){const t=typeof e;return!e||\"object\"!==t&&\"function\"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if(\"string\"==typeof e&&e.length)return e.length;if(\"object\"==typeof e){if(\"undefined\"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if(\"undefined\"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!(\"undefined\"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||\"\").toString()||null,i=(r.agentID||\"\").toString()||null,o=(r.trustKey||\"\").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return\"00-\"+t+\"-\"+e+\"-01\"}generateTraceContextStateHeader(e,t,r,n,i){return i+\"@nr=0-1-\"+r+\"-\"+n+\"-\"+e+\"----\"+t}generateTraceHeader(e,t,r,n,i,o){if(!(\"function\"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:\"Browser\",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,\"distributed_tracing\")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener(\"load\",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener(\"progress\",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader(\"X-NewRelic-ID\",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader(\"newrelic\",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader(\"traceparent\",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader(\"tracestate\",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{\"abort\"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),(\"load\"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||\"function\"!=typeof t.onload)&&\"function\"==typeof o.end)&&o.end(t)}catch(e){try{n.emit(\"internal-error\",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set(\"newrelic\",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set(\"traceparent\",t.traceContextParentHeader),t.traceContextStateHeader&&e.set(\"tracestate\",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;\"string\"==typeof i?r=i:\"object\"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&\"object\"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(\"\"+(i&&i instanceof Y&&i.method||n.method||\"GET\")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,\"string\"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i(\"xhr\",[this.params,o,this.startTime,this.endTime,\"fetch\"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||\"agent\")),this.start()):(0,l.Z)(\"Failed to initial the agent. Could not determine the runtime environment.\")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t=\"features\";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)(\"\".concat(t.featureName,\" is enabled but one or more dependent features has been disabled (\").concat((0,D.P)(n),\"). This may cause unintended consequences or missing data...\")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)(\"Failed to initialize all enabled instrument classes (agent aborted) -\",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)(\"bst\",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)(\"bstHist\",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get(\"tracer\"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get(\"events\"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit(\"newURL\",[\"\"+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,\"xhr-resolved\"],this.featureName),f.buffer([ve],this.featureName),u.buffer([\"setTimeout\"+le,\"clearTimeout\"+fe,ve],this.featureName),d.buffer([ve,\"new-xhr\",\"send-xhr\"+fe],this.featureName),l.buffer([me+fe,me+\"-done\",me+he+fe,me+he+le],this.featureName),h.buffer([\"newURL\"],this.featureName),g.buffer([ve],this.featureName),s.buffer([\"propagate\",be,ge,\"executor-err\",\"resolve\"+fe],this.featureName),o.buffer([ve,\"no-\"+ve],this.featureName),a.buffer([\"new-jsonp\",\"cb-start\",\"jsonp-error\",\"jsonp-end\"],this.featureName),y(l,me+fe),y(l,me+\"-done\"),y(a,\"new-jsonp\"),y(a,\"jsonp-end\"),y(a,\"cb-start\"),h.on(\"pushState-end\",m),h.on(\"replaceState-end\",m),window.addEventListener(\"hashchange\",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener(\"load\",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener(\"popstate\",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:\"spa\"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is \"complete\" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event \"completion\" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', \"PixelInitialized\", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { \"@context\": \"https://schema.org\", \"@type\": \"ScholarlyArticle\", \"mainEntityOfPage\": { \"@type\": \"WebPage\", \"@id\": \"https://f1000research.com/articles/15-68\" }, \"headline\": \"Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro\", \"datePublished\": \"2026-01-16T11:57:26\", \"dateModified\": \"2026-05-12T07:37:32\", \"author\": [ { \"@type\": \"Person\", \"name\": \"Rana Alfardan\" } ], \"publisher\": { \"@type\": \"Organization\", \"name\": \"F1000Research\", \"logo\": { \"@type\": \"ImageObject\", \"url\": \"https://f1000research.com/img/AMP/F1000Research_image.png\", \"height\": 480, \"width\": 60 } }, \"image\": { \"@type\": \"ImageObject\", \"url\": \"https://f1000research.com/img/AMP/F1000Research_image.png\", \"height\": 1200, \"width\": 150 }, \"description\": \" Background Pancreatic cancer has a poor prognosis and is highly aggressive and deadly. Most pancreatic cancer diagnoses are adenocarcinomas, which account for more than 90 % of all cases. Developing effective therapeutic strategies requires an understanding of the molecular mechanisms associated with pancreatic cancer progression. Small nucleolar RNA 64 (SNORA64) was presented as a predictive marker for pancreatic cancer stages in our previous study. SNORA64 showed a gradual loss of its expression throughout the carcinogenesis process, and it inhibited metastasis by interfering with epithelial to mesenchymal transition (EMT). In this study, we investigated the role of SNORA64 on an intrinsic apoptotic pathway in pancreatic cancers by using human pancreatic cell line derived from adenocarcinoma PK-8 with SNORA64 knockdown and the scramble to compare with. Methods QPCR techniques used to measure the gene expression level of apoptosis related genes and cell viability analyzer are implanted in this study as investigational methods. Results Pk-8 with low expression of SNORA64 shows significantly high expression of anti-apoptotic genes B-cell leukemia/lymphoma-2 (BCl2) and B-cell lymphoma-extra-large (BCL-Xl) in contrast to the scramble control cell line. Conversely, the pro-apoptotic genes BH3 interacting domain death agonist (BID), BCL2 Associated X (BAX), and BCL2 homologous antagonist/killer (BAK) show significantly low expression compared to the scramble control. However, there is no change in the expression of BAD and BIM in Pk-8 with SNORA64 knockdown compared to the scrambled control cell line. Furthermore, the Pk-8 with low expression of SNORA64 shows a significant high proliferation rate and viability percentage compared to the scramble control cell line. Conclusion The downregulation of SNORA64 affects apoptosis pathways by manipulating pro- and anti-apoptotic gene regulators. The SNORA64 interactions with apoptotic inhibitor molecules and downregulation of pro-apoptotic molecules significantly sustain cellular viability. Therefore; SNORA64 can be used to increase the cell sensitivity to death during treatment. \" } { \"@context\": \"http://schema.org\", \"@type\": \"BreadcrumbList\", \"itemListElement\": [ { \"@type\": \"ListItem\", \"position\": \"1\", \"item\": { \"@id\": \"https://f1000research.com/\", \"name\": \"Home\" } }, { \"@type\": \"ListItem\", \"position\": \"2\", \"item\": { \"@id\": \"https://f1000research.com/browse/articles\", \"name\": \"Browse\" } }, { \"@type\": \"ListItem\", \"position\": \"3\", \"item\": { \"@id\": \"https://f1000research.com/articles/15-68/v1\", \"name\": \"Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes...\" } } ] } Home Browse Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Alfardan R. Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2026, 15 :68 ( https://doi.org/10.12688/f1000research.173746.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 1; peer review: 1 approved with reservations, 1 not approved] Rana Alfardan https://orcid.org/0000-0002-2859-9073 Rana Alfardan https://orcid.org/0000-0002-2859-9073 PUBLISHED 16 Jan 2026 Author details Author details Community Health Techniques Department, Southern Technical University, Basrah, Basrah, 61004, Iraq Rana Alfardan Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Resources, Software, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the Cell & Molecular Biology gateway. This article is included in the Oncology gateway. Abstract Background Pancreatic cancer has a poor prognosis and is highly aggressive and deadly. Most pancreatic cancer diagnoses are adenocarcinomas, which account for more than 90 % of all cases. Developing effective therapeutic strategies requires an understanding of the molecular mechanisms associated with pancreatic cancer progression. Small nucleolar RNA 64 (SNORA64) was presented as a predictive marker for pancreatic cancer stages in our previous study. SNORA64 showed a gradual loss of its expression throughout the carcinogenesis process, and it inhibited metastasis by interfering with epithelial to mesenchymal transition (EMT). In this study, we investigated the role of SNORA64 on an intrinsic apoptotic pathway in pancreatic cancers by using human pancreatic cell line derived from adenocarcinoma PK-8 with SNORA64 knockdown and the scramble to compare with. Methods QPCR techniques used to measure the gene expression level of apoptosis related genes and cell viability analyzer are implanted in this study as investigational methods. Results Pk-8 with low expression of SNORA64 shows significantly high expression of anti-apoptotic genes B-cell leukemia/lymphoma-2 (BCl2) and B-cell lymphoma-extra-large (BCL-Xl) in contrast to the scramble control cell line. Conversely, the pro-apoptotic genes BH3 interacting domain death agonist (BID), BCL2 Associated X (BAX), and BCL2 homologous antagonist/killer (BAK) show significantly low expression compared to the scramble control. However, there is no change in the expression of BAD and BIM in Pk-8 with SNORA64 knockdown compared to the scrambled control cell line. Furthermore, the Pk-8 with low expression of SNORA64 shows a significant high proliferation rate and viability percentage compared to the scramble control cell line. Conclusion The downregulation of SNORA64 affects apoptosis pathways by manipulating pro- and anti-apoptotic gene regulators. The SNORA64 interactions with apoptotic inhibitor molecules and downregulation of pro-apoptotic molecules significantly sustain cellular viability. Therefore; SNORA64 can be used to increase the cell sensitivity to death during treatment. READ ALL READ LESS Keywords Apoptosis, Pancreatic Cancer, Cellular viability, Regulator genes, SNORA64 Corresponding Author(s) Rana Alfardan ( [email protected] ) Close Corresponding author: Rana Alfardan Competing interests: No competing interests were disclosed. Grant information: This work was partially supported by Southern Technical University under scientific research awards, No. 9/7934, 10 Sep. 2025. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2026 Alfardan R. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Alfardan R. Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2026, 15 :68 ( https://doi.org/10.12688/f1000research.173746.1 ) First published: 16 Jan 2026, 15 :68 ( https://doi.org/10.12688/f1000research.173746.1 ) Latest published: 12 May 2026, 15 :68 ( https://doi.org/10.12688/f1000research.173746.3 )  There is a newer version of this article available. Suppress this message for one day. 1. Introduction This Adenocarcinoma and neuroendocrine pancreatic cancer are two major types of pancreatic cancer. Most pancreatic cancer diagnoses are adenocarcinomas, which account for more than 90 % of all cases and originate in the pancreas’ duct lining. 1 There are limited treatment options for pancreatic cancer, because of its aggressive and lethal nature, it has a dismal prognosis. In order to develop effective therapeutic strategies for pancreatic cancer, it is essential to understand the molecular mechanisms involved in its progression. 