{"paper_id":"29c7feb5-10d4-4479-8c1e-2ddb36076872","body_text":"NMES1 promotes lung adenocarcinoma progression by activating PI3K/AKT signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article NMES1 promotes lung adenocarcinoma progression by activating PI3K/AKT signaling pathway Qian Wu, Ning Wang, Chao Sun, Ying Zhang, Jue-ming Han, Hui Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4621213/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Focusing on the role of normal mucosa of esophagus specific 1 (NMES1) in LUAD, TCGA database was hereby first used to explore the expression and prognostic value of NMES1 in LUAD patients. qRT-PCR, Western blotting and immunohistochemistry were utilized to detect expression of NMES1. NMES1 expression was up-regulated in LUAD patients and LUAD cells. Subsequently, siRNA was utilized to transfect LUAD cells to knockdown NMES1. Proliferation, migration and invasion potential were evaluated by cell counting Kit-8, wound healing and transwell migration. Furthermore, experiments were also conducted to investigate the potential mechanisms. Finally, a transplanted tumor model was established to elucidate the functions of NMES1 on the tumorigenesis of LUAD cells. Knockdown of NMES1 notably inhibited proliferation, migration, cell cycle and tumor growth in xenografts. The findings demonstrated the efficiency of NMES1 in mediating the ROS level and Mitochondrial potential to promote PI3K/AKT signaling pathway. Biological sciences/Cancer/Cancer genetics Biological sciences/Cancer/Lung cancer NMES1 LUAD proliferation migration invasion PI3K/AKT Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Despite advancements in understanding its causes, mechanisms, and treatment, lung cancer continues to be the primary cause of cancer-related deaths worldwide, with both its incidence and mortality rates steadily increasing [ 1 ] . According to histopathology, lung cancer can be broadly classified into two main groups of non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), of which NSCLC accounts for approximately 85% of the total incidence of lung cancer. Lung adenocarcinoma (LUAD) has now become the predominant subtype of non-small cell lung cancer (NSCLC), surpassing lung squamous cell carcinoma (LUSC) in prevalence [ 2 ] . Early diagnosis of LUAD often varies. A significant number of patients only seek treatment after experiencing noticeable clinical symptoms, often missing the window for surgery. Although chemotherapy, radiotherapy and immunotherapy bring hope to patients, the occurrence of drug resistance is still inevitable [ 3 ] . Therefore, it is imperative to search for effective tumor markers at the molecular level to help diagnose patients at an early stage and develop individual treatment plans to improve their prognosis. NMES1 was first identified in normal esophageal mucosal tissues. The gene encodes a 0.88kb mRNA, and the protein is thought to be localized in the nucleus. NMES1 is highly expressed in normal esophageal mucosal tissues at both RNA and protein levels, but has low or no expression in esophageal squamous carcinoma (ESCC). This suggests the suppressive role of NMES1 in the development of ESCC [ 4 ] . Arai et al. observed heightened DNA methylation in the promoter region of NMES1 in ESCC cells treated with 5-aza-2'-deoxycytidine, suggesting NMES1's potential as a robust marker for ESCC [ 5 ] . 12-O-tetradecanoylphorbol-13-acetate (TPA) is a highly effective tumor promoter, which can promote the formation of skin tumor in mice [ 6 ] . Penny et al. found that the NMES1 mRNA transcripts were present lower expression in mice susceptible to TPA treatment than those mice resistant to TPA [ 7 ] . In contrast, Su et al. proposed NMES1 as a tumor-promoting gene. They introduced and validated a novel multiplex qRT-PCR method for distinguishing pseudoepitheliomatous hyperplasia from cutaneous squamous cell carcinoma. This method simultaneously detects the expression of NMES1 and KRT9. In cutaneous squamous cell carcinoma, the expression of NMES1 is higher than KRT9 but lower than KRT9 in pseudoepitheliomatous hyperplasia [ 8 ] . TCGA database reveals NMES1 as an independent prognostic factor for glioma. Aberrant methylation of the NMES1 gene is associated with poor prognosis in a variety of cancers. Vitro experiments have demonstrated that NMES1 knockdown reduces proliferation, migration, and invasion of thyroid cancer cells but significantly increases apoptosis [ 9 ] . Zhang et al. observed elevated NMES1 expression in lung squamous carcinoma (LUSC) tissues compared to paraneoplastic tissues through analysis of 30 pairs of samples [ 10 ] . While NMES1 has been preliminarily explored in many cancers, the function and mechanism of NMES1 in LUAD are not fully understood. Herein, the expression and function of NMES1 in LUAD were explored. Firstly, the Cancer Genome Atlas (TCGA) database was utilized to prove that NMES1 was highly expressed in LUAD, and prognostic significance was analyzed. Subsequently, vitro and vivo experiments were performed to investigate the function and related signaling of NMES1. Results Prognosis, function and immune analysis of NMES1 in online database To investigate the expression level of NMES1 in LUAD, the mRNA levels of NMES1 in tumor tissues and normal tissues in TCGA database were analyzed. The results demonstrated that the expression of NMES1 was higher in LUAD tissues (Fig. 1 a). Besides, the correlation between prognosis and NMES1 expression was also explored, and it was found that the patients with high NMES1 expression presented poor overall survival (Fig. 1 b). Undoubtedly, a correlation between NMES1 expression and immune cell activity was observed. Elevated NMES1 levels correlated with increased activation of CD8 T cells (Fig. 1 c). Additionally, genes related to NMES1 function (Fig. 1 d) were explored using the DAVID database. The analysis showed enrichment in pathways such as cellular respiration, oxidative phosphorylation, and chemical carcinogenesis, among others (Fig. 1 e). High NMES1 expression in LUAD tissues Expression of NMES1 mRNA in 14 pairs of LUAD and adjacent tissues was determined by quantitative PCR (Fig. 2 a). Five pairs of tumor and adjacent non-tumor tissues of LUAD patients were collected to perform Western blot (Fig. 2 b). Immunohistochemical (IHC) staining was performed on 10 pairs of tissues (Fig. 2 c). The results demonstrated that NMES1 was elevated in tumor tissues compared with para-carcinoma tissues, and it was also found that mRNA and protein level of NMES1 was highly expressed in three kinds of LUAD cell lines (Fig. 2 d, e). NMES1 knockdown suppressing proliferation and migration, and arresting cell cycle progression in LUAD cells A549 and H1299 cells were hereby selected to establish NMES1 knockdown model for further experiments. Knockdown efficacy was separately confirmed in mRNA and protein levels by PCR and WB (Fig. 3 a, b). CCK8 experiments revealed that knockdown of NMES1 suppressed the proliferation of A549 and H1299 cells (Fig. 3 c). At the same time, the scratch experimental results showed that the healing speed of scratches in the NMES1 knockdown group was slower than that in the control group (Fig. 3 d). The transwell assay was also adopted to detect NMES1 knockdown cell migration and invasion ability (Fig. 3 e, f). Cell cycle analysis demonstrated that A549 and H1299 cells were arrested at S/G2/M phase after knockdown of NMES1(Fig. 3 g). The above experiments were conducted in triplicate. Effect of NMES1 knockdown on ROS accumulation, MMP, apoptosis and ferroptosis The green fluorescence intensity detection using fluorescent microscopy illustrated that the ROS intensity in the NMES1 knockdown group was significantly stronger compared to the NC group (Fig. 4 a). Flow cytometric analysis revealed that NMES1 knockdown contributed to a more significant decline in mitochondrial membrane potential (MMP) (Fig. 4 b). Similarly, the JC-1 red/green ratio, assessed via fluorescent microscopy, demonstrated an elevation upon NMES1 silencing in A549 and H1299 cells (Fig. 4 c). Flow cytometry was also conducted to evaluate the effect of NMES1 on the cell apoptosis. However, no apparent differences in apoptosis were observed between the NMES1 knockdown group and the control group (Fig. 4 d). To further investigate whether NMES1 could inhibit ferroptosis in LUAD cells, the level of Fe2 + in A549 and H1299 cells was measured, and the results indicated that silencing NMES1 increased FerroOrange, suggesting that ferroptosis was negatively modulated by NMES1 (Fig. 4 e). Moreover, although not statistically significant, the mRNA levels of apoptosis and ferroptosis marker genes were assessed (Fig. 4 f). NMES1 knockdown inhibiting tumor growth in vivo To confirm the role of NMES1 in tumor formation, xenograft transplantation experiments were performed. Transfection efficacy was confirmed through Western Blotting (Fig. 5 a). A549 cells transfected with either a control shRNA or shRNA against NMES1 were injected into two groups of nude mice (Fig. 5 b, c). Furthermore, the weight and volume of xenograft tumors in nude mice were also analyzed, and the results showed that compared with the shNC group, knockdown of NMES1 could inhibit tumor growth (Fig. 5 d, e). HE and IHC staining proved the alternation of NMES1 expression. The positive rate of Ki67 was decreased in the shNMES1 group (Fig. 5 f). Overall, these results suggested the oncogenic property of NMES1 in LUAD cells. NMES1 promoting cell proliferation by hindering ROS accumulation via PI3K/AKT pathway Previously, many studies have shown the inextricable connection between ROS and PI3K/AKT pathway in many tumors such