{"paper_id":"267dddbb-f05d-4c5c-82ab-3051164977eb","body_text":"C9orf72 Overexpression in Asthenozoospermia: Implications for Spermatogonia Proliferation through mitophagy and glucose metabolism | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article C9orf72 Overexpression in Asthenozoospermia: Implications for Spermatogonia Proliferation through mitophagy and glucose metabolism Hui Lu, Dongchuan Xu, Liqiang Zhao, Hailing Ruan, Anguo Wang, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3351258/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background The role of the C9orf72 gene in sperm function and asthenozoospermia remains unclear. This study aimed to investigate whether the expression of C9orf72 was abnormal in patients with asthenozoospermia and its effects on spermatogonia proliferation. Methods Semen samples were collected from 27 men with asthenozoospermia and 31 normal men. Immunofluorescence and Western blotting were employed to detect the protein expression of C9orf72 in semen samples. Mouse spermatogonia (GC-1 spg) transfected with C9orf72-overexpressing lentivirus were assessed for cell viability, apoptosis, ROS levels, mitochondrial membrane potential changes, colocalization between autophagosomes and mitochondria, glucose content and glucose energy metabolism-related protein expression. The effect of the mitophagy inhibitor Mdivi-1 on C9orf72-induced apoptosis in GC-1 spg cells was investigated. Results The results showed that the C9orf72 protein was significantly upregulated in asthenozoospermic semen samples and negatively correlated with sperm progressive motility. Overexpression of C9orf72 inhibited proliferation, increased apoptosis, and elevated ROS levels in GC-1 spg cells. Enhanced mitophagy was observed in C9orf72-overexpressing cells, as indicated by mitochondrial membrane potential reduction, decreased MitoTracker Red CMXRos-labeled mitochondria, and increased LC-3-labeled autophagy. Moreover, glucose energy metabolism was impaired in C9orf72-overexpressing cells, with decreased glucose uptake and reduced protein expression of GLUT1, GLUT3, HK2 and LDHA. The mitophagy inhibitor Mdivi-1 partially reversed C9orf72-induced apoptosis in GC-1 spg cells. Conclusions This study demonstrates that C9orf72 is significantly overexpressed in asthenozoospermic semen samples and negatively correlated with sperm progressive motility. C9orf72 overexpression inhibits spermatogonia proliferation, and the mechanism by which it inhibits the proliferation of spermatogonia may be through promoting mitophagy and inhibiting glucose metabolism, representing a potential regulatory mechanism underlying asthenozoospermia. Asthenozoospermia Spermatogonial Proliferation Mitophagy Glucose metabolism Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Background Asthenozoospermia, characterized by reduced sperm motility, is one of the most common types of male infertility, accounting for 20–40% of male infertility cases[1]. Diagnosis of asthenospermia is based on the reporting of progressive motility (PR) of sperm less than 32% in two or more semen analyses, while all other parameters are within the normal range based on the fifth edition of the World Health Organization (WHO) semen analysis criteria[2,3]. The etiology of asthenospermia is complex and can be investigated through auxiliary examinations such as semen analysis, reproductive endocrine hormone examination, imaging examination, and genetic testing. However, the causes and pathogenesis of 30–40% of asthenospermia cases remain unclear [4]. Asthenospermia may be associated with defects in flagella or cilia structure, ion channel stability, gene mutations, adverse exposure (such as smoking, alcohol consumption, and pesticide exposure), and mitochondrial ATP production function [5]. Damage to mitochondrial membrane integrity and sheath function is one of the main characteristics of decreased sperm motility, as part of the energy required for movement is provided by mitochondria [6]. Currently, there are no effective clinical treatments for asthenospermia, and some asthenospermia patients are often treated with drugs combined with traditional Chinese and Western medicine and surgery, but the efficacy of these treatments is not definitive. Many infertile couples have to resort to assisted reproductive techniques, which are expensive and may bring unforeseeable complications (for example, salpingitis, endometriosis, etc.)[7]. Therefore, in-depth research on the regulation and energy mechanism of sperm mitochondrial function may be the key to treating asthenospermia [8–10]. Therefore, investigating the role of C9orf72 in the pathogenesis of asthenozoospermia may provide new insights into this condition. Autophagy is an important pathway wherein cells rely on lysosomes to degrade proteins and organelles [11,12]. The degradation of mitochondria through autophagy is specifically referred to as mitophagy [13]. Mitophagy regulates the quality and quantity of mitochondria and is thus crucial in maintaining mitochondrial homeostasis [14]. Metabolic disruption mediated by mitophagy is considered one of the main causes of asthenozoospermia [15]. Currently, it is believed that the classical pathways of mitophagy mainly include the PINK1/Parkin pathway and the BNIP3/BNIP3L pathway[14,16]. In previous research conducted by our group, it was found that C9orf72 (GenBank ID: NM_028466.2) is