{"paper_id":"28099eb7-c453-4634-8d47-0a09b9ee7ea4","body_text":"Molecular cloning and characterization of a GH10 thermophilic xylanase from hot spring and its potential application in promoting probiotic growth | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular cloning and characterization of a GH10 thermophilic xylanase from hot spring and its potential application in promoting probiotic growth Jian-ling Li, Wei Hu, Lan-Hua Pu, Jing Sun, Maite Ortúzar, Zhi-Hua Lv, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6988407/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 07 Jan, 2026 Read the published version in BMC Biotechnology → Version 1 posted 11 You are reading this latest preprint version Abstract Background Xylan is widely found in plant cell walls, and xylanase, an essential enzyme in xylan breakdown, has promising applications in energy, food, feed, and healthcare sectors. Results This study presents the discovery of a novel GH10 family xylanase gene, termed lc-xyn81, isolated from the hot spring of Eryuan, Dali, Yunnan Province, employing enrichment culture and metagenomic approaches. The amino acid sequence of Lc-Xyn81 shares 72.29% identity with that of Blastocatellia bacte-rium. The gene was amplified via specific PCR, cloned, and heterologously expressed in Esche-richia coli. The recombinant Lc-Xyn81 was purified using Ni-affinity chromatography, followed by enzymatic characterization. Lc-Xyn81 demonstrated optimal activity at 75°C and pH 6.6. It maintained over 80% relative activity between 65–75°C, and its activity increased to over 120% after incubation at 70°C for 40–100 min with a half-life of 180 min at 70°C. Additionally, incu-bation at pH 5.0–7.0 for 12 h boosted its activity to over 140%. Lc-Xyn81 was activated by di-valent metal ions such as Co²⁺(128.55%), Mn²⁺ (119.84%), and Cu²⁺(112.27%). The enzyme ex-hibited activity against beechwood xylan (213.68 U/mg), corncob xylan (143.40 U/mg), and sugarcane bagasse xylan (80.39 U/mg). The primary degradation products were xylobiose and xylotetraose, which significantly promoted the growth of L. lactis. Kinetic analysis indicated that the Km and Vmax values for Lc-Xyn81 were 4.62 mg/ml and 312.5 µmol/min/mg, respectively. Conclusions In summary, Lc-Xyn81, a thermophilic and thermostable xylanase, exhibits considerable poten-tial for industrial applications in lignocellulose degradation and prebiotic production. Hot Springs Metagenomics Xylanase Thermophilic XOS Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Lignocellulose is the most abundant renewable polymeric biomass on Earth, composed of three primary components: cellulose, hemicellulose, and lignin[ 1 ]. Most hemicelluloses are highly branched heteropolymers composed of various sugars in their main and side chains, with xylan being the predominant hemicellulose in plant cell walls [ 2 , 3 ]. Xylan cannot be directly fermented or converted by microorganisms such as yeast[ 4 ]. It must first be degraded by xylanase into xy-lose monomers, xylooligosaccharides, and other derivatives, which can subsequently be utilized for the production of biofuels, prebiotics, and other value-added products[ 5 , 6 ]. Xylanase is the primary enzyme responsible for hydrolyzing xylan, catalyzing the cleavage of β-1,4 linkages between xylose residues in the hemicellulose backbone[ 7 ]. According to the CAZy database ( http://www.cazy.org ), endo-1,4-β-xylanases are classified into several glycoside hydrolase (GH) families. The majority of xylanases belong to the GH10 and GH11 families and are widely distributed in prokaryotes and eukaryotes[ 8 , 9 , 10 ]. Thermophilic and thermostable xylanases are frequently essential for numerous industrial processes. For instance, thermophilic and alkaliphilic xylanases are essential in pulp and paper bleaching processes[ 11 , 12 ], while thermostable and acidophilic xylanases are more desirable in industries such as juice production, baking, and animal feed[ 13 , 14 ]. Currently, suitable thermophilic xylanases for industrial applica-tions are relatively scarce. Therefore, exploring and characterizing thermophilic xylanases through metagenomic approaches offers significant potential for industrial applications. Hot springs represent an intriguing source of novel thermophilic enzymes with potential bio-technological applications[ 15 ], and harbor specialized microorganisms adapted to high temper-atures and extreme pH conditions, which are capable of producing diverse xylanases. Previous studies by Zarafeta et al. and Yin et al. have explored xylanases from hot spring environ-ments[ 16 , 17 ]. Our investigation revealed that Eryuan in Dali, renowned for its rich hot spring re-sources, is an excellent site for discovering thermophilic and thermostable xylanases. Microbial enzymes are now recognized as a major source of diverse biocatalysts, with successful applica-tions across various industrial processes [ 18 ]. However, due to the limitations of pure culture techniques, over 99% of prokaryotic microorganisms cannot be cultured under laboratory condi-tions, which has significantly hindered the development of thermophilic and thermostable xy-lanases[ 19 ]. Metagenomics addresses the limitations of pure culture methods by directly obtain-ing nucleotide sequences of the majority of genes from environmental DNA [ 20 ]. Therefore, metagenomic technology holds great promise for developing thermophilic xylanases from mi-croorganisms in extreme natural environments[ 21 ]. In addition to their industrial applications, thermophilic xylanases can also be utilized for the production of prebiotics. Prebiotics are compounds that can be utilized by gut microbiota and promoting beneficial effects on the gut microbial community. As the pace of modern life quick-ens, living standards rise, and health awareness grows, the value of prebiotics, especially xylooli-gosaccharides (XOS), has garnered considerable attention. XOS are non-digestible oligosaccha-rides consisting of 2–10 xylose units linked by β-1,4 glycosidic bonds, which can be produced by xylanases. It has been reported that the global XOS market was estimated to be valued at $ 99 million in 2019 and is projected to reach $ 128 million by 2025, indicating its significant market potential [ 22 ]. XOS, derived from the processing of lignocellulosic biomass, exhibit various prebi-otic effects and have been utilized to improve human health by preventing colon cancer, regu-lating insulin secretion, and enhancing immune functions[ 23 , 24 ]. Therefore, the discovery and characterization of enzymes capable of converting xylan into sustainable products, such as XOS, which promote bioeconomic growth and benefit human health, are of paramount importance. In this study, a novel xylanase gene (Lc-Xyn81) was isolated from metagenomic data ob-tained from samples collected at the Wenquanjie hot spring in Eryuan, City Dali, China. The gene was characterized through heterologous expression, protein purification, and enzymatic property analysis. The results indicated that Lc-Xyn81 is a thermophilic enzyme with broad pH stability, high resistance to metal ions and chemical reagents, and hydrolysis products primarily consisting of xylobiose and xylotetraose. These characteristics suggest that Lc-Xyn81 has considerable po-tential for applications in the food, feed, paper, and bioethanol industries, particularly for the production of prebiotics. 2. Materials and Methods 2.1 Sample Collection and Metagenomic Sequencing Soil samples were collected from the Wenquanjie hot spring in Eryuan, Dali, Yunnan Prov-ince (latitude 25°98′72.38″N, longitude 99°92′37.66″E). The samples underwent enrichment cul-ture, and DNA was isolated using a commercial DNA extraction kit. Metagenomic sequencing was performed using the HiSeq 2500 platform (GENWIZ, Suzhou). De novo assembly of the sequencing data was conducted using the Velvet assembly program (version 1.2.08)[ 25 ]. The Integrated Microbial Genomes (IMG) platform ( https://img.jgi.doe.gov/cgi-bin/mer/main.cgi ) was used to analyze the assembled sequences. To further annotate the potential functions of indi-vidual genes and open reading frames (ORFs), the COG (Clusters of Orthologous Groups) data-base[ 26 ], KEGG (Kyoto Encyclopedia of Genes and Genomes) [ 27 ], and Pfam (Protein families database)[ 28 ] were employed. 2.2 Sequence Prediction and Analysis of Lc-Xyn81 Functional prediction and analysis were performed using the KEGG and COG databases to identify functional genes associated with xylanase activity, and domain analysis was conducted using the Pfam database. A novel xylanase gene sequence, designated as lc-xyn81, was identi-fied from the metagenomic database. The nucleotide sequence of the lc-xyn81 gene was depos-ited in GenBank (accession NO.: PQ856056). The lc-xyn81 gene was synthesized based on Esch-erichia coli codon preferences and cloned into the PSHY211 vector. BLASTx and BLASTp pro-grams ( http://blast.ncbi.nlm.nih.gov/Blast.cgi ) were used to compare the DNA and protein se-quences of Lc-Xyn81, respectively. Signal peptide prediction was performed using SignalP ( http://www.cbs.dtu.dk/services/SignalP/ ), and the amino acid sequence structure was deduced and analyzed using the EXPASY tool ( http://web.expasy.org/protparam/).Th e protein sequence of Lc-Xyn81 was compared against the NCBI BLASTp database to identify homologous xy-lanase sequences. Sequences with high similarity from the same or closely related genera were selected as neighboring sequences, while xylanase protein sequences with low similarity from other genera were used as outgroup sequences for multiple alignments and phylogenetic tree construction. Multiple sequence alignment of Lc-Xyn81 and closely related protein sequences was performed using ClustalX[ 29 ]. Phylogenetic analysis was conducted using the MEGA7 software package [ 30 ]. A phylogenetic tree was constructed using the maximum likelihood (ML) method with a Poisson correction model. The Lc-Xyn81 sequence was further aligned with pro-tein databases ( http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi ) for multiple sequence compari-sons [ 31 ]. Homology modeling of the Lc-Xyn81 amino acid sequence was performed using the Swiss-Model platform and visualized with PyMOL software. 2.3 Molecular Cloning of Lc-Xyn81 The full-length gene of lc-xyn81 was amplified using the following primers: lc-xyn81-F: CATCATCATCATCATCATGAA GAGGAGGAGGCCGGCCGGTC lc-xyn81-R: GTGCTCGAGTGCGGCCGCAAG GGGCAACGACGCGCTCTCCTG. The underlined sequences represent recombinant fragments that are homologous to the pSHY211 vector, which had previously been digested with EcoRI and HindIII. The PCR program included an initial denaturation step at 95°C for 180 seconds, followed by 10 cycles of 98°C for 20 seconds and annealing and extension at 68°C for 150 seconds. Subsequently, 30 cycles of 98°C for 20 seconds, 55°C for 30 seconds, and 72°C for 150 seconds were performed, with a final extension at 72°C for 10 min. The PCR product was inserted into the pSHY211 vector using the seamless cloning and assembly kit (pEASY-Uni, TransGen Biotech, China) to generate the expression plasmid pSHY211-Lc-Xyn81. The lc-xyn81 gene was cloned and expressed in E. coli DH5α, wiht the E. coli cells were grown on LB medium supplemented with 50 µg/mL kanamycin. DNA isolation and purification were performed using a DNA purification kit (Sangon Biotech, China). 2.4 Heterologous Expression and Purification of Lc-Xyn81 Escherichia coli DH5α cells harboring the recombinant plasmid pSHY211-Lc-Xyn81 were cultured for the heterologous expression of the lc-xyn81 gene. The recombinant E. coli DH5α strain containing pSHY211-Lc-Xyn81 was cultivated in 100 mL of LB medium supplemented with 50 µg/mL kanamycin at 37°C and 180 rpm for 7 h. The culture was then transferred to 25°C and continued shaking at 180 rpm for an additional 12 h. The culture broth was aliquoted into 50 mL centrifuge tubes and centrifuged at 4000×g for 20 min to pellet the cells. The super-natant was discarded, and the cell pellets were resuspended. After resuspension, the cells were disrupted by ultrasonic treatment, followed by centrifugation at 12,000×g for 15 min at 4°C to collect the cell lysate. The cell lysate was purified using a Ni-affinity chromatography column (HisTrap, TransGen Biotech, China) according to the method previously reported by Yin[ 32 ]. The protein concentration was determined using the Bradford Protein Assay Kit (Order No. C503031, Sangon Biotech, China), with bovine serum albumin as the standard. 2.5 SDS-PAGE and Zymography Analysis The protein purified through the Ni-affinity column was analyzed using 12% denaturing polyacrylamide gel electrophoresis (SDS-PAGE). Simultaneously, a 12% native polyacrylamide gel was prepared with a final concentration of 0.2% beechwood xylan as the substrate for zymography. After electrophoresis, the native gel was immersed in phosphate buffer (pH 7.6) containing 2.5% Triton-X100 at 4°C for 30 min. The gel was then transferred to phosphate buffer (pH 7.6) and incubated at 60°C for 2 h. The gel was stained with 0.2% Congo red and destained using 1 M NaCl. Clear bands against the red background indicated xylanase activity. 2.6 Activity Assay of Lc-Xyn81 The enzymatic activity of the recombinant protein Lc-Xyn81 was determined following the method described by Yin et al. The reducing sugars released were quantified using the DNS (3,5-dinitrosalicylic acid) method, with xylose as the standard [ 33 ].One unit of xylanase activity was defined as the amount of enzyme required to release 1 µmol of reducing sugars per min un-der the assay conditions. 2.7 Enzymatic Characterization The purified enzyme Lc-Xyn81 was characterized by determining its activity at various temperatures (20–80°C) under pH 7 conditions to identify the optimal temperature. The optimal pH for Lc-Xyn81 was determined by incubating the purified enzyme in different buffer systems across a pH range of 3.0–12.0 (citric acid-sodium phosphate buffer for pH 3.0–8.0; glycine-sodium hydroxide buffer for pH 8.0–12.0) and measuring its activity at the optimal temperature. To evaluate the thermal and pH stability of Lc-Xyn81, the enzyme was incubated at various temperatures for different durations (0, 20, 40, 60, 80, 100, and 120 min) and in buffers with pH ranging from 3.0 to 9.0 for extended periods (12 and 24 h). Residual enzyme activity was measured after incubation to assess stability. Evaluation of the Effects of Metal Ions and Chemical Reagents on Lc-Xyn81 Activity. The influence of various metal ions (K⁺, Mg²⁺, Fe³⁺, Ca²⁺, Zn²⁺, Co²⁺, Cu²⁺, Ag⁺, Mn²⁺, Pb²⁺, Ni²⁺) at concentrations of 1 mM and 10 mM, and chemical reagents (0.1% and 1%) such as ethylenediaminetetraacetic acid (EDTA), phenylmethylsulfonyl fluoride (PMSF), polysorbate 80 (Tween 80), methanol (MeOH), ethanol (EtOH), sodium dodecyl sulfate (SDS), urea, β-mercaptoethanol (β-ME), cetyltrimethylammonium bromide (CTAB), and dithiothreitol (DTT) were assessed by adding them to the reaction system. Control experiments were conducted under identical conditions without the addition of any metal ions or chemical reagents. The enzymatic activity of Lc-Xyn81 was evaluated using various substrates, including beechwood xylan, corncob xylan, oat spelt xylan, sugarcane bagasse xylan, carboxymethyl cellulose sodium salt (CMC-Na), microcrystalline cellulose (Avicel), and cellobiose, at a concentration of 1% (w/v). Under optimal pH and temperature conditions, the kinetic constants of Lc-Xyn81 were determined using compound concentrations ranging from 0.1 to 20 mg/mL. The Michaelis-Menten constant (Km) and maximum reaction velocity (Vmax) were calculated using the Lineweaver-Burk plot. 2.8 TLC Analysis of Xylanase Lc-Xyn81 Reaction mixtures containing 1% xylan or CMC-Na and 10 µg of purified enzyme were incubated at optimal pH and temperature for 12 h. The hydrolysis products of beechwood xylan and corncob xylan were analyzed using thin-layer chromatography (TLC) on silica gel 60 plates (Merck, Darmstadt, Germany). The solvent system used was n-butanol/acetic acid/water (2:1:1, v/v/v). The plates were sprayed with freshly prepared 5% (v/v) H₂SO₄ in ethanol and heated at 120°C for 10 min to visualize sugar content. Xylose (X1), xylobiose (X2), xylotriose (X3), and xylotetraose (X4) were used as standards. 2.9 Effect of Prebiotics on the Growth of Lactococcus lactis NZ9000 Prebiotic products were generated by treating xylan substrates with the enzyme xylanase Lc-Xyn81. Equal amounts of the prebiotic products were added to 10 mL of LB liquid medium, which was then inoculated with 200 µL of either L. lactis NZ9000 or Escherichia coli . Control groups, which did not receive prebiotic products, were established with three replicates for each group. The cultures were incubated at 37°C in a shaking incubator, and bacterial growth was monitored by measuring the optical density at 600 nm (OD600). Measurements were taken every 2 h for the first 14 h, followed by intervals of 6 and 12 h up to 48 h. Growth curves were plotted for both L. lactis NZ9000 and E. coli . To simulate the intestinal microbiota environment, prebiotics were supplemented into Luria-Bertani (LB) medium, followed by the co-culture of E. coli and L. lactis NZ9000 to investigate the effects of prebiotics on beneficial gut microorganisms such as L. lactis NZ9000. The EJFP fluorescent reporter gene was introduced into E. coli , with co-cultures including L. lactis NZ9000 serving as the negative control. The experimental group comprised co-cultures of E. coli and L. lactis NZ9000 in LB medium supplemented with prebiotics. The initial inoculum concentrations of E. coli and L. lactis NZ9000 were standardized across both control and experimental groups. Both groups were incubated at 37°C in a shaking incubator, and at 24-h, 36-h, and 48-h intervals, cultures were homogenized. Subsequently, 1 mL of the mixed culture was aseptically transferred to sterile centrifuge tubes, serially diluted to 10⁻⁷, and 100 µL of the diluted cultures were plated for colony enumeration. To better assess the effect of prebiotics on the growth of L. lactis NZ9000, this study measured both the biomass and fluorescence intensity of the control and experimental groups. Both groups were cultured in a 37°C shaking incubator, and biomass (OD600) and fluorescence intensity (Excitation: 485/20, Emission: 528/20) were measured every 2 h up to 12 h. After 12 h, measurements were taken every 12 h until 72 h. 2.10 Molecular Docking The small molecule xylooligosaccharides (XOS), which include X2, X3, X4, and X5[ 34 ], were used as docking ligands, while the Lc-Xyn81 protein served as the receptor for molecular docking. Enzyme-ligand docking simulations were performed using the AutoDock Vina 1.5.6 platform (ADT). Docking grid parameters for all XOS ligands were referenced from the supplementary materials. The grid box encapsulates the entire active site cleft, including sub-sites at the + 1 and − 1 positions in the center. Ligand atoms exhibited high flexibility, and active torsional selections and torsion root identifications were performed during ligand parameterization. During this process, both rotatable and non-rotatable bonds within the substrate molecule were evaluated. The ligand conformation that exhibited the best fit with the protein complex was selected based on sequence consistency and query coverage. The docking results were ranked according to binding energy scores, selecting the lowest energy conformation for positional binding analysis. Protein-ligand interaction analysis was performed using the Protein-Ligand Interaction Profiler (PLIP) to optimize the active site residues. The criterion for hydrogen bond formation was that the maximum distance between the donor and acceptor atoms should be less than 3.4 Å. To visualize the enzyme-substrate interaction, PyMOL was used for structural analysis. 2.11 Statistical Analysis Unless otherwise specified, all experiments were conducted in triplicate, and mean values were used for all analyses. Statistical analyses were performed using SPSS version 20.0, and results are presented as mean ± SEM. One-way analysis of variance (ANOVA) was employed for statistical comparisons, and Tukey’s post hoc test was used for multiple group comparisons. A p-value of < 0.05 was considered to indicate statistical significance in all comparisons. 3. Results 3.1 Cloning and Molecular Analysis of the Lc-Xyn81 Gene Sediment samples were collected from Eryuan Hot Spring and subjected to enrichment culture. DNA was extracted from these samples and sequenced. A similarity search of the Lc-Xyn81 sequence identified a novel candidate gene designated as lc-xyn81. Nucleotide sequence analysis of the full-length Lc-Xyn81 gene revealed a total length of 1,107 base pairs (bp). The open reading frame (ORF) encodes 369 amino acid residues, which include a signal peptide sequence spanning residues 1–26 and a domain that encodes the GH10 family structure spanning residues 87–386. The theoretical molecular weight of the Lc-Xyn81 xylanase is calculated to be 44.52 kDa, with an estimated isoelectric point (pI) of 6. Comparative analysis of the amino acid sequence of Lc-Xyn81 showed homology of 72.29%, 72.57%, and 72.29% with endo-1,4-β-xylanases from Blastocatellia bacterium (HST22061.1), Bryobacteraceae bacterium (HEY1242353.1), and Blastocatellia bacterium (HKS43363.1), respectively(Fig. 1 A). Additionally, a protein structure model of Lc-Xyn81 was also simulated (Fig. 1 B). 