2 Cancer cells, however, are often able to escape cell death and continue to proliferate in pancreatic cancer due to the deregulation of the apoptosis pathway. 1 The process of apoptosis, or programmed cell death, maintains tissue homeostasis and prevents cancer triggered by several stimuli. During early development and in pathophysiological conditions, programmed cell death plays a key role in maintaining morphogenetic homeostasis. 3 The development and progression of cancer are associated with the deregulation of different apoptotic components. 2 Apoptosis requires the activation of distinct signaling pathways that are frequently deregulated by cancer, such as tumor suppressor P53. 3 P53 is the most common genetic alteration found in clinical tumor samples, and there’s a positive statistical association between its expression and apoptosis. 4 It may therefore be possible to track the progression of cancer by investigating the single or multiple apoptotic components involved in its expression during carcinogenesis. 2 DNA damage and oxidative stress are examples of internal, or so-called mitochondrial stimuli that can also affect apoptosis (as well as external stimuli). 2 , 3 In the intrinsic apoptotic pathway, members of the B-cell leukemia/lymphoma-2 (BCl2) family include groups of genes known as pro- or antiapoptotic proteins. Apoptosis activation is relatively dependent on the balance between the expression of these genes. There are anti-apoptotic regulators (BCl2, BCL-XL, BCLDW, and MCL-1), pro-apoptotic BH3-only regulators that act as apoptotic sensitizers (BAD, NOXA, HRK, BIK, BMF), pro-apoptotic BH3-only regulators that act as apoptotic activators (BID, BIM, and PUMA), and pore-forming regulators that act as effectors (BAX, BAK). 3 Specifically, the BCl2 family of proteins is responsible for regulating mitochondrial outer membrane permeabilization. Any change in mitochondrial outer membrane permeabilization leads to the irreversible release of intermembrane space proteins such as Cytochrome c (Cyt.c). 5 The latter is a water-soluble protein released from the mitochondrial membrane in the cytoplasm and initiates the executive apoptotic pathways, such as activates the execution pathway mediated by caspase enzymes. Several cancer types have been associated with Cyt.c as a prognostic indicator of apoptosis, based on the data available so far. Researchers discovered that NS398 medications were linked to the suppression of Cyclo-oxygenase-2 (COX-2) production in esophageal cancer cells via a cyt. c-dependent pathway. 6 In a similar study, teniposide increased Cyt. c expression in a dose-dependent manner, indicating that it affected anticancer drug resistance and induced programmed cell death in cancerous cells. Upon release from the mitochondrial membrane in the cytoplasm, Cyt. c activates procaspase-9 which has a proteolytic activity. 7 In the intrinsic apoptosis pathway, procaspase-9 is an initiator caspase that is present in a monomer form and consists of three domains. 3 In the event of caspase-9 activation, it cleaves and activates executor caspase-3. It is known that caspase-3, a major component of the execution pathway, cleaves DNAase inhibitors and proteins of the cytoskeleton, causing the fragmentation of cells. 3 , 8 It is believed that caspase-3 participates in proteolytic series by activating caspases -6, -7, and -9 to facilitate the disintegration of the apoptotic cells prior to their removal by phagocytosis. 3 Generally, cell death results from the execution pathway, which is demonstrated by blebbing membranes, DNA disintegration condensed chromosomes, and cell shrinkage. Evidence suggests that deregulation of specific caspases enhances the tumorigenic potential of cells. 9 One of the most prominent examples of non-coding RNAs (ncRNAs) are small nucleolar RNAs (snoRNAs). snoRNA is a small RNA molecule that typically consists of 60 to 300 nucleotides and is found primarily in the nucleus of a cell. 10 In the late 1970s, snoRNA’s primary role was uncovered in research to ensure that ribosomes, the cellular machinery that synthesizes proteins, are assembled and function correctly. 11 In recent years, researchers have covered a wide variety of regulatory processes, including transcription, post-transcriptional modification, and translation. However, it was found that snoRNA was significantly downregulated in meningiomas compared with normal brain tissue. This led to further investigation of the potential role of snoRNA in cancer. 12 Clinical samples and cell lines have also shown that snoRNAs are expressed in a variety of malignancies, indicating that they may be used as prognostic and diagnostic indicators for diseases including breast cancer and non-small cell lung cancer (NSCLC). Among the snoRNAs that are frequently overexpressed in breast cancer, prostate cancer, and lung cancer, SNORA42, SNORD15A, SNORD15B, SNORD22, SNORD17, and SNORD87 have been demonstrated to correlate with tumorigenicity, highlighting snoRNA’s significance in regulating cancer biology. 13 As demonstrated by the strong correlation between a poor clinical outcome and increased SNORD52 expression in hepatocellular carcinoma (HCC). SNORD52 increases the stability of the CDK1 protein, which in turn promotes the development of HCC. Therefore; targeting the Upf1/SNORD52/CDK1 pathway may have therapeutic potential for the treatment of HCC. 14 Though their processes, particularly their functions in cellular signal transduction pathways, are not fully understood, the majority of recent reports focus on SNORAs screening and verifying their correlations with illnesses. Based on these findings, it is possible that SNORAs play an important role at the transcriptional and epigenetic levels, as well as in healthy and tumor tissues and body fluids. 12 , 13 Small nucleolar RNA, H/ACA box 64 (SNORA64) or U64 is one of the SNORAs that enables protein binding, as evidenced by Inferred Physical Interaction (IPI). In addition, SNORA64 is involved in processing primary RNA transcripts into one or more mature RNA molecules as Inferred from Electronic Annotation (IEA). 15 , 16 The interaction of this molecule with a number of proteins could be involved in modulating telomerase, according to some researchers. 15 Further, it may serve as a potential osteoarthritis biomarker. 17 According to our earlier research, there are variations in mRNA expression between the three distinct tumor grades, indicating a significant part for SNORA64 in the genesis and progression of pancreatic cancer. Furthermore, there is a link between the stimulation of the epithelial-to-mesenchymal transition and the reduction of SNORA64 expression. 18 Due to the lack of knowledge of SNORAs’ impact on apoptotic pathways, we are currently examining how SNORA64 affects the expression of both pro- and anti-apoptotic genes in pancreatic cancer cells. 2. Material and methods 2.1 Cell line and construct Pancreatic cancer cell line PK-8 obtained from Riken Cell Bank (RRID:CVCL_4718). PK-8 with SNORA64 knockdown and scramble cell line as a control are used in this study. The efficiency of the transfection was around 50%, as determined in our previous study. 18 A humidified incubator is used for cultivation of cell lines in RPMI-1640 containing 10% fetal bovine serum (FBS), 100 u/ml of penicillin, 100 g/ml of streptomycin, and 5% carbon dioxide. 2.2 Real-time reverse transcription polymerase chain reaction (RT-PCR) Using two sets of primers (left and right), each gene’s RNA expression was measured using RT-PCR analysis with four replicates for each sample. Gel electrophoresis utilizing ethidium bromide was employed for the confirmation of qPCR results. Data for gene sequences were obtained from the National Center for Biotechnology Information (NIH), starting with Homo sapiens tumor suppressor P53. Homo sapiens BCL2 and BCL2-related protein, long isoform (BCL-Xl) have been used as anti-apoptotic gene markers. Homo sapiens BCL2 like 11(BIM), BCL2 antagonist of cell death (BAD), BH3 interacting domain death agonist (BID), BCL2 associated X protein (BAX), and BCL2 antagonist/killer (BAK) have been used as pro-apoptotic genes. Homo sapiens CASP-9, CASP-3, and CASP-7 genes are used as indicators of the initiation of the apoptotic cascade. β-ACTIN, a housekeeping protein, is the reference gene used to normalize the amounts of mRNA ( Table 1 ). The Trizol technique (MRC, Cata#RT111) was used to extract total RNA, and the nanodrop spectrophotometer used to measure the RNA purity and concentration. cDNA was produced using ProtoScript ® M-MuLV TaqRT-PCR kit (NEB, cat#E6400S). 18 The mixture’s templet cDNA’s targeted genes were amplified using Biorad CFX96. 18 , 19 Table 1. Left and right primer sequences used in (RT-PCR) analysis. Gene symbol Primer sequences pairs 5'-Left Primer Sequence-3' 5'-Right Primer Sequence-3' P53 aggttggctctgactgtacc gattctcttcctctgtgcgc BCL2 ggaggattgtggccttcttt gccgtacagttccacaaagg BCL-Xl catggcagcagtaaagcaag tcccggaagagttcattcac BAD gaagactccagctctgcaga catcccttcgtcgtcctcc BID ggcctaccctagagacatgg tggctaagctcctcacgtag BIM tggcccttttgctaccagat aggaggacttggggtttgtg BAX tctgacggcaacttcaactg ttgaggagtctcacccaacc BAK ccaggacacagaggaggttt ctctgagtcatagcgtcggt CASP -9 ctagtttgcccacacccagt cctttcaccgaaacagcatt CASP-3 tggaattgatgcgtgatgtt ggcaggcctgaataatgaaa CASP -7 ttccacggttccaggctatt agttccttggtgagcatgga β-ACTIN agaaaatctggcaccacacc agaggcgtacagggatagca 2.3 Cell proliferation assay Six-well plates were seeded with 2X10 4 SNORA64 knockdown cells of PK-8, along with scramble cell lines as a control, and incubated for six hours. Trypsin was used to collect the cells, and then medium-washed over them. The Vi-cell XR (cell viability analyzer) uses trypan blue dye to determine the quantity of viability and viable cells. 2.4 Analytical statistics After the data were examined, a two-tailed Student’s t-test was used to identify any significant differences in gene expression. P-value ≤ 0.05. 3. Results 3.1 Pk-8 SNORA64 knockdown shows a significant low expression of tumor suppressor P53 In comparison to a scrambled control cell line, Pk-8 with SNORA64 knockdown significantly downregulated the expression of p53 ( Figure 1 ). Figure 1. Tumor suppressor P53 mRNA expression level in Pk-8 SNORA64 knockdown cell line. Pk-8 with SNORA64 knockdown significantly downregulated the expression of p53 mRNA compared to the scramble control cell line. P-value was 0.01. 3.2 Pk-8 SNORA64 knockdown shows significant differences in the expression of apoptotic regulator genes Pk-8 cell line with SNORA64 knockdown significantly upregulated the expression of anti-apoptotic regulator genes BCL2 and BCL-Xl in contrast with the scramble ( Figure 2A ). Figure 2. Apoptotic regulators mRNA expression levels in the Pk-8 SNORA64 knockdown cell line. A.Pk-8 with SNORA64 knockdown significantly upregulated the expression of anti-apoptotic regulator genes BCL2 and BCL-Xl in contrast with the scramble. P-value were 0.01, and 0.01respectively. B. In comparison to the scramble control cell line, Pk-8 with SNORA64 knockdown markedly reduced the pro-apoptotic regulator genes BID, BAX, and BAK. BAD and BIM, however, do not differ from scramble cell line control in terms of expression. P-value were 0.001, 0.001, 0.001, 0.1 and 0.06 respectively. In comparison to a scrambled control cell line, Pk-8 with SNORA64 knockdown significantly downregulated the pro-apoptotic genes BID, BAX, and BAK ( Figure 2B ). Despite this, there is no change in the expression of BAD and BIM in Pk-8 with SNORA64 knockdown compared to the scrambled control cell line ( Figure 2B ). 3.3 Pk-8 SNORA64 knockdown shows significantly low expression of apoptotic enzymes In comparison to a scrambled control cell line, Pk-8 with SNORA64 knockdown significantly downregulated the expression of apoptotic enzyme genes CASP-9, 3, and 7 ( Figure 3 ). Figure 3. Apoptotic enzyme mRNA expression levels in the Pk-8 SNORA64 knockdown cell line. Pk-8 with SNORA64 knockdown significantly downregulated the expression of apoptotic enzyme regulator genes CASP-9, 3, and 7 compared to the scramble control cell line. P-value were 0.0001, 0.002, and 0.001 respectively. 