as gastric cancer, liver cancer and lung cancer. Therefore, it was hereby speculated that NMES1 promoted malignant proliferation of LUAD cells through the activation of the ROS-mediated PI3K/AKT signaling pathway. As shown in Fig. 6 A, A549 and H1299 cells with NMES1 knockdown inhibited phosphorylation of PI3K and AKT (Fig. 6 a). The ROS scavenger, NAC, not only reversed the effects of NMES1 knockdown on proliferation (Fig. 6 b, c), but also activated PI3K/AKT pathway (Fig. 6 d). These results demonstrated that NMES1 induced proliferation via the reduction of ROS generation in LUAD cells by activating PI3K/AKT pathway. Discussion The present study revealed a significant adverse correlation between NMES1 expression and LUAD prognosis, as indicated by TCGA databases. The results demonstrated that NMES1 regulated proliferation, migration and cell cycle by activating PI3K/AKT signaling pathway in A549 and H1299 cells. NMES1, also named as C15orf48 and MOCCI, was first discovered in 2003 [ 4 ] . NMES1 is a peptide encoded by open reading frame (ORF) in the nucleus, and is then transported to the mitochondria and located in mitochondrial inner membrane. In this study, NMES1 was suggested as a potential substitute for NDUFA4, a subunit of mitochondrial respiratory chain complex IV (cytochrome C oxidase, CcO). This replacement was proposed to inhibit the activity of complex IV during chronic inflammation, resulting in decreased mitochondrial potential and reduced ROS production [ 11 , 12 ] . During RA and COVID-19, activation of macrophages induced the expression of NMES1, which could substitute the CcO subunit NDUFA4, leading to conserved response to inflammatory disease [ 13 ] . Many studies have demonstrated the close correlation between tumorigenesis and chronic inflammation [ 14 , 15 ] . NMES1 acts as an oncogene in thyroid carcinoma and cutaneous squamous cell carcinoma [ 9 ] . Bioinformatics analysis proposed NMES1 as an important oncogene in LUAD and clarified its correlation with prognosis of LUAD. The expression of NMES1 could influence the immune microenvironment. Functional enrichment analysis revealed close association between NMES1 and mitochondrial respiratory chain. However, the role of NMES1 in LUAD has been rarely studied. Herein, it was found that NMES1 functioned as an oncogene in LUAD. Mitochondrial potential was significantly reduced, and ROS accumulation was elevated in NMES1 knockdown cells. Previous studies reported the regulation of ROS levels as a double-edged sword in cancer. In most organisms, the ability to regulate ROS balance was inherent. During the early stages, ROS could induce DNA damage, potentially promoting tumorigenesis. However, excessive ROS levels could initiate oxidative stress. Mild oxidative stress typically impacted processes such as proliferation, differentiation, and the cell cycle, while severe oxidative stress could accelerate aging and result in cell death [ 16 – 18 ] . Although the downregulation of NMES1 resulted in inhibition of cell proliferation, migration and cell cycle arrest, cell apoptosis was not obviously affected. Hence, the present study explored whether NMES1 might trigger alternative forms of cell death, such as ferroptosis. Our findings revealed that in NMES1 knockdown cells, there was a significant increase in iron levels. These results suggested that NMES1 might disturb ROS balance. While the accumulation of ROS did not cause a significant increase in apoptosis, ferroptosis was influenced. The precise mechanism should be further explored. To delve deeper into the molecular mechanism underlying NMES1's promotion of proliferation and migration, the research turned to the pertinent literature for further investigation. ROS induced by NOX4 caused the production of various cytokines such as CCL7 and IL8 via PI3K/AKT pathway, leading to growth of NSCLC [ 19 ] . As an oncogene, FGF21 could decrease ROS production to activate PI3K/AKT signaling [ 20 ] . Isovalerylspiramycin I and artemisia argyi both could inhibit PI3K/AKT signaling by promoting the generation of ROS to exert anti-cancer effect by causing apoptosis and interfering with the cell cycle [ 21 , 22 ] . Therefore, an investigation was conducted to explore whether NMES1 acted on PI3K/AKT pathway, and it was found that the silencing of NMES1 was correlated with a decrease in phosphorylated PI3K and AKT. NAC is extensively acknowledged as an anti-oxidate blocking intracellular ROS. The addition of NAC reversed the inhibition of PI3K/AKT signaling pathway. Hence, it was inferred that NMES1 might regulate PI3K/AKT pathway by ROS. However, this study was also exposed to several limitations. Firstly, while we demonstrated that NMES1 could impact the level of Fe 2+ , other ferroptosis-related agents (such as SOD and LDH) were not explored, and specific mechanistic details were not delved into. Secondly, although it was hypothesized that NMES1 regulated the PI3K/AKT signaling pathway by influencing ROS levels, the downstream signaling pathways remained poorly defined. Conclusion In conclusion, it was hereby found that NMES1, an oncogene in LUAD, induced ROS accumulation to mediate the PI3K/AKT signaling pathway, leading to promoting proliferation and migration. In this case, NMES1 was confirmed to have the potential of acting as a new therapeutic target in LUAD treatment. Methods Database analysis The mRNA expression profiles and clinical data of 510 LUAD samples and 58 normal samples were downloaded from TCGA database. The expression of NMES1 between LUAD and normal tissue was analyzed using R software. According to the NMES1 expression level, LUAD patients were divided into the high expression group and the low expression group. Then, the survival curve was painted using the Kaplan–Meier method. Besides, the relationship between the immune cell expression and two groups was also analyzed. Genes associated with NMES1 were excavated using the online String database. The Database for Annotation Visualization and Integrated Discovery (DAVID) was utilized to investigate the function of these genes. Clinical specimens LUAD tissues were collected, and adjacent normal tissues from patients who had been pathologically diagnosed from the department of thoracic surgery, Second Hospital of Shandong university (Jinan, China) were paired. Patients who received chemotherapy or radiotherapy were excluded. Among these patients, 14 pairs of LUAD specimens and normal specimens were used to detect the mRNA level of NMES1 with the help of real-time PCR. Then, 5 pairs of LUAD cancer tissues and adjacent tissues were chosen to examine the protein level of NMES1 by western blot. Additionally, immunohistochemical analysis was also carried out to evaluate NMES1 protein expression and localization. Cell culture The human LUAD cell lines A549, H1299 and the normal lung cell line HBE were purchased from Procell Life Science & Technology Co. Ltd. (Wuhan, China). A549 and H1299 cell lines were cultured in RPMI-1640 medium, and HBE cells were cultivated in DMEM medium. The medium contained 10% FBS and 1% penicillin and streptomycin. All the cells were fostered in a humidified cell culture incubator at 37°C with 5% CO2. siRNA transfection The siRNA target sequences designed by GenePharma (Shanghai) to silence NMES1 mRNA were the followings: NMES1 siRNA1(5′-3′): CUUCGCUGUAUUCUCUTT; AGAGAAUACACAGCGAAAGTT. NMES1 siRNA2(5′-3′): CAAUCAACCAACAAUGGAATT; UUCCAUUGUUGGUUGAUUGTT Negative control siRNA (5′-3′): UUCUCCGAACGUGUCACGUTT; ACCUGACACGUUCGGAGAATT. The transfection efficiency was evaluated using qRT-PCR and western blot. qRT-PCR Trizol (AG) was used to extract the total RNA from cells, and cDNA was synthesized by ReverTra Ace qPCR RT Master Mix (TOYOBO). Real-time PCR was conducted with SYBR Green Fast qPCR Mix (Abclonal) in accordance with the protocol on a Real-Time PCR System. GADPH was viewed as endogenous control, and the expression levels was calculated utilizing the 2 –ΔΔCT method. The primer sequences used for PCR are shown in Table 1 . Table 1 Primer sequences for PCR are as follows: Primer Sequences (5′-3′) NMES1-F GGTTCAAATGTATTTTTCTCCCAT NMES1-R TTTGGGCTCTGGATAAGGAAT GPX4-F CAGTGAGGCAAGACCGAAGT GPX4-R CCGAACTGGTTACACGGGAA ACSL4-F AATACCTGGACTGGGACCGA ACSL4-R GCTGGACTGGTCAGAGAGTG BCL2-F GTGAACTGGGGGAGGATTGT BCL2-R GCCCAGACTCACATCACCAAG BAX-F GAGGTCTTTTTCCGAGTGGCA BAX-R GGCAAAGTAGAAAAGGGCGAC GADPH-F GCACCGTCAAGGCTGGAAC GADPH-R TGGTGAAGACGCCAGTGGA Western blot Cells (HBE, A549 and H1299) were cultured in 6-well plates, lysed with RIPA buffer containing 1% PMSF, and their total protein concentration was quantified using a BCA Kit. The proteins were then denatured at 100°C for 5 min. Subsequently, 20 µg of each protein sample was loaded onto 10% SDS-PAGE gels and electrophoresed for 60 min. Next, gels having undergone constant current of 200 mA for 90 min were transformed into 0.45µm PVDF membranes. Following blocking with non-fat milk at room temperature for 1 h, the membrane was incubated with primary antibodies [anti-NMES1(1:1000, rabbit. biomatik), anti-pPI3K (1:1000, rabbit. Affinity), anti-pAKT (1:1000, rabbit. Affinity), anti-PI3K (1:1000, rabbit. Cohesion), anti-AKT (1:1000, rabbit. Cohesion), anti-GPX4 (1:1000, rabbit. ABclonal), and anti-β-actin (1:1000, mouse. ABclonal)] at 4°C overnight and was then washed three times. Finally, the membrane was placed in the secondary antibody for 60 min, and the protein bands were captured using the ECL solution. Immunohistochemical analysis Tissue samples were paraffin-embedded and sliced into 5 µm sections. These sections were incubated overnight at 4°C with NMES1 antibody (1:1000). The next day, secondary antibody was applied at room temperature