3.2 Heterologous Expression and Purification of Lc-Xyn81 The lc-xyn81 gene was successfully cloned into the pSHY211 vector, resulting in a His-tagged fusion protein, which was further confirmed by sequencing. The recombinant enzyme Lc-Xyn81 was purified using Ni²⁺-NTA affinity chromatography. SDS-PAGE analysis of the purified protein on a 12% gel revealed a single band at approximately 43 kDa, consistent with the theoretical molecular weight (Fig. 2 ). The enzymatic activity of the purified protein was validated through zymogram analysis, which indicated decolorization against a red background within the 38–45 kDa range, thus confirming the enzymatic activity at this molecular weight (Fig. 2 ). 3.3 Effects of Temperature and pH on Lc-Xyn81 The optimal reaction temperature for Lc-Xyn81 was determined at 75°C, with the enzyme maintaining over 60% of its relative activity within the temperature range of 60–75°C (Fig. 3 A). Thermal stability assessments revealed that Lc-Xyn81 retained more than 90% of its activity after 60 min of incubation at 65°C. The enzyme exhibited half-lives of 180 min and 10 min at 70°C and 75°C, respectively. Notably, incubation at 70°C for 80 min led to an increase in enzyme activity of 149%, followed by a subsequent decline (Fig. 3 C). The optimal pH for Lc-Xyn81 activity was found to be pH 6.6, with the enzyme maintaining over 50% of its relative activity across a pH range of 6 to 9 (Fig. 3 B). pH stability analyses demonstrated that the purified enzyme retained more than 100% of its initial activity after incubation at 4°C for 12 h within the pH range of 4.0–8.0. After 24 h of incubation, the enzyme maintained over 60% of its activity (Fig. 3 D). 3.4 Effects of Metal Ions and Chemical Reagents on Lc-Xyn81 As shown in Table 1 , at ion concentrations of 1 mM and 10 mM, the activity of Lc-Xyn81 was activated by Co²⁺, Cu²⁺, Fe³⁺, Pb²⁺, Mn²⁺, Ni²⁺, and Mg²⁺, exhibiting varying degrees of activation. The enzyme activity was significantly inhibited by K⁺and Ag⁺. Overall, most metal ions were capable of activating Lc-Xyn81 activity. Additionally, as indicated in Table 2 , chemical reagents such as PMSF, SDS, EDTA, MeOH, EtOH, β-ME, DTT, Urea, and CTAB exhibited inhibitory effects on Lc-Xyn81. High concentrations of SDS, DTT, CTAB, and β-ME strongly inhibited the enzyme. However, when the concentrations of MeOH and EtOH were at 10%, Lc-Xyn81 retained over 80% of its activity, suggesting a potential tolerance to these alcohols. Tween 80 was able to activate Lc-Xyn81 activity, with maximum activity exceeding 120% in the presence of 1% Tween 80. Furthermore, in the presence of 1% Urea, PMSF, and EDTA, the enzyme maintained activity levels above 70%. Table 1 Effects of Metal Ions on Lc-Xyn81 Effector Relative activity 1 mM 10 mM Control 100 ± 0.41 100 ± 0.41 K + 70.95 ± 3.68** 49.37 ± 6.49** Mg 2+ 102.59 ± 5.96 122.82 ± 3.87** Fe 3+ 166.44 ± 9.61** 144.74 ± 1.32** Ca 2+ 95.55 ± 0.70 88.93 ± 3.71** Zn 2+ 97.65 ± 0.28 96.68 ± 0.24** Co 2+ 128.55 ± 9.33** 143.39 ± 2.64** Cu 2+ 112.27 ± 9.02* 101.38 ± 0.15** Ag + 0** 0** Mn 2+ 119.84 ± 5.87** 170.09 ± 2.21** Pb 2+ 102.23 ± 2.62 102.41 ± 0.69 Ni 2+ 108.01 ± 4.20 106.28 ± 0.69* Note: Activity in the absence of additives is set to 100%. Each value represents the mean ± SD. * indicates a significant difference in activity with the addition of additives (P ≤ 0.05). ** indicates a highly significant difference in activity with the addition of additives (P ≤ 0.01). Table 2 Effects of Chemical Reagents on Lc-Xyn81 Relative activity Effector Effector concentration (W/V) 0.1% 1% Control 100 ± 0.41 100 ± 0.41 DTT 52.96 ± 0.82** 21.47 ± 0.42** SDS 95.65 ± 1.25 0** Urea 94.58 ± 9.79 90.60 ± 3.76** PMSF 83.44 ± 2.89** 72.89 ± 1.90** EDTA 97.82 ± 0.68 70.03 ± 3.53** CTAB 24.04 ± 7.91** 19.87 ± 6.20** Effector concentration (W/V) 1% 10% Tween80 129.69 ± 4.86** 121.81 ± 2.23** MeOH 96.76 ± 0.69 80.72 ± 0.06** EtOH 95.46 ± 0.72 84.56 ± 2.94** β-Me 84.38 ± 3.27* 1.93 ± 1.87** Note: Activity in the absence of additives is set to 100%. Each value represents the mean ± SD. * indicates a significant difference in activity with the addition of additives (P ≤ 0.05). ** indicates a highly significant difference in activity with the addition of additives (P ≤ 0.01). 3.5 Substrate Specificity and Kinetic Analysis of Lc-Xyn81 As presented in Table 3 , the relative activity of Lc-Xyn81 towards beechwood xylan was 213.68 ± 1.21 U/mg, while its relative activities towards corn cob xylan, sugarcane bagasse xylan, and oat xylan were 143.40 ± 8.32 U/mg, 80.39 ± 10.74 U/mg, and 10.80 ± 5.19 U/mg, respectively. Notably, Lc-Xyn81 exhibited no enzymatic activity against Avicel, carboxymethyl cellulose (CMC), and cellobiose. Kinetic parameters for the recombinant enzyme Lc-Xyn81 using beechwood xylan as the substrate were determined, yielding a Km of 4.62 mg/mL, a Vmax of 312.50 µmol/min/mg, and a Kcat of 242.49 s⁻¹ (refer to Table 4 ). These results indicate that Lc-Xyn81 possesses activity against various types of xylan, demonstrating its capability to degrade these substrates effectively. Table 3 Activity of Lc-Xyn81 on Different Substrates Substres Specific activity(U/mg) Beechwood xylan 213.68 ± 1.21 Corncob xylan 143.40 ± 8.32 Bagasse xylan 80.39 ± 10.74 Oatspelt xylan 10.80 ± 5.19 Avicel cellulose 0 Cellobiose 0 CMC 0 Table 4 Characteristics of Lc-Xyn81 Parameters Values Substrate Beechwood xylan Optimal temperature 75℃ Optimal pH 6.6 Specific activity 213.68 ± 1.21 Km 4.62mg/ml Vmax 312.50 µmol/min/mg Molecular mass 44.52 KDa Kcat 242.49s − 1 3.6 TLC Analysis As shown in Fig. 4 , the hydrolysis products of xylan by Lc-Xyn81 were analyzed using thin-layer chromatography (TLC). The results demonstrated that the primary hydrolysis products of Lc-Xyn81 were xylobiose (X2) and xylotetraose (X4), along with a minor amount of xylotriose (X3). 3.7 Analysis of the Growth-Promoting Effects of Prebiotic Products The growth-promoting effects of the xylan hydrolysis products (prebiotics) generated by Lc-Xyn81 are shown in Fig. 5 A. During the first 10 h of cultivation, L. lactis NZ9000 remained in the lag phase. After 10 h, they entered the logarithmic growth phase. Compared to the control group without prebiotic supplementation, the growth rate of L. lactis NZ9000 in the prebiotic-supplemented group showed no significant difference during the first 14 h. However, the cell density of L. lactis NZ9000 in the prebiotic-supplemented group was relatively higher. After 14 h, the growth rate of L. lactis NZ9000 in the control group plateaued, entering the stationary phase. In contrast, the growth rate in the prebiotic-supplemented group continued to increase, with the OD600 of the bacterial cells significantly higher (3–5 times that of the control group) between 24 and 48 h (Fig. 5 A). For Escherichia coli DH5α, no significant difference in growth was observed between the groups with and without prebiotic supplementation (Fig. 5 B). These results indicate that the xylan hydrolysis products of Lc-Xyn81 function as effective prebiotics, significantly promoting the growth of L. lactis NZ9000, while having no growth-promoting effect on E. coli . Using a co-culture of Escherichia coli and Lactococcus lactis NZ9000 to investigate the effect of Lc-Xyn81 xylan hydrolysis products (prebiotics) on gut microbiota. The results showed that the relative abundance of L. lactis NZ9000 at 24 h (45% and 46.3%), 36 h (3.7% and 68.8%), and 48 h (2.4% and 34.2%) with and without the addition of prebiotics, respectively (Supplementary Fig. S1 ). In the control group, the population of E. coli gradually increased over time, while L. lactis NZ9000 were extremely scarce. In contrast, the prebiotic-supplemented group, both E. coli and L. lactis NZ9000 exhibited growth, with the population of L. lactis NZ9000 significantly higher than that of the control group. Notably, at 36 and 48 h, the population of L. lactis NZ9000 surpassed that of E. coli . These results demonstrate that the obtained prebiotic products have a growth-promoting effect on L. lactis NZ9000. In the control group, the fluorescence intensity continuously increased over time, indicating a gradual increase in the number of Escherichia coli (carrying the EGFP gene) and a corresponding decrease in the number of L. lactis NZ9000. In contrast, in the prebiotic-treated group, the OD600 of L. lactis NZ9000 significantly increased, and the fluorescence intensity was lower than that in the untreated group. This suggests that the number of L. lactis NZ9000 was significantly higher in the prebiotic-treated group compared to the control group, with L. lactis NZ9000 being more abundant than E. coli (Fig. 6 ). These results indicate that the prebiotic product obtained has a promoting effect on the growth of L. lactis NZ9000. 4. Discussion In this study, the Lc-Xyn81 gene, which encodes a xylanase, was identified from the metagenome of microorganisms inhabiting the hot spring sediments of Longwangmiao, Eryuan. The gene was cloned and expressed to obtain the recombinant xylanase Lc-Xyn81. The optimal temperature for Lc-Xyn81 was 75°C, with relative activity below 20% at 20–50°C, while retaining more than 60% relative activity at 60–70°C. The half-life of Lc-Xyn81 was 3 h at 70°C and 10 min at 75°C, indicating that it is a thermophilic and thermostable xylanase. Phylogenetic analysis indicated that Lc-Xyn81 clusters with the Blastocatellia class. The protein structure of Lc-Xyn81 was modeled using SWISS-MODEL, employing the template with the highest sequence identity (71.63%) and GMQE score (0.91). The protein model of Lc-Xyn81 exhibited the typical TIM-barrel structure of the GH10 family, a three-dimensional protein structure consisting of eight β-strands alternating with eight α-helices. The active site of enzymes with a TIM-barrel structure is generally located at the C-terminal end of the β-strands. The β-strands are considered to contribute to thermostability, possibly due to the formation of salt bridges within the β-strands, which stabilize the entire protein structure[ 35 ]. Thermostable xylanases play a crucial role in industrial processes that require high-temperature conditions. It has been reported that most thermostable xylanases exhibit op-timal activity within the temperature range of 60–75°C[ 36 , 37 ]. For instance, FAE-1, XynA, and rXynSOS show optimal temperatures of 60°C, 65°C, and 70°C, respectively[ 38 , 39 ]. The thermal stability of xylanases is an important factor for their functionality in industrial applications. Lc-Xyn81 exhibited a half-life of 3 h at 70°C, demonstrating superior thermal stability compared to Pm25, a xylanase from Bacteroides isolated from the termite gut metagenome, with a half-life of 1 h at 60°C, and Xyn30Y5 from Bacillus sp. 30Y5, which has a half-life of 30 min at 60°C(Table 5 )[ 41 , 42 ]. Consequently, the thermophilic and thermostable xylanase Lc-Xyn81 is well-suited for industrial processes that operate at moderate to high temperatures. Table 5 Comparison of Enzymatic Properties Between Lc-Xyn81 and Other Xylanases Enzyme Sources GH Family Optimal condition Thermostability Half-life XOS Production Reference Lc-Xyn81 Hot Spring Metagenome GH10 pH6.6, 75 °C ≤ 75℃ 70, t₁/₂=3h X2、X4 This study XynA Bacillus sp. KW1 GH10 pH6.0, 65 °C ≤ 70℃ 70, t₁/₂=1.5h X1-X4 [ 37 ] Tc Xyn10A Thermobacillus composti GH10 pH6 ~ 8, 65°C ≤ 65℃ 65, t₁/₂=8h X2、X3 [ 40 ] Pm25 Termite Gut Metagenome GH10 pH7.5, 50 °C ≤ 60℃ 60, t₁/₂=1h X1-X6 [ 41 ] Xyn30Y5 Bacillus sp. 30Y5 GH10 pH7.0, 70 °C ≤ 70℃ 60, t₁/₂=0.5h - [ 42 ] NhGH11 Nectria haematococca GH11 pH6.0, 45 °C ≤ 50℃ 50, t₁/₂=4h X1-X4 [ 43 ] Studies have reported that HJ2, HJ14, and XynA (from Bacillus sp.) are mildly acidic xy-lanases. In this study, Lc-Xyn81 was found to have an optimal pH of 6.6, classifying it as a mildly acidic enzyme[ 37 , 44 , 45 ]. Although Lc-Xyn81 is classified as mildly acidic enzyme, it ex-hibited excellent stability within a pH range of 4.0–8.0, spanning weakly acidic to mildly alkaline conditions. Xylanases from the GH10 family are recognized for their broad pH stability. For in-stance, PspXyn10 ( Penicillium sp.) retains 50% of its activity at pH 3.0–6.5, Xyn10B ( Aci-dothermus cellulolyticus 11B ) maintains over 90% stability between pH 5.0 and 8.0, and Xyn10A ( Aspergillus fumigatus Z5 ) demonstrates good stability across pH 3.0–11.0 [ 46 , 47 , 48 ]. Xylanases that remain stable under acidic conditions exhibit resistance to harsh environments, making them suitable for applications in industries such as biofuel production, animal feed, and fruit juice clarification[ 49 ]. Therefore, Lc-Xyn81 holds significant potential for industrial pro-cesses requiring acidic conditions. In industrial production, high concentrations of metal ions can inhibit xylanase activity. Moreover, certain chemical agents may react with xylanases, altering their structure or properties and affecting catalytic efficiency. Thus, xylanases resistant to metal ions and chemical agents are better suited to overcome industrial limitations. Experimental data indicate that Ag⁺ inhibits the enzymatic activity of Lc-Xyn81, consistent with its inhibitory effects on xylanases such as Af-XYNA ( Aspergillus fumigatus ) and Xyn1923 ( Microbacterium imperiale YD-01 ) [ 50 , 51 ]. GH10 family xylanases have been reported to be inhibited by various metal ions. For example, Xyn27 is inhibited by Ni²⁺, Fe²⁺, and Cu²⁺ (with inhibition ranging from 5–30%); XynSPP2 is inhibited by Co²⁺, Ca²⁺, and Mg²⁺ (6–28% inhibition); and SCXyl is highly inhibited by Co²⁺, Cu²⁺, and Mn²⁺ [ 52 , 53 , 54 ]. In contrast, Lc-Xyn81 is activated by divalent metal ions such as Mg²⁺, Co²⁺, and Cu²⁺ (Table 1 ), demonstrating better metal ion resistance compared to these pre-viously reported xylanases. Overall, while most xylanases are inhibited by divalent metal ions, Lc-Xyn81 exhibits activation by certain ions, highlighting its potential advantages for industrial applications. The inhibitory effect of the metal chelator EDTA on Lc-Xyn81 suggests that the xylanase may require metal ions as cofactors[ 55 ]. This hypothesis is supported by the observation that the activity of Lc-Xyn81 increases to 170% in the presence of 10 mM Mn²⁺. Sodium dodecyl sulfate (SDS) inhibits most enzyme activities, likely because SDS, as an anionic surfactant, induces conformational changes in the enzyme, leading to inactivation or denaturation [ 56 , 57 ]. For in-stance, the activities of Xyl10E ( Bispora sp. MEY-1 ) and Thxyn11A are similarly inhibited by SDS [ 58 , 59 ]. Overall, Lc-Xyn81 exhibits favorable enzymatic stability and retains suitable activ-ity in the presence of both the evaluated metal ions and chemical reagents, positioning it as a robust candidate for industrial applications. As global agricultural production expands, the generation of agricultural waste is also in-creasing. Examples include sugarcane bagasse, corncobs, rice husk ash, sunflower stalks, and beechwood chips, all of which are rich in lignocellulose [ 60 , 61 , 62 ]. The utilization of xylanase for processing agricultural waste not only mitigates environmental pollution but also enables re-source recycling. Lc-Xyn81, characterized by its diverse xylanolytic activities, emerges as a promising candidate for the treatment of agricultural waste. Xylanases from the GH10 family typically produce xylobiose (X2) and xylotetraose (X4) as reaction products when degrading xylan, although some may also produce xylose (X1) [ 63 ]. One of the most valuable products derived from xylanase activity is xylooligosaccharides (XOS), which are nondigestible oligosaccharides consisting of 2–10 xylose units linked by β-1,4 bonds. Studies have shown that XOS are promising prebiotics, capable of stimulating the growth of ben-eficial gut microbiota and counteracting intestinal pathogens[ 64 ]. For example, the hydrolysis products of rXynSW3 ( Streptomyces sp.) mainly include xylobiose (X2), xylotriose (X3), and xy-lotetraose (X4), while Xyn10J primarily produces xylobiose (X2) and xylotetraose (X4). Ssxyn10 ( Streptomyces sp. F-3 ) generates xylobiose (X2) and xylotriose (X3). The XOS produced by these enzymes can be utilized in various industries, including prebiotic production, food, biofuel, and waste treatment [ 65 , 66 , 67 ]. Lc-Xyn81 predominantly produces xylobiose and xylotetraose upon hydrolyzing xylan, highlighting its potential for XOS production and its applicability in the prebi-otic industry. Molecular docking analysis of Lc-Xyn81 with xylooligosaccharides (X2-X5) revealed in-sights into its molecular recognition and substrate affinity(Fig. 7 ). The docking simulations in-dicated that the lowest binding energies of X2, X3, X4, and X5 with the Lc-Xyn81 receptor were − 7.3, − 8.3, − 9.4, and − 9.7 kcal/mol, respectively. Among them, X5 exhibited the lowest binding energy with Lc-Xyn81. To further investigate the potential aglycone sub-sites, we used X5 as an example and overlaid the Lc-Xyn81-X5 complex with the crystal structure of the X5-bound XT6 (extracellular xylanase from G. stearothermophilus (E159Q)) complex (PDB: 4PUD)[ 68 ]. The Lc-Xyn81-X5 complex was located at the − 2 to + 3 sub-sites (Fig. 8 A). In the + 1 sub-site, the reducing xylose interacts with the side chains of Lys88, His121, Glu174, and Gln248, forming hydrogen bonds, while a salt bridge is formed between Arg252 and xylose. In the + 2 sub-site, xy-lose directly interacts with Asn85 and Trp345 through hydrogen bonds (Fig. 7 D). These interac-tions are highly conserved in GH10 xylanases. Xylanase sequences from Longimicrobiales bacterium (HEY8484312.1), Bryobacteraceae bacterium (HEY1242353.1), Terriglobales bacterium (HMK31177.1), Blastocatellia bacterium (HST22061.1, HKS43363.1), and the protein sequence of 4L4O from the PDB database were subjected to multiple sequence alignment. The alignment revealed that the two glutamic acid residues, Glu174 and Glu279, of Lc-Xyn81 correspond to the catalytic active site residues Glu139 and Glu247 in 4L4O (Supplementary Fig. S2). Therefore, Glu174 and Glu279 are highly likely to be the catalytic sites of Lc-Xyn81.The hydrolysis of xylan substrates typically occurs between the − 1 and + 1 sub-sites. The residues Glu174, His121, Lys88, and Asn85 are hydro-gen-bonded to X2 and are located between the − 2 and − 1 sub-sites, preventing further hydrolysis to xylose. X3 is hydrogen-bonded to residues Glu279, Gln248, and others, located at the + 1 to + 3 sub-sites, and also does not undergo hydrolysis. X4 is situated between the − 2 and + 2 sub-sites, interacting with Glu174 and His121, and is capable of being hydrolyzed into two molecules of X2 (Fig.s 7 and 8B). In the XT6-X5 complex, X5 is positioned between the − 2 and + 3 sub-sites, and when superimposed with the Lc-Xyn81-xylopentose structure, it was found that although there are differences, the overall orientation is similar. Consequently, X5 remains in the − 2 to + 3 sub-sites and is hydrolyzed into X3 and X2 (Fig. 8 ). As naturally occurring nutrients in food, xylooligosaccharides (XOS) are indigestible and non-absorbable in the human gastrointestinal tract. However, they undergo fermentation in the colon, producing organic acids (e.g., acetic acid) and gases, which serve as nutrients for symbiotic gut bacteria, thereby stimulating the growth of beneficial bacteria[ 69 ]. Studies have reported that XOS are resistant to degradation by known gut pathogens such as Staphylococcus aureus and Salmonella enterica, but are readily utilized by probiotic strains like Lactobacillus and Bifidobacterium. The fermentation products of XOS enhance antagonistic effects against path-ogenic microbiota in the gut [ 64 , 70 , 71 ]. Oral supplementation with XOS has been shown to in-crease the abundance of Bifidobacterium in healthy individuals without causing gastrointestinal side effects [ 72 ]. At a dosage of 2 g/day for 8 weeks, XOS improved insulin sensitivity and mod-ulated gut microbiota in individuals with prediabetes. In other studies, a dosage of 4 g/day for 8 weeks significantly reduced blood glucose and glycated hemoglobin levels in diabetic patients[ 22 , 68 ]. Mäkeläinen demonstrated that Xylooligosaccharides (XOS) can increase the abundance of Bifidobacterium in the colon and optimize the gut microbiota by reducing the levels of patho-genic bacteria[ 73 ]. Therefore, we propose that XOS may inhibit the growth of Escherichia coli by promoting the population of beneficial probiotics.An increasing body of research suggests that XOS is a promising prebiotic candidate, playing roles in the prevention of colorectal cancer, reg-ulation of insulin secretion, enhancement of immune function, and maintenance of gastrointes-tinal health[ 23 , 74 , 75 ]. In this study, a simplified in vitro gut environment was simulated by co-culturing E. coli and L. lactis NZ9000. The results demonstrated that XOS obtained from xy-lan hydrolysis significantly increased the population of L. lactis NZ9000. The prebiotic products derived from xylan substrates using the xylanase Lc-Xyn81 effectively promoted the growth of L. lactis NZ9000, indicating its immense potential in applications aimed at maintaining gut health. 