3.4 Pk-8 SNORA64 knockdown shows significant survival n in viable cells and viability In comparison to a scrambled control cell line, Pk-8 with SNORA64 knockdown significantly elevated the number of viable cells ( Figure 4A ) and viability ( Figure 4B ). Figure 4. Cellular viabilities in Pk-8 SNORA64 knockdown cell line. A. In comparison with the scramble control cell line, Pk-8 with SNORA64 knockdown showed a significant increase in viable cells. P-value was 0.01. B. Pk-8 with SNORA64 knockdown significantly increased the viability of the cells compared to the scramble control cell line. P-value was 0.01. 4. Discussion Despite the limited treatment options and poor prognosis for pancreatic cancer, this disease is highly aggressive and deadly. 1 One of the characteristics of pancreatic cancer that encourages initiation, growth, and therapeutic resistance is apoptosis avoidance. 2 , 3 , 19 Apoptosis relies on specific signaling pathways that are often deregulated in cancer development and progression. 2 , 3 The apoptosis pathway is cooperatively coordinated by tumor suppressor p53 signaling pathways. Epidemiological research and molecular evidence have shown that P53 mutations are associated with an increased risk of developing cancer. 3 , 4 , 20 Our results show low expression of P53 in the Pk-8 with SNORA64 low expression compared to the control. It is well known that genetic alteration in the tumor suppressor P53 is common during stages of pancreatic carcinogenesis. 20 By interacting with the multidomain members of the BCL2 family, p53 directly contributes to the intrinsic apoptotic pathway by inducing permeabilization of the mitochondrial outer membrane. 3 Furthermore, an investigation was conducted to determine how the expression of the p53 and BCL2 proteins relates to the various kinds of human cancers. 20 In the malignant tumors, there was a noteworthy negative connection observed between the expression of p53 and BCL2. 10 , 20 According to our findings, Pk-8 has elevated BCL2 and BCL-XL expression, while SNORA64 expression is low. The BCL2 and BCL-XL dimers prevent death signals and promote cell survival. 3 As pancreatic cancer progresses, BCL-XL expression rises. Treatments using anti-BCL-XL may be able to stop pancreatic tumors from progressing from their primary to more advanced stages. 21 Furthermore, BCL-XL overexpression raises the incidence rates of pancreatic cancer by preventing apoptosis and senescence brought on by oncogenes. 22 It is well known that the tumor suppressor gene p53 essential for maintaining genomic stability. It controls the production of the anti-apoptosis molecule BCL2 as well as the pro-apoptosis molecule BAX. 4 The pro-apoptotic gene BAX and the anti-apoptotic gene BCL2 have been found to be significant participants in the control of apoptosis in pancreatic cancer. 22 Conversely, this study shows a decline in the expression of the pro-apoptotic molecules BID, BAK, and BAX, while SNORA64 expression is low. BID is one of the molecules that activate BAK and BAX dimerization. BID protein is truncated in the presence of one of the intrinsic signaling apoptosis. Truncated BID can activate the effector proteins BAK and BAX. The BAK and BAX dimers bind to and sequester the anti-apoptotic BCL2 and BCL-XL. 3 , 5 The subsequent signals have an impact on the potential of the mitochondrial membrane and result in the release of Cyt. c to the cytoplasm. Consequently, the release of Cyt. c and the activation of Casp-9 and 3 initiate the cascade of caspases. 3 , 6 Casp-3 activation is thought to initiate the apoptotic execution route since it can activate Casp-6 and 7. The execution route is irreversible and constitutes the last phase of apoptosis induction. 3 Many studies demonstrated the Casp-3 role in the progression, aggressiveness, and overall survival time of patients with gastric, ovarian, prostate, cervical, and colorectal cancer. 23 – 25 Furthermore, Casp-3 can suppress dissemination and invasion and promote the epithelial-to-mesenchymal transition phenotype. Casp-3 is therefore regarded as a significant prognostic marker and an indicator for cancer disease-free survival rates as well as overall 5-year survival rates. 23 , 25 When compared to the scrambled control cells, our data demonstrate a decrease in the key caspases’ mRNA expression in the intrinsic signaling apoptosis Casp-9, 3, and 7. Despite this, SNORA64 knockdown showed no effect on the expression of BAD and BIM in Pk-8 with low expression of SNORA64 when compared with the scrambled control cells. Pro-apoptotic and anti-apoptotic regulator equilibrium is essential for homeostasis, and any change toward survival through a variety of escape mechanisms will encourage tumor growth. 3 One of the primary methods that tumor cells develop resistance to chemotherapy and radiation treatment is through apoptosis-regulatory mediators, particularly elevated concentrations of anti-apoptotic proteins. 26 Restoring apoptosis in the tumor cells resistant to chemotherapy and radiation therapy is crucial to the treatment. 26 , 27 Therefore, SNORA64 can be used as a therapeutic agent to increase cell sensitivity to death by chemotherapy. A future step should be taken to investigate the synergistic effect of SNORA64 and chemotherapy in cancer treatment. The imbalance of both pro- and anti-apoptotic genes may stimulate tumor growth and progression in pancreatic cancer by increasing cell proliferation, cell viability, and decreasing cell death. 1 , 2 Our results indicated a significant increase in viable cells and viability in Pk-8 with low expression of SNORA64. Culture productivity is increased when anti-apoptosis genes, such as BCL2, are overexpressed and suppress apoptosis. 5 We also recently reported that the expression of SNORA64 in pancreatic cancer tissues is significantly higher than that in normal pancreatic ductal tissues. 18 Several studies have demonstrated the critical role played by SNORAs in cancer development and their potential uses as biomarkers and/or therapeutic targets. 12 – 18 As a result, changes in SNORAs expression could significantly affect the pathogenic processes and pathways underlying the development of cancer. Our research shows that, among particular molecules, the SNORA64 molecule has the capacity to activate the apoptotic intrinsic pathway or enhance sensitivity to death. On the other hand, SNORA64 could be a key indicator for cell proliferation and survival. 5. Conclusion Based on our findings, SNORA64 may modulate both pro-apoptotic and anti-apoptotic genes that control apoptosis. SNORA64 promotes apoptosis by increasing the expression of pro-apoptotic molecules such as BID, BAX, and BAK. Meanwhile, SNORA64 expression impact the anti-apoptosis molecules BCL2 and BCL-XL by decreasing their expression. Consequently, low expression of SNORA64 increases the viability of pancreatic cancer cells by increasing viable cells number. Ethics information This study was completed in accordance with Southern Technical University’s ethical guidelines with approval number 5/1863. This study did not involve human participants. Data availability I consent to make all of the information and resources used to support the findings or analyses in my research publicly available under an open license that allows CC-BY.4.0 reuse. The datasets with DOI 10.6084/m9.figshare.30742097 are freely available at https://figshare.com . 28 References 1. Sarantis P, Koustas E, Papadimitropoulou A, et al. : Pancreatic ductal adenocarcinoma: Treatment hurdles, tumor microenvironment and immunotherapy. World J. Gastrointest. Oncol. 2020 Feb 15; 12 (2): 173–181. PubMed Abstract | Publisher Full Text | Free Full Text 2. Kumar L, Kumar S, Sandeep K, et al. : Therapeutic Approaches in Pancreatic Cancer: Recent Updates. Biomedicines. 2023 Jun 1; 11 (6): 1611–1632. PubMed Abstract | Publisher Full Text | Free Full Text 3. Kashyap D, Garg VK, Goel N: Intrinsic and extrinsic pathways of apoptosis: Role in cancer development and prognosis. Adv. Protein Chem. Struct. Biol. 2021; 125 : 73–120. PubMed Abstract | Publisher Full Text 4. Wang H, Guo M, Wei H, et al. : Targeting p53 pathways: mechanisms, structures, and advances in therapy. Signal Transduct. Target. Ther. 2023 Mar 1; 8 (1): 92–126. PubMed Abstract | Publisher Full Text | Free Full Text 5. Qian S, Wei Z, Yang W, et al. : The role of BCL-2 family proteins in regulating apoptosis and cancer therapy. Front. Oncol. 2022 Oct 12; 12 : 985363–985379. PubMed Abstract | Publisher Full Text | Free Full Text 6. Li M, Wu X, Xu XC: Induction of apoptosis by cyclo-oxygenase-2 inhibitor NS398 through a cytochrome C-dependent pathway in esophageal cancer cells. Int. J. Cancer. 2001 Jul 15; 93 (2): 218–223. PubMed Abstract | Publisher Full Text 7. Kadenbach B, Arnold S, Lee I, et al. : The possible role of cytochrome c oxidase in stress-induced apoptosis and degenerative diseases. Biochim. Biophys. Acta. 2004; 1655 (1-3): 400–408. PubMed Abstract | Publisher Full Text 8. Soni IV, Jeanne A: Hardy Caspase-9 Activation of Procaspase-3 but Not Procaspase-6 Is Based on the Local Context of Cleavage Site Motifs and on Sequence. Biochemistry. 2021; 60 (37): 2824–2835. PubMed Abstract | Publisher Full Text | Free Full Text 9. Boice A, Bouchier-Hayes L: Targeting apoptotic caspases in cancer. Biochim. Biophys. Acta, Mol. Cell Res. 2020 Jun; 1867 (6): 118688. PubMed Abstract | Publisher Full Text | Free Full Text 10. Bratkovič T, Božič J, Rogelj B: Functional diversity of small nucleolar RNAs. Nucleic Acids Res. 2020 Feb 28; 48 (4): 1627–1651. PubMed Abstract | Publisher Full Text | Free Full Text 11. Samarsky DA, Fournier MJ, Singer RH, et al. : The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization. EMBO J. 1998 Jul 1; 17 (13): 3747–3757. PubMed Abstract | Publisher Full Text | Free Full Text 12. Zhang X, Wang C, Xia S, et al. : The emerging role of snoRNAs in human disease. Genes Dis. 2022 Dec 26; 10 (5): 2064–2081. PubMed Abstract | Publisher Full Text | Free Full Text 13. Gong J, Li Y, Liu CJ, et al. : A Pan-cancer Analysis of the Expression and Clinical Relevance of Small Nucleolar RNAs in Human Cancer. Cell Rep. 2017 Nov 14; 21 (7): 1968–1981. PubMed Abstract | Publisher Full Text 14. Li C, Wu L, Liu P, et al. : The C/D box small nucleolar RNA SNORD52 regulated by Upf1 facilitates Hepatocarcinogenesis by stabilizing CDK1. Theranostics. 2020 Jul 23; 10 (20): 9348–9363. PubMed Abstract | Publisher Full Text | Free Full Text 15. Fu D, Collins K: Purification of human telomerase complexes identifies factors involved in telomerase biogenesis and telomere length regulation. Mol. Cell. 2007 Dec 14; 28 (5): 773–785. PubMed Abstract | Publisher Full Text | Free Full Text 16. Dragon F, Pogacić V, Filipowicz W: In vitro assembly of human H/ACA small nucleolar RNPs reveals unique features of U17 and telomerase RNAs. Mol. Cell. Biol. 2000 May; 20 (9): 3037–3048. PubMed Abstract | Publisher Full Text | Free Full Text 17. Steinbusch MM, Fang Y, Milner PI, et al. : Serum snoRNAs as biomarkers for joint ageing and post traumatic osteoarthritis. Sci. Rep. 2017 Mar 2; 7 : 43558. PubMed Abstract | Publisher Full Text | Free Full Text 18. Alfardan R: Small Nuclear RNA 64 (snoRNA64): A novel Tumor Biomarker for Pancreatic Cancer. Baghdad Sci. J. 2023; 20 (5): 1873–1881. Publisher Full Text 19. Alfardan RK, Al-Ismaeel WN: The role of Integrin Subunit Alpha 2 (ITGA2) in pancreatic cancer progression. Eksp. Klin. Gastroenterol. 2023; (10): 120–124. Publisher Full Text 20. Voutsadakis IA: Mutations of p53 associated with pancreatic cancer and therapeutic implications. Ann. Hepatobiliary Pancreat. Surg. 2021 Aug 31; 25 (3): 315–327. PubMed Abstract | Publisher Full Text | Free Full Text 21. Zhou L, Sheng W, Jia C, et al. : Musashi2 promotes the progression of pancreatic cancer through a novel ISYNA1-p21/ZEB-1 pathway. J. Cell. Mol. Med. 2020 Sep; 24 (18): 10560–10572. PubMed Abstract | Publisher Full Text | Free Full Text 22. Magouliotis DE, Karamolegkou AP, Zotos PA, et al. : Bioinformatic Analysis of the BCL-xL/BCL2L1 Interactome in Patients with Pancreatic Cancer. Medicina (Kaunas). 