significantly overexpressed in seminal extracellular vesicles of asthenospermia patients and may affect the occurrence and development of asthenospermia [17]. C9orf72 is a guanine nucleotide exchange factor, and its GGGGCC repeat expansion is a common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), which has attracted attention from many researchers [18–20]. Studies have shown that C9orf72 can regulate the initiation of autophagy by interacting with the Rab1a-ULK1 complex [21], and the C9orf72-SMCR8 complex can also regulate the protein kinase activity of ULK1/ATG1 by interacting with the complex, functioning as a regulator of autophagy initiation [22]. However, the regulation of mitophagy by C9orf72 has not yet been reported. Recent studies have shown that C9orf72, as a mitochondrial membrane-binding protein, regulates energy homeostasis by stabilizing mitochondrial complex I assembly [23]. In addition, C9orf72 is involved in the transport of mitochondrial destruction to the metabolic demand site [24]. Glucose metabolism is crucial for sperm energy production and function, affecting sperm motility [25,26]. However, whether C9orf72 promotes the development of asthenospermia by inhibiting spermatogonia proliferation through mitophagy and glucose metabolism has not been reported. This study aims to investigate the expression of C9orf72 in asthenospermia patients, its impact on spermatogonia proliferation, and whether C9orf72 influences spermatogonia proliferation through mitochondrial autophagy and glucose metabolism. To provide a theoretical basis for a comprehensive understanding of the functional mechanisms through which C9orf72 regulates asthenospermia and for targeted clinical interventions in asthenospermia. 2. Materials and methods 2.1 Subjects The human semen samples involved in this study were obtained from the Hainan Women and Children's Medical Center. All procedures related to this study complied with the Helsinki Declaration and were approved by the Ethics Committee of the Hainan Women and Children's Medical Center (Approval No. 2021-033). All the subjects of this study were informed of the experimental details and signed informed consent forms. Semen samples were excluded if any of the following parameters were abnormal: fructose level, acid phosphatase level, liquefaction time, pH value, sperm morphology, and α-glucosidase level. Twenty-seven seminal samples with asthenospermia were included in this study, and the inclusion criteria for asthenospermia were as follows: (1) progressive motility less than 32% in two consecutive semen analyses; (2) normal levels of sex hormones, such as follicle-stimulating hormone, testosterone, and estradiol; (3) no abnormalities found on physical examination of the urinary and reproductive systems; and (4) complete medical records and follow-up information. Thirty-one normal control seminal samples were included in this study, and the inclusion criteria for the control group were as follows: (1) progressive motility of semen greater than or equal to 32%; (2) normal levels of sex hormones, such as follicle-stimulating hormone, testosterone, and estradiol; (3) no obvious abnormalities found in the clinical examination indicators; and (4) complete medical records and follow-up information. 2.2 Immunofluorescence Fresh semen samples were collected using a sterile collection tube. The semen was added to a flat-bottomed centrifuge tube containing PBS buffer, mixed gently, and centrifuged at 3000 rpm for 15 min. The supernatant was discarded, and the semen was fixed with a 4% paraformaldehyde solution at room temperature for 30 min. Finally, the fixed semen was evenly spread on a glass slide and air-dried naturally at room temperature or in a 37℃ incubator to prepare semen smears using similar methods for preparing GC-1 spg cell smears. After air-drying and washing with PBS, the semen smears or cell smears were blocked with goat serum for 2 h, followed by incubation with C9orf72 (ab308169, 1: 250), LC3 (ab192890, 1: 250) or TOM20 (ab56783 1: 250) primary antibodies overnight. After washing, the smears were incubated with fluorescent secondary antibodies (Beyotime, anti-rabbit A0516, anti-mouse A0521, 1: 250) at room temperature and finally stained with DAPI nuclear dye (Sigma‒Aldrich, D9542). The fluorescence images were observed and captured using a confocal laser scanning microscope (Leica, TCS SP2). 2.3 Western blot analysis Semen or cells were lysed on ice for 30 min in RIPA cell lysis buffer (Thermo Fisher Scientific, 89900, USA), followed by centrifugation at 12,000 rpm and 4°C for 15 min to obtain the cell total protein. Protein concentration was measured by the BCA (Thermo Fisher Scientific, 23225, USA) method. Total protein (50 µg) was separated by 10% SDS‒PAGE (Bio-Rad, 1610184, USA) and transferred onto a PVDF membrane (Millipore, IPVH00010, USA), which was blocked at room temperature with 5% nonfat milk for 2 h. The membrane was probed with C9orf72 (Abcam, ab308169, 1: 500), LC3 (Abcam, ab192890, 1: 2000), p62 (Abcam, ab109012, 1: 10000), BNIP3 (Abcam, ab10433, 2 µg/ml), PINK1 (Abcam, ab216144, 1: 1000), GLUT1 (Abcam, ab115730, 1: 100000), GLUT3 (Abcam, ab314193, 1: 1000), HK2 (Abcam, ab209847, 1: 1000), LDHA (Abcam, ab52488, 1: 5000) or GAPDH (Abcam, ab8245, 1: 1000) primary antibodies targeting the protein of interest overnight, followed by washing with TBST three times for 10 min each. Then, the membrane was incubated with HRP-conjugated secondary antibodies (Thermo Pierce, 31210, 1:5000) at room temperature for 1 h, followed by washing with TBST three times for 10 min each. ECL reagents (Thermo Fisher, 32106) were used for luminescence detection and imaging, GAPDH expression was used as an internal reference for relative protein expression, and ImageJ software (National Institutes of Health, V1.8.0.112) was used for analysis in normalization. 