5. Conclusion In conclusion, this study discovered a novel xylanase gene ( lc-xyn81 ) from the Wenquanjie hot spring in Dali City, China, through enrichment culture and metagenomic techniques. The gene was PCR-amplified, cloned, and expressed in Escherichia coli . Lc-Xyn81 exhibited high ac-tivity against xylans from beechwood, corncob, and sugarcane bagasse with optimal perfor-mance at 75°C and pH 6.6. Its activity was significantly enhanced after incubation at 70°C and various pH levels, and it was activated by divalent metal ions like Co²⁺, Mn²⁺, and Cu²⁺. The en-zyme primarily produced xylobiose and xylotetraose from beechwood xylan, promoting the growth of L. lactis NZ9000. These properties suggest that Lc-Xyn81 has potential applications in bioenergy and prebiotic production. Declarations Ethics approval and consent to participate: Not applicable Consent for publication: Agree to publish Author Contributions: Conceptualization, Y.R.Y. and L.Q.Y.; methodology, L.H.P. and K.Q.X.; software, Z.F.Y. and Z.H.L.; validation, J.L.L., J.S., and W.H.; formal analysis, M.O.; investigation, D.Z. and Y.R.Y.; writing—original draft preparation, J.L.L. and W.H.; writing—review and editing, Y.R.Y. and L.Q.Y.; fund-ing acquisition, Y.R.Y. and W.H. All authors engaged in result discussions and provided feedback on the manuscript. Every author has reviewed and consented to the published version. Funding: The author(s) declare that ﬁnancial support was received for the research, authorship, and/or publication of this article. This research was funded by the Yunnan Applied Basic Research Projects (No. 202101AU070138 and 202501AT070411), the Science and Technology Projects of the Xizang Autonomous Region, China (No. XZ202501ZY0019), the Yunnan Provincial Clinical Medical Center for Emergency Traumatic Dis-eases(No. YWLCYXZX2023300075), and the Xingdian Talent Support Program of Yunnan Province (No. 230212528080). Institutional Review Board Statement: This manuscript does not include any research involving human participants or animals. Sample collection was conducted in compliance with local regulations and approved by the relevant management authorities. Availability of data and materials: The original data supporting the findings of this study are included in the arti-cle/Supplementary Materials. The nucleotide sequence of the Lc-Xyn81 gene has been submitted to GenBank (https://www.ncbi.nlm.nih.gov/nuccore/PQ856056.1/). Further inquiries can be directed to the corresponding authors. Acknowledgments: We extend our heartfelt gratitude to the administrative division of the Dali Geothermal Paradise tourist site for their invaluable support in facilitating the sample collection for this research. Competing interests: The authors declare no competing interest. References Ghaemi, F., Abdullah, L. C., & Ariffin, H. Lignocellulose Structure and the Effect on Nanocellulose Production. In Lignocellulose for Future Bioeconomy. Elsevier. 2019 ,17–30. https://doi.org/10.1016/b978-0-12-816354-2.00002-5 Johnson AM, Karaaslan MA, Cho M, Ogawa Y, Renneckar S. Exploring the impact of water on the morphology and crystallinity of xylan hydrate nanotiles. Carbohydrate Polymers. 2023 ,319,121165. https://doi.org/10.1016/j.carbpol.2023.121165 Sohail M, Barzkar N, Michaud P, Tamadoni Jahromi S, Babich O, Sukhikh S, Das R, Nahavandi R. Cellulolytic and xylanolytic enzymes from yeasts: Properties and industrial applications. Molecules. 2022,27,3783. https://doi.org/10.3390/molecules27123783 Rennie EA, Scheller HV. Xylan biosynthesis. Current opinion in biotechnology. 2014,26,100-107. https://doi.org/10.1016/j.copbio.2013.11.013 Knapik K, Becerra M, González-Siso MI. Microbial diversity analysis and screening for novel xylanase enzymes from the sediment of the Lobios Hot Spring in Spain. Scientific reports. 2019 ,9,11195. https://doi.org/10.1038/s41598-019-47637-z Uday US, Choudhury P, Bandyopadhyay TK, Bhunia B. Classification, mode of action and production strategy of xylanase and its application for biofuel production from water hyacinth. International journal of biological macromolecules. 2016,82,1041-1054. https://doi.org/10.1016/j.ijbiomac.2015.10.086 Kalim B, Böhringer N, Ali N, Schäberle TF. Xylanases–from microbial origin to industrial application. Br Biotechnol J. 2015,7,1-20. https://doi.org/10.9734/BBJ/2015/15982 Kiribayeva A, Mukanov B, Silayev D, Akishev Z, Ramankulov Y, Khassenov B. Cloning, expression, and characterization of a recombinant xylanase from Bacillus sonorensis T6. PLoS One. 2022,17,e0265647. https://doi.org/10.1371/journal.pone.0265647 Bouiche C, Boucherba N, Benallaoua S, Martinez J, Diaz P, Pastor FJ, Valenzuela SV. Differential antioxidant activity of glucuronoxylooligosaccharides (UXOS) and arabinoxylooligosaccharides (AXOS) produced by two novel xylanases. International journal of biological macromolecules. 2020,155,1075-1083. https://doi.org/10.1016/j.ijbiomac.2019.11.073 Nguyen ST, Freund HL, Kasanjian J, Berlemont R. Function, distribution, and annotation of characterized cellulases, xylanases, and chitinases from CAZy. Applied microbiology and biotechnology. 2018,102,1629-1637. https://doi.org/10.1007/s00253-018-8778-y Walia A, Guleria S, Mehta P, Chauhan A, Parkash J. Microbial xylanases and their industrial application in pulp and paper biobleaching: a review. 3 Biotech. 2017,7,1-2. https://doi.org/10.1007/s13205-016-0584-6. Mhiri S, Bouanane-Darenfed A, Jemli S, Neifar S, Ameri R, Mezghani M, Bouacem K, Jaouadi B, Bejar S. A thermophilic and thermostable xylanase from Caldicoprobacter algeriensis: Recombinant expression, characterization and application in paper biobleaching. International journal of biological macromolecules. 2020,164,808-817. https://doi.org/10.1016/j.ijbiomac.2020.07.162 Verma D. Extremophilic prokaryotic endoxylanases: Diversity, applicability, and molecular insights. Frontiers in Microbiology. 2021,12,728475. https://doi.org/10.3389/fmicb.2021.728475 Mon ML, Marrero Díaz de Villegas R, Campos E, Soria MA, Talia PM. Characterization of a novel GH10 alkali-thermostable xylanase from a termite microbiome. Bioresources and Bioprocessing. 2022,9,84. https://doi.org/10.1186/s40643-022-00572-w Escuder-Rodríguez JJ, DeCastro ME, Cerdán ME, Rodríguez-Belmonte E, Becerra M, González-Siso MI. Cellulases from thermophiles found by metagenomics. Microorganisms. 2018,6,66. https://doi.org/10.3390/microorganisms6030066 Zarafeta D, Galanopoulou AP, Leni ME, Kaili SI, Chegkazi MS, Chrysina ED, Kolisis FN, Hatzinikolaou DG, Skretas G. XynDZ5: a new thermostable GH10 xylanase. Frontiers in microbiology. 2020,11,545. https://doi.org/10.3389/fmicb.2020.00545 Yin YR, Li XW, Long CH, Li L, Hang YY, Rao MD, Yan X, Liu QL, Sang P, Li WJ, Yang LQ. Characterization of a gh10 extremely thermophilic xylanase from the metagenome of hot spring for prebiotic production. Scientific Reports. 2023,13,16053. https://doi.org/10.1038/s41598-023-42920-6 Adrio JL, Demain AL. Microbial enzymes: tools for biotechnological processes. Biomolecules. 2014,4,117-139. https://doi.org/10.3390/biom4010117 Uchiyama T, Miyazaki K. Functional metagenomics for enzyme discovery: challenges to efficient screening. Current opinion in biotechnology. 2009,20,616-622. https://doi.org/10.1016/j.copbio.2009.09.010 Tansirichaiya S, Hutton W, Roberts AP. Functional and sequence-specific screening protocols for the detection of novel antimicrobial resistance genes in metagenomic DNA. InMetagenomics: Methods and Protocols 2022,51-72. https://doi.org/10.1007/978-1-0716-2795-2_4 (2023). Montella S, Amore A, Faraco V. Metagenomics for the development of new biocatalysts to advance lignocellulose saccharification for bioeconomic development. Critical reviews in biotechnology. 2016,36,998-1009. https://doi.org/10.3109/07388551.2015.1083939 Batsalova T, Georgiev Y, Moten D, Teneva I, Dzhambazov B. Natural xylooligosaccharides exert antitumor activity via modulation of cellular antioxidant state and TLR4. International Journal of Molecular Sciences. 2022,23,10430. https://doi.org/10.3390/ijms231810430 Cruz-Guerrero A, Gómez-Ruiz L, Guzmán-Rodríguez F. Xylooligosaccharides (XOS). InHandbook of Food Bioactive Ingredients: Properties and Applications 2022,1-28.DOI: 10.1007/978-3-030-81404-5_30-1 Chapla D, Pandit P, Shah A. Production of xylooligosaccharides from corncob xylan by fungal xylanase and their utilization by probiotics. Bioresource Technology. 2012,115,215-221. https://doi.org/10.1016/j.biortech.2011.10.083 Zerbino DR, Birney E. Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome research. 2008,18,821-829. https://doi.org/10.1101/gr.074492.107 Tatusov RL, Natale DA, Garkavtsev IV, Tatusova TA, Shankavaram UT, Rao BS, Kiryutin B, Galperin MY, Fedorova ND, Koonin EV. The COG database: new developments in phylogenetic classification of proteins from complete genomes. Nucleic acids research. 2001 ,29,22-28. https://doi.org/10.1093/nar/29.1.22 Nakaya A, Katayama T, Itoh M, Hiranuka K, Kawashima S, Moriya Y, Okuda S, Tanaka M, Tokimatsu T, Yamanishi Y, Yoshizawa AC. KEGG OC: a large-scale automatic construction of taxonomy-based ortholog clusters. Nucleic acids research. 2012,41,D353- D357. https://doi.org/10.1093/nar/gks1239 Bateman A, Coin L, Durbin R, Finn RD, Hollich V, Griffiths‐Jones S, Khanna A, Marshall M, Moxon S, Sonnhammer EL, Studholme DJ. The Pfam protein families database. Nucleic acids research. 2004,32,D138- D141. https://doi.org/10.1093/nar/gkp985 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic acids research. 1997,25,4876-4882. https://doi.org/10.1093/nar/25.24.4876 Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular biology and evolution. 2016,33,1870-1874. https://doi.org/10.1093/molbev/msw054 Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD. Clustal W and Clustal X version 2.0. bioinformatics. 2007,23,2947-2948. https://doi.org/10.1093/bioinformatics/btm404 Yin YR, Meng ZH, Hu QW, Jiang Z, **an WD, Li LH, Hu W, Zhang F, Zhou EM, Zhi XY, Li WJ. The hybrid strategy of Thermoactinospora rubra YIM 77501T for utilizing cellulose as a carbon source at different temperatures. Frontiers in Microbiology. 2017,8,942. https://doi.org/10.3389/fmicb.2017.00942 Miller GL. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Analytical chemistry. 1959,31,426-428. https://doi.org/10.1021/ac60147a030 Yang J, Han Z. Understanding the positional binding and substrate interaction of a highly thermostable GH10 xylanase from Thermotoga maritima by molecular docking. Biomolecules. 2018,8,64. https://doi.org/10.3390/biom8030064 Huang YY, Wu P, Wu XC, Zhu QR, Zhu Q, Zheng HZ, Zhu D, Lv ZH, Yin YR. Characterization of a thermophilic and inhibitor-tolerant gh1 β-glucosidase present in a hot spring. Water. 2023,15,3389. https://doi.org/10.3390/w15193389 Glekas PD, Kalantzi S, Dalios A, Hatzinikolaou DG, Mamma D. Biochemical and thermodynamic studies on a novel thermotolerant GH10 xylanase from Bacillus safensis. Biomolecules. 2022,12,790. https://doi.org/10.3390/biom12060790 Wang K, Cao R, Wang M, Lin Q, Zhan R, Xu H, Wang S. A novel thermostable GH10 xylanase with activities on a wide variety of cellulosic substrates from a xylanolytic Bacillus strain exhibiting significant synergy with commercial Celluclast 1.5 L in pretreated corn stover hydrolysis[J]. Biotechnology for biofuels, 2019, 12, 1-13. https://doi.org/10.1186/s13068-019-1389-8 Mafa MS, Malgas S, Pletschke B I. Feruloyl esterase (FAE-1) sourced from a termite hindgut and GH10 xylanases synergy improves degradation of arabinoxylan[J]. AMB Express, 2021, 11,1-9. https://doi.org/10.1186/s13568-021-01180-1 Pozo-Rodríguez A, Méndez-Líter JA, de Eugenio LI, Nieto-Domínguez M, Calviño E, Cañada FJ, Santana AG, Díez J, Asensio JL, Barriuso J, Prieto A. A fungal versatile GH10 endoxylanase and its glycosynthase variant: Synthesis of xylooligosaccharides and glycosides of bioactive phenolic compounds. International Journal of Molecular Sciences. 2022 ,23,1383. https://doi.org/10.3390/ijms23031383 Sepulchro AG, Pellegrini VO, Briganti L, de Araujo EA, de Araujo SS, Polikarpov I. Transformation of xylan into value-added biocommodities using Thermobacillus composti GH10 xylanase. Carbohydrate Polymers. 2020,247,116714. https://doi.org/10.1016/j.carbpol.2020.116714 Wu H, Ioannou E, Henrissat B, Montanier CY, Bozonnet S, O’Donohue MJ, Dumon C. Multimodularity of a GH10 xylanase found in the termite gut metagenome. Applied and Environmental Microbiology. 2021,87,e01714-20. https://doi.org/10.1128/AEM.01714-20 Lai Z, Zhou C, Ma X, Xue Y, Ma Y. Enzymatic characterization of a novel thermostable and alkaline tolerant GH10 xylanase and activity improvement by multiple rational mutagenesis strategies. International Journal of Biological Macromolecules. 2021,170,164-177. https://doi.org/10.1016/j.ijbiomac.2020.12.137 Andaleeb H, Ullah N, Falke S, Perbandt M, Brognaro H, Betzel C. High-resolution crystal structure and biochemical characterization of a GH11 endoxylanase from Nectria haematococca. Scientific reports. 2020,10,15658. https://doi.org/10.1038/s41598-020-72644-w Zhou J, Dong Y, Tang X, Li J, Xu B, Wu Q, Gao Y, Pan L, Huang Z. Molecular and biochemical characterization of a novel intracellular low-temperature-active xylanase. Journal of microbiology and biotechnology. 2012,22,501-509. https://doi.org/10.4014/jmb.1108.08006 Zhou J, Wu Q, Zhang R, Mo M, Tang X, Li J, Xu B, Ding J, Lu Q, Huang Z. A thermo-halo-tolerant and proteinase-resistant endoxylanase from Bacillus sp. HJ14. Folia microbiologica. 2014,59,423-431. https://doi.org/10.1007/s12223-014-0316-4 Shibata N, Suetsugu M, Kakeshita H, Igarashi K, Hagihara H, Takimura Y. A novel GH10 xylanase from Penicillium sp. accelerates saccharification of alkaline-pretreated bagasse by an enzyme from recombinant Trichoderma reesei expressing Aspergillus β-glucosidase[J]. Biotechnology for biofuels, 2017, 10, 1-17. https://doi.org/10.1186/s13068-017-0970-2 Miao, Y., Kong, Y., Li, P., Li, G., Liu, D., Shen, Q., & Zhang, R. Effect of CBM1 and linker region on enzymatic properties of a novel thermostable dimeric GH10 xylanase (Xyn10A) from filamentous fungus Aspergillus fumigatus Z5. AMB Express.2018,8, 1-10. https://doi.org/10.1186/s13568-018-0576-5 Shahid S, Tajwar R, Akhtar M W. A novel trifunctional, family GH10 enzyme from Acidothermus cellulolyticus 11B, exhibiting endo-xylanase, arabinofuranosidase and acetyl xylan esterase activities[J]. Extremophiles,2018, 22,109-119. https://doi.org/10.1007/s00792-017-0981-8 **a Y, Wang W, Wei Y, Guo C, Song S, Cai S, Miao Y. Clustered surface amino acid residues modulate the acid stability of GH10 xylanase in fungi[J]. Applied Microbiology and Biotechnology, 2024, 108,216. https://doi.org/10.1007/s00253-024-13045-1 Tang K, Cui Y, **ao J, Ding M, Chao H, Wu J, Han Z, Liu J, Li X, Yan D. Molecular cloning and characterization of a novel xylanase from Microbacterium imperiale YD‐01. Journal of Food Biochemistry. 2021,45,e13988. https://doi.org/10.1111/jfbc.13988 Chang X, Xu B, Bai Y, Luo H, Ma R, Shi P, Yao B. Role of N-linked glycosylation in the enzymatic properties of a thermophilic GH 10 xylanase from Aspergillus fumigatus expressed in Pichia pastoris. PLoS One. 2017,12,e0171111. https://doi.org/10.1371/journal.pone.0171111 Qiu H, Li Z, Wang H, Zhang H, Li S, Luo X, Song Y, Wang N, He H, Zhou H, Ma W. Molecular and biochemical characterization of a novel cold-active and metal ion-tolerant GH10 xylanase from frozen soil. Biotechnology & Biotechnological Equipment. 2017,31,955-63. https://doi.org/10.1080/13102818.2017.1359667 Han Z, Shang-Guan F, Yang J. Molecular and biochemical characterization of a bimodular xylanase from Marinifilaceae bacterium strain SPP2. Frontiers in microbiology. 2019,10,1507. https://doi.org/10.3389/fmicb.2019.01507 Alvarez TM, Goldbeck R, Santos CR, Paixão DA, Gonçalves TA, Franco Cairo JP, Almeida RF, de Oliveira Pereira I, Jackson G, Cota J, Büchli F. Development and biotechnological application of a novel endoxylanase family GH10 identified from sugarcane soil metagenome. PLoS One. 2013,8,e70014. https://doi.org/10.1371/journal.pone.0070014 Tang L, Lei X, Ouyang K, Wang L, Qiu Q, Li Y, Zang Y, Liu C, Zhao X. A Glycosyl Hydrolase 30 Family Xylanase from the Rumen Metagenome and Its Effects on In Vitro Ruminal Fermentation of Wheat Straw. Animals. 2023,14,118. https://doi.org/10.3390/ani14010118 Hamid A, Aftab MN. Cloning, purification, and characterization of recombinant thermostable β-xylanase Tnap_0700 from Thermotoga naphthophila. Applied Biochemistry and Biotechnology. 2019,189,1274-1290. https://doi.org/10.1007/s12010-019-03068-0 Terrasan CR, Guisan JM, Carmona EC. Xylanase and β-xylosidase from Penicillium janczewskii: Purification, characterization and hydrolysis of substrates. Electronic Journal of Biotechnology. 2016,23,54-62. https://doi.org/10.1016/j.ejbt.2016.08.001 Zhang F, Chen JJ, Ren WZ, Lin LB, Zhou Y, Zhi XY, Tang SK, Li WJ. Cloning, expression, and characterization of an alkaline thermostable GH11 xylanase from Thermobifida halotolerans YIM 90462T. Journal of Industrial Microbiology and Biotechnology. 2012 ,39,1109-16. https://doi.org/10.1007/s10295-012-1119-8 Wang X, Zheng F, Wang Y, Tu T, Ma R, Su X, You S, Yao B, **e X, Luo H. Improvement of the catalytic efficiency of a hyperthermophilic xylanase from Bispora sp. MEY-1. PloS one. 2017 ,12,e0189806. https://doi.org/10.1371/journal.pone.0189806 Rajaram S, Varma A. Production and characterization of xylanase from Bacillus thermoalkalophilus grown on agricultural wastes. Applied microbiology and biotechnology. 1990 ,34,141-144. https://doi.org/10.1007/bf00170939 Kocabas DS, Ozben N. Co-production of xylanase and xylooligosaccharides from lignocellulosic agricultural wastes. RSC Advances. 2014,4,26129-26139. https://doi.org/10.1039/C4RA02508C Wang F, Yao Z, Zhang X, Han Z, Chu X, Ge X, Lu F, Liu Y. High-level production of xylose from agricultural wastes using GH11 endo-xylanase and GH43 β-xylosidase from Bacillus sp. Bioprocess and Biosystems Engineering. 2022,45,1705-1717. https://doi.org/10.1007/s00449-022-02778-w Hero JS, Pisa JH, Romero CM, Nordberg Karlsson E, Linares-Pastén JA, Martinez MA. Endo-xylanases from Cohnella sp. AR92 aimed at xylan and arabinoxylan conversion into value-added products. Applied Microbiology and Biotechnology. 2021,105,6759-6778. https://doi.org/10.1007/s00253-021-11495-5 de Oliveira Nascimento CE, de Oliveira Simões LC, de Cassia Pereira J, da Silva RR, de Lima EA, de Almeida GC, Penna AL, Boscolo M, Gomes E, da Silva R. Application of a recombinant GH10 endoxylanase from Thermoascus aurantiacus for xylooligosaccharide production from sugarcane bagasse and probiotic bacterial growth. Journal of Biotechnology. 2022,347,1-8. https://doi.org/10.1016/j.jbiotec.2022.02.003 Sukhumsirichart W, Deesukon W, Kawakami T, Matsumoto S, Seesom W, Sakamoto T. Expression and characterization of recombinant GH11 xylanase from thermotolerant Streptomyces sp. SWU10. Applied biochemistry and biotechnology. 2014,172,436-446. https://doi.org/10.1007/s12010-013-0508-4 Al-Darkazali H, Meevootisom V, Isarangkul D, Wiyakrutta S. Gene expression and molecular characterization of a xylanase from chicken cecum metagenome. International journal of microbiology. 2017,2017,4018398. https://doi.org/10.1155/2017/4018398 Liu, Mengyu, et al. \"Effective Degradation of Brewer Spent Grains by a Novel Thermostable GH10 Xylanase.\" Applied Biochemistry and Biotechnology.2023,1-12. https://doi.org/10.1007/s12010-023-04779-1 Yang J, Summanen PH, Henning SM, Hsu M, Lam H, Huang J, Tseng CH, Dowd SE, Finegold SM, Heber D, Li Z. Xylooligosaccharide supplementation alters gut bacteria in both healthy and prediabetic adults: a pilot study. Frontiers in physiology. 2015,6,216. https://doi.org/10.3389/fphys.2015.00216 Spencer S, Silva EG, Carter MM, Caffrey E, Wastyk H, Olm MR, Sonnenburg J. 442: FERMENTED FOODS PROMOTE GUT MICROBIOTA DIVERSITY AND MODULATE HOST IMMUNITY VIA BACTERIAL METABOLITES. Gastroenterology. 2022,162,S-96.DOI: 10.1016/S0016-5085(22)60241-5 Moura P, Barata R, Carvalheiro F, Gírio F, Loureiro-Dias MC, Esteves MP. In vitro fermentation of xylo-oligosaccharides from corn cobs autohydrolysis by Bifidobacterium and Lactobacillus strains. LWT-Food Science and Technology. 2007,40,963-972. https://doi.org/10.1016/j.lwt.2006.07.013 Kondepudi KK, Ambalam P, Nilsson I, Wadström T, Ljungh Å. Prebiotic-non-digestible oligosaccharides preference of probiotic bifidobacteria and antimicrobial activity against Clostridium difficile. Anaerobe. 2012,18,489-497. https://doi.org/10.1016/j.anaerobe.2012.08.005 Finegold SM, Li Z, Summanen PH, Downes J, Thames G, Corbett K, Dowd S, Krak M, Heber D. Xylooligosaccharide increases bifidobacteria but not lactobacilli in human gut microbiota. Food & Function. 2014,5,436-445. DOI: 10.1039/C3FO60348B Mäkeläinen H, Forssten S, Saarinen M, Stowell J, Rautonen N, Ouwehand AC. Xylo-oligosaccharides enhance the growth of bifidobacteria and Bifidobacterium lactis in a simulated colon model. Beneficial Microbes. 2009,1,81-92. https://doi.org/10.3920/bm2009.0025 Broekaert WF, Courtin CM, Verbeke K, Van de Wiele T, Verstraete W, Delcour JA. Prebiotic and other health-related effects of cereal-derived arabinoxylans, arabinoxylan-oligosaccharides, and xylooligosaccharides. Critical reviews in food science and nutrition. 2011,51,178-194. https://doi.org/10.1080/10408390903044768 Aachary AA, Prapulla SG. Xylooligosaccharides (XOS) as an emerging prebiotic: microbial synthesis, utilization, structural characterization, bioactive properties, and applications. Comprehensive Reviews in Food Science and Food Safety. 