2022 Nov 17; 58 (11): 1663. PubMed Abstract | Publisher Full Text | Free Full Text 23. Hu Q, Peng J, Liu W, et al. : Elevated cleaved caspase-3 is associated with shortened overall survival in several cancer types. Int. J. Clin. Exp. Pathol. 2014 Jul 15; 7 (8): 5057–5070. PubMed Abstract 24. Gardner AB, Charo LM, Mann AK, et al. : Ovarian, uterine, and cervical cancer patients with distant metastases at diagnosis: most common locations and outcomes. Clin. Exp. Metastasis. 2020 Feb; 37 (1): 107–113. PubMed Abstract | Publisher Full Text 25. Acar V, Couto Fernandez FL, Buscariolo FF, et al. : Immunohistochemical Evaluation of PARP and Caspase-3 as Prognostic Markers in Prostate Carcinomas. Clin. Med. Res. 2021 Dec; 19 (4): 183–191. PubMed Abstract | Publisher Full Text | Free Full Text 26. Dogan E, Kara HG, Kosova B, et al. : Targeting Apoptosis to Overcome Chemotherapy Resistance. Sergi CM, editor. Metastasis. Brisbane (AU): Exon Publications; 2022 May 3. Chapter 12. Reference Source 27. Kim R, Kin T, Beck WT: Impact of Complex Apoptotic Signaling Pathways on Cancer Cell Sensitivity to Therapy. Cancers (Basel). 2024 Feb 28; 16 (5): 984. PubMed Abstract | Publisher Full Text | Free Full Text 28. Alafrdan R: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer. Dataset. figshare. 2025 Nov 29. Publisher Full Text Comments on this article Comments (0) Version 3 VERSION 3 PUBLISHED 16 Jan 2026 ADD YOUR COMMENT Comment Author details Author details Community Health Techniques Department, Southern Technical University, Basrah, Basrah, 61004, Iraq Rana Alfardan Roles: Conceptualization, Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Resources, Software, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information This work was partially supported by Southern Technical University under scientific research awards, No. 9/7934, 10 Sep. 2025. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (3) version 3 Revised Published: 12 May 2026, 15:68 https://doi.org/10.12688/f1000research.173746.3 version 2 Revised Published: 26 Mar 2026, 15:68 https://doi.org/10.12688/f1000research.173746.2 version 1 Published: 16 Jan 2026, 15:68 https://doi.org/10.12688/f1000research.173746.1 Copyright © 2026 Alfardan R. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Alfardan R. Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2026, 15 :68 ( https://doi.org/10.12688/f1000research.173746.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 1 VERSION 1 PUBLISHED 16 Jan 2026 Views 0 Cite How to cite this report: Liang T. Reviewer Report For: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2026, 15 :68 ( https://doi.org/10.5256/f1000research.191586.r455858 ) The direct URL for this report is: https://f1000research.com/articles/15-68/v1#referee-response-455858 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 23 Feb 2026 Tingbo Liang , Zhejiang University School of Medicine, Hangzhou, Zhejiang, China Not Approved VIEWS 0 https://doi.org/10.5256/f1000research.191586.r455858 Alfardan examines SNORA64 knockdown in PK-8 pancreatic adenocarcinoma cells using qPCR of BCL-2 family genes and viability/proliferation assays to argue SNORA64 regulates intrinsic apoptosis. While the concept is interesting, the conclusions are based mainly on mRNA changes and non-specific ... Continue reading READ ALL Alfardan examines SNORA64 knockdown in PK-8 pancreatic adenocarcinoma cells using qPCR of BCL-2 family genes and viability/proliferation assays to argue SNORA64 regulates intrinsic apoptosis. While the concept is interesting, the conclusions are based mainly on mRNA changes and non-specific viability readouts, without direct apoptosis validation and with insufficient methodological detail. Substantial additional experiments and clearer reporting are required. Apoptosis is inferred from mRNA only; functional apoptosis assays are needed. Please include at least one direct apoptosis readout: Annexin V/PI (or Annexin V/7-AAD) flow cytometry;Caspase-3/7 activity, cleaved caspase-3 and cleaved PARP by Western blot;Mitochondrial membrane potential (JC-1/TMRE) and cytochrome c release to connect to intrinsic pathway. Without these, it is difficult to conclude that apoptosis is truly altered rather than changes in transcription accompanying altered growth state. Clarify causality and strengthen mechanistic claims. The conclusion states “SNORA64 interactions with apoptotic inhibitor molecules,” but no interaction data are described. If “interaction” is meant mechanistically, consider: RNA pulldown / RIP (e.g., with candidate RNA-binding proteins) or CLIP-based approaches;Assessment of snoRNA canonical function (rRNA modification targets) and whether those changes affect translation of apoptosis regulators. Use of a single cell line limits generalizability. Findings are based on PK-8 only. Pancreatic cancer is heterogeneous. Please validate in additional PDAC lines (e.g., PANC-1, MiaPaCa-2, BxPC-3, AsPC-1) and/or a non-malignant pancreatic ductal cell line as a baseline. Knockdown validation and experimental design details are insufficient. Provide SNORA64 knockdown efficiency (qPCR Ct values, % reduction) and number of independent biological replicates. Therapeutic sensitization claim requires treatment context. The final sentence implies SNORA64 can increase sensitivity “during treatment,” but no drug or stress condition is tested. Consider adding experiments with standard PDAC agents (e.g., gemcitabine, nab-paclitaxel, irinotecan/5-FU regimens) or apoptosis inducers, showing differential response between scramble and knockdown (or rescue with SNORA64 re-expression). Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Partly Competing Interests: No competing interests were disclosed. Reviewer Expertise: Pancreatic cancer I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Liang T. Reviewer Report For: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2026, 15 :68 ( https://doi.org/10.5256/f1000research.191586.r455858 ) The direct URL for this report is: https://f1000research.com/articles/15-68/v1#referee-response-455858 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 26 Mar 2026 Rana Alfardan , Community Health Techniques Department, Southern Technical University, Basrah, 61004, Iraq 26 Mar 2026 Author Response Dear Dr. Tingbo Liang, Thank you very much for your time and for your insightful comments on my manuscript. I would like to address the points you have raised ... Continue reading Dear Dr. Tingbo Liang, Thank you very much for your time and for your insightful comments on my manuscript. I would like to address the points you have raised and provide clarification where necessary: Regarding the assessment of apoptosis, quantitative real-time PCR (qPCR) results provide supporting evidence of apoptosis through the evaluation of changes in gene expression. Nevertheless, I acknowledge that confirmation via protein cleavage assays or flow cytometry constitutes an essential step and will be pursued in future investigations. The use of a single cell line is acknowledged as a limitation of the current study. This point has now been explicitly mentioned in the second version of the manuscript. Transfection of the PK-8 cell line was carried out using siRNA oligonucleotides delivered via the psiRNA-h7SKG1 vector. The specific oligo sequences and the detailed protocol are provided in the cited reference. In accordance with the other reviewer’s suggestion, the type of small RNA employed for knockdown has now been clearly specified in the second version. With respect to the therapeutic sensitization effect, I would like to clarify that this interpretation remains speculative at this stage and is proposed as a direction for future studies. Thank you again for your valuable feedback, which has helped strengthen the manuscript. Sincerely, Dr. Rana Alfardan Dear Dr. Tingbo Liang, Thank you very much for your time and for your insightful comments on my manuscript. I would like to address the points you have raised and provide clarification where necessary: Regarding the assessment of apoptosis, quantitative real-time PCR (qPCR) results provide supporting evidence of apoptosis through the evaluation of changes in gene expression. Nevertheless, I acknowledge that confirmation via protein cleavage assays or flow cytometry constitutes an essential step and will be pursued in future investigations. The use of a single cell line is acknowledged as a limitation of the current study. This point has now been explicitly mentioned in the second version of the manuscript. Transfection of the PK-8 cell line was carried out using siRNA oligonucleotides delivered via the psiRNA-h7SKG1 vector. The specific oligo sequences and the detailed protocol are provided in the cited reference. In accordance with the other reviewer’s suggestion, the type of small RNA employed for knockdown has now been clearly specified in the second version. With respect to the therapeutic sensitization effect, I would like to clarify that this interpretation remains speculative at this stage and is proposed as a direction for future studies. Thank you again for your valuable feedback, which has helped strengthen the manuscript. Sincerely, Dr. Rana Alfardan Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 26 Mar 2026 Rana Alfardan , Community Health Techniques Department, Southern Technical University, Basrah, 61004, Iraq 26 Mar 2026 Author Response Dear Dr. Tingbo Liang, Thank you very much for your time and for your insightful comments on my manuscript. I would like to address the points you have raised ... Continue reading Dear Dr. Tingbo Liang, Thank you very much for your time and for your insightful comments on my manuscript. I would like to address the points you have raised and provide clarification where necessary: Regarding the assessment of apoptosis, quantitative real-time PCR (qPCR) results provide supporting evidence of apoptosis through the evaluation of changes in gene expression. Nevertheless, I acknowledge that confirmation via protein cleavage assays or flow cytometry constitutes an essential step and will be pursued in future investigations. The use of a single cell line is acknowledged as a limitation of the current study. This point has now been explicitly mentioned in the second version of the manuscript. Transfection of the PK-8 cell line was carried out using siRNA oligonucleotides delivered via the psiRNA-h7SKG1 vector. The specific oligo sequences and the detailed protocol are provided in the cited reference. In accordance with the other reviewer’s suggestion, the type of small RNA employed for knockdown has now been clearly specified in the second version. With respect to the therapeutic sensitization effect, I would like to clarify that this interpretation remains speculative at this stage and is proposed as a direction for future studies. Thank you again for your valuable feedback, which has helped strengthen the manuscript. Sincerely, Dr. Rana Alfardan Dear Dr. Tingbo Liang, Thank you very much for your time and for your insightful comments on my manuscript. I would like to address the points you have raised and provide clarification where necessary: Regarding the assessment of apoptosis, quantitative real-time PCR (qPCR) results provide supporting evidence of apoptosis through the evaluation of changes in gene expression. Nevertheless, I acknowledge that confirmation via protein cleavage assays or flow cytometry constitutes an essential step and will be pursued in future investigations. The use of a single cell line is acknowledged as a limitation of the current study. This point has now been explicitly mentioned in the second version of the manuscript. Transfection of the PK-8 cell line was carried out using siRNA oligonucleotides delivered via the psiRNA-h7SKG1 vector. The specific oligo sequences and the detailed protocol are provided in the cited reference. In accordance with the other reviewer’s suggestion, the type of small RNA employed for knockdown has now been clearly specified in the second version. With respect to the therapeutic sensitization effect, I would like to clarify that this interpretation remains speculative at this stage and is proposed as a direction for future studies. Thank you again for your valuable feedback, which has helped strengthen the manuscript. Sincerely, Dr. Rana Alfardan Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Oluremi A. Reviewer Report For: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2026, 15 :68 ( https://doi.org/10.5256/f1000research.191586.r451315 ) The direct URL for this report is: https://f1000research.com/articles/15-68/v1#referee-response-451315 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 21 Jan 2026 Adeolu Oluremi , University of Arkansas at Little Rock, Little Rock, Arkansas, USA Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.191586.r451315 Title & Abstract Title: Consider making it more specific and impactful. Suggestion: \"Downregulation of SNORA64 Promotes Pancreatic Cancer Cell Survival by Modulating the Apoptotic Regulator Gene Network\" Abstract Methods: The methods description is overly ... Continue reading READ ALL Title & Abstract Title: Consider making it more specific and impactful. Suggestion: \"Downregulation of SNORA64 Promotes Pancreatic Cancer Cell Survival by Modulating the Apoptotic Regulator Gene Network\" Abstract Methods: The methods description is overly brief. Specify the key techniques used (e.g., RT-qPCR for gene expression, cell viability assay using trypan blue exclusion). Results: Include the key finding about p53 downregulation, as it's a central result. Mention the lack of change in BAD/BIM for completeness. Conclusion: State the potential therapeutic implication more clearly (e.g., \"SNORA64 may serve as a sensitizer to apoptosis-inducing therapies.