2.4 Spermatogonia Cultivation Mouse spermatogonia GC-1 spg (ATCC, CRL-2053.) was cultured in 1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin solution (Gibco, 11960-044). The cells were incubated at 37°C with 5% CO 2 and 95% air. 2.5 Lentiviral Construction and Transfection The mouse C9orf72 gene coding region (CDS, GenBank ID: NM_028466.2) sequence was retrieved from the NCBI database ( https://www.ncbi.nlm.nih.gov/ ). The full-length C9orf72 coding sequence was synthesized and cloned and inserted into the GV358 lentiviral expression vector (Guangzhou Anernor Biotechnology Co., Ltd, GV358). Then, the lentiviral expression vector, viral envelope, and packaging/helper plasmids were cotransfected into 293T cells using Lipofectamine 3000 (Invitrogen, L3000-015). After 48 hours, the supernatant was collected, concentrated, and purified to obtain C9orf72-overexpressing lentivirus and a negative control lentivirus. GC-1 spg cells were transduced with the lentivirus at a multiplicity of infection (MOI) of 50, assisted by polybrene (GeneChem), and subjected to subsequent experiments after 96 hours. 2.6 Real-time quantitative PCR (RT‒qPCR) analysis Total RNA from the sperm or cells was extracted using TRIzol reagent (Invitrogen, 15596018). The RT‒PCR kit was obtained from Takara (RR036A), and all reagents and consumables used were treated to remove RNase. Total RNA was reverse transcribed into cDNA using reverse transcriptase, SYBR Green was used to detect C9orf72 expression, and GAPDH was used as an internal reference. A fluorescence quantitative PCR assay was performed using a fluorescence quantitative PCR instrument (Agilent Stratagene, Mx3000P). After the reaction, the reaction curve was analyzed to obtain the Ct value. The relative expression value was calculated using the 2-ΔΔct method, and each sample was repeated three times. The PCR conditions were as follows: 95℃ for 2 min, 94℃ for 20 s, 58℃ for 20 s, and 72℃ for 20 s, and 40 cycles were performed. Dissociation curve analysis was performed as follows: 94°C for 30 s, 65°C for 30 s, and 94°C for 30 s. The sequences of primers used were as follows: C9orf72 forward primer (5'-3'): GTTCCGTTGTAGTTGGCAGC; C9orf72 reverse primer (5'-3'): CTTGCACAAAGAGTCCCGAT. GAPDH forward primer (5'-3'): AGAGTGTTTCCTCGTCCCGT; GAPDH reverse primer (5'-3'): GAGGTCAATGAAGGGGTCGT. 2.7 CCK8 Assay for Cell Viability Log-phase cells were seeded in a 96-well plate at a density of 5 × 10 3 cells/well and incubated overnight. CCK-8 reagent (Dojindo, CK04) was added, and the cells were incubated for an additional 6 hours. The OD450 values were measured using a spectrophotometer (Shimadzu, Japan, UV-1900) and analyzed. This process was repeated for five consecutive days, with three independent experiments performed. 2.8 Flow Cytometry Detection of Cell Apoptosis After digestion, log-phase cells were resuspended in PBS. Cells were stained with an Annexin V/PI apoptosis detection kit (BD Biosciences, 556547) and analyzed using flow cytometry (Becton Dickinson Company, USA, FACSAria) to determine the rate of cell apoptosis. When exploring mitophagy inhibition, transfection for 96 h was followed by treatment with 10 µM mitophagy inhibitor Mdivi-1 (Sigma‒Aldrich, M0199) for 24 h. The experiment was repeated three times. 2.9 JC-1 staining experiment Mitochondrial membrane potential was determined using the JC-1ochondrial Membrane Potential Assay Kit (Beyotime, C2003S) according to the manufacturer's instructions. First, the JC-1 staining working solution was prepared. Each 1 ml of JC-1 staining working solution contained 5 µl of JC-1(200X). The spermatogonium was added to a flat-bottomed centrifuge tube containing PBS buffer, mixed gently, and centrifuged at 3000 rpm for 15 min. Add 0.5 ml of JC-1 staining working solution, invert several times to mix, and then incubate at 5% CO 2 and 37°C for 20 min. After the incubation period, the sample was centrifuged again at 3000 rpm for 15 min. The supernat discarded, followed by washing twice with JC-1 staining buffer. Finally, resuspend in an appropriate amount of JC-1 staining buffer and observe with a laser confocal microscope(Leica, TCS SP2) for fluorescence observation and result analysis. When detecting JC-1 monomers, the excitation wavelength was set at 490 nm and the emission wavelength was set at 530 nm. When detecting JC-1 polymers, the excitation wavelength was set at 525 nm and the emission wavelength was set at 590 nm. Green fluorescence indicates decreased mitochondrial membrane potential and red fluorescence indicates normal mitochondrial membrane potential. 2.10 Mitochondrial Fluorescence Labeling Experiment A solution of Mito-Tracker Red CMXRos mitochondrial red fluorescent probe (Beyotime, C1035) was mixed with 420 µl of anhydrous DMS to obtain a 200 µM storage solution. Then, 1 µl of the 200 µM storage solution was added to 1 ml of culture medium, which after thorough mixing yielded a 200 nM working solution. When cell growth reached 50%-60%, the culture medium was removed, and the cells were incubated with the pre-warmed working solution at 37℃ for 30 min. Upon successful incubation, the cells were fixed following the same method as used in immunofluorescence procedures. 