for 30 min. Hematoxylin was used to counterstain the nuclei, followed by dehydration. Finally, visualization and photography were conducted under a microscope. Wound-healing assay Firstly, A549 and H1299 cells with or without NMES1 knockdown were added into 6-well plates. When the cells were maintained at 37°C for 24h, 200-µL pipette tips were employed to scrape the cells. Next, cells were continued to be cultured in fresh RPMI-1640 medium, and pictures were captured at 0 and 24h. CCK8 assay A549 and H1299 were seeded in 96-well plates with a density of 2×10 4 cells/well for 24h. Then, siRNA was transfected into these cells. Cell Counting Kit-8 (CCK8) was added into each well at 24, 48, 72 and 96h. The OD value was evaluated at 450 nm after incubating for one additional hour. Transwell assay An 8-µm pore size chamber was inserted into a 24-well culture plate, dividing it into upper and lower chambers. To assess cell migration, serum-starved cells (1×10 5 cells/well) were seeded in the upper chamber with serum-free medium, while 10% FBS-containing medium was added to the lower chamber. After 24 h, cells in the lower chamber were fixed in 4% paraformaldehyde and stained with crystal violet for 10 min. Visualization was conducted using a microscope. Cell cycle assay Treated cells were collected, washed with PBS, and fixed in 70% ethanol at 4°C for 1 h. After RNase treatment and a 30-minute incubation at 37°C, propidium iodide was added and cells were incubated in the dark. Cell cycle analysis was then conducted using a flow cytometer. Mitochondrial membrane potential detection As a fluorescent probe, the change of JC-1 from red to green fluorescence indicated a decrease in mitochondrial membrane potential. Cells were planted in 6-well plates the day before. JC-1 dye working fluid was added into wells for 20 min at 37°C followed by 3 washes with JC-1 dye buffer. Flow cytometer and confocal microscopy were used to detect mitochondrial membrane potential, respectively. Reactive oxygen species (ROS) assay Reactive Oxygen Species Assay Kit (Beyotime, China) was used to detect the reactive oxygen species (ROS) level of cells. A549 and H1299 cells were cultured in 15mm petri dish. Cells were treated with probe DCFH-DA at 37°C for 20 minutes and then washed with PBS. The fluorescence intensities of DCF were measured using excitation at 488 nm and emission at 525 nm to quantify ROS levels. Intracellular Fe 2+ content assay A549 and H1299 cells, with or without NMES1 knockdown, were seeded into 15 mm petri dishes 24h prior to treatment. Fe 2+ fluorescence probe was loaded into dishes, followed by incubating in 37°C for 1h and washing with PBS for 3 times. Finally, fluorescence was detected using confocal microscopy. Apoptosis assay Cells were collected post-treatment with transfection, washed with PBS, and incubated with an Annexin V-FITC/PI Apoptosis Detection Kit according to the manufacturer’s protocols. Subsequently, flow cytometric analysis was conducted to assess cell apoptosis. Lentivirus transfection and xenograft tumor model Lentiviruses provided by Shanghai GeneChem were used for transfection. Stable A549 cell lines were generated by transfecting with lentiviruses at an MOI of 10 and culturing with puromycin (2 mg/ml) for one week. The transfection efficiency was validated through Western blotting. Five-week-old female nude mice were obtained from HFK Bio-Technology. The animal protocol was approved by Ethics Committee of the Second Hospital of Shandong University. Besides, 12 nude mice were randomly allocated to 2 groups. A549 cells (1×10 7 cells) transfected with shNC or shNMES1 were injected into right underarm of mice (n = 6 mice each). Tumor size was measured every 5 days, and tumor volume was calculated using the following formula: volume = length × width 2 /2(mm 3 ). Finally, the mice were killed, and the tumor tissue was stripped for HE and IHC. Statements All experiments were performed in accordance with relevant guidelines and regulations. All studies were performed under supervised and approved by Ethics Committee of the Second Hospital of Shandong University. Registration No. of the patient study and the animal study is “KYLL-2023(LW)077”. Informed consent was obtained from all subjects and/or their legal guardian(s). All methods are reported in accordance with ARRIVE guidelines ( https://arriveguidelines.org ) for the reporting of animal experiments. Statistical analysis GraphPad Prism software was applied for statistical analyzing and data mapping. The results of immunohistochemistry, wound healing and transwell assay were quantified using image J software. Every experiment was repeated for 3 times. Student’s t-test for significant differences or one-way ANOVA for multiple comparisons was used for data analysis. A p value less than 0.05 was considered statistically significant. Declarations Competing interests The author(s) declare no competing interests. Consent for publication All authors agree with the submission. Author Contribution HW provided direction and instruction. QW and NW designed the experiments. QW and CS carried out the experiments. YZ and JH collected the clinical samples. NW conducted the bioinformatic analyses. YZ conducted data analysis. QW wrote the original draft. QW and HW contributed to furtherly editing the manuscript. All authors reviewed the manuscript. Data Availability The TCGA data was avaliable in https://xenabrowser.net/datapages/. Other data used in this study are available from the corresponding author upon request. References Oliver AL. Lung Cancer: Epidemiology and Screening. Surg Clin North Am. 2022;102(3):335–44.doi: 10.1016/j.suc.2021.12.001 . Travis WD, Brambilla E, Nicholson AG, Yatabe Y, Austin JHM, Beasley MB, et al. The 2015 World Health Organization Classification of Lung Tumors: Impact of Genetic, Clinical and Radiologic Advances Since the 2004 Classification. J Thorac Oncol. 2015;10(9):1243–60.doi: 10.1097/jto.0000000000000630 . Alexander M, Kim SY, Cheng H. Update 2020: Management of Non-Small Cell Lung Cancer. Lung. 2020;198(6):897–907.doi: 10.1007/s00408-020-00407-5 . Zhou J, Wang H, Lu A, Hu G, Luo A, Ding F, et al. A novel gene, NMES1, downregulated in human esophageal squamous cell carcinoma. Int J Cancer. 2002;101(4):311–6.doi: 10.1002/ijc.10600 . Arai M, Imazeki F, Sakai Y, Mikata R, Tada M, Seki N, et al. Analysis of the methylation status of genes up-regulated by the demethylating agent, 5-aza-2'-deoxycytidine, in esophageal squamous cell carcinoma. Oncol Rep. 2008;20(2):405–12. Li H, Brakebusch C. Analyzing skin tumor development in mice by the DMBA/TPA model. Methods Cell Biol. 2021;163:113–21.doi: 10.1016/bs.mcb.2020.08.004 . Riggs PK, Angel JM, Abel EL, DiGiovanni J. Differential gene expression in epidermis of mice sensitive and resistant to phorbol ester skin tumor promotion. Mol Carcinog. 2005;44(2):122–36.doi: 10.1002/mc.20127 . Su A, Ra S, Li X, Zhou J, Binder S. Differentiating cutaneous squamous cell carcinoma and pseudoepitheliomatous hyperplasia by multiplex qRT-PCR. Mod Pathol. 2013;26(11):1433–7.doi: 10.1038/modpathol.2013.82 . Li C, Tang Y, Li Q, Liu H, Ma X, He L, et al. The prognostic and immune significance of C15orf48 in pan-cancer and its relationship with proliferation and apoptosis of thyroid carcinoma. Front Immunol. 2023;14:1131870.doi: 10.3389/fimmu.2023.1131870 . Heng Z. (2001) Preliminary study on the expression of nmes1 gene in lung squamous cell carcinoma tissue. Preliminary analysis of gene expression profile in lung squamous cell carcinoma tissue using Atlas microarray membrane [dissertation/master's thesis]. Beijing (IL): China Union Medical University. (2001). Lee CQE, Kerouanton B, Chothani S, Zhang S, Chen Y, Mantri CK, et al. Coding and non-coding roles of MOCCI (C15ORF48) coordinate to regulate host inflammation and immunity. Nat Commun. 2021;12(1):2130.doi: 10.1038/s41467-021-22397-5 . Endou M, Yoshida K, Hirota M, Nakajima C, Sakaguchi A, Komatsubara N, et al. Coxfa4l3, a novel mitochondrial electron transport chain Complex 4 subunit protein, switches from Coxfa4 during spermatogenesis. Mitochondrion. 2020;52:1–7.doi: 10.1016/j.mito.2020.02.003 . Clayton SA, Daley KK, MacDonald L, Fernandez-Vizarra E, Bottegoni G, O'Neil JD, et al. Inflammation causes remodeling of mitochondrial cytochrome c oxidase mediated by the bifunctional gene C15orf48. Sci Adv. 2021;7(50):eabl5182.doi: 10.1126/sciadv.abl5182 . Murata M. Inflammation and cancer. Environ Health Prev Med. 2018;23(1):50.doi: 10.1186/s12199-018-0740-1 . Kay J, Thadhani E, Samson L, Engelward B. Inflammation-induced DNA damage, mutations and cancer. DNA Repair (Amst). 2019;83:102673.doi: 10.1016/j.dnarep.2019.102673 . Wang J, Yi J. Cancer cell killing via ROS: to increase or decrease, that is the question. Cancer Biol Ther. 2008;7(12):1875–84.doi: 10.4161/cbt.7.12.7067 . Ismail T, Kim Y, Lee H, Lee DS, Lee HS. Interplay Between Mitochondrial Peroxiredoxins and ROS in Cancer Development and Progression. Int J Mol Sci. 2019;20(18).doi: 10.3390/ijms20184407 . Zheng D, Liu J, Piao H, Zhu Z, Wei R, Liu K. ROS-triggered endothelial cell death mechanisms: Focus on pyroptosis, parthanatos, and ferroptosis. Front Immunol. 2022;13:1039241.doi: 10.3389/fimmu.2022.1039241 . Zhang J, Li H, Wu Q, Chen Y, Deng Y, Yang Z, et al. Tumoral NOX4 recruits M2 tumor-associated macrophages via ROS/PI3K signaling-dependent various cytokine production to promote NSCLC growth. Redox Biol. 2019;22:101116.doi: 10.1016/j.redox.2019.101116 . Yu X, Li Y, Jiang G, Fang J, You Z, Shao G, et al. FGF21 promotes non-small cell lung cancer progression by SIRT1/PI3K/AKT signaling. Life Sci. 2021;269:118875.doi: 10.1016/j.lfs.2020.118875 . Liu Z, Huang M, Hong Y, Wang S, Xu Y, Zhong C, et al. Isovalerylspiramycin I suppresses non-small cell lung carcinoma growth through ROS-mediated inhibition of PI3K/AKT signaling pathway. Int J Biol Sci. 2022;18(9):3714–30.doi: 10.7150/ijbs.69989 . Su SH, Sundhar N, Kuo WW, Lai SC, Kuo CH, Ho TJ, et al. Artemisia argyi extract induces apoptosis in human gemcitabine-resistant lung cancer cells via the PI3K/MAPK signaling pathway. J Ethnopharmacol. 