\"). Introduction Flow: The transition from general apoptosis mechanisms to snoRNAs to SNORA64 specifically is somewhat abrupt. The rationale for studying SNORA64 in pancreatic cancer needs a stronger link. Suggestion: After introducing snoRNAs in cancer, add 1-2 sentences summarizing your previous study (mentioned in the Abstract) that identified SNORA64 as a predictive marker in pancreatic cancer, which directly motivates the current functional investigation into apoptosis. Materials & Methods Clarity and Detail: 2.1: Specify how the SNORA64 knockdown was achieved (e.g., shRNA, siRNA) and the source/sequence of the scramble control. 2.2: The description of gel electrophoresis to \"confirm qPCR results\" is unusual, as qPCR is typically quantitative and agarose gels are qualitative. Clarify if this was for product verification. Table 1: The table formatting is corrupted in the text. Ensure it is presented clearly with separate columns for Gene Symbol, Left Primer, and Right Primer. 2.4: Mention the software used for statistical analysis. Results Logical Order: The results for p53 (3.1) are critical and should be presented before the BCL2 family results (3.2), as p53 is a key upstream regulator of many of these genes. This improves the narrative flow. Figure References: Ensure every figure (1, 2A/B, 3, 4A/B) is explicitly called out in the results text in sequential order. Language: Consistently use \"knockdown\" or \"low expression.\" Avoid switching between them (e.g., \"Pk-8 with SNORA64 knockdown\" vs. \"Pk-8 with low expression of SNORA64\"). Discussion Structure: The discussion is comprehensive but can be better organized to mirror the results. Paragraph 1: Discuss p53 downregulation and its implications. Paragraph 2: Discuss the BCL2 family (anti-apoptotic: BCL2, BCL-XL; pro-apoptotic: BID, BAX, BAK) results. Paragraph 3: Discuss the caspase results and their connection to the BCL2 pathway. Paragraph 4: Synthesize how these molecular changes explain the increased cell viability. Paragraph 5: Discuss the lack of effect on BAD/BIM, which is an interesting negative result—speculate briefly on why SNORA64 might not affect these specific BH3-only proteins. Mechanistic Speculation: The discussion excellently connects the dots. To strengthen it, propose a testable hypothetical model in a sentence (e.g., \"We propose that SNORA64 may influence a transcriptional or post-transcriptional regulator that coordinately modulates p53 and a subset of BCL2 family genes, but not BAD/BIM.\"). Limitations: Add a brief limitations subsection before the conclusion. Acknowledge that this is an in vitro study using a single cell line (PK-8). Future work should validate findings in other pancreatic cancer cell lines and in vivo models. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Cancer Biology, Infectious diseases, Nanotechnology, Biomedical Sciences I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Oluremi A. Reviewer Report For: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2026, 15 :68 ( https://doi.org/10.5256/f1000research.191586.r451315 ) The direct URL for this report is: https://f1000research.com/articles/15-68/v1#referee-response-451315 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 26 Mar 2026 Rana Alfardan , Community Health Techniques Department, Southern Technical University, Basrah, 61004, Iraq 26 Mar 2026 Author Response Subject: Revision of the research article (Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro) Dear Dr. Adeolu Oluremi, Thank you very ... Continue reading Subject: Revision of the research article (Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro) Dear Dr. Adeolu Oluremi, Thank you very much for your thoughtful and constructive suggestions. I have accepted all of them, and they have significantly enriched my manuscript. Please find below a point-by-point response to your comments: Title: Thank you for your valuable suggestion regarding the manuscript title. I agree that the proposed title, \"Downregulation of SNORA64 Promotes Pancreatic Cancer Cell Survival by Modulating the Apoptotic Regulator Gene Network,\" would indeed be powerful and appropriate for this work. However, upon further consideration of this modification, I have encountered a significant practical constraint. The data of the manuscript has already been published online under its current title, making a title change procedurally difficult at this stage. Furthermore, the previous two editors involved with this manuscript explicitly endorsed the current title during the review process. Given these circumstances, and with respect for the editorial consistency maintained throughout the review process, I believe the title should remain unchanged. I hope you understand this decision, and I appreciate your understanding regarding this limitation. Sincerely, Abstract: As suggested, the abstract has been revised to specify the key techniques used. It now also explicitly includes the key findings regarding p53 downregulation and the lack of change in BAD/BIM. Furthermore, the potential therapeutic implications have been stated more clearly. Conclusion: The conclusion has been revised exactly as you suggested. Introduction: Our previous study is already mentioned in the introduction. The text has been revised to directly introduce pancreatic cancer and explicitly motivate the current functional investigation into apoptosis, creating a smoother transition from the background to the study's objective. Materials and Methods: 2.1: The transfection of the PK-8 cell line is performed with siRNA oligos carried by psiRNA-h7SKG1. The oligo sequences and the protocol are detailed in the cited reference. However, as you suggested, the type of small RNA used for the knockdown has now been specified in the text. 2.2: The sentence regarding the use of agarose gels for qPCR product verification has been revised as you suggested for clarity. Table 1: The table format has been changed as you recommended. It now consists of three columns: Gene Symbol, Left Primer, and Right Primer. 2.4: Excel has now been added to the \"Materials\" subsection as one of the software used for statistical analysis. Results: The results for p53 (3.1) are now presented before the BCL2 family results (3.2), following the logical flow you recommended. Figure References: All figures (Figure 1, 2A/B, 3, 4A/B) are now explicitly called out in the results text in sequential order. Language: For consistency, the phrasing \"PK-8 with SNORA64 knockdown\" is now used consistently throughout the manuscript. Discussion: Paragraph 1: Two sentences have been added to discuss the observed downregulation of p53 and its potential implications. Paragraph 2: This paragraph now focuses on discussing the BCL2 family, including both pro- and anti-apoptotic molecules. Paragraph 3: Two sentences have been added to discuss the connection between the caspase cascade and the BCL2 pathway. Paragraph 4: This paragraph has been rephrased, and three sentences have been added to elaborate on the increase in cell viability. Paragraph 5: A new paragraph specifically discussing BIM and BAD has been added. Mechanistic Speculation: Thank you for this excellent suggestion. This section has been incorporated into the revised manuscript (version 2). Limitations: A new \"Limitations\" subsection has been added to the discussion, as you recommended, to address the constraints of the current study. Thank you again for your time and expertise, which have greatly improved the quality of my work. Sincerely, Dr. Rana Alfardan Subject: Revision of the research article (Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro) Dear Dr. Adeolu Oluremi, Thank you very much for your thoughtful and constructive suggestions. I have accepted all of them, and they have significantly enriched my manuscript. Please find below a point-by-point response to your comments: Title: Thank you for your valuable suggestion regarding the manuscript title. I agree that the proposed title, \"Downregulation of SNORA64 Promotes Pancreatic Cancer Cell Survival by Modulating the Apoptotic Regulator Gene Network,\" would indeed be powerful and appropriate for this work. However, upon further consideration of this modification, I have encountered a significant practical constraint. The data of the manuscript has already been published online under its current title, making a title change procedurally difficult at this stage. Furthermore, the previous two editors involved with this manuscript explicitly endorsed the current title during the review process. Given these circumstances, and with respect for the editorial consistency maintained throughout the review process, I believe the title should remain unchanged. I hope you understand this decision, and I appreciate your understanding regarding this limitation. Sincerely, Abstract: As suggested, the abstract has been revised to specify the key techniques used. It now also explicitly includes the key findings regarding p53 downregulation and the lack of change in BAD/BIM. Furthermore, the potential therapeutic implications have been stated more clearly. Conclusion: The conclusion has been revised exactly as you suggested. Introduction: Our previous study is already mentioned in the introduction. The text has been revised to directly introduce pancreatic cancer and explicitly motivate the current functional investigation into apoptosis, creating a smoother transition from the background to the study's objective. Materials and Methods: 2.1: The transfection of the PK-8 cell line is performed with siRNA oligos carried by psiRNA-h7SKG1. The oligo sequences and the protocol are detailed in the cited reference. However, as you suggested, the type of small RNA used for the knockdown has now been specified in the text. 2.2: The sentence regarding the use of agarose gels for qPCR product verification has been revised as you suggested for clarity. Table 1: The table format has been changed as you recommended. It now consists of three columns: Gene Symbol, Left Primer, and Right Primer. 