5 µg/ml Tubulin primary antibody (Abcam, ab7291) was added and incubated overnight at 4℃. After washing with PBS, an appropriately diluted fluorescent secondary antibody (Beyotime, anti-rabbit A0516, anti-mouse A0521, 1: 250) was added and incubated for 1 hour at room temperature in the dark. The cells were then washed three times with PBS. DAPI was added and incubated in the dark for 5 min for nuclear staining, followed by washing with PBS to remove excess DAPI. Finally, the fluorescence images were observed and captured using a confocal laser scanning microscope (Leica, TCS SP2). 2.11 ROS assay To assess ROS levels via flow cytometry, cells were first harvested and counted, adjusting the cell density to 1x10 6 cells/mL. The cells were then incubated with 10 µM DCFH-DA (2',7'-dichlorofluorescein diacetate) from the ROS Assay Kit (Beyotime, S0033) for 20 min at 37°C in a humidified 5% CO 2 atmosphere. After incubation, the cells were washed twice with ice-cold PBS by centrifugation at 300 x g for 5 min to remove excess dye. Subsequently, the cells were resuspended in PBS, and their fluorescence intensity was immediately measured using a flow cytometer (Becton Dickinson Company, USA, FACSAria) equipped with a 488 nm excitation laser and a 530 nm bandpass filter. 2.12 Cell Glucose Content Detection To determine the cellular glucose levels, cells were first harvested and counted, adjusting the cell density to 1x10 6 cells/mL. At 0 and 24 hours, the cells were then washed twice with ice-cold PBS by centrifugation at 300 x g for 5 min and lysed using the glucose assay buffer provided in the Glucose Uptake Assay Kit (BioVision, K606-100). The lysates were clarified by centrifugation at 10,000 x g for 5 min at 4°C, and the supernatants were collected for analysis. Subsequently, the samples were loaded into a 96-well plate, and the assay reagents from the kit were added according to the manufacturer's instructions. After a designated incubation time, the absorbance was measured using a spectrophotometer (Shimadzu Corporation, Japan, UV-1900) at 412 nm, and the corresponding glucose concentration was calculated based on the standard curve. 2.13 Statistical Analysis GraphPad Prism software (GraphPad Software, USA, v9.0) was employed for statistical analysis and data visualization through plotting. Data are presented as the mean ± standard deviation (mean ± SD). Pearson's correlation coefficient was used to analyze the relationships between variables. Differences among multiple groups were assessed using ordinary one-way ANOVA, while differences in multiple indicators across various groups were examined with two-way ANOVA. A p value < 0.05 was considered statistically significant. 3. Results 3.1 C9orf72 is significantly upregulated in asthenozoospermic semen and negatively associated with sperm progressive motility We collected semen samples from 27 patients with asthenospermia and 31 healthy males for our study. Immunofluorescence was conducted to observe the protein expression of C9orf72 in the two groups separately. The results demonstrated that the expression of C9orf72 was significantly higher in the asthenospermic group than in the normal group, as shown in Fig. 1 A. Western blot analysis was performed to detect the protein expression of C9orf72, and the differences in C9orf72 protein expression between groups were analyzed along with the correlation with progressive motility rate (last recorded value). The Western blot results revealed a significantly higher relative expression of C9orf72 protein in the asthenospermic group than in the normal group ( p < 0.001), as shown in Fig. 1 B. Correlation analysis indicated a significant negative correlation between C9orf72 protein expression and the progressive motility rate (r=-0.9126, p < 0.001), as shown in Fig. 1 C. 3.2 Overexpression of C9orf72 Inhibits Proliferation in Spermatogonia The GC-1 spg line was derived from mouse spermatogonia. After transfecting GC-1 spg cells with C9orf72-overexpressing lentivirus and a negative control, C9orf72 mRNA expression was detected by RT‒PCR, C9orf72 protein expression was assessed by Western blotting, cell viability changes were evaluated using the CCK8 assay, and alterations in cell apoptosis and ROS levels were examined by flow cytometry. The results showed that, compared to the negative control group (NC), the relative expression of C9orf72 mRNA in the C9orf72-overexpressing lentivirus-transfected group (C9orf72) was significantly increased ( p < 0.001, as shown in Fig. 2 A), as was the relative expression of C9orf72 protein ( p < 0.001, as shown in Figs. 2 B and 2 C). Moreover, cell viability was significantly reduced ( p < 0.001, as shown in Fig. 2 D), and both the rate of cell apoptosis ( p < 0.001, as shown in Fig. 2 E) and ROS levels ( p < 0.001, as shown in Fig. 2 F) were significantly elevated. 