2011,10,2-16. https://doi.org/10.1111/j.1541-4337.2010.00135.x Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterials.docx graphicalabstract.jpg Cite Share Download PDF Status: Published Journal Publication published 07 Jan, 2026 Read the published version in BMC Biotechnology → Version 1 posted Editorial decision: Revision requested 13 Nov, 2025 Reviews received at journal 05 Nov, 2025 Reviewers agreed at journal 11 Aug, 2025 Reviews received at journal 24 Jul, 2025 Reviewers agreed at journal 17 Jul, 2025 Reviewers agreed at journal 17 Jul, 2025 Reviewers invited by journal 10 Jul, 2025 Editor assigned by journal 10 Jul, 2025 Editor invited by journal 09 Jul, 2025 Submission checks completed at journal 09 Jul, 2025 First submitted to journal 09 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6988407\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":483955772,\"identity\":\"c255e65f-b1d0-4485-b812-adbe07764acc\",\"order_by\":0,\"name\":\"Jian-ling Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Dali University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jian-ling\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":483955775,\"identity\":\"79ea77ef-2220-4c8b-b4db-1a1657546f82\",\"order_by\":1,\"name\":\"Wei Hu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Dali University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Wei\",\"middleName\":\"\",\"lastName\":\"Hu\",\"suffix\":\"\"},{\"id\":483955776,\"identity\":\"77b67d08-f44c-481d-8525-902003b4a54e\",\"order_by\":2,\"name\":\"Lan-Hua Pu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Dali University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lan-Hua\",\"middleName\":\"\",\"lastName\":\"Pu\",\"suffix\":\"\"},{\"id\":483955777,\"identity\":\"86c5863f-f5f5-4256-932e-326618ed41cc\",\"order_by\":3,\"name\":\"Jing Sun\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Dali University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jing\",\"middleName\":\"\",\"lastName\":\"Sun\",\"suffix\":\"\"},{\"id\":483955778,\"identity\":\"1918af11-fc3b-4761-8b02-486de2134c4f\",\"order_by\":4,\"name\":\"Maite Ortúzar\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Sun Yat-Sen University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Maite\",\"middleName\":\"\",\"lastName\":\"Ortúzar\",\"suffix\":\"\"},{\"id\":483955782,\"identity\":\"ce4657c7-1f57-43a2-adc4-8c62d87fa42f\",\"order_by\":5,\"name\":\"Zhi-Hua Lv\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Dali University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zhi-Hua\",\"middleName\":\"\",\"lastName\":\"Lv\",\"suffix\":\"\"},{\"id\":483955784,\"identity\":\"cb3200c9-ea9c-43eb-b4d5-9d76a783f8cc\",\"order_by\":6,\"name\":\"Zheng-Feng Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Dali University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zheng-Feng\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":483955786,\"identity\":\"7de994ba-0f50-4580-8fe6-9a2deb2b39f2\",\"order_by\":7,\"name\":\"Dan Zhu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Dali University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dan\",\"middleName\":\"\",\"lastName\":\"Zhu\",\"suffix\":\"\"},{\"id\":483955789,\"identity\":\"3fb6f639-0786-4193-a1d6-f12bf9eeead3\",\"order_by\":8,\"name\":\"Kai-Qing Xie\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Dali University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Kai-Qing\",\"middleName\":\"\",\"lastName\":\"Xie\",\"suffix\":\"\"},{\"id\":483955792,\"identity\":\"dcc78a37-0a65-4c2c-b9f3-e08a9fa45110\",\"order_by\":9,\"name\":\"Li-Quan Yang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Dali University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Li-Quan\",\"middleName\":\"\",\"lastName\":\"Yang\",\"suffix\":\"\"},{\"id\":483955797,\"identity\":\"5f1f12e2-362f-4174-86c6-57c14d2eceae\",\"order_by\":10,\"name\":\"Yi-Rui Yin\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIiWNgGAWjYDACZiBOYGDg4WdIYDwAZDA2EK1FsiGBgUgtMGAAVH+AgRgtBsd5j0k83HNYxvh48oMDDxhsZDccYH72AK+Ww3xpEgnPDvOYnXkGsijNeMMBNnMD/Fp4zCQSDgDJGwkgLYcTNxzgYZMgSovxjPQPQC3/SdBiIJEDDgHCWiSB5lskHEjnkTjzpuBAgkGy8czDbGZ4tfCdP2N488cBa3v+9vSND39U2Mn2HW9+hleLwgEGFiQFoKBixqceCOQbGJg/EFAzCkbBKBgFIx0AADDyTueHfeOwAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Dali University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Yi-Rui\",\"middleName\":\"\",\"lastName\":\"Yin\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-06-27 06:23:07\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6988407/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6988407/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1186/s12896-025-01096-9\",\"type\":\"published\",\"date\":\"2026-01-07T15:57:29+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":86665536,\"identity\":\"b037020b-dbc9-4883-bb95-db7ef998b964\",\"added_by\":\"auto\",\"created_at\":\"2025-07-14 11:03:42\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":217611,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e(A)Phylogenetic tree of strain Lc-Xyn81 constructed based on amino acid sequence homology. (B) The homology modeling of Lc-Xyn81.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6988407/v1/e94ced1cfa8ec05cc84737a2.jpg\"},{\"id\":86664782,\"identity\":\"2e60b7ee-8669-41f4-8580-5e7f5e8b1f68\",\"added_by\":\"auto\",\"created_at\":\"2025-07-14 10:55:42\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":138063,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSDS-PAGE and Zymogram of Xylanase Lc-Xyn81. Note:1\\u003cem\\u003e \\u003c/em\\u003eProtein marker; 2 Cell lysate; 3 Purified protein; 4 Zymogram\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6988407/v1/f87aecff909723fa28246810.png\"},{\"id\":86665537,\"identity\":\"8f3ee5b1-ec93-436a-abd4-8f2ae28d5615\",\"added_by\":\"auto\",\"created_at\":\"2025-07-14 11:03:42\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1496982,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEnzymatic Properties of Recombinant Xylanase Lc-Xyn81. (A)Optimal Temperature of Xylanase Lc-Xyn81; (B) Optimal pH of Xylanase Lc-Xyn81; (C) Thermal Stability of Xylanase Lc-Xyn81; (D) pH Stability of Xylanase Lc-Xyn81.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6988407/v1/49a35aa01ce2bb16f03e1df0.jpg\"},{\"id\":86668389,\"identity\":\"cac14cc9-f2e6-4d4f-b6d9-e392261fdfef\",\"added_by\":\"auto\",\"created_at\":\"2025-07-14 11:19:42\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":30678,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eTLC analysis of hydrolysis products of beechwood xylan and corncob xylan by Lc-Xyn81. Note: 1: Xylo-oligosaccharide marker (X1: xylose, X2: xylobiose, X3: xylotriose, X4: xylotetraose).(A)2: Products of Lc-Xyn81 hydrolysis of beechwood xylan. 3: Products of inactivated enzyme incubated with bee-chwood xylan. (B) 2: Products of inactivated enzyme incubated with corncob xylan.3: Products of Lc-Xyn81 hydrolysis of corncob xylan.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6988407/v1/320df46b7fa778cc6b60cecd.jpg\"},{\"id\":86664794,\"identity\":\"da516627-d088-47f2-8f1b-ffeee097bf35\",\"added_by\":\"auto\",\"created_at\":\"2025-07-14 10:55:42\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":5477556,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eGrowth-Promoting Effects of Xylan Hydrolysis Products (Prebiotics) from Lc-Xyn81 on Gut Microbiota. (A)Growth curve of\\u003cem\\u003e Lactococcus lactis\\u003c/em\\u003e NZ9000. (B) Growth curve of \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e DH5α. Note: * Indicates a statistically significant difference in growth-promoting effects after prebiotic supplementation (P ≤ 0.05).** Indicates a highly significant difference in growth-promoting effects after prebiotic supplementation (P ≤ 0.01).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6988407/v1/553d9c2712518a886f1688cd.jpg\"},{\"id\":86664792,\"identity\":\"9a0ffbba-2026-417a-b54c-b289ea54568d\",\"added_by\":\"auto\",\"created_at\":\"2025-07-14 10:55:42\",\"extension\":\"jpg\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":909557,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eGrowth curve and fluorescence intensity of gut microbiota co-cultivation. Note:The red curve represents the OD600 value, and the green curve represents the fluorescence intensity.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure6.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6988407/v1/92de8fbc8daa955d81658f5d.jpg\"},{\"id\":86664796,\"identity\":\"7f0b98ec-e065-4f99-a331-2df266998d87\",\"added_by\":\"auto\",\"created_at\":\"2025-07-14 10:55:42\",\"extension\":\"jpg\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":116947,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eMolecular Docking of Lc-Xyn81. A. Docking structure of the Lc-Xyn81-X2 complex; B. Docking structure of the Lc-Xyn81-X3 complex; C. Docking structure of the Lc-Xyn81-X4 complex; d. Docking structure of the Lc-Xyn81-X5 complex.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure7.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6988407/v1/9566d7f59b613fc9ec3432e6.jpg\"},{\"id\":86664810,\"identity\":\"7198d54b-d587-478f-86ce-7859c8ad584e\",\"added_by\":\"auto\",\"created_at\":\"2025-07-14 10:55:43\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":362282,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eBinding Mode of Xylooligosaccharides (XOS) in Lc-Xyn81. A: Superimposed structure of xylopentose and the XT6-X5 complex. The green portion represents the XT6-X5 complex, and the blue molecules represent X5 docked with Lc-Xyn81. B: Based on the docking structure, the proposed binding position of XOS within the active site cavity of Lc-Xyn81.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6988407/v1/277d2b16c8a103f93f8c0351.png\"},{\"id\":100070156,\"identity\":\"2e6e9639-594b-4ce7-9b99-9af973244d48\",\"added_by\":\"auto\",\"created_at\":\"2026-01-12 16:16:37\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":9940210,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6988407/v1/c1cf78d8-15a2-4a7d-8c9c-cf77c205f4bb.pdf\"},{\"id\":86667026,\"identity\":\"b6bca0af-5342-44f8-aca8-f41bb84f66b0\",\"added_by\":\"auto\",\"created_at\":\"2025-07-14 11:11:42\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1535448,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"SupplementaryMaterials.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6988407/v1/3a36dd6d155324b6cdbc2ae4.docx\"},{\"id\":86664790,\"identity\":\"e4cdace9-581c-41f4-ac4e-204cc04650bf\",\"added_by\":\"auto\",\"created_at\":\"2025-07-14 10:55:42\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":180478,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"graphicalabstract.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6988407/v1/4053db49811227540856539e.jpg\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Molecular cloning and characterization of a GH10 thermophilic xylanase from hot spring and its potential application in promoting probiotic growth\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eLignocellulose is the most abundant renewable polymeric biomass on Earth, composed of three primary components: cellulose, hemicellulose, and lignin[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. Most hemicelluloses are highly branched heteropolymers composed of various sugars in their main and side chains, with xylan being the predominant hemicellulose in plant cell walls [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. Xylan cannot be directly fermented or converted by microorganisms such as yeast[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. It must first be degraded by xylanase into xy-lose monomers, xylooligosaccharides, and other derivatives, which can subsequently be utilized for the production of biofuels, prebiotics, and other value-added products[\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e].\\u003c/p\\u003e\\u003cp\\u003eXylanase is the primary enzyme responsible for hydrolyzing xylan, catalyzing the cleavage of β-1,4 linkages between xylose residues in the hemicellulose backbone[\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. According to the CAZy database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.cazy.org\\u003c/span\\u003e\\u003cspan address=\\\"http://www.cazy.org\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e), endo-1,4-β-xylanases are classified into several glycoside hydrolase (GH) families. The majority of xylanases belong to the GH10 and GH11 families and are widely distributed in prokaryotes and eukaryotes[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. Thermophilic and thermostable xylanases are frequently essential for numerous industrial processes. For instance, thermophilic and alkaliphilic xylanases are essential in pulp and paper bleaching processes[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e], while thermostable and acidophilic xylanases are more desirable in industries such as juice production, baking, and animal feed[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. Currently, suitable thermophilic xylanases for industrial applica-tions are relatively scarce. Therefore, exploring and characterizing thermophilic xylanases through metagenomic approaches offers significant potential for industrial applications.\\u003c/p\\u003e\\u003cp\\u003eHot springs represent an intriguing source of novel thermophilic enzymes with potential bio-technological applications[\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e], and harbor specialized microorganisms adapted to high temper-atures and extreme pH conditions, which are capable of producing diverse xylanases. Previous studies by Zarafeta et al. and Yin et al. have explored xylanases from hot spring environ-ments[\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. Our investigation revealed that Eryuan in Dali, renowned for its rich hot spring re-sources, is an excellent site for discovering thermophilic and thermostable xylanases. Microbial enzymes are now recognized as a major source of diverse biocatalysts, with successful applica-tions across various industrial processes [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. However, due to the limitations of pure culture techniques, over 99% of prokaryotic microorganisms cannot be cultured under laboratory condi-tions, which has significantly hindered the development of thermophilic and thermostable xy-lanases[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. Metagenomics addresses the limitations of pure culture methods by directly obtain-ing nucleotide sequences of the majority of genes from environmental DNA [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. Therefore, metagenomic technology holds great promise for developing thermophilic xylanases from mi-croorganisms in extreme natural environments[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e].\\u003c/p\\u003e\\u003cp\\u003eIn addition to their industrial applications, thermophilic xylanases can also be utilized for the production of prebiotics. Prebiotics are compounds that can be utilized by gut microbiota and promoting beneficial effects on the gut microbial community. As the pace of modern life quick-ens, living standards rise, and health awareness grows, the value of prebiotics, especially xylooli-gosaccharides (XOS), has garnered considerable attention. XOS are non-digestible oligosaccha-rides consisting of 2\\u0026ndash;10 xylose units linked by β-1,4 glycosidic bonds, which can be produced by xylanases. It has been reported that the global XOS market was estimated to be valued at \\u003cspan\\u003e$\\u003c/span\\u003e99\\u0026nbsp;million in 2019 and is projected to reach \\u003cspan\\u003e$\\u003c/span\\u003e128\\u0026nbsp;million by 2025, indicating its significant market potential [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. XOS, derived from the processing of lignocellulosic biomass, exhibit various prebi-otic effects and have been utilized to improve human health by preventing colon cancer, regu-lating insulin secretion, and enhancing immune functions[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. Therefore, the discovery and characterization of enzymes capable of converting xylan into sustainable products, such as XOS, which promote bioeconomic growth and benefit human health, are of paramount importance.\\u003c/p\\u003e\\u003cp\\u003eIn this study, a novel xylanase gene (Lc-Xyn81) was isolated from metagenomic data ob-tained from samples collected at the Wenquanjie hot spring in Eryuan, City Dali, China. The gene was characterized through heterologous expression, protein purification, and enzymatic property analysis. The results indicated that Lc-Xyn81 is a thermophilic enzyme with broad pH stability, high resistance to metal ions and chemical reagents, and hydrolysis products primarily consisting of xylobiose and xylotetraose. These characteristics suggest that Lc-Xyn81 has considerable po-tential for applications in the food, feed, paper, and bioethanol industries, particularly for the production of prebiotics.\\u003c/p\\u003e\"},{\"header\":\"2. Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.1 Sample Collection and Metagenomic Sequencing\\u003c/h2\\u003e\\u003cp\\u003eSoil samples were collected from the Wenquanjie hot spring in Eryuan, Dali, Yunnan Prov-ince (latitude 25\\u0026deg;98\\u0026prime;72.38\\u0026Prime;N, longitude 99\\u0026deg;92\\u0026prime;37.66\\u0026Prime;E). The samples underwent enrichment cul-ture, and DNA was isolated using a commercial DNA extraction kit. Metagenomic sequencing was performed using the HiSeq 2500 platform (GENWIZ, Suzhou). De novo assembly of the sequencing data was conducted using the Velvet assembly program (version 1.2.08)[\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. The Integrated Microbial Genomes (IMG) platform (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://img.jgi.doe.gov/cgi-bin/mer/main.cgi\\u003c/span\\u003e\\u003cspan address=\\\"https://img.jgi.doe.gov/cgi-bin/mer/main.cgi\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) was used to analyze the assembled sequences. To further annotate the potential functions of indi-vidual genes and open reading frames (ORFs), the COG (Clusters of Orthologous Groups) data-base[\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e], KEGG (Kyoto Encyclopedia of Genes and Genomes) [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e], and Pfam (Protein families database)[\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e] were employed.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.2 Sequence Prediction and Analysis of Lc-Xyn81\\u003c/h2\\u003e\\u003cp\\u003eFunctional prediction and analysis were performed using the KEGG and COG databases to identify functional genes associated with xylanase activity, and domain analysis was conducted using the Pfam database. A novel xylanase gene sequence, designated as lc-xyn81, was identi-fied from the metagenomic database. The nucleotide sequence of the lc-xyn81 gene was depos-ited in GenBank (accession NO.: PQ856056). The lc-xyn81 gene was synthesized based on Esch-erichia coli codon preferences and cloned into the PSHY211 vector. BLASTx and BLASTp pro-grams (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://blast.ncbi.nlm.nih.gov/Blast.cgi\\u003c/span\\u003e\\u003cspan address=\\\"http://blast.ncbi.nlm.nih.gov/Blast.cgi\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) were used to compare the DNA and protein se-quences of Lc-Xyn81, respectively. Signal peptide prediction was performed using SignalP (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.cbs.dtu.dk/services/SignalP/\\u003c/span\\u003e\\u003cspan address=\\\"http://www.cbs.dtu.dk/services/SignalP/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e), and the amino acid sequence structure was deduced and analyzed using the EXPASY tool (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://web.expasy.org/protparam/).Th\\u003c/span\\u003e\\u003cspan address=\\\"http://web.expasy.org/protparam/).Th\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003ee protein sequence of Lc-Xyn81 was compared against the NCBI BLASTp database to identify homologous xy-lanase sequences. Sequences with high similarity from the same or closely related genera were selected as neighboring sequences, while xylanase protein sequences with low similarity from other genera were used as outgroup sequences for multiple alignments and phylogenetic tree construction. Multiple sequence alignment of Lc-Xyn81 and closely related protein sequences was performed using ClustalX[\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. Phylogenetic analysis was conducted using the MEGA7 software package [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. A phylogenetic tree was constructed using the maximum likelihood (ML) method with a Poisson correction model. The Lc-Xyn81 sequence was further aligned with pro-tein databases (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi\\u003c/span\\u003e\\u003cspan address=\\\"http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) for multiple sequence compari-sons [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. Homology modeling of the Lc-Xyn81 amino acid sequence was performed using the Swiss-Model platform and visualized with PyMOL software.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.3 Molecular Cloning of Lc-Xyn81\\u003c/h2\\u003e\\u003cp\\u003eThe full-length gene of lc-xyn81 was amplified using the following primers:\\u003c/p\\u003e\\u003cp\\u003elc-xyn81-F: \\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eCATCATCATCATCATCATGAA\\u003c/span\\u003eGAGGAGGAGGCCGGCCGGTC\\u003c/p\\u003e\\u003cp\\u003elc-xyn81-R: \\u003cspan type=\\\"Underline\\\" class=\\\"Underline\\\" name=\\\"Emphasis\\\"\\u003eGTGCTCGAGTGCGGCCGCAAG\\u003c/span\\u003eGGGCAACGACGCGCTCTCCTG.\\u003c/p\\u003e\\u003cp\\u003eThe underlined sequences represent recombinant fragments that are homologous to the pSHY211 vector, which had previously been digested with EcoRI and HindIII. The PCR program included an initial denaturation step at 95\\u0026deg;C for 180 seconds, followed by 10 cycles of 98\\u0026deg;C for 20 seconds and annealing and extension at 68\\u0026deg;C for 150 seconds. Subsequently, 30 cycles of 98\\u0026deg;C for 20 seconds, 55\\u0026deg;C for 30 seconds, and 72\\u0026deg;C for 150 seconds were performed, with a final extension at 72\\u0026deg;C for 10 min. The PCR product was inserted into the pSHY211 vector using the seamless cloning and assembly kit (pEASY-Uni, TransGen Biotech, China) to generate the expression plasmid pSHY211-Lc-Xyn81. The lc-xyn81 gene was cloned and expressed in \\u003cem\\u003eE. coli\\u003c/em\\u003e DH5α, wiht the \\u003cem\\u003eE. coli\\u003c/em\\u003e cells were grown on LB medium supplemented with 50 \\u0026micro;g/mL kanamycin. DNA isolation and purification were performed using a DNA purification kit (Sangon Biotech, China).