2.4: Excel has now been added to the \"Materials\" subsection as one of the software used for statistical analysis. Results: The results for p53 (3.1) are now presented before the BCL2 family results (3.2), following the logical flow you recommended. Figure References: All figures (Figure 1, 2A/B, 3, 4A/B) are now explicitly called out in the results text in sequential order. Language: For consistency, the phrasing \"PK-8 with SNORA64 knockdown\" is now used consistently throughout the manuscript. Discussion: Paragraph 1: Two sentences have been added to discuss the observed downregulation of p53 and its potential implications. Paragraph 2: This paragraph now focuses on discussing the BCL2 family, including both pro- and anti-apoptotic molecules. Paragraph 3: Two sentences have been added to discuss the connection between the caspase cascade and the BCL2 pathway. Paragraph 4: This paragraph has been rephrased, and three sentences have been added to elaborate on the increase in cell viability. Paragraph 5: A new paragraph specifically discussing BIM and BAD has been added. Mechanistic Speculation: Thank you for this excellent suggestion. This section has been incorporated into the revised manuscript (version 2). Limitations: A new \"Limitations\" subsection has been added to the discussion, as you recommended, to address the constraints of the current study. Thank you again for your time and expertise, which have greatly improved the quality of my work. Sincerely, Dr. Rana Alfardan Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 26 Mar 2026 Rana Alfardan , Community Health Techniques Department, Southern Technical University, Basrah, 61004, Iraq 26 Mar 2026 Author Response Subject: Revision of the research article (Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro) Dear Dr. Adeolu Oluremi, Thank you very ... Continue reading Subject: Revision of the research article (Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro) Dear Dr. Adeolu Oluremi, Thank you very much for your thoughtful and constructive suggestions. I have accepted all of them, and they have significantly enriched my manuscript. Please find below a point-by-point response to your comments: Title: Thank you for your valuable suggestion regarding the manuscript title. I agree that the proposed title, \"Downregulation of SNORA64 Promotes Pancreatic Cancer Cell Survival by Modulating the Apoptotic Regulator Gene Network,\" would indeed be powerful and appropriate for this work. However, upon further consideration of this modification, I have encountered a significant practical constraint. The data of the manuscript has already been published online under its current title, making a title change procedurally difficult at this stage. Furthermore, the previous two editors involved with this manuscript explicitly endorsed the current title during the review process. Given these circumstances, and with respect for the editorial consistency maintained throughout the review process, I believe the title should remain unchanged. I hope you understand this decision, and I appreciate your understanding regarding this limitation. Sincerely, Abstract: As suggested, the abstract has been revised to specify the key techniques used. It now also explicitly includes the key findings regarding p53 downregulation and the lack of change in BAD/BIM. Furthermore, the potential therapeutic implications have been stated more clearly. Conclusion: The conclusion has been revised exactly as you suggested. Introduction: Our previous study is already mentioned in the introduction. The text has been revised to directly introduce pancreatic cancer and explicitly motivate the current functional investigation into apoptosis, creating a smoother transition from the background to the study's objective. Materials and Methods: 2.1: The transfection of the PK-8 cell line is performed with siRNA oligos carried by psiRNA-h7SKG1. The oligo sequences and the protocol are detailed in the cited reference. However, as you suggested, the type of small RNA used for the knockdown has now been specified in the text. 2.2: The sentence regarding the use of agarose gels for qPCR product verification has been revised as you suggested for clarity. Table 1: The table format has been changed as you recommended. It now consists of three columns: Gene Symbol, Left Primer, and Right Primer. 2.4: Excel has now been added to the \"Materials\" subsection as one of the software used for statistical analysis. Results: The results for p53 (3.1) are now presented before the BCL2 family results (3.2), following the logical flow you recommended. Figure References: All figures (Figure 1, 2A/B, 3, 4A/B) are now explicitly called out in the results text in sequential order. Language: For consistency, the phrasing \"PK-8 with SNORA64 knockdown\" is now used consistently throughout the manuscript. Discussion: Paragraph 1: Two sentences have been added to discuss the observed downregulation of p53 and its potential implications. Paragraph 2: This paragraph now focuses on discussing the BCL2 family, including both pro- and anti-apoptotic molecules. Paragraph 3: Two sentences have been added to discuss the connection between the caspase cascade and the BCL2 pathway. Paragraph 4: This paragraph has been rephrased, and three sentences have been added to elaborate on the increase in cell viability. Paragraph 5: A new paragraph specifically discussing BIM and BAD has been added. Mechanistic Speculation: Thank you for this excellent suggestion. This section has been incorporated into the revised manuscript (version 2). Limitations: A new \"Limitations\" subsection has been added to the discussion, as you recommended, to address the constraints of the current study. Thank you again for your time and expertise, which have greatly improved the quality of my work. Sincerely, Dr. Rana Alfardan Subject: Revision of the research article (Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro) Dear Dr. Adeolu Oluremi, Thank you very much for your thoughtful and constructive suggestions. I have accepted all of them, and they have significantly enriched my manuscript. Please find below a point-by-point response to your comments: Title: Thank you for your valuable suggestion regarding the manuscript title. I agree that the proposed title, \"Downregulation of SNORA64 Promotes Pancreatic Cancer Cell Survival by Modulating the Apoptotic Regulator Gene Network,\" would indeed be powerful and appropriate for this work. However, upon further consideration of this modification, I have encountered a significant practical constraint. The data of the manuscript has already been published online under its current title, making a title change procedurally difficult at this stage. Furthermore, the previous two editors involved with this manuscript explicitly endorsed the current title during the review process. Given these circumstances, and with respect for the editorial consistency maintained throughout the review process, I believe the title should remain unchanged. I hope you understand this decision, and I appreciate your understanding regarding this limitation. Sincerely, Abstract: As suggested, the abstract has been revised to specify the key techniques used. It now also explicitly includes the key findings regarding p53 downregulation and the lack of change in BAD/BIM. Furthermore, the potential therapeutic implications have been stated more clearly. Conclusion: The conclusion has been revised exactly as you suggested. Introduction: Our previous study is already mentioned in the introduction. The text has been revised to directly introduce pancreatic cancer and explicitly motivate the current functional investigation into apoptosis, creating a smoother transition from the background to the study's objective. Materials and Methods: 2.1: The transfection of the PK-8 cell line is performed with siRNA oligos carried by psiRNA-h7SKG1. The oligo sequences and the protocol are detailed in the cited reference. However, as you suggested, the type of small RNA used for the knockdown has now been specified in the text. 2.2: The sentence regarding the use of agarose gels for qPCR product verification has been revised as you suggested for clarity. Table 1: The table format has been changed as you recommended. It now consists of three columns: Gene Symbol, Left Primer, and Right Primer. 2.4: Excel has now been added to the \"Materials\" subsection as one of the software used for statistical analysis. Results: The results for p53 (3.1) are now presented before the BCL2 family results (3.2), following the logical flow you recommended. Figure References: All figures (Figure 1, 2A/B, 3, 4A/B) are now explicitly called out in the results text in sequential order. Language: For consistency, the phrasing \"PK-8 with SNORA64 knockdown\" is now used consistently throughout the manuscript. Discussion: Paragraph 1: Two sentences have been added to discuss the observed downregulation of p53 and its potential implications. Paragraph 2: This paragraph now focuses on discussing the BCL2 family, including both pro- and anti-apoptotic molecules. Paragraph 3: Two sentences have been added to discuss the connection between the caspase cascade and the BCL2 pathway. Paragraph 4: This paragraph has been rephrased, and three sentences have been added to elaborate on the increase in cell viability. Paragraph 5: A new paragraph specifically discussing BIM and BAD has been added. Mechanistic Speculation: Thank you for this excellent suggestion. This section has been incorporated into the revised manuscript (version 2). Limitations: A new \"Limitations\" subsection has been added to the discussion, as you recommended, to address the constraints of the current study. Thank you again for your time and expertise, which have greatly improved the quality of my work. Sincerely, Dr. Rana Alfardan Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Comments on this article Comments (0) Version 3 VERSION 3 PUBLISHED 16 Jan 2026 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 3 4 Version 3 (revision) 12 May 26 Version 2 (revision) 26 Mar 26 read read read Version 1 16 Jan 26 read read Adeolu Oluremi , University of Arkansas at Little Rock, Little Rock, USA Tingbo Liang , Zhejiang University School of Medicine, Hangzhou, China Ramina Khoshaba Elia , University of Baghdad, Baghdad, Iraq Dheyaa Al-Sallami , Southern Illinois University School of Medicine, Springfield, USA Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Al-Sallami D. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 20 Apr 2026 | for Version 2 Dheyaa Al-Sallami , Pharmacology, Southern Illinois University School of Medicine, Springfield, Illinois, USA 0 Views copyright © 2026 Al-Sallami D. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The paper addresses a genuinely underexplored question — the role of a specific H/ACA snoRNA in pancreatic cancer apoptosis — and the direction is scientifically interesting. However, the study has significant methodological and interpretive gaps that must be addressed before full approval. The following specific corrections are requested. I would be prepared to approve the manuscript after these revisions have been satisfactorily addressed Here are the 11 unique comments: 1. Title : Replace \"Small Nuclear RNA 64\" with \"Small Nucleolar RNA, H/ACA Box 64\" to reflect the correct molecular classification per HGNC nomenclature. 2. Abstract , line 1: Same nomenclature correction: \"Small Nuclear RNA\" to be \"Small Nucleolar RNA.\" Also, add a sentence briefly defining the H/ACA snoRNA family for readers unfamiliar with ncRNA biology. 3. Abstract, Results: The abstract summarizes results as directional changes without quantification. Include representative fold-change values and p-values for key findings (e.g., p53, BCL2, CASP-3) to strengthen the abstract's informativeness. 4. Introduction, paragraph 2: The introduction would benefit from a brief overview of H/ACA snoRNA biology: canonical pseudouridylation function, emerging non-canonical roles, and why SNORA64 specifically was selected for study. 5. Methods, RT-PCR: Specify whether this is semi-quantitative RT-PCR or quantitative real-time RT-PCR (qRT-PCR). 6. Methods, Statistics: Clarify whether n = 4 refers to biological replicates (independent experiments) or technical replicates. 7. Results, Cell Viability: Clearly state the time points at which viability was measured. Distinguish between viability (live/dead) and proliferation in the text. 8. Discussion, page 7: Correct \"pro-apoptotic molecules BCL2 and BCL-XL\" to \"anti-apoptotic molecules BCL2 and BCL-XL.\" This is a factual error. 