3.3 Overexpression of C9orf72 Enhances Mitophagy in Spermatogonia. Following transfection of GC-1 spg cells with C9orf72-overexpressing lentivirus and negative control, mitochondrial membrane potential changes were observed after JC-1 staining. Tubulin-labeled cytoskeleton and MitoTracker Red CMXRos-labeled mitochondria were used to visualize mitochondrial alterations. Autophagosomes labeled with LC-3 and MitoTracker Red CMXRos-labeled mitochondria were employed to observe colocalization and quantity changes of autophagosomes and mitochondria. Western blotting was performed to detect the expression of mitophagy-related proteins (LC3, p62, PINK1 and BNIP3). The results showed that in the C9orf72-overexpressing lentivirus-transfected group (C9orf72), compared to the negative control group (NC), the amount of JC-1 monomers (green) increased and JC-1 aggregates (red) decreased, indicating a reduction in mitochondrial membrane potential (as shown in Fig. 3 A); Simultaneously, the number of MitoTracker Red CMXRos-labeled mitochondria (red) decreased (as shown in Figs. 3 B and 4 A), while the level of LC-3-labeled autophagy (green) increased, and autophagosomes colocalized with mitochondria (as shown in Fig. 4 A). Additionally, the ratio of LC3Ⅱ/Ⅰ ( p < 0.001), PINK1 ( p < 0.001), and BNIP3 ( p < 0.001) protein expression in the C9orf72 group was significantly elevated relative to that in the NC group, and p62 protein expression was significantly reduced (p < 0.001) (as shown in Fig. 4 B). In summary, overexpression of C9orf72 decreased mitochondrial membrane potential, reduced mitochondrial number, increased autophagosome formation, induced autophagosome colocalization with mitochondria, and increased the expression of mitochondrial autophagy-related proteins in GC-1 spg, indicating enhanced mitophagy. 3.4 Overexpression of C9orf72 Impairs Glucose Energy Metabolism in Spermatogonia. After transfecting GC-1 spg cells with C9orf72-overexpressing lentivirus and negative control, glucose concentrations at 0 and 24 h were measured, and the expression of glucose energy metabolism-related proteins was assessed by Western blotting. The results showed that compared to that in the negative control group (NC), the glucose concentration at 24 h in the C9orf72-overexpressing lentivirus-transfected group (C9orf72) was significantly decreased ( p < 0.001, as shown in Fig. 5 A), indicating a significant increase in glucose uptake at 24 h ( p < 0.01, as shown in Fig. 5 B). Concurrently, the protein expression levels of GLUT1 ( p < 0.001), GLUT3 ( p < 0.001), HK2 ( p < 0.001), and LDHA ( p < 0.001) were significantly reduced in the C9orf72 group (as shown in Fig. 5 C). 3.5 Mitophagy Inhibitor Reverse Apoptosis Induced by C9orf72 Overexpression. Following transfection of GC-1 spg cells with C9orf72-overexpressing lentivirus and a negative control lentivirus, the cells overexpressing C9orf72 were treated with the mitophagy inhibitor Mdivi-1. The results revealed that, compared to the negative control group (NC), the apoptotic rate significantly increased in the C9orf72-overexpressing lentivirus-transfected group (C9orf72) ( p < 0.001), consistent with previous research. Moreover, relative to the C9orf72 group, the apoptotic rate was significantly reduced in the C9orf72-overexpressing cells treated with the mitophagy inhibitor Mdivi-1 (C9orf72 + Mdivi-1) ( p < 0.001), as shown in Fig. 6 . These findings suggest that Mdivi-1, a mitophagy inhibitor, can partially reverse the proapoptotic effects of C9orf72 on GC-1 spg cells. 4. Discussion Asthenozoospermia, also known as weak sperm motility, is a common etiology of male infertility[27]. The pathogenesis of asthenozoospermia is complex and multifactorial. It involves various biological pathways that regulate sperm production, function, and quality[28]. According to the diagnostic criteria of asthenozoospermia, the percentage of progressive motility (PR) is less than 32%, while other parameters remain normal[29]. Therefore, progressive motility is a critical indicator of this condition. Our study demonstrated that C9orf72 was significantly upregulated in the semen of patients with asthenozoospermia and negatively correlated with progressive motility. These findings suggest that C9orf72 may be a pivotal molecule that promotes asthenozoospermia, as its overexpression impairs the forward motility of sperm, which may be a key factor in the pathogenesis of this condition. Previous studies have shown that the overexpression of C9orf72 may play a critical role in nonobstructive azoospermia[30]. To the best of our knowledge, this is the first report of the association between C9orf72 and asthenozoospermia, suggesting that C9orf72 may be involved in the pathogenesis and progression of asthenozoospermia. Spermatogonia are precursor cells of sperm that undergo a series of growth, differentiation, and maturation processes in the testes before developing into mature sperm with reproductive potential[31]. During the developmental process of spermatogonia, their morphology, function, and quantity are controlled by various biological and metabolic factors, including testicular hormones, DNA damage repair, mitochondrial function, and autophagy[32,33]. The proliferation, apoptosis, and differentiation of spermatogonia can impact sperm vitality and ultimately contribute to the development of asthenozoospermia[34]. Studies have shown that Cuscuta chinensis Lam. and Lycium barbarum L. can decrease the proportion of GC-1 spg cells in S phase, increase mitochondrial membrane potential, significantly reduce cell apoptosis, and improve sperm quantity and survival rates, suggesting that this may be one of their mechanisms for treating asthenozoospermia[35]. In