2022;299:115658.doi: 10.1016/j.jep.2022.115658 . Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4621213\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":327297181,\"identity\":\"564cb083-7489-487e-9e26-4e8c44982e70\",\"order_by\":0,\"name\":\"Qian Wu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Second Hospital of Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qian\",\"middleName\":\"\",\"lastName\":\"Wu\",\"suffix\":\"\"},{\"id\":327297182,\"identity\":\"47286d97-cccd-43f5-aa3e-6b77cea2064b\",\"order_by\":1,\"name\":\"Ning Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Second Hospital of Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ning\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":327297183,\"identity\":\"721ab409-24db-4750-8037-281e8633bc91\",\"order_by\":2,\"name\":\"Chao Sun\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Second Hospital of Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chao\",\"middleName\":\"\",\"lastName\":\"Sun\",\"suffix\":\"\"},{\"id\":327297184,\"identity\":\"47770a9f-a815-46b1-8600-d64774210bfe\",\"order_by\":3,\"name\":\"Ying Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Second Hospital of Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ying\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":327297187,\"identity\":\"2557ec72-016f-41b5-b73c-c48aa3daf77a\",\"order_by\":4,\"name\":\"Jue-ming Han\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"The Second Hospital of Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jue-ming\",\"middleName\":\"\",\"lastName\":\"Han\",\"suffix\":\"\"},{\"id\":327297188,\"identity\":\"424dda4f-a9bc-4983-9a03-cf255c0c531f\",\"order_by\":5,\"name\":\"Hui Wang\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAu0lEQVRIie3PoQvCQBTH8XccnOWh9SzOP2EimAT/lbO4svXFgXBJzBNE/wvzOwYm7cIWBMFk2NrSEIvVFw33Tb/wPuEB+Hz/mAagputGqrcmNhEuVzTt49mwiSxQ0fKg4zFPhGUGBWIVWYgB2vTEIBWB2+tnYuFKYnMpf5PZzQC9QplYsTVSWC5BIyMlMeQTh1QYpbhk8SG7bDWxqIxj/TLMjaybbB4Ex4e7tymDAAzq7yTOvc/n8/kYvQGy1j/LV1VBzwAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"The Second Hospital of Shandong University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Hui\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-06-22 09:32:19\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4621213/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4621213/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":60635367,\"identity\":\"52435bd2-0092-4ce1-ba17-a365c407d0c6\",\"added_by\":\"auto\",\"created_at\":\"2024-07-19 01:58:43\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2277208,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eComprehensive analysis of NMES1 in TCGA database on expression, prognosis and function. (a) Expression of NMES1 in LUAD patients (N=58 T=510) utilizing TCGA database; (b) Kaplan-Meier survival analysis between NMES1 expression and LUAD prognosis; (c) Expression of immune cells between the NMES1 highly-expressed group and the lowly-expressed group; (d) Relative genes of NMES1; (e) Functional enrichment analysis of NMES1.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4621213/v1/e5757d91a555d76be6a6416c.png\"},{\"id\":60635773,\"identity\":\"6db04503-5aa4-45ce-a67f-43295e4ec320\",\"added_by\":\"auto\",\"created_at\":\"2024-07-19 02:06:43\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2212479,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eExpression levels of NMES1 in LUAD patients and cell lines. (a) The expression level of NMES1 in 14 pairs of LUAD tissues detected by qRT-PCR; (b) NMES1 expression detected by Western blotting in 5 pairs of LUAD tissues; (c) IHC analysis of NMES1 expression in normal and LUAD tissue samples; (d) Expression of NMES1 in HBE, A549, H1299, and H1975 cell lines detected by qRT-PCR and (e)western blot assay.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4621213/v1/2884a193c1497528418b6719.png\"},{\"id\":60635369,\"identity\":\"a0bc734d-32ef-46ce-9e63-a27ad02a6ba1\",\"added_by\":\"auto\",\"created_at\":\"2024-07-19 01:58:43\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":7205834,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffect of NMES1 on the biological functions. (a) qRT-PCR and (b)Western blotting assessment of NMES1 knockdown in A549 and H1299 cell lines; Growth and migration capabilities of NMES1 knockdown cells detected by (c) CCK8, (d) wound healing, and (e) transwell assays; (f) The cell cycles of shNC and shNMES1 cells analyzed using flow cytometry.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4621213/v1/e54c6c3b84b5ba99281b4444.png\"},{\"id\":60635772,\"identity\":\"b79feec8-f5ba-49a1-9ae5-6bccb14fffd0\",\"added_by\":\"auto\",\"created_at\":\"2024-07-19 02:06:43\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":4877515,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eNMES1 influenced cellular respiration. (a) Lipid ROS levels of NMES1 detected using ROS assay; (b-c) MMP detected by JC-1 staining in A549 and H1299 cells with silencing or not silencing NMES1. (d) Cell apoptosis measured by staining with Annexin V-FITC and PI; (e) Intracellular Fe\\u003csup\\u003e2+\\u003c/sup\\u003e analyzed with orange fluorescence; (f) The mRNA expression of relative genes of ferroptosis and apoptosis assessed using qRT-PCR.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4621213/v1/5a5206258233931bd8703157.png\"},{\"id\":60635771,\"identity\":\"96575dc6-db10-48c3-9a40-a5027c6133da\",\"added_by\":\"auto\",\"created_at\":\"2024-07-19 02:06:43\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":2465914,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eXenograft tumor model was built. (a) Knockdown efficiency of NMRS1 in A549 was proved; (b-c) The images of tumor and mice; (d) Tumor weight measured 24 days after subcutaneous injection; (e) Tumor volume calculated every 6 days after subcutaneous injection; (f) Representative images of HE and IHC staining in tumors.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4621213/v1/7ce7d90edb6438c9c5eb698d.png\"},{\"id\":60635365,\"identity\":\"05de77f6-7239-40db-b72e-a8d28be07e75\",\"added_by\":\"auto\",\"created_at\":\"2024-07-19 01:58:43\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1040411,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eNMES1 influenced PI3K/AKT signaling pathway. (a) Expression of PI3K/AKT signaling pathway markers detected in A549 and H1299 cells silencing or not silencing NMES1; (b) Repression of ROS level rescued by NAC; (c) CCK8 assay proving that inhibition of cell proliferation caused by NMES1 knockdown could be reversed by NAC; (d) The protein levels of PI3K/AKT signaling pathway detected with/without NAC.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4621213/v1/11619e2176735f3a3a28f332.png\"},{\"id\":69931439,\"identity\":\"37373fc9-3057-40bd-bf14-745941ad7df5\",\"added_by\":\"auto\",\"created_at\":\"2024-11-26 17:47:22\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":21022495,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4621213/v1/51d87733-1b57-47ff-8c45-c47a812e12d4.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"NMES1 promotes lung adenocarcinoma progression by activating PI3K/AKT signaling pathway\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eDespite advancements in understanding its causes, mechanisms, and treatment, lung cancer continues to be the primary cause of cancer-related deaths worldwide, with both its incidence and mortality rates steadily increasing\\u003csup\\u003e[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]\\u003c/sup\\u003e. According to histopathology, lung cancer can be broadly classified into two main groups of non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), of which NSCLC accounts for approximately 85% of the total incidence of lung cancer. Lung adenocarcinoma (LUAD) has now become the predominant subtype of non-small cell lung cancer (NSCLC), surpassing lung squamous cell carcinoma (LUSC) in prevalence\\u003csup\\u003e[\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]\\u003c/sup\\u003e. Early diagnosis of LUAD often varies. A significant number of patients only seek treatment after experiencing noticeable clinical symptoms, often missing the window for surgery. Although chemotherapy, radiotherapy and immunotherapy bring hope to patients, the occurrence of drug resistance is still inevitable\\u003csup\\u003e[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]\\u003c/sup\\u003e. Therefore, it is imperative to search for effective tumor markers at the molecular level to help diagnose patients at an early stage and develop individual treatment plans to improve their prognosis.