\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.4 Heterologous Expression and Purification of Lc-Xyn81\\u003c/h2\\u003e\\u003cp\\u003e\\u003cem\\u003eEscherichia coli DH5α\\u003c/em\\u003e cells harboring the recombinant plasmid pSHY211-Lc-Xyn81 were cultured for the heterologous expression of the lc-xyn81 gene. The recombinant \\u003cem\\u003eE. coli DH5α\\u003c/em\\u003e strain containing pSHY211-Lc-Xyn81 was cultivated in 100 mL of LB medium supplemented with 50 \\u0026micro;g/mL kanamycin at 37\\u0026deg;C and 180 rpm for 7 h. The culture was then transferred to 25\\u0026deg;C and continued shaking at 180 rpm for an additional 12 h. The culture broth was aliquoted into 50 mL centrifuge tubes and centrifuged at 4000\\u0026times;g for 20 min to pellet the cells. The super-natant was discarded, and the cell pellets were resuspended. After resuspension, the cells were disrupted by ultrasonic treatment, followed by centrifugation at 12,000\\u0026times;g for 15 min at 4\\u0026deg;C to collect the cell lysate. The cell lysate was purified using a Ni-affinity chromatography column (HisTrap, TransGen Biotech, China) according to the method previously reported by Yin[\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. The protein concentration was determined using the Bradford Protein Assay Kit (Order No. C503031, Sangon Biotech, China), with bovine serum albumin as the standard.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.5 SDS-PAGE and Zymography Analysis\\u003c/h2\\u003e\\u003cp\\u003eThe protein purified through the Ni-affinity column was analyzed using 12% denaturing polyacrylamide gel electrophoresis (SDS-PAGE). Simultaneously, a 12% native polyacrylamide gel was prepared with a final concentration of 0.2% beechwood xylan as the substrate for zymography. After electrophoresis, the native gel was immersed in phosphate buffer (pH 7.6) containing 2.5% Triton-X100 at 4\\u0026deg;C for 30 min. The gel was then transferred to phosphate buffer (pH 7.6) and incubated at 60\\u0026deg;C for 2 h. The gel was stained with 0.2% Congo red and destained using 1 M NaCl. Clear bands against the red background indicated xylanase activity.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.6 Activity Assay of Lc-Xyn81\\u003c/h2\\u003e\\u003cp\\u003eThe enzymatic activity of the recombinant protein Lc-Xyn81 was determined following the method described by Yin et al. The reducing sugars released were quantified using the DNS (3,5-dinitrosalicylic acid) method, with xylose as the standard [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e].One unit of xylanase activity was defined as the amount of enzyme required to release 1 \\u0026micro;mol of reducing sugars per min un-der the assay conditions.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.7 Enzymatic Characterization\\u003c/h2\\u003e\\u003cp\\u003eThe purified enzyme Lc-Xyn81 was characterized by determining its activity at various temperatures (20\\u0026ndash;80\\u0026deg;C) under pH 7 conditions to identify the optimal temperature. The optimal pH for Lc-Xyn81 was determined by incubating the purified enzyme in different buffer systems across a pH range of 3.0\\u0026ndash;12.0 (citric acid-sodium phosphate buffer for pH 3.0\\u0026ndash;8.0; glycine-sodium hydroxide buffer for pH 8.0\\u0026ndash;12.0) and measuring its activity at the optimal temperature. To evaluate the thermal and pH stability of Lc-Xyn81, the enzyme was incubated at various temperatures for different durations (0, 20, 40, 60, 80, 100, and 120 min) and in buffers with pH ranging from 3.0 to 9.0 for extended periods (12 and 24 h). Residual enzyme activity was measured after incubation to assess stability.\\u003c/p\\u003e\\u003cp\\u003eEvaluation of the Effects of Metal Ions and Chemical Reagents on Lc-Xyn81 Activity. The influence of various metal ions (K⁺, Mg\\u0026sup2;⁺, Fe\\u0026sup3;⁺, Ca\\u0026sup2;⁺, Zn\\u0026sup2;⁺, Co\\u0026sup2;⁺, Cu\\u0026sup2;⁺, Ag⁺, Mn\\u0026sup2;⁺, Pb\\u0026sup2;⁺, Ni\\u0026sup2;⁺) at concentrations of 1 mM and 10 mM, and chemical reagents (0.1% and 1%) such as ethylenediaminetetraacetic acid (EDTA), phenylmethylsulfonyl fluoride (PMSF), polysorbate 80 (Tween 80), methanol (MeOH), ethanol (EtOH), sodium dodecyl sulfate (SDS), urea, β-mercaptoethanol (β-ME), cetyltrimethylammonium bromide (CTAB), and dithiothreitol (DTT) were assessed by adding them to the reaction system. Control experiments were conducted under identical conditions without the addition of any metal ions or chemical reagents.\\u003c/p\\u003e\\u003cp\\u003eThe enzymatic activity of Lc-Xyn81 was evaluated using various substrates, including beechwood xylan, corncob xylan, oat spelt xylan, sugarcane bagasse xylan, carboxymethyl cellulose sodium salt (CMC-Na), microcrystalline cellulose (Avicel), and cellobiose, at a concentration of 1% (w/v). Under optimal pH and temperature conditions, the kinetic constants of Lc-Xyn81 were determined using compound concentrations ranging from 0.1 to 20 mg/mL. The Michaelis-Menten constant (Km) and maximum reaction velocity (Vmax) were calculated using the Lineweaver-Burk plot.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.8 TLC Analysis of Xylanase Lc-Xyn81\\u003c/h2\\u003e\\u003cp\\u003eReaction mixtures containing 1% xylan or CMC-Na and 10 \\u0026micro;g of purified enzyme were incubated at optimal pH and temperature for 12 h. The hydrolysis products of beechwood xylan and corncob xylan were analyzed using thin-layer chromatography (TLC) on silica gel 60 plates (Merck, Darmstadt, Germany). The solvent system used was n-butanol/acetic acid/water (2:1:1, v/v/v). The plates were sprayed with freshly prepared 5% (v/v) H₂SO₄ in ethanol and heated at 120\\u0026deg;C for 10 min to visualize sugar content. Xylose (X1), xylobiose (X2), xylotriose (X3), and xylotetraose (X4) were used as standards.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.9 Effect of Prebiotics on the Growth of \\u003cem\\u003eLactococcus lactis\\u003c/em\\u003e NZ9000\\u003c/h2\\u003e\\u003cp\\u003ePrebiotic products were generated by treating xylan substrates with the enzyme xylanase Lc-Xyn81. Equal amounts of the prebiotic products were added to 10 mL of LB liquid medium, which was then inoculated with 200 \\u0026micro;L of either \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 or \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e. Control groups, which did not receive prebiotic products, were established with three replicates for each group. The cultures were incubated at 37\\u0026deg;C in a shaking incubator, and bacterial growth was monitored by measuring the optical density at 600 nm (OD600). Measurements were taken every 2 h for the first 14 h, followed by intervals of 6 and 12 h up to 48 h. Growth curves were plotted for both \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 and \\u003cem\\u003eE. coli\\u003c/em\\u003e.\\u003c/p\\u003e\\u003cp\\u003eTo simulate the intestinal microbiota environment, prebiotics were supplemented into Luria-Bertani (LB) medium, followed by the co-culture of \\u003cem\\u003eE. coli\\u003c/em\\u003e and \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 to investigate the effects of prebiotics on beneficial gut microorganisms such as \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000. The EJFP fluorescent reporter gene was introduced into \\u003cem\\u003eE. coli\\u003c/em\\u003e, with co-cultures including \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 serving as the negative control. The experimental group comprised co-cultures of \\u003cem\\u003eE. coli\\u003c/em\\u003e and L. lactis NZ9000 in LB medium supplemented with prebiotics. The initial inoculum concentrations of \\u003cem\\u003eE. coli\\u003c/em\\u003e and \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 were standardized across both control and experimental groups. Both groups were incubated at 37\\u0026deg;C in a shaking incubator, and at 24-h, 36-h, and 48-h intervals, cultures were homogenized. Subsequently, 1 mL of the mixed culture was aseptically transferred to sterile centrifuge tubes, serially diluted to 10⁻⁷, and 100 \\u0026micro;L of the diluted cultures were plated for colony enumeration. To better assess the effect of prebiotics on the growth of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000, this study measured both the biomass and fluorescence intensity of the control and experimental groups. Both groups were cultured in a 37\\u0026deg;C shaking incubator, and biomass (OD600) and fluorescence intensity (Excitation: 485/20, Emission: 528/20) were measured every 2 h up to 12 h. After 12 h, measurements were taken every 12 h until 72 h.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.10 Molecular Docking\\u003c/h2\\u003e\\u003cp\\u003eThe small molecule xylooligosaccharides (XOS), which include X2, X3, X4, and X5[\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e], were used as docking ligands, while the Lc-Xyn81 protein served as the receptor for molecular docking. Enzyme-ligand docking simulations were performed using the AutoDock Vina 1.5.6 platform (ADT). Docking grid parameters for all XOS ligands were referenced from the supplementary materials. The grid box encapsulates the entire active site cleft, including sub-sites at the +\\u0026thinsp;1 and \\u0026minus;\\u0026thinsp;1 positions in the center. Ligand atoms exhibited high flexibility, and active torsional selections and torsion root identifications were performed during ligand parameterization. During this process, both rotatable and non-rotatable bonds within the substrate molecule were evaluated. The ligand conformation that exhibited the best fit with the protein complex was selected based on sequence consistency and query coverage. The docking results were ranked according to binding energy scores, selecting the lowest energy conformation for positional binding analysis. Protein-ligand interaction analysis was performed using the Protein-Ligand Interaction Profiler (PLIP) to optimize the active site residues. The criterion for hydrogen bond formation was that the maximum distance between the donor and acceptor atoms should be less than 3.4 \\u0026Aring;. To visualize the enzyme-substrate interaction, PyMOL was used for structural analysis.\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e2.11 Statistical Analysis\\u003c/h2\\u003e\\u003cp\\u003eUnless otherwise specified, all experiments were conducted in triplicate, and mean values were used for all analyses. Statistical analyses were performed using SPSS version 20.0, and results are presented as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM. One-way analysis of variance (ANOVA) was employed for statistical comparisons, and Tukey\\u0026rsquo;s post hoc test was used for multiple group comparisons. A p-value of \\u0026lt;\\u0026thinsp;0.05 was considered to indicate statistical significance in all comparisons.\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e3.1 Cloning and Molecular Analysis of the Lc-Xyn81 Gene\\u003c/h2\\u003e\\u003cp\\u003eSediment samples were collected from Eryuan Hot Spring and subjected to enrichment culture. DNA was extracted from these samples and sequenced. A similarity search of the Lc-Xyn81 sequence identified a novel candidate gene designated as lc-xyn81. Nucleotide sequence analysis of the full-length Lc-Xyn81 gene revealed a total length of 1,107 base pairs (bp). The open reading frame (ORF) encodes 369 amino acid residues, which include a signal peptide sequence spanning residues 1\\u0026ndash;26 and a domain that encodes the GH10 family structure spanning residues 87\\u0026ndash;386. The theoretical molecular weight of the Lc-Xyn81 xylanase is calculated to be 44.52 kDa, with an estimated isoelectric point (pI) of 6. Comparative analysis of the amino acid sequence of Lc-Xyn81 showed homology of 72.29%, 72.57%, and 72.29% with endo-1,4-β-xylanases from \\u003cem\\u003eBlastocatellia bacterium\\u003c/em\\u003e (HST22061.1), \\u003cem\\u003eBryobacteraceae bacterium\\u003c/em\\u003e (HEY1242353.1), and \\u003cem\\u003eBlastocatellia bacterium\\u003c/em\\u003e (HKS43363.1), respectively(Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). Additionally, a protein structure model of Lc-Xyn81 was also simulated (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e3.2 Heterologous Expression and Purification of Lc-Xyn81\\u003c/h2\\u003e\\u003cp\\u003eThe lc-xyn81 gene was successfully cloned into the pSHY211 vector, resulting in a His-tagged fusion protein, which was further confirmed by sequencing. The recombinant enzyme Lc-Xyn81 was purified using Ni\\u0026sup2;⁺-NTA affinity chromatography. SDS-PAGE analysis of the purified protein on a 12% gel revealed a single band at approximately 43 kDa, consistent with the theoretical molecular weight (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). The enzymatic activity of the purified protein was validated through zymogram analysis, which indicated decolorization against a red background within the 38\\u0026ndash;45 kDa range, thus confirming the enzymatic activity at this molecular weight (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e3.3 Effects of Temperature and pH on Lc-Xyn81\\u003c/h2\\u003e\\u003cp\\u003eThe optimal reaction temperature for Lc-Xyn81 was determined at 75\\u0026deg;C, with the enzyme maintaining over 60% of its relative activity within the temperature range of 60\\u0026ndash;75\\u0026deg;C (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). Thermal stability assessments revealed that Lc-Xyn81 retained more than 90% of its activity after 60 min of incubation at 65\\u0026deg;C. The enzyme exhibited half-lives of 180 min and 10 min at 70\\u0026deg;C and 75\\u0026deg;C, respectively. Notably, incubation at 70\\u0026deg;C for 80 min led to an increase in enzyme activity of 149%, followed by a subsequent decline (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eThe optimal pH for Lc-Xyn81 activity was found to be pH 6.6, with the enzyme maintaining over 50% of its relative activity across a pH range of 6 to 9 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB). pH stability analyses demonstrated that the purified enzyme retained more than 100% of its initial activity after incubation at 4\\u0026deg;C for 12 h within the pH range of 4.0\\u0026ndash;8.0. After 24 h of incubation, the enzyme maintained over 60% of its activity (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD).\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e3.4 Effects of Metal Ions and Chemical Reagents on Lc-Xyn81\\u003c/h2\\u003e\\u003cp\\u003eAs shown in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e, at ion concentrations of 1 mM and 10 mM, the activity of Lc-Xyn81 was activated by Co\\u0026sup2;⁺, Cu\\u0026sup2;⁺, Fe\\u0026sup3;⁺, Pb\\u0026sup2;⁺, Mn\\u0026sup2;⁺, Ni\\u0026sup2;⁺, and Mg\\u0026sup2;⁺, exhibiting varying degrees of activation. The enzyme activity was significantly inhibited by K⁺and Ag⁺. Overall, most metal ions were capable of activating Lc-Xyn81 activity. Additionally, as indicated in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, chemical reagents such as PMSF, SDS, EDTA, MeOH, EtOH, β-ME, DTT, Urea, and CTAB exhibited inhibitory effects on Lc-Xyn81. High concentrations of SDS, DTT, CTAB, and β-ME strongly inhibited the enzyme. However, when the concentrations of MeOH and EtOH were at 10%, Lc-Xyn81 retained over 80% of its activity, suggesting a potential tolerance to these alcohols. Tween 80 was able to activate Lc-Xyn81 activity, with maximum activity exceeding 120% in the presence of 1% Tween 80. Furthermore, in the presence of 1% Urea, PMSF, and EDTA, the enzyme maintained activity levels above 70%.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eEffects of Metal Ions on Lc-Xyn81\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"4\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colspan=\\\"2\\\" morerows=\\\"1\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\" rowspan=\\\"2\\\"\\u003e\\u003cp\\u003eEffector\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c4\\\" namest=\\\"c3\\\"\\u003e\\u003cp\\u003eRelative activity\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e1 mM\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e10 mM\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eControl\\u003c/b\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e100\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.41\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e100\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.41\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eK\\u003c/b\\u003e\\u003csup\\u003e\\u003cb\\u003e+\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e70.95\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.68**\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e49.37\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;6.49**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eMg\\u003c/b\\u003e\\u003csup\\u003e\\u003cb\\u003e2+\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e102.59\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;5.96\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e122.82\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.87**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eFe\\u003c/b\\u003e\\u003csup\\u003e\\u003cb\\u003e3+\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e166.44\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;9.61**\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e144.74\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.32**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eCa\\u003c/b\\u003e\\u003csup\\u003e\\u003cb\\u003e2+\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e95.55\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.70\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e88.93\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.71**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eZn\\u003c/b\\u003e\\u003csup\\u003e\\u003cb\\u003e2+\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e97.65\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.28\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e96.68\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.24**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eCo\\u003c/b\\u003e\\u003csup\\u003e\\u003cb\\u003e2+\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e128.55\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;9.33**\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e143.39\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.64**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eCu\\u003c/b\\u003e\\u003csup\\u003e\\u003cb\\u003e2+\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e112.27\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;9.02*\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e101.38\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.15**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eAg\\u003c/b\\u003e\\u003csup\\u003e\\u003cb\\u003e+\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e0**\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eMn\\u003c/b\\u003e\\u003csup\\u003e\\u003cb\\u003e2+\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e119.84\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;5.87**\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e170.09\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.21**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003ePb\\u003c/b\\u003e\\u003csup\\u003e\\u003cb\\u003e2+\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e102.23\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.62\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e102.41\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.69\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eNi\\u003c/b\\u003e\\u003csup\\u003e\\u003cb\\u003e2+\\u003c/b\\u003e\\u003c/sup\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e108.01\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;4.20\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e106.28\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.69*\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003ctfoot\\u003e\\u003ctr\\u003e\\u003ctd colspan=\\\"4\\\"\\u003eNote: Activity in the absence of additives is set to 100%. Each value represents the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD. * indicates a significant difference in activity with the addition of additives (P\\u0026thinsp;\\u0026le;\\u0026thinsp;0.05). ** indicates a highly significant difference in activity with the addition of additives (P\\u0026thinsp;\\u0026le;\\u0026thinsp;0.01).