this study, we found that overexpression of C9orf72 inhibited the proliferation of GC-1 spg cells and promoted their apoptosis and ROS levels. Increased intracellular levels of ROS indicate that the cells are under stress, oxidative imbalance, or metabolic disorders (such as hypoxia or energy deficiency) [36,37]. This finding is consistent with our subsequent discovery that C9orf72 overexpression promotes mitophagy and inhibits glucose metabolism. The overexpression of C9orf72 inhibits spermatogonia proliferation, potentially constituting a pivotal mechanism through which C9orf72 contributes to asthenozoospermia. Mitochondrial function and intact mitochondrial membrane potential are necessary for sperm motility, hyperactivation, energy acquisition, acrosome reaction, and preservation of DNA integrity [38,39]. Therefore, optimal mitochondrial activity is crucial for human sperm function and semen quality, and defects in sperm mitochondrial function can severely impair the energy production required for maintaining sperm motility, which may be one of the fundamental causes of asthenozoospermia [9]. Studies have shown that C9orf72 can regulate autophagy initiation by interacting with the Rab1a-ULK1 complex [21]. Research has shown that Qiangjing tablets ameliorate mouse asthenozoospermia via mitochondrial ubiquitination and mitophagy mediated by LKB1/AMPK/ULK1 signaling[40]. However, there are currently no studies on the regulation of mitophagy by C9orf72. In this study, we found that C9orf72 overexpression promoted mitophagy in spermatogonia (GC-1 spg), leading to decreased mitochondrial membrane potential and mitochondrial quantity. Research has demonstrated the significant role of mitochondrial homeostasis in influencing sperm vitality [15]. While the role of mitophagy in either promoting or inhibiting proliferation remains equivocal, varying regulatory mechanisms may exist among different cell types; nonetheless, mitophagy is widely acknowledged as one of the mechanisms governing proliferation [41,42]. This suggests that the promotion of mitophagy may be one of the key mechanisms through which C9orf72 inhibits spermatogonia proliferation. Moreover, we also found that the mitophagy inhibitor Mdivi-1 could reverse C9orf72 overexpression-induced GC-1 spg cell apoptosis, suggesting that Mdivi-1 may be applied in the treatment of asthenozoospermia induced by C9orf72 overexpression, which requires further research to confirm. Mitochondria serve as the primary cellular organelle for glucose metabolism and ATP generation, with mitophagy influencing alterations in intracellular glucose metabolism [43]. Glucose-derived ATP functions as an energy source for spermatozoa in a myriad of cellular processes, encompassing cellular competence, motility, hyperactivation, acrosome reaction, and maintenance of the intracellular milieu [44]. Our results showed that overexpression of C9orf72 in GC-1 spg cells led to a decrease in the expression of glucose transporters (GLUT1 and GLUT3), as well as a decrease in the expression of key enzymes involved in glucose metabolism, such as hexokinase 2 (HK2) and lactate dehydrogenase A (LDHA). Additionally, we observed a decrease in the concentration of glucose in the media of cells overexpressing C9orf72. These findings suggest that C9orf72 may play a role in the regulation of glucose metabolism and that its regulation may contribute to the development of asthenozoospermia. 5. Conclusions Our study demonstrates that C9orf72 is significantly overexpressed in semen samples from patients with asthenozoospermia and negatively correlated with sperm forward motility. C9orf72 overexpression inhibits the proliferation of GC-1 spg spermatogonia, and its mechanism may be related to the promotion of mitophagy and inhibition of glucose metabolism, which may represent a new regulatory mechanism underlying asthenozoospermia. Declarations Ethics approval and consent to participate ： The human semen samples involved in this study were obtained from the Hainan Women and Children's Medical Center. All procedures related to this study complied with the Helsinki Declaration and were approved by the Ethics Committee of the Hainan Women and Children's Medical Center (Approval No. 2021-033). Consent for publication ： Not applicable. Availability of data and materials ： All data generated or analysed during this study are included in this published article (and its supplementary information files). Competing interests ： The authors declare that they have no competing interests. Funding: This work was supported by the Hainan Provincial Natural Science Foundation (822RC857) and the Key R&D Program of Hainan Province (ZDYF2023SHFZ093). Authors' contributions: L.H and X.D.C performed cell testing, both of them were major contributors in writing the manuscript and data analysis. Z.L.Q performed cell culture and material procurement. R.H.L performed mitophagy detection. W.A.G performed western blot detection. L.Y.J performed glucose metabolism detection. L.W.Y performed cell apoptosis assay and was responsible for the revision of the manuscript. Acknowledgements: We would like to express our gratitude to the Natural Science Foundation of Hainan Province (822RC857) and the Key R&D Program of Hainan Province (ZDYF2023SHFZ093) for providing research funding to this study. References Krausz C, et al. Genetics of male infertility. Nat Rev Urol, 2018, 15(6): 