9. Discussion, Mechanism: Add a paragraph discussing possible mechanisms by which a snoRNA could influence mRNA levels of apoptosis genes. Consider: (1) rRNA pseudouridylation affecting translational fidelity, (2) snoRNA-derived small RNAs with miRNA-like activity, (3) direct snoRNA-protein interactions. Acknowledge that the current study cannot distinguish among these possibilities. 10. Discussion, Therapeutic: Remove or substantially qualify the claim that \"SNORA64 can be used as a therapeutic agent.\" This requires in vivo data, pharmacokinetic studies, and drug combination experiments that are entirely absent from this work. 11. Conclusion: Rewrite to use correlative language: \"SNORA64 knockdown was associated with...\" rather than \"SNORA64 promotes apoptosis by increasing...\" Distinguish clearly between observation and interpretation. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Molecular Oncology, CRISPR design and application, Molecular Biology, Molecular Neuroscience , I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Al-Sallami D. Peer Review Report For: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2026, 15 :68 ( https://doi.org/10.5256/f1000research.197739.r471178) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/15-68/v2#referee-response-471178 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Elia R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 17 Apr 2026 | for Version 2 Ramina Khoshaba Elia , University of Baghdad, Baghdad, Baghdad Governorate, Iraq 0 Views copyright © 2026 Elia R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Dr. Al-Fardan addresses an important and emerging topic in cancer biology, particularly the role of non-coding RNAs in apoptosis with clear biological focus on intrinsic apoptosis pathway. The study explores the role of SNORA64, a small nucleolar RNA, in regulating apoptosis-related genes in pancreatic cancer using an in vitro model. Given the increasing importance of non-coding RNAs in cancer biology, Title: I suggest revising the title to better highlight the outcomes of the study. For example: \"SNORA64 Knockdown Promotes Anti-Apoptotic Signaling and Cell Survival in Pancreatic Cancer Cell\" 2. Materials and Methods The gene expression analysis provides useful information, it does not confirm whether apoptosis is actually occurring. Techniques such as Annexin V/PI staining, caspase activity assays, or flow cytometry should be included to validate the biological effects. 2.2 Real-time reverse transcription polymerase chain reaction (RT-PCR). - The qPCR analysis lacks information on normalization methods (e.g., ΔΔCt). Also, Primer validation and efficiency are not reported . - The use of gel electrophoresis for qPCR validation is no longer commonly used. 2.4 Analytical statistics The use of Student’s t -test alone may not be sufficient given the number of comparisons performed across multiple genes. The application of more appropriate statistical methods, such as analysis of variance (ANOVA) followed by post hoc testing, is recommended. Writing and Presentation: The manuscript is generally well structured; however, there are multiple language and grammar issues that affect clarity. Professional editing services are recommended to address language issues. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Partly Competing Interests No competing interests were disclosed. Reviewer Expertise Genetics, Cancer Research, Molecular Biology, Microbial Genetics, Gene Expression and qPCR Analysis. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Elia RK. Peer Review Report For: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2026, 15 :68 ( https://doi.org/10.5256/f1000research.197739.r471177) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/15-68/v2#referee-response-471177 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Liang T. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 10 Apr 2026 | for Version 2 Tingbo Liang , Zhejiang University School of Medicine, Hangzhou, Zhejiang, China 0 Views copyright © 2026 Liang T. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The authors have responded appropriately to the issues raised, and I consider the manuscript acceptable in its revised form. Competing Interests No competing interests were disclosed. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Liang T. Peer Review Report For: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2026, 15 :68 ( https://doi.org/10.5256/f1000research.197739.r470979) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/15-68/v2#referee-response-470979 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Liang T. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 23 Feb 2026 | for Version 1 Tingbo Liang , Zhejiang University School of Medicine, Hangzhou, Zhejiang, China 0 Views copyright © 2026 Liang T. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Not Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Alfardan examines SNORA64 knockdown in PK-8 pancreatic adenocarcinoma cells using qPCR of BCL-2 family genes and viability/proliferation assays to argue SNORA64 regulates intrinsic apoptosis. While the concept is interesting, the conclusions are based mainly on mRNA changes and non-specific viability readouts, without direct apoptosis validation and with insufficient methodological detail. Substantial additional experiments and clearer reporting are required. Apoptosis is inferred from mRNA only; functional apoptosis assays are needed. Please include at least one direct apoptosis readout: Annexin V/PI (or Annexin V/7-AAD) flow cytometry;Caspase-3/7 activity, cleaved caspase-3 and cleaved PARP by Western blot;Mitochondrial membrane potential (JC-1/TMRE) and cytochrome c release to connect to intrinsic pathway. Without these, it is difficult to conclude that apoptosis is truly altered rather than changes in transcription accompanying altered growth state. Clarify causality and strengthen mechanistic claims. The conclusion states “SNORA64 interactions with apoptotic inhibitor molecules,” but no interaction data are described. If “interaction” is meant mechanistically, consider: RNA pulldown / RIP (e.g., with candidate RNA-binding proteins) or CLIP-based approaches;Assessment of snoRNA canonical function (rRNA modification targets) and whether those changes affect translation of apoptosis regulators. Use of a single cell line limits generalizability. Findings are based on PK-8 only. Pancreatic cancer is heterogeneous. Please validate in additional PDAC lines (e.g., PANC-1, MiaPaCa-2, BxPC-3, AsPC-1) and/or a non-malignant pancreatic ductal cell line as a baseline. Knockdown validation and experimental design details are insufficient. Provide SNORA64 knockdown efficiency (qPCR Ct values, % reduction) and number of independent biological replicates. Therapeutic sensitization claim requires treatment context. The final sentence implies SNORA64 can increase sensitivity “during treatment,” but no drug or stress condition is tested. Consider adding experiments with standard PDAC agents (e.g., gemcitabine, nab-paclitaxel, irinotecan/5-FU regimens) or apoptosis inducers, showing differential response between scramble and knockdown (or rescue with SNORA64 re-expression). Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Partly Competing Interests No competing interests were disclosed. Reviewer Expertise Pancreatic cancer I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above. reply Respond to this report Responses (1) Author Response 26 Mar 2026 Rana Alfardan, Community Health Techniques Department, Southern Technical University, Basrah, 61004, Iraq Dear Dr. Tingbo Liang, Thank you very much for your time and for your insightful comments on my manuscript. I would like to address the points you have raised and provide clarification where necessary: Regarding the assessment of apoptosis, quantitative real-time PCR (qPCR) results provide supporting evidence of apoptosis through the evaluation of changes in gene expression. Nevertheless, I acknowledge that confirmation via protein cleavage assays or flow cytometry constitutes an essential step and will be pursued in future investigations. The use of a single cell line is acknowledged as a limitation of the current study. This point has now been explicitly mentioned in the second version of the manuscript. Transfection of the PK-8 cell line was carried out using siRNA oligonucleotides delivered via the psiRNA-h7SKG1 vector. The specific oligo sequences and the detailed protocol are provided in the cited reference. In accordance with the other reviewer’s suggestion, the type of small RNA employed for knockdown has now been clearly specified in the second version. With respect to the therapeutic sensitization effect, I would like to clarify that this interpretation remains speculative at this stage and is proposed as a direction for future studies. Thank you again for your valuable feedback, which has helped strengthen the manuscript. Sincerely, Dr. Rana Alfardan View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Liang T. Peer Review Report For: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2026, 15 :68 ( https://doi.org/10.5256/f1000research.191586.r455858) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/15-68/v1#referee-response-455858 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Oluremi A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 21 Jan 2026 | for Version 1 Adeolu Oluremi , University of Arkansas at Little Rock, Little Rock, Arkansas, USA 0 Views copyright © 2026 Oluremi A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Title & Abstract Title: Consider making it more specific and impactful. Suggestion: \"Downregulation of SNORA64 Promotes Pancreatic Cancer Cell Survival by Modulating the Apoptotic Regulator Gene Network\" Abstract Methods: The methods description is overly brief. Specify the key techniques used (e.g., RT-qPCR for gene expression, cell viability assay using trypan blue exclusion). Results: Include the key finding about p53 downregulation, as it's a central result. Mention the lack of change in BAD/BIM for completeness. Conclusion: State the potential therapeutic implication more clearly (e.g., \"SNORA64 may serve as a sensitizer to apoptosis-inducing therapies.\"). Introduction Flow: The transition from general apoptosis mechanisms to snoRNAs to SNORA64 specifically is somewhat abrupt. The rationale for studying SNORA64 in pancreatic cancer needs a stronger link. Suggestion: After introducing snoRNAs in cancer, add 1-2 sentences summarizing your previous study (mentioned in the Abstract) that identified SNORA64 as a predictive marker in pancreatic cancer, which directly motivates the current functional investigation into apoptosis. Materials & Methods Clarity and Detail: 2.1: Specify how the SNORA64 knockdown was achieved (e.g., shRNA, siRNA) and the source/sequence of the scramble control. 2.2: The description of gel electrophoresis to \"confirm qPCR results\" is unusual, as qPCR is typically quantitative and agarose gels are qualitative. Clarify if this was for product verification. Table 1: The table formatting is corrupted in the text. Ensure it is presented clearly with separate columns for Gene Symbol, Left Primer, and Right Primer. 2.4: Mention the software used for statistical analysis. Results Logical Order: The results for p53 (3.1) are critical and should be presented before the BCL2 family results (3.2), as p53 is a key upstream regulator of many of these genes. This improves the narrative flow. Figure References: Ensure every figure (1, 2A/B, 3, 4A/B) is explicitly called out in the results text in sequential order. Language: Consistently use \"knockdown\" or \"low expression.\" Avoid switching between them (e.g., \"Pk-8 with SNORA64 knockdown\" vs. \"Pk-8 with low expression of SNORA64\"). Discussion Structure: The discussion is comprehensive but can be better organized to mirror the results. Paragraph 1: Discuss p53 downregulation and its implications. Paragraph 2: Discuss the BCL2 family (anti-apoptotic: BCL2, BCL-XL; pro-apoptotic: BID, BAX, BAK) results. Paragraph 3: Discuss the caspase results and their connection to the BCL2 pathway. Paragraph 4: Synthesize how these molecular changes explain the increased cell viability. Paragraph 5: Discuss the lack of effect on BAD/BIM, which is an interesting negative result—speculate briefly on why SNORA64 might not affect these specific BH3-only proteins. Mechanistic Speculation: The discussion excellently connects the dots. To strengthen it, propose a testable hypothetical model in a sentence (e.g., \"We propose that SNORA64 may influence a transcriptional or post-transcriptional regulator that coordinately modulates p53 and a subset of BCL2 family genes, but not BAD/BIM.