\\u003c/p\\u003e \\u003cp\\u003eNMES1 was first identified in normal esophageal mucosal tissues. The gene encodes a 0.88kb mRNA, and the protein is thought to be localized in the nucleus. NMES1 is highly expressed in normal esophageal mucosal tissues at both RNA and protein levels, but has low or no expression in esophageal squamous carcinoma (ESCC). This suggests the suppressive role of NMES1 in the development of ESCC\\u003csup\\u003e[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]\\u003c/sup\\u003e. Arai et al. observed heightened DNA methylation in the promoter region of NMES1 in ESCC cells treated with 5-aza-2'-deoxycytidine, suggesting NMES1's potential as a robust marker for ESCC\\u003csup\\u003e[\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]\\u003c/sup\\u003e. 12-O-tetradecanoylphorbol-13-acetate (TPA) is a highly effective tumor promoter, which can promote the formation of skin tumor in mice\\u003csup\\u003e[\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]\\u003c/sup\\u003e. Penny et al. found that the NMES1 mRNA transcripts were present lower expression in mice susceptible to TPA treatment than those mice resistant to TPA\\u003csup\\u003e[\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]\\u003c/sup\\u003e. In contrast, Su et al. proposed NMES1 as a tumor-promoting gene. They introduced and validated a novel multiplex qRT-PCR method for distinguishing pseudoepitheliomatous hyperplasia from cutaneous squamous cell carcinoma. This method simultaneously detects the expression of NMES1 and KRT9. In cutaneous squamous cell carcinoma, the expression of NMES1 is higher than KRT9 but lower than KRT9 in pseudoepitheliomatous hyperplasia\\u003csup\\u003e[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]\\u003c/sup\\u003e. TCGA database reveals NMES1 as an independent prognostic factor for glioma. Aberrant methylation of the NMES1 gene is associated with poor prognosis in a variety of cancers. Vitro experiments have demonstrated that NMES1 knockdown reduces proliferation, migration, and invasion of thyroid cancer cells but significantly increases apoptosis\\u003csup\\u003e[\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]\\u003c/sup\\u003e. Zhang et al. observed elevated NMES1 expression in lung squamous carcinoma (LUSC) tissues compared to paraneoplastic tissues through analysis of 30 pairs of samples\\u003csup\\u003e[\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]\\u003c/sup\\u003e. While NMES1 has been preliminarily explored in many cancers, the function and mechanism of NMES1 in LUAD are not fully understood.\\u003c/p\\u003e \\u003cp\\u003eHerein, the expression and function of NMES1 in LUAD were explored. Firstly, the Cancer Genome Atlas (TCGA) database was utilized to prove that NMES1 was highly expressed in LUAD, and prognostic significance was analyzed. Subsequently, vitro and vivo experiments were performed to investigate the function and related signaling of NMES1.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePrognosis, function and immune analysis of NMES1 in online database\\u003c/h2\\u003e \\u003cp\\u003eTo investigate the expression level of NMES1 in LUAD, the mRNA levels of NMES1 in tumor tissues and normal tissues in TCGA database were analyzed. The results demonstrated that the expression of NMES1 was higher in LUAD tissues (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea). Besides, the correlation between prognosis and NMES1 expression was also explored, and it was found that the patients with high NMES1 expression presented poor overall survival (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb). Undoubtedly, a correlation between NMES1 expression and immune cell activity was observed. Elevated NMES1 levels correlated with increased activation of CD8 T cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec). Additionally, genes related to NMES1 function (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ed) were explored using the DAVID database. The analysis showed enrichment in pathways such as cellular respiration, oxidative phosphorylation, and chemical carcinogenesis, among others (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ee).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eHigh NMES1 expression in LUAD tissues\\u003c/h2\\u003e \\u003cp\\u003eExpression of NMES1 mRNA in 14 pairs of LUAD and adjacent tissues was determined by quantitative PCR (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea). Five pairs of tumor and adjacent non-tumor tissues of LUAD patients were collected to perform Western blot (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eb). Immunohistochemical (IHC) staining was performed on 10 pairs of tissues (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ec). The results demonstrated that NMES1 was elevated in tumor tissues compared with para-carcinoma tissues, and it was also found that mRNA and protein level of NMES1 was highly expressed in three kinds of LUAD cell lines (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ed, e).\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eNMES1 knockdown suppressing proliferation and migration, and arresting cell cycle progression in LUAD cells\\u003c/h3\\u003e\\n\\u003cp\\u003eA549 and H1299 cells were hereby selected to establish NMES1 knockdown model for further experiments. Knockdown efficacy was separately confirmed in mRNA and protein levels by PCR and WB (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea, b). CCK8 experiments revealed that knockdown of NMES1 suppressed the proliferation of A549 and H1299 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ec). At the same time, the scratch experimental results showed that the healing speed of scratches in the NMES1 knockdown group was slower than that in the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ed). The transwell assay was also adopted to detect NMES1 knockdown cell migration and invasion ability (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ee, f). Cell cycle analysis demonstrated that A549 and H1299 cells were arrested at S/G2/M phase after knockdown of NMES1(Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eg). The above experiments were conducted in triplicate.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEffect of NMES1 knockdown on ROS accumulation, MMP, apoptosis and ferroptosis\\u003c/h2\\u003e \\u003cp\\u003eThe green fluorescence intensity detection using fluorescent microscopy illustrated that the ROS intensity in the NMES1 knockdown group was significantly stronger compared to the NC group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ea). Flow cytometric analysis revealed that NMES1 knockdown contributed to a more significant decline in mitochondrial membrane potential (MMP) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eb). Similarly, the JC-1 red/green ratio, assessed via fluorescent microscopy, demonstrated an elevation upon NMES1 silencing in A549 and H1299 cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ec). Flow cytometry was also conducted to evaluate the effect of NMES1 on the cell apoptosis. However, no apparent differences in apoptosis were observed between the NMES1 knockdown group and the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ed). To further investigate whether NMES1 could inhibit ferroptosis in LUAD cells, the level of Fe2\\u0026thinsp;+\\u0026thinsp;in A549 and H1299 cells was measured, and the results indicated that silencing NMES1 increased FerroOrange, suggesting that ferroptosis was negatively modulated by NMES1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ee). Moreover, although not statistically significant, the mRNA levels of apoptosis and ferroptosis marker genes were assessed (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003ef).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eNMES1 knockdown inhibiting tumor growth in vivo\\u003c/h2\\u003e \\u003cp\\u003eTo confirm the role of NMES1 in tumor formation, xenograft transplantation experiments were performed. Transfection efficacy was confirmed through Western Blotting (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ea). A549 cells transfected with either a control shRNA or shRNA against NMES1 were injected into two groups of nude mice (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eb, c). Furthermore, the weight and volume of xenograft tumors in nude mice were also analyzed, and the results showed that compared with the shNC group, knockdown of NMES1 could inhibit tumor growth (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ed, e). HE and IHC staining proved the alternation of NMES1 expression. The positive rate of Ki67 was decreased in the shNMES1 group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003ef). Overall, these results suggested the oncogenic property of NMES1 in LUAD cells.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eNMES1 promoting cell proliferation by hindering ROS accumulation via PI3K/AKT pathway\\u003c/h2\\u003e \\u003cp\\u003ePreviously, many studies have shown the inextricable connection between ROS and PI3K/AKT pathway in many tumors such as gastric cancer, liver cancer and lung cancer. Therefore, it was hereby speculated that NMES1 promoted malignant proliferation of LUAD cells through the activation of the ROS-mediated PI3K/AKT signaling pathway. As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eA, A549 and H1299 cells with NMES1 knockdown inhibited phosphorylation of PI3K and AKT (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003ea). The ROS scavenger, NAC, not only reversed the effects of NMES1 knockdown on proliferation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eb, c), but also activated PI3K/AKT pathway (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003ed). These results demonstrated that NMES1 induced proliferation via the reduction of ROS generation in LUAD cells by activating PI3K/AKT pathway.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eThe present study revealed a significant adverse correlation between NMES1 expression and LUAD prognosis, as indicated by TCGA databases. The results demonstrated that NMES1 regulated proliferation, migration and cell cycle by activating PI3K/AKT signaling pathway in A549 and H1299 cells.