369–384.doi:10.1038/s41585-018-0003-3 Esteves S C. Evolution of the World Health Organization semen analysis manual: where are we? Nature reviews. Urology, 2022, 19(7): 439–446.doi:10.1038/s41585-022-00593-2 Wang C, et al. Evolution of the WHO \"Semen\" processing manual from the first (1980) to the sixth edition (2021). Fertility and sterility, 2022, 117(2): 237–245.doi:10.1016/j.fertnstert.2021.11.037 Minhas S, et al. European Association of Urology Guidelines on Male Sexual and Reproductive Health: 2021 Update on Male Infertility. European urology, 2021, 80(5): 603–620.doi:10.1016/j.eururo.2021.08.014 Shahrokhi S Z, et al. Asthenozoospermia: Cellular and molecular contributing factors and treatment strategies. Andrologia, 2020, 52(2): e13463.doi:10.1111/and.13463 Du Plessis S S, et al. Oxidative phosphorylation versus glycolysis: what fuel do spermatozoa use? Asian J Androl, 2015, 17(2): 230-5.doi:10.4103/1008-682x.135123 Kiani A K, et al. Complications related to in vitro reproductive techniques support the implementation of natural procreative technologies. Acta bio-medica : Atenei Parmensis, 2020, 91(13-s): e2020018.doi:10.23750/abm.v91i13-S.10525 Vertika S, et al. Mitochondria, spermatogenesis, and male infertility - An update. Mitochondrion, 2020, 54: 26–40.doi:10.1016/j.mito.2020.06.003 Durairajanayagam D, et al. Causes and consequences of sperm mitochondrial dysfunction. Andrologia, 2021, 53(1): e13666.doi:10.1111/and.13666 Barbagallo F, et al. Evaluation of Sperm Mitochondrial Function: A Key Organelle for Sperm Motility. J Clin Med, 2020, 9(2).doi:10.3390/jcm9020363 Klionsky D J, et al. Autophagy in major human diseases. The EMBO journal, 2021, 40(19): e108863.doi:10.15252/embj.2021108863 Galluzzi L, et al. Autophagy-Independent Functions of the Autophagy Machinery. Cell, 2019, 177(7): 1682–1699.doi:10.1016/j.cell.2019.05.026 Doblado L, et al. Mitophagy in Human Diseases. International journal of molecular sciences, 2021, 22(8).doi:10.3390/ijms22083903 Onishi M, et al. Molecular mechanisms and physiological functions of mitophagy. The EMBO journal, 2021, 40(3): e104705.doi:10.15252/embj.2020104705 Gupta S, et al. Estrogen-related receptor is critical for testicular mitochondrial homeostasis and sperm motility: a Drosophila-based study. F&S science, 2022, 3(3): 217–227.doi:10.1016/j.xfss.2022.02.003 Killackey S A, et al. Mitophagy pathways in health and disease. J. Cell Biol., 2020, 219(11).doi:10.1083/jcb.202004029 Lu H, et al. RNA-sequencing and bioinformatics analysis of long noncoding RNAs and mRNAs in the asthenozoospermia. Bioscience reports, 2020, 40(7).doi:10.1042/bsr20194041 Balendra R, et al. C9orf72-mediated ALS and FTD: multiple pathways to disease. Nat. Rev. Neurol., 2018, 14(9): 544–558.doi:10.1038/s41582-018-0047-2 Smeyers J, et al. C9ORF72: What It Is, What It Does, and Why It Matters. Front. Cell. Neurosci., 2021, 15: 661447.doi:10.3389/fncel.2021.661447 Pang W, et al. Cellular and physiological functions of C9ORF72 and implications for ALS/FTD. J. Neurochem., 2021, 157(3): 334–350.doi:10.1111/jnc.15255 Webster C P, et al. The C9orf72 protein interacts with Rab1a and the ULK1 complex to regulate initiation of autophagy. EMBO J., 2016, 35(15): 1656-76.doi:10.15252/embj.201694401 Yang M, et al. A C9ORF72/SMCR8-containing complex regulates ULK1 and plays a dual role in autophagy. Sci Adv, 2016, 2(9): e1601167.doi:10.1126/sciadv.1601167 Wang T, et al. C9orf72 regulates energy homeostasis by stabilizing mitochondrial complex I assembly. Cell Metab., 2021, 33(3): 531–546.e9.doi:10.1016/j.cmet.2021.01.005 Oakes J A, et al. TBK1: a new player in ALS linking autophagy and neuroinflammation. Mol. Brain, 2017, 10(1): 5.doi:10.1186/s13041-017-0287-x Hsiao C H, et al. Mesenchymal stem cells restore the sperm motility from testicular torsion-detorsion injury by regulation of glucose metabolism in sperm. Stem cell research & therapy, 2019, 10(1): 270.doi:10.1186/s13287-019-1351-5 Numata S, et al. The sodium-glucose cotransporter isoform 1 (SGLT-1) is important for sperm energetics, motility, and fertility†. Biology of reproduction, 2022, 106(6): 1206–1217.doi:10.1093/biolre/ioac052 Qu R, et al. ADGB variants cause asthenozoospermia and male infertility. Hum. Genet., 2023, 142(6): 735–748.doi:10.1007/s00439-023-02546-0 Tu C, et al. Genetic underpinnings of asthenozoospermia. Best Pract. Res. Clin. Endocrinol. Metab., 2020, 34(6): 101472.doi:10.1016/j.beem.2020.101472 Carson S A, et al. Diagnosis and Management of Infertility: A Review. Jama, 2021, 326(1): 65–76.doi:10.1001/jama.2021.4788 Luo X, et al. Identification of biomarkers associated with macrophage infiltration in non-obstructive azoospermia using single-cell transcriptomic and microarray data. Annals of translational medicine, 2023, 11(2): 55.doi:10.21037/atm-22-5601 Saitou M, et al. Mammalian in vitro gametogenesis. Science, 2021, 374(6563): eaaz6830.doi:10.1126/science.aaz6830 Wang M, et al. Autophagy: a multifaceted player in the fate of sperm. Hum. Reprod. Update, 2022, 28(2): 200–231.doi:10.1093/humupd/dmab043 Rajender S, et al. Epigenetics, spermatogenesis and male infertility. Mutat. Res., 2011, 727(3): 62–71.doi:10.1016/j.mrrev.2011.04.002 Olawuyi T S, et al. Histomorphometric evaluation of seminiferous tubules and stereological assessment of germ cells in testes following administration of aqueous leaf-extract of Lawsonia inermis on aluminium-induced oxidative stress