\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tfoot\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eEffects of Chemical Reagents on Lc-Xyn81\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"4\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c4\\\" namest=\\\"c3\\\"\\u003e\\u003cp\\u003eRelative activity\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eEffector\\u003c/b\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c4\\\" namest=\\\"c3\\\"\\u003e\\u003cp\\u003eEffector concentration (W/V)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e0.1%\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e1%\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eControl\\u003c/b\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e100\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.41\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e100\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.41\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eDTT\\u003c/b\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e52.96\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.82**\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e21.47\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.42**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eSDS\\u003c/b\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e95.65\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.25\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e0**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eUrea\\u003c/b\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e94.58\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;9.79\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e90.60\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.76**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003ePMSF\\u003c/b\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e83.44\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.89**\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e72.89\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.90**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eEDTA\\u003c/b\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e97.82\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.68\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e70.03\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.53**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eCTAB\\u003c/b\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e24.04\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;7.91**\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e19.87\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;6.20**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c4\\\" namest=\\\"c3\\\"\\u003e\\u003cp\\u003eEffector concentration (W/V)\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e1%\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e10%\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eTween80\\u003c/b\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e129.69\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;4.86**\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e121.81\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.23**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eMeOH\\u003c/b\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e96.76\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.69\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e80.72\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.06**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eEtOH\\u003c/b\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e95.46\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.72\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e84.56\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.94**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colspan=\\\"2\\\" nameend=\\\"c2\\\" namest=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cb\\u003eβ-Me\\u003c/b\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003e84.38\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.27*\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003e1.93\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.87**\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003ctfoot\\u003e\\u003ctr\\u003e\\u003ctd colspan=\\\"4\\\"\\u003eNote: Activity in the absence of additives is set to 100%. Each value represents the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD. * indicates a significant difference in activity with the addition of additives (P\\u0026thinsp;\\u0026le;\\u0026thinsp;0.05). ** indicates a highly significant difference in activity with the addition of additives (P\\u0026thinsp;\\u0026le;\\u0026thinsp;0.01).\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tfoot\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e3.5 Substrate Specificity and Kinetic Analysis of Lc-Xyn81\\u003c/h2\\u003e\\u003cp\\u003eAs presented in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e, the relative activity of Lc-Xyn81 towards beechwood xylan was 213.68\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.21 U/mg, while its relative activities towards corn cob xylan, sugarcane bagasse xylan, and oat xylan were 143.40\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;8.32 U/mg, 80.39\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;10.74 U/mg, and 10.80\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;5.19 U/mg, respectively. Notably, Lc-Xyn81 exhibited no enzymatic activity against Avicel, carboxymethyl cellulose (CMC), and cellobiose. Kinetic parameters for the recombinant enzyme Lc-Xyn81 using beechwood xylan as the substrate were determined, yielding a Km of 4.62 mg/mL, a Vmax of 312.50 \\u0026micro;mol/min/mg, and a Kcat of 242.49 s⁻\\u0026sup1; (refer to Table\\u0026nbsp;\\u003cspan refid=\\\"Tab4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). These results indicate that Lc-Xyn81 possesses activity against various types of xylan, demonstrating its capability to degrade these substrates effectively.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab3\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 3\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eActivity of Lc-Xyn81 on Different Substrates\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"2\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eSubstres\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eSpecific activity(U/mg)\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eBeechwood xylan\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e213.68\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.21\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCorncob xylan\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e143.40\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;8.32\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eBagasse xylan\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e80.39\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;10.74\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eOatspelt xylan\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e10.80\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;5.19\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eAvicel cellulose\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e0\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCellobiose\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e0\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eCMC\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e0\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab4\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 4\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eCharacteristics of Lc-Xyn81\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"2\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eParameters\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eValues\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eSubstrate\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eBeechwood xylan\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eOptimal temperature\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e75℃\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eOptimal pH\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e6.6\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eSpecific activity\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e213.68\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.21\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eKm\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e4.62mg/ml\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eVmax\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e312.50 \\u0026micro;mol/min/mg\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eMolecular mass\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e44.52 KDa\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eKcat\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e242.49s\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e3.6 TLC Analysis\\u003c/h2\\u003e\\u003cp\\u003eAs shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e, the hydrolysis products of xylan by Lc-Xyn81 were analyzed using thin-layer chromatography (TLC). The results demonstrated that the primary hydrolysis products of Lc-Xyn81 were xylobiose (X2) and xylotetraose (X4), along with a minor amount of xylotriose (X3).\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e\\u003ch2\\u003e3.7 Analysis of the Growth-Promoting Effects of Prebiotic Products\\u003c/h2\\u003e\\u003cp\\u003eThe growth-promoting effects of the xylan hydrolysis products (prebiotics) generated by Lc-Xyn81 are shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA. During the first 10 h of cultivation, \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 remained in the lag phase. After 10 h, they entered the logarithmic growth phase. Compared to the control group without prebiotic supplementation, the growth rate of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 in the prebiotic-supplemented group showed no significant difference during the first 14 h. However, the cell density of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 in the prebiotic-supplemented group was relatively higher. After 14 h, the growth rate of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 in the control group plateaued, entering the stationary phase. In contrast, the growth rate in the prebiotic-supplemented group continued to increase, with the OD600 of the bacterial cells significantly higher (3\\u0026ndash;5 times that of the control group) between 24 and 48 h (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA). For \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e DH5α, no significant difference in growth was observed between the groups with and without prebiotic supplementation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB). These results indicate that the xylan hydrolysis products of Lc-Xyn81 function as effective prebiotics, significantly promoting the growth of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000, while having no growth-promoting effect on \\u003cem\\u003eE. coli\\u003c/em\\u003e.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eUsing a co-culture of \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e and \\u003cem\\u003eLactococcus lactis NZ9000\\u003c/em\\u003e to investigate the effect of Lc-Xyn81 xylan hydrolysis products (prebiotics) on gut microbiota. The results showed that the relative abundance of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 at 24 h (45% and 46.3%), 36 h (3.7% and 68.8%), and 48 h (2.4% and 34.2%) with and without the addition of prebiotics, respectively (Supplementary Fig. \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e). In the control group, the population of \\u003cem\\u003eE. coli\\u003c/em\\u003e gradually increased over time, while \\u003cem\\u003eL. lactis NZ9000\\u003c/em\\u003e were extremely scarce. In contrast, the prebiotic-supplemented group, both \\u003cem\\u003eE. coli\\u003c/em\\u003e and \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 exhibited growth, with the population of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 significantly higher than that of the control group. Notably, at 36 and 48 h, the population of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 surpassed that of \\u003cem\\u003eE. coli\\u003c/em\\u003e. These results demonstrate that the obtained prebiotic products have a growth-promoting effect on \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000.\\u003c/p\\u003e\\u003cp\\u003eIn the control group, the fluorescence intensity continuously increased over time, indicating a gradual increase in the number of Escherichia coli (carrying the EGFP gene) and a corresponding decrease in the number of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000. In contrast, in the prebiotic-treated group, the OD600 of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 significantly increased, and the fluorescence intensity was lower than that in the untreated group. This suggests that the number of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 was significantly higher in the prebiotic-treated group compared to the control group, with \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000 being more abundant than \\u003cem\\u003eE. coli\\u003c/em\\u003e (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). These results indicate that the prebiotic product obtained has a promoting effect on the growth of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eIn this study, the Lc-Xyn81 gene, which encodes a xylanase, was identified from the metagenome of microorganisms inhabiting the hot spring sediments of Longwangmiao, Eryuan. The gene was cloned and expressed to obtain the recombinant xylanase Lc-Xyn81. The optimal temperature for Lc-Xyn81 was 75\\u0026deg;C, with relative activity below 20% at 20\\u0026ndash;50\\u0026deg;C, while retaining more than 60% relative activity at 60\\u0026ndash;70\\u0026deg;C. The half-life of Lc-Xyn81 was 3 h at 70\\u0026deg;C and 10 min at 75\\u0026deg;C, indicating that it is a thermophilic and thermostable xylanase.\\u003c/p\\u003e\\u003cp\\u003ePhylogenetic analysis indicated that Lc-Xyn81 clusters with the Blastocatellia class. The protein structure of Lc-Xyn81 was modeled using SWISS-MODEL, employing the template with the highest sequence identity (71.63%) and GMQE score (0.91). The protein model of Lc-Xyn81 exhibited the typical TIM-barrel structure of the GH10 family, a three-dimensional protein structure consisting of eight β-strands alternating with eight α-helices. The active site of enzymes with a TIM-barrel structure is generally located at the C-terminal end of the β-strands. The β-strands are considered to contribute to thermostability, possibly due to the formation of salt bridges within the β-strands, which stabilize the entire protein structure[\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e].\\u003c/p\\u003e\\u003cp\\u003eThermostable xylanases play a crucial role in industrial processes that require high-temperature conditions. It has been reported that most thermostable xylanases exhibit op-timal activity within the temperature range of 60\\u0026ndash;75\\u0026deg;C[\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. For instance, FAE-1, XynA, and rXynSOS show optimal temperatures of 60\\u0026deg;C, 65\\u0026deg;C, and 70\\u0026deg;C, respectively[\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e]. The thermal stability of xylanases is an important factor for their functionality in industrial applications. Lc-Xyn81 exhibited a half-life of 3 h at 70\\u0026deg;C, demonstrating superior thermal stability compared to Pm25, a xylanase from Bacteroides isolated from the termite gut metagenome, with a half-life of 1 h at 60\\u0026deg;C, and Xyn30Y5 from Bacillus sp. 30Y5, which has a half-life of 30 min at 60\\u0026deg;C(Table\\u0026nbsp;\\u003cspan refid=\\\"Tab5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e)[\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]. Consequently, the thermophilic and thermostable xylanase Lc-Xyn81 is well-suited for industrial processes that operate at moderate to high temperatures.\\u003c/p\\u003e\\u003cp\\u003e\\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab5\\\" border=\\\"1\\\"\\u003e\\u003ccaption language=\\\"En\\\"\\u003e\\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 5\\u003c/div\\u003e\\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\u003cp\\u003eComparison of Enzymatic Properties Between Lc-Xyn81 and Other Xylanases\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/caption\\u003e\\u003ccolgroup cols=\\\"8\\\"\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c7\\\" colnum=\\\"7\\\"\\u003e\\u003c/div\\u003e\\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c8\\\" colnum=\\\"8\\\"\\u003e\\u003c/div\\u003e\\u003cthead\\u003e\\u003ctr\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eEnzyme\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eSources\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGH Family\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003eOptimal\\u003c/p\\u003e\\u003cp\\u003econdition\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003eThermostability\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003eHalf-life\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003eXOS Production\\u003c/p\\u003e\\u003c/th\\u003e\\u003cth align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u003cp\\u003eReference\\u003c/p\\u003e\\u003c/th\\u003e\\u003c/tr\\u003e\\u003c/thead\\u003e\\u003ctbody\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eLc-Xyn81\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eHot Spring Metagenome\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGH10\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003epH6.6, 75\\u0026nbsp;\\u0026deg;C\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e\\u0026le;\\u0026thinsp;75℃\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e70, t₁/₂=3h\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003eX2、X4\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u003cp\\u003eThis study\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eXynA\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eBacillus\\u003c/em\\u003e sp. KW1\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGH10\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003epH6.0, 65\\u0026nbsp;\\u0026deg;C\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e\\u0026le;\\u0026thinsp;70℃\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e70, t₁/₂=1.5h\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003eX1-X4\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u003cp\\u003e[\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eTc\\u003c/em\\u003eXyn10A\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eThermobacillus composti\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGH10\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003epH6\\u0026thinsp;~\\u0026thinsp;8, 65\\u0026deg;C\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e\\u0026le;\\u0026thinsp;65℃\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e65, t₁/₂=8h\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003eX2、X3\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u003cp\\u003e[\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003ePm25\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003eTermite Gut Metagenome\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGH10\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003epH7.5, 50\\u0026nbsp;\\u0026deg;C\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e\\u0026le;\\u0026thinsp;60℃\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e60, t₁/₂=1h\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003eX1-X6\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u003cp\\u003e[\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eXyn30Y5\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eBacillus\\u003c/em\\u003e sp. 30Y5\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGH10\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003epH7.0, 70\\u0026nbsp;\\u0026deg;C\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e\\u0026le;\\u0026thinsp;70℃\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e60, t₁/₂=0.5h\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003e-\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u003cp\\u003e[\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003ctr\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u003cp\\u003eNhGH11\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u003cp\\u003e\\u003cem\\u003eNectria haematococca\\u003c/em\\u003e\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e\\u003cp\\u003eGH11\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u003cp\\u003epH6.0, 45\\u0026nbsp;\\u0026deg;C\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u003cp\\u003e\\u0026le;\\u0026thinsp;50℃\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u003cp\\u003e50, t₁/₂=4h\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e\\u003cp\\u003eX1-X4\\u003c/p\\u003e\\u003c/td\\u003e\\u003ctd align=\\\"left\\\" colname=\\\"c8\\\"\\u003e\\u003cp\\u003e[\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]\\u003c/p\\u003e\\u003c/td\\u003e\\u003c/tr\\u003e\\u003c/tbody\\u003e\\u003c/colgroup\\u003e\\u003c/table\\u003e\\u003c/div\\u003e\\u003c/p\\u003e\\u003cp\\u003eStudies have reported that HJ2, HJ14, and XynA (from \\u003cem\\u003eBacillus\\u003c/em\\u003e sp.) are mildly acidic xy-lanases. In this study, Lc-Xyn81 was found to have an optimal pH of 6.6, classifying it as a mildly acidic enzyme[\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e]. Although Lc-Xyn81 is classified as mildly acidic enzyme, it ex-hibited excellent stability within a pH range of 4.0\\u0026ndash;8.0, spanning weakly acidic to mildly alkaline conditions. Xylanases from the GH10 family are recognized for their broad pH stability. For in-stance, PspXyn10 (\\u003cem\\u003ePenicillium\\u003c/em\\u003e sp.) retains 50% of its activity at pH 3.0\\u0026ndash;6.5, Xyn10B (\\u003cem\\u003eAci-dothermus cellulolyticus 11B\\u003c/em\\u003e) maintains over 90% stability between pH 5.0 and 8.0, and Xyn10A (\\u003cem\\u003eAspergillus fumigatus Z5\\u003c/em\\u003e) demonstrates good stability across pH 3.0\\u0026ndash;11.0 [\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e]. Xylanases that remain stable under acidic conditions exhibit resistance to harsh environments, making them suitable for applications in industries such as biofuel production, animal feed, and fruit juice clarification[\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e]. Therefore, Lc-Xyn81 holds significant potential for industrial pro-cesses requiring acidic conditions.