\\u003c/p\\u003e \\u003cp\\u003eNMES1, also named as C15orf48 and MOCCI, was first discovered in 2003\\u003csup\\u003e[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]\\u003c/sup\\u003e. NMES1 is a peptide encoded by open reading frame (ORF) in the nucleus, and is then transported to the mitochondria and located in mitochondrial inner membrane. In this study, NMES1 was suggested as a potential substitute for NDUFA4, a subunit of mitochondrial respiratory chain complex IV (cytochrome C oxidase, CcO). This replacement was proposed to inhibit the activity of complex IV during chronic inflammation, resulting in decreased mitochondrial potential and reduced ROS production \\u003csup\\u003e[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]\\u003c/sup\\u003e. During RA and COVID-19, activation of macrophages induced the expression of NMES1, which could substitute the CcO subunit NDUFA4, leading to conserved response to inflammatory disease \\u003csup\\u003e[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]\\u003c/sup\\u003e. Many studies have demonstrated the close correlation between tumorigenesis and chronic inflammation \\u003csup\\u003e[\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eNMES1 acts as an oncogene in thyroid carcinoma and cutaneous squamous cell carcinoma \\u003csup\\u003e[\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]\\u003c/sup\\u003e. Bioinformatics analysis proposed NMES1 as an important oncogene in LUAD and clarified its correlation with prognosis of LUAD. The expression of NMES1 could influence the immune microenvironment. Functional enrichment analysis revealed close association between NMES1 and mitochondrial respiratory chain. However, the role of NMES1 in LUAD has been rarely studied. Herein, it was found that NMES1 functioned as an oncogene in LUAD. Mitochondrial potential was significantly reduced, and ROS accumulation was elevated in NMES1 knockdown cells. Previous studies reported the regulation of ROS levels as a double-edged sword in cancer. In most organisms, the ability to regulate ROS balance was inherent. During the early stages, ROS could induce DNA damage, potentially promoting tumorigenesis. However, excessive ROS levels could initiate oxidative stress. Mild oxidative stress typically impacted processes such as proliferation, differentiation, and the cell cycle, while severe oxidative stress could accelerate aging and result in cell death \\u003csup\\u003e[\\u003cspan additionalcitationids=\\\"CR17\\\" citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]\\u003c/sup\\u003e. Although the downregulation of NMES1 resulted in inhibition of cell proliferation, migration and cell cycle arrest, cell apoptosis was not obviously affected. Hence, the present study explored whether NMES1 might trigger alternative forms of cell death, such as ferroptosis. Our findings revealed that in NMES1 knockdown cells, there was a significant increase in iron levels. These results suggested that NMES1 might disturb ROS balance. While the accumulation of ROS did not cause a significant increase in apoptosis, ferroptosis was influenced. The precise mechanism should be further explored.\\u003c/p\\u003e \\u003cp\\u003eTo delve deeper into the molecular mechanism underlying NMES1's promotion of proliferation and migration, the research turned to the pertinent literature for further investigation. ROS induced by NOX4 caused the production of various cytokines such as CCL7 and IL8 via PI3K/AKT pathway, leading to growth of NSCLC \\u003csup\\u003e[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]\\u003c/sup\\u003e. As an oncogene, FGF21 could decrease ROS production to activate PI3K/AKT signaling \\u003csup\\u003e[\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]\\u003c/sup\\u003e. Isovalerylspiramycin I and artemisia argyi both could inhibit PI3K/AKT signaling by promoting the generation of ROS to exert anti-cancer effect by causing apoptosis and interfering with the cell cycle \\u003csup\\u003e[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]\\u003c/sup\\u003e. Therefore, an investigation was conducted to explore whether NMES1 acted on PI3K/AKT pathway, and it was found that the silencing of NMES1 was correlated with a decrease in phosphorylated PI3K and AKT. NAC is extensively acknowledged as an anti-oxidate blocking intracellular ROS. The addition of NAC reversed the inhibition of PI3K/AKT signaling pathway. Hence, it was inferred that NMES1 might regulate PI3K/AKT pathway by ROS.\\u003c/p\\u003e \\u003cp\\u003eHowever, this study was also exposed to several limitations. Firstly, while we demonstrated that NMES1 could impact the level of Fe\\u003csup\\u003e2+\\u003c/sup\\u003e, other ferroptosis-related agents (such as SOD and LDH) were not explored, and specific mechanistic details were not delved into. Secondly, although it was hypothesized that NMES1 regulated the PI3K/AKT signaling pathway by influencing ROS levels, the downstream signaling pathways remained poorly defined.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eIn conclusion, it was hereby found that NMES1, an oncogene in LUAD, induced ROS accumulation to mediate the PI3K/AKT signaling pathway, leading to promoting proliferation and migration. In this case, NMES1 was confirmed to have the potential of acting as a new therapeutic target in LUAD treatment.\\u003c/p\\u003e \"},{\"header\":\"Methods\",\"content\":\"\\u003ch2\\u003eDatabase analysis\\u003c/h2\\u003e\\u003cp\\u003eThe mRNA expression profiles and clinical data of 510 LUAD samples and 58 normal samples were downloaded from TCGA database. The expression of NMES1 between LUAD and normal tissue was analyzed using R software. According to the NMES1 expression level, LUAD patients were divided into the high expression group and the low expression group. Then, the survival curve was painted using the Kaplan–Meier method. Besides, the relationship between the immune cell expression and two groups was also analyzed. Genes associated with NMES1 were excavated using the online String database. The Database for Annotation Visualization and Integrated Discovery (DAVID) was utilized to investigate the function of these genes.\\u003c/p\\u003e\\u003ch2\\u003eClinical specimens\\u003c/h2\\u003e\\u003cp\\u003eLUAD tissues were collected, and adjacent normal tissues from patients who had been pathologically diagnosed from the department of thoracic surgery, Second Hospital of Shandong university (Jinan, China) were paired. Patients who received chemotherapy or radiotherapy were excluded. Among these patients, 14 pairs of LUAD specimens and normal specimens were used to detect the mRNA level of NMES1 with the help of real-time PCR. Then, 5 pairs of LUAD cancer tissues and adjacent tissues were chosen to examine the protein level of NMES1 by western blot. Additionally, immunohistochemical analysis was also carried out to evaluate NMES1 protein expression and localization.\\u003c/p\\u003e\\u003ch2\\u003eCell culture\\u003c/h2\\u003e\\u003cp\\u003eThe human LUAD cell lines A549, H1299 and the normal lung cell line HBE were purchased from Procell Life Science \\u0026amp; Technology Co. Ltd. (Wuhan, China). A549 and H1299 cell lines were cultured in RPMI-1640 medium, and HBE cells were cultivated in DMEM medium. The medium contained 10% FBS and 1% penicillin and streptomycin. All the cells were fostered in a humidified cell culture incubator at 37°C with 5% CO2.\\u003c/p\\u003e\\u003ch2\\u003esiRNA transfection\\u003c/h2\\u003e\\u003cp\\u003eThe siRNA target sequences designed by GenePharma (Shanghai) to silence NMES1 mRNA were the followings:\\u003c/p\\u003e\\u003cp\\u003eNMES1 siRNA1(5′-3′): CUUCGCUGUAUUCUCUTT; AGAGAAUACACAGCGAAAGTT.\\u003c/p\\u003e\\u003cp\\u003eNMES1 siRNA2(5′-3′): CAAUCAACCAACAAUGGAATT; UUCCAUUGUUGGUUGAUUGTT\\u003c/p\\u003e\\u003cp\\u003eNegative control siRNA (5′-3′): UUCUCCGAACGUGUCACGUTT; ACCUGACACGUUCGGAGAATT.\\u003c/p\\u003e\\u003cp\\u003eThe transfection efficiency was evaluated using qRT-PCR and western blot.\\u003c/p\\u003e\\u003ch2\\u003eqRT-PCR\\u003c/h2\\u003e\\u003cp\\u003eTrizol (AG) was used to extract the total RNA from cells, and cDNA was synthesized by ReverTra Ace qPCR RT Master Mix (TOYOBO). Real-time PCR was conducted with SYBR Green Fast qPCR Mix (Abclonal) in accordance with the protocol on a Real-Time PCR System. GADPH was viewed as endogenous control, and the expression levels was calculated utilizing the 2\\u003csup\\u003e–ΔΔCT\\u003c/sup\\u003e method. The primer sequences used for PCR are shown in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimer sequences for PCR are as follows:\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e\\u003ccolgroup cols=\\\"2\\\"\\u003e\\u003c/colgroup\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer\\u003c/p\\u003e \\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eSequences (5′-3′)\\u003c/p\\u003e \\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eNMES1-F\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGTTCAAATGTATTTTTCTCCCAT\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eNMES1-R\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTTTGGGCTCTGGATAAGGAAT\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGPX4-F\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCAGTGAGGCAAGACCGAAGT\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGPX4-R\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCGAACTGGTTACACGGGAA\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eACSL4-F\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAATACCTGGACTGGGACCGA\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eACSL4-R\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCTGGACTGGTCAGAGAGTG\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBCL2-F\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGTGAACTGGGGGAGGATTGT\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBCL2-R\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCCCAGACTCACATCACCAAG\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBAX-F\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGAGGTCTTTTTCCGAGTGGCA\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBAX-R\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGCAAAGTAGAAAAGGGCGAC\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGADPH-F\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCACCGTCAAGGCTGGAAC\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGADPH-R\\u003c/p\\u003e \\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTGGTGAAGACGCCAGTGGA\\u003c/p\\u003e \\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003ch2\\u003eWestern blot\\u003c/h2\\u003e\\u003cp\\u003eCells (HBE, A549 and H1299) were cultured in 6-well plates, lysed with RIPA buffer containing 1% PMSF, and their total protein concentration was quantified using a BCA Kit. The proteins were then denatured at 100°C for 5 min. Subsequently, 20 µg of each protein sample was loaded onto 10% SDS-PAGE gels and electrophoresed for 60 min. Next, gels having undergone constant current of 200 mA for 90 min were transformed into 0.45µm PVDF membranes. Following blocking with non-fat milk at room temperature for 1 h, the membrane was incubated with primary antibodies [anti-NMES1(1:1000, rabbit. biomatik), anti-pPI3K (1:1000, rabbit. Affinity), anti-pAKT (1:1000, rabbit. Affinity), anti-PI3K (1:1000, rabbit. Cohesion), anti-AKT (1:1000, rabbit. Cohesion), anti-GPX4 (1:1000, rabbit. ABclonal), and anti-β-actin (1:1000, mouse. ABclonal)] at 4°C overnight and was then washed three times. Finally, the membrane was placed in the secondary antibody for 60 min, and the protein bands were captured using the ECL solution.\\u003c/p\\u003e\\u003ch2\\u003eImmunohistochemical analysis\\u003c/h2\\u003e\\u003cp\\u003eTissue samples were paraffin-embedded and sliced into 5 µm sections. These sections were incubated overnight at 4°C with NMES1 antibody (1:1000). The next day, secondary antibody was applied at room temperature for 30 min. Hematoxylin was used to counterstain the nuclei, followed by dehydration. Finally, visualization and photography were conducted under a microscope.\\u003c/p\\u003e\\u003ch2\\u003eWound-healing assay\\u003c/h2\\u003e\\u003cp\\u003eFirstly, A549 and H1299 cells with or without NMES1 knockdown were added into 6-well plates. When the cells were maintained at 37°C for 24h, 200-µL pipette tips were employed to scrape the cells. Next, cells were continued to be cultured in fresh RPMI-1640 medium, and pictures were captured at 0 and 24h.\\u003c/p\\u003e\\u003ch2\\u003eCCK8 assay\\u003c/h2\\u003e\\u003cp\\u003eA549 and H1299 were seeded in 96-well plates with a density of 2×10\\u003csup\\u003e4\\u003c/sup\\u003e cells/well for 24h. Then, siRNA was transfected into these cells. Cell Counting Kit-8 (CCK8) was added into each well at 24, 48, 72 and 96h. The OD value was evaluated at 450 nm after incubating for one additional hour.\\u003c/p\\u003e\\u003ch2\\u003eTranswell assay\\u003c/h2\\u003e\\u003cp\\u003eAn 8-µm pore size chamber was inserted into a 24-well culture plate, dividing it into upper and lower chambers. To assess cell migration, serum-starved cells (1×10\\u003csup\\u003e5\\u003c/sup\\u003e cells/well) were seeded in the upper chamber with serum-free medium, while 10% FBS-containing medium was added to the lower chamber. After 24 h, cells in the lower chamber were fixed in 4% paraformaldehyde and stained with crystal violet for 10 min. Visualization was conducted using a microscope.\\u003c/p\\u003e\\u003ch2\\u003eCell cycle assay\\u003c/h2\\u003e\\u003cp\\u003eTreated cells were collected, washed with PBS, and fixed in 70% ethanol at 4°C for 1 h. After RNase treatment and a 30-minute incubation at 37°C, propidium iodide was added and cells were incubated in the dark. Cell cycle analysis was then conducted using a flow cytometer.\\u003c/p\\u003e\\u003ch2\\u003eMitochondrial membrane potential detection\\u003c/h2\\u003e\\u003cp\\u003eAs a fluorescent probe, the change of JC-1 from red to green fluorescence indicated a decrease in mitochondrial membrane potential. Cells were planted in 6-well plates the day before. JC-1 dye working fluid was added into wells for 20 min at 37°C followed by 3 washes with JC-1 dye buffer. Flow cytometer and confocal microscopy were used to detect mitochondrial membrane potential, respectively.\\u003c/p\\u003e\\u003ch2\\u003eReactive oxygen species (ROS) assay\\u003c/h2\\u003e\\u003cp\\u003eReactive Oxygen Species Assay Kit (Beyotime, China) was used to detect the reactive oxygen species (ROS) level of cells. A549 and H1299 cells were cultured in 15mm petri dish. Cells were treated with probe DCFH-DA at 37°C for 20 minutes and then washed with PBS. The fluorescence intensities of DCF were measured using excitation at 488 nm and emission at 525 nm to quantify ROS levels.\\u003c/p\\u003e\\u003ch2\\u003eIntracellular Fe\\u003csup\\u003e2+\\u003c/sup\\u003e content assay\\u003c/h2\\u003e\\u003cp\\u003eA549 and H1299 cells, with or without NMES1 knockdown, were seeded into 15 mm petri dishes 24h prior to treatment. Fe\\u003csup\\u003e2+\\u003c/sup\\u003e fluorescence probe was loaded into dishes, followed by incubating in 37°C for 1h and washing with PBS for 3 times. Finally, fluorescence was detected using confocal microscopy.\\u003c/p\\u003e\\u003ch2\\u003eApoptosis assay\\u003c/h2\\u003e\\u003cp\\u003eCells were collected post-treatment with transfection, washed with PBS, and incubated with an Annexin V-FITC/PI Apoptosis Detection Kit according to the manufacturer’s protocols. Subsequently, flow cytometric analysis was conducted to assess cell apoptosis.\\u003c/p\\u003e\\u003ch2\\u003eLentivirus transfection and xenograft tumor model\\u003c/h2\\u003e\\u003cp\\u003eLentiviruses provided by Shanghai GeneChem were used for transfection. Stable A549 cell lines were generated by transfecting with lentiviruses at an MOI of 10 and culturing with puromycin (2 mg/ml) for one week. The transfection efficiency was validated through Western blotting. Five-week-old female nude mice were obtained from HFK Bio-Technology. The animal protocol was approved by Ethics Committee of the Second Hospital of Shandong University. Besides, 12 nude mice were randomly allocated to 2 groups. A549 cells (1×10\\u003csup\\u003e7\\u003c/sup\\u003ecells) transfected with shNC or shNMES1 were injected into right underarm of mice (n = 6 mice each). Tumor size was measured every 5 days, and tumor volume was calculated using the following formula: volume = length × width\\u003csup\\u003e2\\u003c/sup\\u003e/2(mm\\u003csup\\u003e3\\u003c/sup\\u003e). Finally, the mice were killed, and the tumor tissue was stripped for HE and IHC.\\u003c/p\\u003e\\u003ch2\\u003eStatements\\u003c/h2\\u003e\\u003cp\\u003e All experiments were performed in accordance with relevant guidelines and regulations. All studies were performed under supervised and approved by Ethics Committee of the Second Hospital of Shandong University. Registration No. of the patient study and the animal study is “KYLL-2023(LW)077”. Informed consent was obtained from all subjects and/or their legal guardian(s). All methods are reported in accordance with ARRIVE guidelines (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://arriveguidelines.org\\u003c/span\\u003e\\u003cspan address=\\\"https://arriveguidelines.org\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) for the reporting of animal experiments.\\u003c/p\\u003e\\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e\\u003cp\\u003eGraphPad Prism software was applied for statistical analyzing and data mapping. The results of immunohistochemistry, wound healing and transwell assay were quantified using image J software. Every experiment was repeated for 3 times. Student’s t-test for significant differences or one-way ANOVA for multiple comparisons was used for data analysis. A p value less than 0.05 was considered statistically significant.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e \\u003ch2\\u003eCompeting interests\\u003c/h2\\u003e \\u003cp\\u003eThe author(s) declare no competing interests.\\u003c/p\\u003e \\u003c/p\\u003e\\u003cp\\u003e \\u003ch2\\u003eConsent for publication\\u003c/h2\\u003e \\u003cp\\u003eAll authors agree with the submission.\\u003c/p\\u003e \\u003c/p\\u003e\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eHW provided direction and instruction. QW and NW designed the experiments. QW and CS carried out the experiments. YZ and JH collected the clinical samples. NW conducted the bioinformatic analyses. YZ conducted data analysis. QW wrote the original draft. QW and HW contributed to furtherly editing the manuscript. All authors reviewed the manuscript.\\u003c/p\\u003e\\u003ch2\\u003eData Availability\\u003c/h2\\u003e\\u003cp\\u003eThe TCGA data was avaliable in https://xenabrowser.net/datapages/. Other data used in this study are available from the corresponding author upon request.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eOliver AL. Lung Cancer: Epidemiology and Screening. Surg Clin North Am. 2022;102(3):335\\u0026ndash;44.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.suc.2021.12.001\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.suc.2021.12.001\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTravis WD, Brambilla E, Nicholson AG, Yatabe Y, Austin JHM, Beasley MB, et al. The 2015 World Health Organization Classification of Lung Tumors: Impact of Genetic, Clinical and Radiologic Advances Since the 2004 Classification. J Thorac Oncol. 