\"). Limitations: Add a brief limitations subsection before the conclusion. Acknowledge that this is an in vitro study using a single cell line (PK-8). Future work should validate findings in other pancreatic cancer cell lines and in vivo models. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Cancer Biology, Infectious diseases, Nanotechnology, Biomedical Sciences I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 26 Mar 2026 Rana Alfardan, Community Health Techniques Department, Southern Technical University, Basrah, 61004, Iraq Subject: Revision of the research article (Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro) Dear Dr. Adeolu Oluremi, Thank you very much for your thoughtful and constructive suggestions. I have accepted all of them, and they have significantly enriched my manuscript. Please find below a point-by-point response to your comments: Title: Thank you for your valuable suggestion regarding the manuscript title. I agree that the proposed title, \"Downregulation of SNORA64 Promotes Pancreatic Cancer Cell Survival by Modulating the Apoptotic Regulator Gene Network,\" would indeed be powerful and appropriate for this work. However, upon further consideration of this modification, I have encountered a significant practical constraint. The data of the manuscript has already been published online under its current title, making a title change procedurally difficult at this stage. Furthermore, the previous two editors involved with this manuscript explicitly endorsed the current title during the review process. Given these circumstances, and with respect for the editorial consistency maintained throughout the review process, I believe the title should remain unchanged. I hope you understand this decision, and I appreciate your understanding regarding this limitation. Sincerely, Abstract: As suggested, the abstract has been revised to specify the key techniques used. It now also explicitly includes the key findings regarding p53 downregulation and the lack of change in BAD/BIM. Furthermore, the potential therapeutic implications have been stated more clearly. Conclusion: The conclusion has been revised exactly as you suggested. Introduction: Our previous study is already mentioned in the introduction. The text has been revised to directly introduce pancreatic cancer and explicitly motivate the current functional investigation into apoptosis, creating a smoother transition from the background to the study's objective. Materials and Methods: 2.1: The transfection of the PK-8 cell line is performed with siRNA oligos carried by psiRNA-h7SKG1. The oligo sequences and the protocol are detailed in the cited reference. However, as you suggested, the type of small RNA used for the knockdown has now been specified in the text. 2.2: The sentence regarding the use of agarose gels for qPCR product verification has been revised as you suggested for clarity. Table 1: The table format has been changed as you recommended. It now consists of three columns: Gene Symbol, Left Primer, and Right Primer. 2.4: Excel has now been added to the \"Materials\" subsection as one of the software used for statistical analysis. Results: The results for p53 (3.1) are now presented before the BCL2 family results (3.2), following the logical flow you recommended. Figure References: All figures (Figure 1, 2A/B, 3, 4A/B) are now explicitly called out in the results text in sequential order. Language: For consistency, the phrasing \"PK-8 with SNORA64 knockdown\" is now used consistently throughout the manuscript. Discussion: Paragraph 1: Two sentences have been added to discuss the observed downregulation of p53 and its potential implications. Paragraph 2: This paragraph now focuses on discussing the BCL2 family, including both pro- and anti-apoptotic molecules. Paragraph 3: Two sentences have been added to discuss the connection between the caspase cascade and the BCL2 pathway. Paragraph 4: This paragraph has been rephrased, and three sentences have been added to elaborate on the increase in cell viability. Paragraph 5: A new paragraph specifically discussing BIM and BAD has been added. Mechanistic Speculation: Thank you for this excellent suggestion. This section has been incorporated into the revised manuscript (version 2). Limitations: A new \"Limitations\" subsection has been added to the discussion, as you recommended, to address the constraints of the current study. Thank you again for your time and expertise, which have greatly improved the quality of my work. Sincerely, Dr. Rana Alfardan View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Oluremi A. Peer Review Report For: Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator Genes in Pancreatic Cancer in Vitro [version 1; peer review: 1 approved with reservations, 1 not approved] . F1000Research 2026, 15 :68 ( https://doi.org/10.5256/f1000research.191586.r451315) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/15-68/v1#referee-response-451315 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = \"Effect of Small Nuclear RNA 64 (SNORA64)...\".replace(\"'\", ''); var linkedInUrl = \"http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/15-68/v1\" + \"&title=\" + encodeURIComponent(lTitle) + \"&summary=\" + encodeURIComponent('Read the article by '); var deliciousUrl = \"https://del.icio.us/post?url=https://f1000research.com/articles/15-68/v1&title=\" + encodeURIComponent(lTitle); var redditUrl = \"http://reddit.com/submit?url=https://f1000research.com/articles/15-68/v1\" + \"&title=\" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Alfardan R'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : \"facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com\", services_expanded : \"facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com\", services_custom : [ { name: \"LinkedIn\", url: linkedInUrl, icon:\"/img/icon/at_linkedin.svg\" }, { name: \"Mendeley\", url: \"http://www.mendeley.com/import/?url=https://f1000research.com/articles/15-68/v1/mendeley\", icon:\"/img/icon/at_mendeley.svg\" }, { name: \"Reddit\", url: redditUrl, icon:\"/img/icon/at_reddit.svg\" }, ] }; var addthis_share = { url: \"https://f1000research.com/articles/15-68\", templates : { twitter : \"Effect of Small Nuclear RNA 64 (SNORA64) on Apoptosis Regulator.... Alfardan R, published by \" + \"@F1000Research\" + \", https://f1000research.com/articles/15-68/v1\" } }; if (typeof(addthis) != \"undefined\"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(\".f1r-shares-twitter\").attr(\"href\", \"https://twitter.com/intent/tweet?text=\" + addthis_share.templates.twitter); $(\".f1r-shares-facebook\").attr(\"href\", \"https://www.facebook.com/sharer/sharer.php?u=\" + addthis_share.url); $(\".f1r-shares-linkedin\").attr(\"href\", addthis_config.services_custom[0].url); $(\".f1r-shares-reddit\").attr(\"href\", addthis_config.services_custom[2].url); $(\".f1r-shares-mendelay\").attr(\"href\", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(\".addthis_button_expanded\").each(function(){ var count = $(this).text(); if (count !== \"\" && count != \"0\") $(this).removeClass(\"is-hidden\"); else $(this).addClass(\"is-hidden\"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get(\"/articles/acj/173746/191586\") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay(\"articles\", \"article\", \"191586\"); $(document).ready(function() { $( \"#frame1\" ).on('load', function() { var mydiv = $(this).contents().find(\"div\"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(\".interactive-living-figure-label .icon-more-info\"), titleLivingFigure = tooltipLivingFigure.attr(\"title\"); tooltipLivingFigure.simpletip({ fixed: true, position: [\"-115\", \"30\"], baseClass: 'small-tooltip', content:titleLivingFigure + \" \" }); tooltipLivingFigure.removeAttr(\"title\"); $(\"body\").on(\"click\", \".cite-living-figure\", function(e) { e.preventDefault(); var ref = $(this).attr(\"data-ref\"); $(this).closest(\".living-figure-list-container\").find(\"#\" + ref).fadeIn(200); }); $(\"body\").on(\"click\", \".close-cite-living-figure\", function(e) { e.preventDefault(); $(this).closest(\".popup-window-wrapper\").fadeOut(200); }); $(document).on(\"mouseup\", function(e) { var metricsContainer = $(\".article-metrics-popover-wrapper\"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(\".article-metrics-close-button\").click(); } }); var articleId = $('#articleId').val(); if($(\"#main-article-count-box\").attachArticleMetrics) { $(\"#main-article-count-box\").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(\".new_figshare_widget\"); if (figshareWidget.length > 0) { window.figshare.load(\"f1000\", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr(\"figshare_articleId\") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { \"471175\": 0, \"471174\": 0, \"471173\": 0, \"471172\": 0, \"470979\": 9, \"470978\": 0, \"483983\": 0, \"483982\": 0, \"471181\": 0, \"483981\": 0, \"471180\": 0, \"483980\": 0, \"471179\": 0, \"471178\": 11, \"471177\": 8, \"471176\": 0, \"454382\": 0, \"455854\": 0, \"451310\": 0, \"454383\": 0, \"455855\": 0, \"451311\": 0, \"454380\": 0, \"451308\": 0, \"454381\": 0, \"455853\": 0, \"451309\": 0, \"454378\": 0, \"454379\": 0, \"451307\": 0, \"454377\": 0, \"455862\": 0, \"455860\": 0, \"451316\": 0, \"455861\": 0, \"454386\": 0, \"455858\": 19, \"451314\": 0, \"455859\": 0, \"451315\": 34, \"454384\": 0, \"455856\": 0, \"451312\": 0, \"454385\": 0, \"455857\": 0, \"451313\": 0, }; $(\".referee-response-container,.js-referee-report\").each(function(index, el) { var reportId = $(el).attr(\"data-reportid\"), reportCount = reportIds[reportId] || 0; $(el).find(\".comments-count-container,.js-referee-report-views\").html(reportCount); }); var uuidInput = $(\"#article_uuid\"), oldUUId = uuidInput.val(), newUUId = \"f6aa0d92-7a34-4383-b913-f6fddee30295\"; uuidInput.val(newUUId); $(\"a[href*='article_uuid=']\").each(function(index, el) { var newHref = $(el).attr(\"href\").replace(oldUUId, newUUId); $(el).attr(\"href\", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: \"f1000research\", displayName: \"F1000Research\", hostName: \"f1000research.com\", id: \"1\", editorialEmail: \"research@f1000.com\", infoEmail: \"info@f1000.com\", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(\".cookie-warning\").is(\":visible\")) { $(\".sticky\").css(\"margin-bottom\", \"35px\"); $(\".devices\").addClass(\"devices-and-cookie-warning\"); } $(\".cookie-warning .close-button\").click(function (e) { $(\".devices\").removeClass(\"devices-and-cookie-warning\"); $(\".sticky\").css(\"margin-bottom\", \"0\"); }); $(\"#tweeter-feed .tweet-message\").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(\".partner\").on(\"mouseenter mouseleave\", function() { $(this).find(\".gray-scale, .colour\").toggleClass(\"is-hidden\"); }); }); <!-- Sign in --> Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $(\"a[id=googleSignInButton]\").click(function(event){ event.preventDefault(); $(\"input[id=oAuthSystem]\").val(\"GOOGLE\"); $(\"form[id=oAuthForm]\").submit(); }); $(\"a[id=facebookSignInButton]\").click(function(event){ event.preventDefault(); $(\"input[id=oAuthSystem]\").val(\"FACEBOOK\"); $(\"form[id=oAuthForm]\").submit(); }); $(\"a[id=orcidSignInButton]\").click(function(event){ event.preventDefault(); $(\"input[id=oAuthSystem]\").val(\"ORCID\"); $(\"form[id=oAuthForm]\").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($(\"#sign-in-form-gfb-popup\")); $(\".target-field\").each(function () { var uris = $(this).val().split(\"/\"); if (uris.pop() === \"login\") { $(this).val(uris.toString().replace(\",\",\"/\")); } }); });","source_license":"CC-BY-4.0","license_restricted":false}