\\u003c/p\\u003e\\u003cp\\u003eIn industrial production, high concentrations of metal ions can inhibit xylanase activity. Moreover, certain chemical agents may react with xylanases, altering their structure or properties and affecting catalytic efficiency. Thus, xylanases resistant to metal ions and chemical agents are better suited to overcome industrial limitations. Experimental data indicate that Ag⁺ inhibits the enzymatic activity of Lc-Xyn81, consistent with its inhibitory effects on xylanases such as Af-XYNA (\\u003cem\\u003eAspergillus fumigatus\\u003c/em\\u003e) and Xyn1923 (\\u003cem\\u003eMicrobacterium imperiale YD-01\\u003c/em\\u003e) [\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e]. GH10 family xylanases have been reported to be inhibited by various metal ions. For example, Xyn27 is inhibited by Ni\\u0026sup2;⁺, Fe\\u0026sup2;⁺, and Cu\\u0026sup2;⁺ (with inhibition ranging from 5\\u0026ndash;30%); XynSPP2 is inhibited by Co\\u0026sup2;⁺, Ca\\u0026sup2;⁺, and Mg\\u0026sup2;⁺ (6\\u0026ndash;28% inhibition); and SCXyl is highly inhibited by Co\\u0026sup2;⁺, Cu\\u0026sup2;⁺, and Mn\\u0026sup2;⁺ [\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e]. In contrast, Lc-Xyn81 is activated by divalent metal ions such as Mg\\u0026sup2;⁺, Co\\u0026sup2;⁺, and Cu\\u0026sup2;⁺ (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e), demonstrating better metal ion resistance compared to these pre-viously reported xylanases. Overall, while most xylanases are inhibited by divalent metal ions, Lc-Xyn81 exhibits activation by certain ions, highlighting its potential advantages for industrial applications.\\u003c/p\\u003e\\u003cp\\u003eThe inhibitory effect of the metal chelator EDTA on Lc-Xyn81 suggests that the xylanase may require metal ions as cofactors[\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e]. This hypothesis is supported by the observation that the activity of Lc-Xyn81 increases to 170% in the presence of 10 mM Mn\\u0026sup2;⁺. Sodium dodecyl sulfate (SDS) inhibits most enzyme activities, likely because SDS, as an anionic surfactant, induces conformational changes in the enzyme, leading to inactivation or denaturation [\\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e57\\u003c/span\\u003e]. For in-stance, the activities of Xyl10E (\\u003cem\\u003eBispora sp. MEY-1\\u003c/em\\u003e) and Thxyn11A are similarly inhibited by SDS [\\u003cspan citationid=\\\"CR58\\\" class=\\\"CitationRef\\\"\\u003e58\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR59\\\" class=\\\"CitationRef\\\"\\u003e59\\u003c/span\\u003e]. Overall, Lc-Xyn81 exhibits favorable enzymatic stability and retains suitable activ-ity in the presence of both the evaluated metal ions and chemical reagents, positioning it as a robust candidate for industrial applications.\\u003c/p\\u003e\\u003cp\\u003eAs global agricultural production expands, the generation of agricultural waste is also in-creasing. Examples include sugarcane bagasse, corncobs, rice husk ash, sunflower stalks, and beechwood chips, all of which are rich in lignocellulose [\\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e60\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e61\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e62\\u003c/span\\u003e]. The utilization of xylanase for processing agricultural waste not only mitigates environmental pollution but also enables re-source recycling. Lc-Xyn81, characterized by its diverse xylanolytic activities, emerges as a promising candidate for the treatment of agricultural waste.\\u003c/p\\u003e\\u003cp\\u003eXylanases from the GH10 family typically produce xylobiose (X2) and xylotetraose (X4) as reaction products when degrading xylan, although some may also produce xylose (X1) [\\u003cspan citationid=\\\"CR63\\\" class=\\\"CitationRef\\\"\\u003e63\\u003c/span\\u003e]. One of the most valuable products derived from xylanase activity is xylooligosaccharides (XOS), which are nondigestible oligosaccharides consisting of 2\\u0026ndash;10 xylose units linked by β-1,4 bonds. Studies have shown that XOS are promising prebiotics, capable of stimulating the growth of ben-eficial gut microbiota and counteracting intestinal pathogens[\\u003cspan citationid=\\\"CR64\\\" class=\\\"CitationRef\\\"\\u003e64\\u003c/span\\u003e]. For example, the hydrolysis products of rXynSW3 (\\u003cem\\u003eStreptomyces\\u003c/em\\u003e sp.) mainly include xylobiose (X2), xylotriose (X3), and xy-lotetraose (X4), while Xyn10J primarily produces xylobiose (X2) and xylotetraose (X4). Ssxyn10 (\\u003cem\\u003eStreptomyces sp. F-3\\u003c/em\\u003e) generates xylobiose (X2) and xylotriose (X3). The XOS produced by these enzymes can be utilized in various industries, including prebiotic production, food, biofuel, and waste treatment [\\u003cspan citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e65\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR66\\\" class=\\\"CitationRef\\\"\\u003e66\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR67\\\" class=\\\"CitationRef\\\"\\u003e67\\u003c/span\\u003e]. Lc-Xyn81 predominantly produces xylobiose and xylotetraose upon hydrolyzing xylan, highlighting its potential for XOS production and its applicability in the prebi-otic industry.\\u003c/p\\u003e\\u003cp\\u003eMolecular docking analysis of Lc-Xyn81 with xylooligosaccharides (X2-X5) revealed in-sights into its molecular recognition and substrate affinity(Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e). The docking simulations in-dicated that the lowest binding energies of X2, X3, X4, and X5 with the Lc-Xyn81 receptor were \\u0026minus;\\u0026thinsp;7.3, \\u0026minus;\\u0026thinsp;8.3, \\u0026minus;\\u0026thinsp;9.4, and \\u0026minus;\\u0026thinsp;9.7 kcal/mol, respectively. Among them, X5 exhibited the lowest binding energy with Lc-Xyn81. To further investigate the potential aglycone sub-sites, we used X5 as an example and overlaid the Lc-Xyn81-X5 complex with the crystal structure of the X5-bound XT6 (extracellular xylanase from G. stearothermophilus (E159Q)) complex (PDB: 4PUD)[\\u003cspan citationid=\\\"CR68\\\" class=\\\"CitationRef\\\"\\u003e68\\u003c/span\\u003e]. The Lc-Xyn81-X5 complex was located at the \\u0026minus;\\u0026thinsp;2 to +\\u0026thinsp;3 sub-sites (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eA). In the +\\u0026thinsp;1 sub-site, the reducing xylose interacts with the side chains of Lys88, His121, Glu174, and Gln248, forming hydrogen bonds, while a salt bridge is formed between Arg252 and xylose. In the +\\u0026thinsp;2 sub-site, xy-lose directly interacts with Asn85 and Trp345 through hydrogen bonds (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eD). These interac-tions are highly conserved in GH10 xylanases.\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003e\\u003c/p\\u003e\\u003cp\\u003eXylanase sequences from \\u003cem\\u003eLongimicrobiales bacterium\\u003c/em\\u003e (HEY8484312.1), Bryobacteraceae bacterium (HEY1242353.1), \\u003cem\\u003eTerriglobales bacterium\\u003c/em\\u003e (HMK31177.1), \\u003cem\\u003eBlastocatellia bacterium\\u003c/em\\u003e (HST22061.1, HKS43363.1), and the protein sequence of 4L4O from the PDB database were subjected to multiple sequence alignment. The alignment revealed that the two glutamic acid residues, Glu174 and Glu279, of Lc-Xyn81 correspond to the catalytic active site residues Glu139 and Glu247 in 4L4O (Supplementary Fig. S2). Therefore, Glu174 and Glu279 are highly likely to be the catalytic sites of Lc-Xyn81.The hydrolysis of xylan substrates typically occurs between the \\u0026minus;\\u0026thinsp;1 and +\\u0026thinsp;1 sub-sites. The residues Glu174, His121, Lys88, and Asn85 are hydro-gen-bonded to X2 and are located between the \\u0026minus;\\u0026thinsp;2 and \\u0026minus;\\u0026thinsp;1 sub-sites, preventing further hydrolysis to xylose. X3 is hydrogen-bonded to residues Glu279, Gln248, and others, located at the +\\u0026thinsp;1 to +\\u0026thinsp;3 sub-sites, and also does not undergo hydrolysis. X4 is situated between the \\u0026minus;\\u0026thinsp;2 and +\\u0026thinsp;2 sub-sites, interacting with Glu174 and His121, and is capable of being hydrolyzed into two molecules of X2 (Fig.s 7 and 8B). In the XT6-X5 complex, X5 is positioned between the \\u0026minus;\\u0026thinsp;2 and +\\u0026thinsp;3 sub-sites, and when superimposed with the Lc-Xyn81-xylopentose structure, it was found that although there are differences, the overall orientation is similar. Consequently, X5 remains in the \\u0026minus;\\u0026thinsp;2 to +\\u0026thinsp;3 sub-sites and is hydrolyzed into X3 and X2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eAs naturally occurring nutrients in food, xylooligosaccharides (XOS) are indigestible and non-absorbable in the human gastrointestinal tract. However, they undergo fermentation in the colon, producing organic acids (e.g., acetic acid) and gases, which serve as nutrients for symbiotic gut bacteria, thereby stimulating the growth of beneficial bacteria[\\u003cspan citationid=\\\"CR69\\\" class=\\\"CitationRef\\\"\\u003e69\\u003c/span\\u003e]. Studies have reported that XOS are resistant to degradation by known gut pathogens such as Staphylococcus aureus and Salmonella enterica, but are readily utilized by probiotic strains like Lactobacillus and Bifidobacterium. The fermentation products of XOS enhance antagonistic effects against path-ogenic microbiota in the gut [\\u003cspan citationid=\\\"CR64\\\" class=\\\"CitationRef\\\"\\u003e64\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR70\\\" class=\\\"CitationRef\\\"\\u003e70\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR71\\\" class=\\\"CitationRef\\\"\\u003e71\\u003c/span\\u003e]. Oral supplementation with XOS has been shown to in-crease the abundance of Bifidobacterium in healthy individuals without causing gastrointestinal side effects [\\u003cspan citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e72\\u003c/span\\u003e]. At a dosage of 2 g/day for 8 weeks, XOS improved insulin sensitivity and mod-ulated gut microbiota in individuals with prediabetes. In other studies, a dosage of 4 g/day for 8 weeks significantly reduced blood glucose and glycated hemoglobin levels in diabetic patients[\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR68\\\" class=\\\"CitationRef\\\"\\u003e68\\u003c/span\\u003e]. M\\u0026auml;kel\\u0026auml;inen demonstrated that Xylooligosaccharides (XOS) can increase the abundance of Bifidobacterium in the colon and optimize the gut microbiota by reducing the levels of patho-genic bacteria[\\u003cspan citationid=\\\"CR73\\\" class=\\\"CitationRef\\\"\\u003e73\\u003c/span\\u003e]. Therefore, we propose that XOS may inhibit the growth of \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e by promoting the population of beneficial probiotics.An increasing body of research suggests that XOS is a promising prebiotic candidate, playing roles in the prevention of colorectal cancer, reg-ulation of insulin secretion, enhancement of immune function, and maintenance of gastrointes-tinal health[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR74\\\" class=\\\"CitationRef\\\"\\u003e74\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR75\\\" class=\\\"CitationRef\\\"\\u003e75\\u003c/span\\u003e]. In this study, a simplified in vitro gut environment was simulated by co-culturing \\u003cem\\u003eE. coli\\u003c/em\\u003e and \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000. The results demonstrated that XOS obtained from xy-lan hydrolysis significantly increased the population of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000. The prebiotic products derived from xylan substrates using the xylanase Lc-Xyn81 effectively promoted the growth of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000, indicating its immense potential in applications aimed at maintaining gut health.\\u003c/p\\u003e\"},{\"header\":\"5. Conclusion\",\"content\":\"\\u003cp\\u003eIn conclusion, this study discovered a novel xylanase gene (\\u003cem\\u003elc-xyn81\\u003c/em\\u003e) from the Wenquanjie hot spring in Dali City, China, through enrichment culture and metagenomic techniques. The gene was PCR-amplified, cloned, and expressed in \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e. Lc-Xyn81 exhibited high ac-tivity against xylans from beechwood, corncob, and sugarcane bagasse with optimal perfor-mance at 75\\u0026deg;C and pH 6.6. Its activity was significantly enhanced after incubation at 70\\u0026deg;C and various pH levels, and it was activated by divalent metal ions like Co\\u0026sup2;⁺, Mn\\u0026sup2;⁺, and Cu\\u0026sup2;⁺. The en-zyme primarily produced xylobiose and xylotetraose from beechwood xylan, promoting the growth of \\u003cem\\u003eL. lactis\\u003c/em\\u003e NZ9000. These properties suggest that Lc-Xyn81 has potential applications in bioenergy and prebiotic production.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate:\\u003c/strong\\u003e Not applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication:\\u003c/strong\\u003e Agree to publish\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contributions:\\u0026nbsp;\\u003c/strong\\u003eConceptualization, Y.R.Y. and L.Q.Y.; methodology, L.H.P. and K.Q.X.; software, Z.F.Y. and Z.H.L.; validation, J.L.L., J.S., and W.H.; formal analysis, M.O.; investigation, D.Z. and Y.R.Y.; writing\\u0026mdash;original draft preparation, J.L.L. and W.H.; writing\\u0026mdash;review and editing, Y.R.Y. and L.Q.Y.; fund-ing acquisition, Y.R.Y. and W.H. All authors engaged in result discussions and provided feedback on the manuscript. Every author has reviewed and consented to the published version.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding:\\u0026nbsp;\\u003c/strong\\u003eThe author(s) declare that ﬁnancial support was received for the research, authorship, and/or publication of this article. This research was funded by the Yunnan Applied Basic Research Projects (No. 202101AU070138 and 202501AT070411), the Science and Technology Projects of the Xizang Autonomous Region, China (No. XZ202501ZY0019), the Yunnan Provincial Clinical Medical Center for Emergency Traumatic Dis-eases(No. YWLCYXZX2023300075), and the Xingdian Talent Support Program of Yunnan Province (No. 230212528080).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eInstitutional Review Board Statement:\\u0026nbsp;\\u003c/strong\\u003eThis manuscript does not include any research involving human participants or animals. Sample collection was conducted in compliance with local regulations and approved by the relevant management authorities.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials:\\u0026nbsp;\\u003c/strong\\u003eThe original data supporting the findings of this study are included in the arti-cle/Supplementary Materials. The nucleotide sequence of the Lc-Xyn81 gene has been submitted to GenBank (https://www.ncbi.nlm.nih.gov/nuccore/PQ856056.1/). Further inquiries can be directed to the corresponding authors.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments:\\u0026nbsp;\\u003c/strong\\u003eWe extend our heartfelt gratitude to the administrative division of the Dali Geothermal Paradise tourist site for their invaluable support in facilitating the sample collection for this research.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests:\\u0026nbsp;\\u003c/strong\\u003eThe authors declare no competing interest.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col class=\\\"decimal_type\\\"\\u003e\\n\\u003cli\\u003eGhaemi, F., Abdullah, L. C., \\u0026amp; Ariffin, H. Lignocellulose Structure and the Effect on Nanocellulose Production. In Lignocellulose for Future Bioeconomy. Elsevier. 2019 ,17\\u0026ndash;30. https://doi.org/10.1016/b978-0-12-816354-2.00002-5 \\u003c/li\\u003e\\n\\u003cli\\u003eJohnson AM, Karaaslan MA, Cho M, Ogawa Y, Renneckar S. Exploring the impact of water on the morphology and crystallinity of xylan hydrate nanotiles. Carbohydrate Polymers. 2023 ,319,121165. https://doi.org/10.1016/j.carbpol.2023.121165 \\u003c/li\\u003e\\n\\u003cli\\u003eSohail M, Barzkar N, Michaud P, Tamadoni Jahromi S, Babich O, Sukhikh S, Das R, Nahavandi R. Cellulolytic and xylanolytic enzymes from yeasts: Properties and industrial applications. Molecules. 2022,27,3783. https://doi.org/10.3390/molecules27123783 \\u003c/li\\u003e\\n\\u003cli\\u003eRennie EA, Scheller HV. Xylan biosynthesis. Current opinion in biotechnology. 2014,26,100-107. https://doi.org/10.1016/j.copbio.2013.11.013 \\u003c/li\\u003e\\n\\u003cli\\u003eKnapik K, Becerra M, Gonz\\u0026aacute;lez-Siso MI. Microbial diversity analysis and screening for novel xylanase enzymes from the sediment of the Lobios Hot Spring in Spain. Scientific reports. 2019 ,9,11195. https://doi.org/10.1038/s41598-019-47637-z \\u003c/li\\u003e\\n\\u003cli\\u003eUday US, Choudhury P, Bandyopadhyay TK, Bhunia B. Classification, mode of action and production strategy of xylanase and its application for biofuel production from water hyacinth. International journal of biological macromolecules. 2016,82,1041-1054. https://doi.org/10.1016/j.ijbiomac.2015.10.086 \\u003c/li\\u003e\\n\\u003cli\\u003eKalim B, B\\u0026ouml;hringer N, Ali N, Sch\\u0026auml;berle TF. Xylanases\\u0026ndash;from microbial origin to industrial application. Br Biotechnol J. 2015,7,1-20. https://doi.org/10.9734/BBJ/2015/15982 \\u003c/li\\u003e\\n\\u003cli\\u003eKiribayeva A, Mukanov B, Silayev D, Akishev Z, Ramankulov Y, Khassenov B. Cloning, expression, and characterization of a recombinant xylanase from Bacillus sonorensis T6. PLoS One. 2022,17,e0265647. https://doi.org/10.1371/journal.pone.0265647 \\u003c/li\\u003e\\n\\u003cli\\u003eBouiche C, Boucherba N, Benallaoua S, Martinez J, Diaz P, Pastor FJ, Valenzuela SV. Differential antioxidant activity of glucuronoxylooligosaccharides (UXOS) and arabinoxylooligosaccharides (AXOS) produced by two novel xylanases. International journal of biological macromolecules. 2020,155,1075-1083. https://doi.org/10.1016/j.ijbiomac.2019.11.073 \\u003c/li\\u003e\\n\\u003cli\\u003eNguyen ST, Freund HL, Kasanjian J, Berlemont R. Function, distribution, and annotation of characterized cellulases, xylanases, and chitinases from CAZy. Applied microbiology and biotechnology. 2018,102,1629-1637. https://doi.org/10.1007/s00253-018-8778-y \\u003c/li\\u003e\\n\\u003cli\\u003eWalia A, Guleria S, Mehta P, Chauhan A, Parkash J. Microbial xylanases and their industrial application in pulp and paper biobleaching: a review. 3 Biotech. 2017,7,1-2. https://doi.org/10.1007/s13205-016-0584-6. \\u003c/li\\u003e\\n\\u003cli\\u003eMhiri S, Bouanane-Darenfed A, Jemli S, Neifar S, Ameri R, Mezghani M, Bouacem K, Jaouadi B, Bejar S. A thermophilic and thermostable xylanase from Caldicoprobacter algeriensis: Recombinant expression, characterization and application in paper biobleaching. International journal of biological macromolecules. 2020,164,808-817. https://doi.org/10.1016/j.ijbiomac.2020.07.162 \\u003c/li\\u003e\\n\\u003cli\\u003eVerma D. Extremophilic prokaryotic endoxylanases: Diversity, applicability, and molecular insights. Frontiers in Microbiology. 2021,12,728475. https://doi.org/10.3389/fmicb.2021.728475 \\u003c/li\\u003e\\n\\u003cli\\u003eMon ML, Marrero D\\u0026iacute;az de Villegas R, Campos E, Soria MA, Talia PM. Characterization of a novel GH10 alkali-thermostable xylanase from a termite microbiome. Bioresources and Bioprocessing. 2022,9,84. https://doi.org/10.1186/s40643-022-00572-w \\u003c/li\\u003e\\n\\u003cli\\u003eEscuder-Rodr\\u0026iacute;guez JJ, DeCastro ME, Cerd\\u0026aacute;n ME, Rodr\\u0026iacute;guez-Belmonte E, Becerra M, Gonz\\u0026aacute;lez-Siso MI. Cellulases from thermophiles found by metagenomics. Microorganisms. 2018,6,66. https://doi.org/10.3390/microorganisms6030066 \\u003c/li\\u003e\\n\\u003cli\\u003eZarafeta D, Galanopoulou AP, Leni ME, Kaili SI, Chegkazi MS, Chrysina ED, Kolisis FN, Hatzinikolaou DG, Skretas G. XynDZ5: a new thermostable GH10 xylanase. Frontiers in microbiology. 2020,11,545. https://doi.org/10.3389/fmicb.2020.00545 \\u003c/li\\u003e\\n\\u003cli\\u003eYin YR, Li XW, Long CH, Li L, Hang YY, Rao MD, Yan X, Liu QL, Sang P, Li WJ, Yang LQ. Characterization of a gh10 extremely thermophilic xylanase from the metagenome of hot spring for prebiotic production. Scientific Reports. 2023,13,16053. https://doi.org/10.1038/s41598-023-42920-6 \\u003c/li\\u003e\\n\\u003cli\\u003eAdrio JL, Demain AL. Microbial enzymes: tools for biotechnological processes. Biomolecules. 2014,4,117-139. https://doi.org/10.3390/biom4010117 \\u003c/li\\u003e\\n\\u003cli\\u003eUchiyama T, Miyazaki K. Functional metagenomics for enzyme discovery: challenges to efficient screening. Current opinion in biotechnology. 2009,20,616-622. https://doi.org/10.1016/j.copbio.2009.09.010 \\u003c/li\\u003e\\n\\u003cli\\u003eTansirichaiya S, Hutton W, Roberts AP. Functional and sequence-specific screening protocols for the detection of novel antimicrobial resistance genes in metagenomic DNA. InMetagenomics: Methods and Protocols 2022,51-72. https://doi.org/10.1007/978-1-0716-2795-2_4 (2023).