2015;10(9):1243\\u0026ndash;60.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1097/jto.0000000000000630\\u003c/span\\u003e\\u003cspan address=\\\"10.1097/jto.0000000000000630\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAlexander M, Kim SY, Cheng H. Update 2020: Management of Non-Small Cell Lung Cancer. Lung. 2020;198(6):897\\u0026ndash;907.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s00408-020-00407-5\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s00408-020-00407-5\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhou J, Wang H, Lu A, Hu G, Luo A, Ding F, et al. A novel gene, NMES1, downregulated in human esophageal squamous cell carcinoma. Int J Cancer. 2002;101(4):311\\u0026ndash;6.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/ijc.10600\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/ijc.10600\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eArai M, Imazeki F, Sakai Y, Mikata R, Tada M, Seki N, et al. Analysis of the methylation status of genes up-regulated by the demethylating agent, 5-aza-2'-deoxycytidine, in esophageal squamous cell carcinoma. Oncol Rep. 2008;20(2):405\\u0026ndash;12.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi H, Brakebusch C. Analyzing skin tumor development in mice by the DMBA/TPA model. Methods Cell Biol. 2021;163:113\\u0026ndash;21.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/bs.mcb.2020.08.004\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/bs.mcb.2020.08.004\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRiggs PK, Angel JM, Abel EL, DiGiovanni J. Differential gene expression in epidermis of mice sensitive and resistant to phorbol ester skin tumor promotion. Mol Carcinog. 2005;44(2):122\\u0026ndash;36.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1002/mc.20127\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/mc.20127\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSu A, Ra S, Li X, Zhou J, Binder S. Differentiating cutaneous squamous cell carcinoma and pseudoepitheliomatous hyperplasia by multiplex qRT-PCR. Mod Pathol. 2013;26(11):1433\\u0026ndash;7.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/modpathol.2013.82\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/modpathol.2013.82\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi C, Tang Y, Li Q, Liu H, Ma X, He L, et al. The prognostic and immune significance of C15orf48 in pan-cancer and its relationship with proliferation and apoptosis of thyroid carcinoma. Front Immunol. 2023;14:1131870.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fimmu.2023.1131870\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fimmu.2023.1131870\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHeng Z. (2001) Preliminary study on the expression of nmes1 gene in lung squamous cell carcinoma tissue. Preliminary analysis of gene expression profile in lung squamous cell carcinoma tissue using Atlas microarray membrane [dissertation/master's thesis]. Beijing (IL): China Union Medical University. (2001).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLee CQE, Kerouanton B, Chothani S, Zhang S, Chen Y, Mantri CK, et al. Coding and non-coding roles of MOCCI (C15ORF48) coordinate to regulate host inflammation and immunity. Nat Commun. 2021;12(1):2130.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41467-021-22397-5\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41467-021-22397-5\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEndou M, Yoshida K, Hirota M, Nakajima C, Sakaguchi A, Komatsubara N, et al. Coxfa4l3, a novel mitochondrial electron transport chain Complex 4 subunit protein, switches from Coxfa4 during spermatogenesis. Mitochondrion. 2020;52:1\\u0026ndash;7.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.mito.2020.02.003\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.mito.2020.02.003\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eClayton SA, Daley KK, MacDonald L, Fernandez-Vizarra E, Bottegoni G, O'Neil JD, et al. Inflammation causes remodeling of mitochondrial cytochrome c oxidase mediated by the bifunctional gene C15orf48. Sci Adv. 2021;7(50):eabl5182.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1126/sciadv.abl5182\\u003c/span\\u003e\\u003cspan address=\\\"10.1126/sciadv.abl5182\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMurata M. Inflammation and cancer. Environ Health Prev Med. 2018;23(1):50.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s12199-018-0740-1\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s12199-018-0740-1\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKay J, Thadhani E, Samson L, Engelward B. Inflammation-induced DNA damage, mutations and cancer. DNA Repair (Amst). 2019;83:102673.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.dnarep.2019.102673\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.dnarep.2019.102673\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang J, Yi J. Cancer cell killing via ROS: to increase or decrease, that is the question. Cancer Biol Ther. 2008;7(12):1875\\u0026ndash;84.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.4161/cbt.7.12.7067\\u003c/span\\u003e\\u003cspan address=\\\"10.4161/cbt.7.12.7067\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eIsmail T, Kim Y, Lee H, Lee DS, Lee HS. Interplay Between Mitochondrial Peroxiredoxins and ROS in Cancer Development and Progression. Int J Mol Sci. 2019;20(18).doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3390/ijms20184407\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/ijms20184407\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZheng D, Liu J, Piao H, Zhu Z, Wei R, Liu K. ROS-triggered endothelial cell death mechanisms: Focus on pyroptosis, parthanatos, and ferroptosis. Front Immunol. 2022;13:1039241.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fimmu.2022.1039241\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fimmu.2022.1039241\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang J, Li H, Wu Q, Chen Y, Deng Y, Yang Z, et al. Tumoral NOX4 recruits M2 tumor-associated macrophages via ROS/PI3K signaling-dependent various cytokine production to promote NSCLC growth. Redox Biol. 2019;22:101116.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.redox.2019.101116\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.redox.2019.101116\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYu X, Li Y, Jiang G, Fang J, You Z, Shao G, et al. FGF21 promotes non-small cell lung cancer progression by SIRT1/PI3K/AKT signaling. Life Sci. 2021;269:118875.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.lfs.2020.118875\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.lfs.2020.118875\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu Z, Huang M, Hong Y, Wang S, Xu Y, Zhong C, et al. Isovalerylspiramycin I suppresses non-small cell lung carcinoma growth through ROS-mediated inhibition of PI3K/AKT signaling pathway. Int J Biol Sci. 2022;18(9):3714\\u0026ndash;30.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.7150/ijbs.69989\\u003c/span\\u003e\\u003cspan address=\\\"10.7150/ijbs.69989\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSu SH, Sundhar N, Kuo WW, Lai SC, Kuo CH, Ho TJ, et al. Artemisia argyi extract induces apoptosis in human gemcitabine-resistant lung cancer cells via the PI3K/MAPK signaling pathway. J Ethnopharmacol. 2022;299:115658.doi:\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.jep.2022.115658\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jep.2022.115658\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"NMES1, LUAD, proliferation, migration, invasion, PI3K/AKT\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4621213/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4621213/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eFocusing on the role of normal mucosa of esophagus specific 1 (NMES1) in LUAD, TCGA database was hereby first used to explore the expression and prognostic value of NMES1 in LUAD patients. qRT-PCR, Western blotting and immunohistochemistry were utilized to detect expression of NMES1. NMES1 expression was up-regulated in LUAD patients and LUAD cells. Subsequently, siRNA was utilized to transfect LUAD cells to knockdown NMES1. Proliferation, migration and invasion potential were evaluated by cell counting Kit-8, wound healing and transwell migration. Furthermore, experiments were also conducted to investigate the potential mechanisms. Finally, a transplanted tumor model was established to elucidate the functions of NMES1 on the tumorigenesis of LUAD cells. Knockdown of NMES1 notably inhibited proliferation, migration, cell cycle and tumor growth in xenografts. The findings demonstrated the efficiency of NMES1 in mediating the ROS level and Mitochondrial potential to promote PI3K/AKT signaling pathway.\\u003c/p\\u003e\",\"manuscriptTitle\":\"NMES1 promotes lung adenocarcinoma progression by activating PI3K/AKT signaling pathway\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-07-19 01:58:38\",\"doi\":\"10.21203/rs.3.rs-4621213/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"d03c9eb5-05f4-4d95-b3c9-81cd9244bd27\",\"owner\":[],\"postedDate\":\"July 19th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":34639944,\"name\":\"Biological sciences/Cancer/Cancer genetics\"},{\"id\":34639945,\"name\":\"Biological sciences/Cancer/Lung cancer\"}],\"tags\":[],\"updatedAt\":\"2024-11-26T17:38:41+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-07-19 01:58:38\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4621213\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4621213\",\"identity\":\"rs-4621213\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}