\\u003c/li\\u003e\\n\\u003cli\\u003eMontella S, Amore A, Faraco V. Metagenomics for the development of new biocatalysts to advance lignocellulose saccharification for bioeconomic development. Critical reviews in biotechnology. 2016,36,998-1009. https://doi.org/10.3109/07388551.2015.1083939 \\u003c/li\\u003e\\n\\u003cli\\u003eBatsalova T, Georgiev Y, Moten D, Teneva I, Dzhambazov B. Natural xylooligosaccharides exert antitumor activity via modulation of cellular antioxidant state and TLR4. International Journal of Molecular Sciences. 2022,23,10430. https://doi.org/10.3390/ijms231810430 \\u003c/li\\u003e\\n\\u003cli\\u003eCruz-Guerrero A, G\\u0026oacute;mez-Ruiz L, Guzm\\u0026aacute;n-Rodr\\u0026iacute;guez F. Xylooligosaccharides (XOS). InHandbook of Food Bioactive Ingredients: Properties and Applications 2022,1-28.DOI: 10.1007/978-3-030-81404-5_30-1\\u003c/li\\u003e\\n\\u003cli\\u003eChapla D, Pandit P, Shah A. Production of xylooligosaccharides from corncob xylan by fungal xylanase and their utilization by probiotics. Bioresource Technology. 2012,115,215-221. https://doi.org/10.1016/j.biortech.2011.10.083\\u003c/li\\u003e\\n\\u003cli\\u003eZerbino DR, Birney E. Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome research. 2008,18,821-829. https://doi.org/10.1101/gr.074492.107 \\u003c/li\\u003e\\n\\u003cli\\u003eTatusov RL, Natale DA, Garkavtsev IV, Tatusova TA, Shankavaram UT, Rao BS, Kiryutin B, Galperin MY, Fedorova ND, Koonin EV. The COG database: new developments in phylogenetic classification of proteins from complete genomes. Nucleic acids research. 2001 ,29,22-28. https://doi.org/10.1093/nar/29.1.22 \\u003c/li\\u003e\\n\\u003cli\\u003eNakaya A, Katayama T, Itoh M, Hiranuka K, Kawashima S, Moriya Y, Okuda S, Tanaka M, Tokimatsu T, Yamanishi Y, Yoshizawa AC. KEGG OC: a large-scale automatic construction of taxonomy-based ortholog clusters. Nucleic acids research. 2012,41,D353- D357. https://doi.org/10.1093/nar/gks1239 \\u003c/li\\u003e\\n\\u003cli\\u003eBateman A, Coin L, Durbin R, Finn RD, Hollich V, Griffiths‐Jones S, Khanna A, Marshall M, Moxon S, Sonnhammer EL, Studholme DJ. The Pfam protein families database. Nucleic acids research. 2004,32,D138- D141. https://doi.org/10.1093/nar/gkp985 \\u003c/li\\u003e\\n\\u003cli\\u003eThompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic acids research. 1997,25,4876-4882. https://doi.org/10.1093/nar/25.24.4876 \\u003c/li\\u003e\\n\\u003cli\\u003eKumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular biology and evolution. 2016,33,1870-1874. https://doi.org/10.1093/molbev/msw054 \\u003c/li\\u003e\\n\\u003cli\\u003eLarkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD. Clustal W and Clustal X version 2.0. bioinformatics. 2007,23,2947-2948. https://doi.org/10.1093/bioinformatics/btm404 \\u003c/li\\u003e\\n\\u003cli\\u003eYin YR, Meng ZH, Hu QW, Jiang Z, **an WD, Li LH, Hu W, Zhang F, Zhou EM, Zhi XY, Li WJ. The hybrid strategy of Thermoactinospora rubra YIM 77501T for utilizing cellulose as a carbon source at different temperatures. Frontiers in Microbiology. 2017,8,942. https://doi.org/10.3389/fmicb.2017.00942 \\u003c/li\\u003e\\n\\u003cli\\u003eMiller GL. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Analytical chemistry. 1959,31,426-428. https://doi.org/10.1021/ac60147a030\\u003c/li\\u003e\\n\\u003cli\\u003eYang J, Han Z. Understanding the positional binding and substrate interaction of a highly thermostable GH10 xylanase from Thermotoga maritima by molecular docking. Biomolecules. 2018,8,64. https://doi.org/10.3390/biom8030064 \\u003c/li\\u003e\\n\\u003cli\\u003eHuang YY, Wu P, Wu XC, Zhu QR, Zhu Q, Zheng HZ, Zhu D, Lv ZH, Yin YR. Characterization of a thermophilic and inhibitor-tolerant gh1 \\u0026beta;-glucosidase present in a hot spring. Water. 2023,15,3389. https://doi.org/10.3390/w15193389 \\u003c/li\\u003e\\n\\u003cli\\u003eGlekas PD, Kalantzi S, Dalios A, Hatzinikolaou DG, Mamma D. Biochemical and thermodynamic studies on a novel thermotolerant GH10 xylanase from Bacillus safensis. Biomolecules. 2022,12,790. https://doi.org/10.3390/biom12060790 \\u003c/li\\u003e\\n\\u003cli\\u003eWang K, Cao R, Wang M, Lin Q, Zhan R, Xu H, Wang S. A novel thermostable GH10 xylanase with activities on a wide variety of cellulosic substrates from a xylanolytic Bacillus strain exhibiting significant synergy with commercial Celluclast 1.5 L in pretreated corn stover hydrolysis[J]. Biotechnology for biofuels, 2019, 12, 1-13. https://doi.org/10.1186/s13068-019-1389-8 \\u003c/li\\u003e\\n\\u003cli\\u003eMafa MS, Malgas S, Pletschke B I. Feruloyl esterase (FAE-1) sourced from a termite hindgut and GH10 xylanases synergy improves degradation of arabinoxylan[J]. AMB Express, 2021, 11,1-9. https://doi.org/10.1186/s13568-021-01180-1 \\u003c/li\\u003e\\n\\u003cli\\u003ePozo-Rodr\\u0026iacute;guez A, M\\u0026eacute;ndez-L\\u0026iacute;ter JA, de Eugenio LI, Nieto-Dom\\u0026iacute;nguez M, Calvi\\u0026ntilde;o E, Ca\\u0026ntilde;ada FJ, Santana AG, D\\u0026iacute;ez J, Asensio JL, Barriuso J, Prieto A. A fungal versatile GH10 endoxylanase and its glycosynthase variant: Synthesis of xylooligosaccharides and glycosides of bioactive phenolic compounds. International Journal of Molecular Sciences. 2022 ,23,1383. https://doi.org/10.3390/ijms23031383 \\u003c/li\\u003e\\n\\u003cli\\u003eSepulchro AG, Pellegrini VO, Briganti L, de Araujo EA, de Araujo SS, Polikarpov I. Transformation of xylan into value-added biocommodities using Thermobacillus composti GH10 xylanase. Carbohydrate Polymers. 2020,247,116714. https://doi.org/10.1016/j.carbpol.2020.116714 \\u003c/li\\u003e\\n\\u003cli\\u003eWu H, Ioannou E, Henrissat B, Montanier CY, Bozonnet S, O\\u0026rsquo;Donohue MJ, Dumon C. Multimodularity of a GH10 xylanase found in the termite gut metagenome. Applied and Environmental Microbiology. 2021,87,e01714-20. https://doi.org/10.1128/AEM.01714-20 \\u003c/li\\u003e\\n\\u003cli\\u003eLai Z, Zhou C, Ma X, Xue Y, Ma Y. Enzymatic characterization of a novel thermostable and alkaline tolerant GH10 xylanase and activity improvement by multiple rational mutagenesis strategies. International Journal of Biological Macromolecules. 2021,170,164-177. https://doi.org/10.1016/j.ijbiomac.2020.12.137 \\u003c/li\\u003e\\n\\u003cli\\u003eAndaleeb H, Ullah N, Falke S, Perbandt M, Brognaro H, Betzel C. High-resolution crystal structure and biochemical characterization of a GH11 endoxylanase from Nectria haematococca. Scientific reports. 2020,10,15658. https://doi.org/10.1038/s41598-020-72644-w \\u003c/li\\u003e\\n\\u003cli\\u003eZhou J, Dong Y, Tang X, Li J, Xu B, Wu Q, Gao Y, Pan L, Huang Z. Molecular and biochemical characterization of a novel intracellular low-temperature-active xylanase. Journal of microbiology and biotechnology. 2012,22,501-509. https://doi.org/10.4014/jmb.1108.08006 \\u003c/li\\u003e\\n\\u003cli\\u003eZhou J, Wu Q, Zhang R, Mo M, Tang X, Li J, Xu B, Ding J, Lu Q, Huang Z. A thermo-halo-tolerant and proteinase-resistant endoxylanase from Bacillus sp. HJ14. Folia microbiologica. 2014,59,423-431. https://doi.org/10.1007/s12223-014-0316-4 \\u003c/li\\u003e\\n\\u003cli\\u003eShibata N, Suetsugu M, Kakeshita H, Igarashi K, Hagihara H, Takimura Y. A novel GH10 xylanase from Penicillium sp. accelerates saccharification of alkaline-pretreated bagasse by an enzyme from recombinant Trichoderma reesei expressing Aspergillus \\u0026beta;-glucosidase[J]. Biotechnology for biofuels, 2017, 10, 1-17. https://doi.org/10.1186/s13068-017-0970-2 \\u003c/li\\u003e\\n\\u003cli\\u003eMiao, Y., Kong, Y., Li, P., Li, G., Liu, D., Shen, Q., \\u0026amp; Zhang, R. Effect of CBM1 and linker region on enzymatic properties of a novel thermostable dimeric GH10 xylanase (Xyn10A) from filamentous fungus Aspergillus fumigatus Z5. AMB Express.2018,8, 1-10. https://doi.org/10.1186/s13568-018-0576-5 \\u003c/li\\u003e\\n\\u003cli\\u003eShahid S, Tajwar R, Akhtar M W. A novel trifunctional, family GH10 enzyme from Acidothermus cellulolyticus 11B, exhibiting endo-xylanase, arabinofuranosidase and acetyl xylan esterase activities[J]. Extremophiles,2018, 22,109-119. https://doi.org/10.1007/s00792-017-0981-8 \\u003c/li\\u003e\\n\\u003cli\\u003e**a Y, Wang W, Wei Y, Guo C, Song S, Cai S, Miao Y. Clustered surface amino acid residues modulate the acid stability of GH10 xylanase in fungi[J]. Applied Microbiology and Biotechnology, 2024, 108,216. https://doi.org/10.1007/s00253-024-13045-1 \\u003c/li\\u003e\\n\\u003cli\\u003eTang K, Cui Y, **ao J, Ding M, Chao H, Wu J, Han Z, Liu J, Li X, Yan D. Molecular cloning and characterization of a novel xylanase from Microbacterium imperiale YD‐01. Journal of Food Biochemistry. 2021,45,e13988. https://doi.org/10.1111/jfbc.13988 \\u003c/li\\u003e\\n\\u003cli\\u003eChang X, Xu B, Bai Y, Luo H, Ma R, Shi P, Yao B. Role of N-linked glycosylation in the enzymatic properties of a thermophilic GH 10 xylanase from Aspergillus fumigatus expressed in Pichia pastoris. PLoS One. 2017,12,e0171111. https://doi.org/10.1371/journal.pone.0171111 \\u003c/li\\u003e\\n\\u003cli\\u003eQiu H, Li Z, Wang H, Zhang H, Li S, Luo X, Song Y, Wang N, He H, Zhou H, Ma W. Molecular and biochemical characterization of a novel cold-active and metal ion-tolerant GH10 xylanase from frozen soil. Biotechnology \\u0026amp; Biotechnological Equipment. 2017,31,955-63. https://doi.org/10.1080/13102818.2017.1359667 \\u003c/li\\u003e\\n\\u003cli\\u003eHan Z, Shang-Guan F, Yang J. Molecular and biochemical characterization of a bimodular xylanase from Marinifilaceae bacterium strain SPP2. Frontiers in microbiology. 2019,10,1507. https://doi.org/10.3389/fmicb.2019.01507 \\u003c/li\\u003e\\n\\u003cli\\u003eAlvarez TM, Goldbeck R, Santos CR, Paix\\u0026atilde;o DA, Gon\\u0026ccedil;alves TA, Franco Cairo JP, Almeida RF, de Oliveira Pereira I, Jackson G, Cota J, B\\u0026uuml;chli F. Development and biotechnological application of a novel endoxylanase family GH10 identified from sugarcane soil metagenome. PLoS One. 2013,8,e70014. https://doi.org/10.1371/journal.pone.0070014 \\u003c/li\\u003e\\n\\u003cli\\u003eTang L, Lei X, Ouyang K, Wang L, Qiu Q, Li Y, Zang Y, Liu C, Zhao X. A Glycosyl Hydrolase 30 Family Xylanase from the Rumen Metagenome and Its Effects on In Vitro Ruminal Fermentation of Wheat Straw. Animals. 2023,14,118. https://doi.org/10.3390/ani14010118 \\u003c/li\\u003e\\n\\u003cli\\u003eHamid A, Aftab MN. Cloning, purification, and characterization of recombinant thermostable \\u0026beta;-xylanase Tnap_0700 from Thermotoga naphthophila. Applied Biochemistry and Biotechnology. 2019,189,1274-1290. https://doi.org/10.1007/s12010-019-03068-0 \\u003c/li\\u003e\\n\\u003cli\\u003eTerrasan CR, Guisan JM, Carmona EC. Xylanase and \\u0026beta;-xylosidase from Penicillium janczewskii: Purification, characterization and hydrolysis of substrates. Electronic Journal of Biotechnology. 2016,23,54-62. https://doi.org/10.1016/j.ejbt.2016.08.001 \\u003c/li\\u003e\\n\\u003cli\\u003eZhang F, Chen JJ, Ren WZ, Lin LB, Zhou Y, Zhi XY, Tang SK, Li WJ. Cloning, expression, and characterization of an alkaline thermostable GH11 xylanase from Thermobifida halotolerans YIM 90462T. Journal of Industrial Microbiology and Biotechnology. 2012 ,39,1109-16. https://doi.org/10.1007/s10295-012-1119-8 \\u003c/li\\u003e\\n\\u003cli\\u003eWang X, Zheng F, Wang Y, Tu T, Ma R, Su X, You S, Yao B, **e X, Luo H. Improvement of the catalytic efficiency of a hyperthermophilic xylanase from Bispora sp. MEY-1. PloS one. 2017 ,12,e0189806. https://doi.org/10.1371/journal.pone.0189806 \\u003c/li\\u003e\\n\\u003cli\\u003eRajaram S, Varma A. Production and characterization of xylanase from Bacillus thermoalkalophilus grown on agricultural wastes. Applied microbiology and biotechnology. 1990 ,34,141-144. https://doi.org/10.1007/bf00170939 \\u003c/li\\u003e\\n\\u003cli\\u003eKocabas DS, Ozben N. Co-production of xylanase and xylooligosaccharides from lignocellulosic agricultural wastes. RSC Advances. 2014,4,26129-26139. https://doi.org/10.1039/C4RA02508C \\u003c/li\\u003e\\n\\u003cli\\u003eWang F, Yao Z, Zhang X, Han Z, Chu X, Ge X, Lu F, Liu Y. High-level production of xylose from agricultural wastes using GH11 endo-xylanase and GH43 \\u0026beta;-xylosidase from Bacillus sp. Bioprocess and Biosystems Engineering. 2022,45,1705-1717. https://doi.org/10.1007/s00449-022-02778-w \\u003c/li\\u003e\\n\\u003cli\\u003eHero JS, Pisa JH, Romero CM, Nordberg Karlsson E, Linares-Past\\u0026eacute;n JA, Martinez MA. Endo-xylanases from Cohnella sp. AR92 aimed at xylan and arabinoxylan conversion into value-added products. Applied Microbiology and Biotechnology. 2021,105,6759-6778. https://doi.org/10.1007/s00253-021-11495-5 \\u003c/li\\u003e\\n\\u003cli\\u003ede Oliveira Nascimento CE, de Oliveira Sim\\u0026otilde;es LC, de Cassia Pereira J, da Silva RR, de Lima EA, de Almeida GC, Penna AL, Boscolo M, Gomes E, da Silva R. Application of a recombinant GH10 endoxylanase from Thermoascus aurantiacus for xylooligosaccharide production from sugarcane bagasse and probiotic bacterial growth. Journal of Biotechnology. 2022,347,1-8. https://doi.org/10.1016/j.jbiotec.2022.02.003 \\u003c/li\\u003e\\n\\u003cli\\u003eSukhumsirichart W, Deesukon W, Kawakami T, Matsumoto S, Seesom W, Sakamoto T. Expression and characterization of recombinant GH11 xylanase from thermotolerant Streptomyces sp. SWU10. Applied biochemistry and biotechnology. 2014,172,436-446. https://doi.org/10.1007/s12010-013-0508-4 \\u003c/li\\u003e\\n\\u003cli\\u003eAl-Darkazali H, Meevootisom V, Isarangkul D, Wiyakrutta S. Gene expression and molecular characterization of a xylanase from chicken cecum metagenome. International journal of microbiology. 2017,2017,4018398. https://doi.org/10.1155/2017/4018398 \\u003c/li\\u003e\\n\\u003cli\\u003eLiu, Mengyu, et al. \\u0026quot;Effective Degradation of Brewer Spent Grains by a Novel Thermostable GH10 Xylanase.\\u0026quot; Applied Biochemistry and Biotechnology.2023,1-12. https://doi.org/10.1007/s12010-023-04779-1 \\u003c/li\\u003e\\n\\u003cli\\u003eYang J, Summanen PH, Henning SM, Hsu M, Lam H, Huang J, Tseng CH, Dowd SE, Finegold SM, Heber D, Li Z. Xylooligosaccharide supplementation alters gut bacteria in both healthy and prediabetic adults: a pilot study. Frontiers in physiology. 2015,6,216. https://doi.org/10.3389/fphys.2015.00216 \\u003c/li\\u003e\\n\\u003cli\\u003eSpencer S, Silva EG, Carter MM, Caffrey E, Wastyk H, Olm MR, Sonnenburg J. 442: FERMENTED FOODS PROMOTE GUT MICROBIOTA DIVERSITY AND MODULATE HOST IMMUNITY VIA BACTERIAL METABOLITES. Gastroenterology. 2022,162,S-96.DOI: 10.1016/S0016-5085(22)60241-5\\u003c/li\\u003e\\n\\u003cli\\u003eMoura P, Barata R, Carvalheiro F, G\\u0026iacute;rio F, Loureiro-Dias MC, Esteves MP. In vitro fermentation of xylo-oligosaccharides from corn cobs autohydrolysis by Bifidobacterium and Lactobacillus strains. LWT-Food Science and Technology. 2007,40,963-972. https://doi.org/10.1016/j.lwt.2006.07.013 \\u003c/li\\u003e\\n\\u003cli\\u003eKondepudi KK, Ambalam P, Nilsson I, Wadstr\\u0026ouml;m T, Ljungh \\u0026Aring;. Prebiotic-non-digestible oligosaccharides preference of probiotic bifidobacteria and antimicrobial activity against Clostridium difficile. Anaerobe. 2012,18,489-497. https://doi.org/10.1016/j.anaerobe.2012.08.005 \\u003c/li\\u003e\\n\\u003cli\\u003eFinegold SM, Li Z, Summanen PH, Downes J, Thames G, Corbett K, Dowd S, Krak M, Heber D. Xylooligosaccharide increases bifidobacteria but not lactobacilli in human gut microbiota. Food \\u0026amp; Function. 2014,5,436-445. DOI: 10.1039/C3FO60348B\\u003c/li\\u003e\\n\\u003cli\\u003eM\\u0026auml;kel\\u0026auml;inen H, Forssten S, Saarinen M, Stowell J, Rautonen N, Ouwehand AC. Xylo-oligosaccharides enhance the growth of bifidobacteria and Bifidobacterium lactis in a simulated colon model. Beneficial Microbes. 2009,1,81-92. https://doi.org/10.3920/bm2009.0025 \\u003c/li\\u003e\\n\\u003cli\\u003eBroekaert WF, Courtin CM, Verbeke K, Van de Wiele T, Verstraete W, Delcour JA. Prebiotic and other health-related effects of cereal-derived arabinoxylans, arabinoxylan-oligosaccharides, and xylooligosaccharides. Critical reviews in food science and nutrition. 2011,51,178-194. https://doi.org/10.1080/10408390903044768 \\u003c/li\\u003e\\n\\u003cli\\u003eAachary AA, Prapulla SG. Xylooligosaccharides (XOS) as an emerging prebiotic: microbial synthesis, utilization, structural characterization, bioactive properties, and applications. Comprehensive Reviews in Food Science and Food Safety. 2011,10,2-16. https://doi.org/10.1111/j.1541-4337.2010.00135.x \\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"bmc-biotechnology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"bbit\",\"sideBox\":\"Learn more about [BMC Biotechnology](http://bmcbiotechnol.biomedcentral.com/)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/bbit/default.aspx\",\"title\":\"BMC Biotechnology\",\"twitterHandle\":\"BMC_series\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC Series\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Hot Springs, Metagenomics, Xylanase, Thermophilic, XOS\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6988407/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6988407/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e\\u003cp\\u003eXylan is widely found in plant cell walls, and xylanase, an essential enzyme in xylan breakdown, has promising applications in energy, food, feed, and healthcare sectors.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e\\u003cp\\u003eThis study presents the discovery of a novel GH10 family xylanase gene, termed lc-xyn81, isolated from the hot spring of Eryuan, Dali, Yunnan Province, employing enrichment culture and metagenomic approaches. The amino acid sequence of Lc-Xyn81 shares 72.29% identity with that of Blastocatellia bacte-rium. The gene was amplified via specific PCR, cloned, and heterologously expressed in Esche-richia coli. The recombinant Lc-Xyn81 was purified using Ni-affinity chromatography, followed by enzymatic characterization. Lc-Xyn81 demonstrated optimal activity at 75\\u0026deg;C and pH 6.6. It maintained over 80% relative activity between 65\\u0026ndash;75\\u0026deg;C, and its activity increased to over 120% after incubation at 70\\u0026deg;C for 40\\u0026ndash;100 min with a half-life of 180 min at 70\\u0026deg;C. Additionally, incu-bation at pH 5.0\\u0026ndash;7.0 for 12 h boosted its activity to over 140%. Lc-Xyn81 was activated by di-valent metal ions such as Co\\u0026sup2;⁺(128.55%), Mn\\u0026sup2;⁺ (119.84%), and Cu\\u0026sup2;⁺(112.27%). The enzyme ex-hibited activity against beechwood xylan (213.68 U/mg), corncob xylan (143.40 U/mg), and sugarcane bagasse xylan (80.39 U/mg). The primary degradation products were xylobiose and xylotetraose, which significantly promoted the growth of L. lactis. Kinetic analysis indicated that the Km and Vmax values for Lc-Xyn81 were 4.62 mg/ml and 312.5 \\u0026micro;mol/min/mg, respectively.\\u003c/p\\u003e\\u003ch2\\u003eConclusions\\u003c/h2\\u003e\\u003cp\\u003eIn summary, Lc-Xyn81, a thermophilic and thermostable xylanase, exhibits considerable poten-tial for industrial applications in lignocellulose degradation and prebiotic production.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Molecular cloning and characterization of a GH10 thermophilic xylanase from hot spring and its potential application in promoting probiotic growth\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-07-14 10:55:38\",\"doi\":\"10.21203/rs.3.rs-6988407/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2025-11-13T08:07:51+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-11-06T03:13:29+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"262674581670428706004429659887390196659\",\"date\":\"2025-08-11T11:37:12+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-07-25T00:36:17+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"188236811060617694905145534796257842858\",\"date\":\"2025-07-18T03:04:14+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"194926074875096269422032160892911963044\",\"date\":\"2025-07-17T11:31:18+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-07-10T08:31:08+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-07-10T08:26:01+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvited\",\"content\":\"\",\"date\":\"2025-07-09T08:10:13+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-07-09T06:32:10+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"BMC Biotechnology\",\"date\":\"2025-07-09T06:27:46+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"bmc-biotechnology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"bbit\",\"sideBox\":\"Learn more about [BMC Biotechnology](http://bmcbiotechnol.biomedcentral.com/)\",\"snPcode\":\"\",\"submissionUrl\":\"https://www.editorialmanager.com/bbit/default.aspx\",\"title\":\"BMC Biotechnology\",\"twitterHandle\":\"BMC_series\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"em\",\"reportingPortfolio\":\"BMC Series\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"9d8ee460-e57b-48a2-8dd3-255875978aac\",\"owner\":[],\"postedDate\":\"July 14th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-01-12T16:10:18+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-6988407\",\"link\":\"https://doi.org/10.1186/s12896-025-01096-9\",\"journal\":{\"identity\":\"bmc-biotechnology\",\"isVorOnly\":false,\"title\":\"BMC Biotechnology\"},\"publishedOn\":\"2026-01-07 15:57:29\",\"publishedOnDateReadable\":\"January 7th, 2026\"},\"versionCreatedAt\":\"2025-07-14 10:55:38\",\"video\":\"\",\"vorDoi\":\"10.1186/s12896-025-01096-9\",\"vorDoiUrl\":\"https://doi.org/10.1186/s12896-025-01096-9\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6988407\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6988407\",\"identity\":\"rs-6988407\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}