in adult Wistar rats. JBRA assisted reproduction, 2019, 23(1): 24–32.doi:10.5935/1518-0557.20180080 Wang J, et al. To study the mechanism of Cuscuta chinensis Lam. And Lycium barbarum L. in the treatment of asthenospermia based on network pharmacology. J. Ethnopharmacol., 2021, 270: 113790.doi:10.1016/j.jep.2021.113790 Schieber M, et al. ROS function in redox signaling and oxidative stress. Curr. Biol., 2014, 24(10): R453-62.doi:10.1016/j.cub.2014.03.034 Rani V, et al. Oxidative stress and metabolic disorders: Pathogenesis and therapeutic strategies. Life Sci., 2016, 148: 183 − 93.doi:10.1016/j.lfs.2016.02.002 Meyers S, et al. Sperm mitochondrial regulation in motility and fertility in horses. Reprod Domest Anim, 2019, 54 Suppl 3: 22–28.doi:10.1111/rda.13461 Bulkeley E A, et al. Effects from disruption of mitochondrial electron transport chain function on bull sperm motility. Theriogenology, 2021, 176: 63–72.doi:10.1016/j.theriogenology.2021.09.015 Li G, et al. Qiangjing tablets ameliorate asthenozoospermia via mitochondrial ubiquitination and mitophagy mediated by LKB1/AMPK/ULK1 signaling. Pharmaceutical biology, 2023, 61(1): 271–280.doi:10.1080/13880209.2023.2168021 He L, et al. PINK1/Parkin-mediated mitophagy promotes apelin-13-induced vascular smooth muscle cell proliferation by AMPKα and exacerbates atherosclerotic lesions. Journal of cellular physiology, 2019, 234(6): 8668–8682.doi:10.1002/jcp.27527 Boyle K A, et al. Mitochondria-targeted drugs stimulate mitophagy and abrogate colon cancer cell proliferation. The Journal of biological chemistry, 2018, 293(38): 14891–14904.doi:10.1074/jbc.RA117.001469 Miyazaki N, et al. PINK1-dependent and Parkin-independent mitophagy is involved in reprogramming of glycometabolism in pancreatic cancer cells. Biochem. Biophys. Res. Commun., 2022, 625: 167–173.doi:10.1016/j.bbrc.2022.08.004 Mukai C, et al. What sperm can teach us about energy production. Reprod Domest Anim, 2012, 47 Suppl 4(0 4): 164-9.doi:10.1111/j.1439-0531.2012.02071.x Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3351258\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":236830595,\"identity\":\"b2017909-548b-4f22-8bba-ca4f4c4e3043\",\"order_by\":0,\"name\":\"Hui Lu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hainan Women and Children's Medical Center\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hui\",\"middleName\":\"\",\"lastName\":\"Lu\",\"suffix\":\"\"},{\"id\":236830596,\"identity\":\"81d9c51b-d5d6-43f7-a31e-10d0fad77aa7\",\"order_by\":1,\"name\":\"Dongchuan Xu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hainan Affiliated Hospital of Hainan Medical University\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dongchuan\",\"middleName\":\"\",\"lastName\":\"Xu\",\"suffix\":\"\"},{\"id\":236830597,\"identity\":\"1776a0b5-f6da-4967-ac7f-fcfa5ebff01d\",\"order_by\":2,\"name\":\"Liqiang Zhao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hainan Women and Children's Medical Center\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Liqiang\",\"middleName\":\"\",\"lastName\":\"Zhao\",\"suffix\":\"\"},{\"id\":236830598,\"identity\":\"b3da8bc7-ba06-4c9a-bcb2-9ac2abdfc77c\",\"order_by\":3,\"name\":\"Hailing Ruan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hainan Women and Children's Medical Center\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hailing\",\"middleName\":\"\",\"lastName\":\"Ruan\",\"suffix\":\"\"},{\"id\":236830599,\"identity\":\"0ca9abee-2bb4-48ba-9615-e8276a24528e\",\"order_by\":4,\"name\":\"Anguo Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hainan Women and Children's Medical Center\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Anguo\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":236830600,\"identity\":\"4d5a00c9-f52b-458a-a70f-7c1bc47a3a69\",\"order_by\":5,\"name\":\"Yejuan Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Hainan Women and Children's Medical Center\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yejuan\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":236830601,\"identity\":\"7620ff51-f8a5-4c08-bd63-62ae1d75868d\",\"order_by\":6,\"name\":\"Weiying Lu\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA50lEQVRIiWNgGAWjYBACAxCRwCDBwMDe2Pjgg4GNHQlaeA4fNpxRkJZMnBYwkEhLE+b5cIixgaAWiRzDBw/bLPLkHXLMmG0MDjAzsB8+uoGAFmODxDaJYsMDZ8we5xjc4WPgSUu7gV9L7jYJoJbEjY095sY5Bs+YGSR4zAhp2f4DrKWZx0zawuAwYwMRWrYxgLTMZ2NLk2YgSgvP+88SCeckEjfwMB827DFIS2Yj5Bf79rTEjz/K6hLnz3/Y+ODHHxs7fvbDx/BqAQNGNqB1B6AcNoLKweAPA4N8A3FKR8EoGAWjYAQCAAvjS8ypGmu9AAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Hainan Women and Children's Medical Center\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Weiying\",\"middleName\":\"\",\"lastName\":\"Lu\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2023-09-13 08:59:25\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3351258/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3351258/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":44145799,\"identity\":\"26f97d9f-0cc1-4258-9dc0-18c85ceac63e\",\"added_by\":\"auto\",\"created_at\":\"2023-10-05 15:28:30\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":152949,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eC9orf72 is significantly upregulated in asthenozoospermic semen and negatively associated with sperm progressive motility\\u003c/p\\u003e\\n\\u003cp\\u003eA: The protein expression of C9orf72 was observed by immunofluorescence (1500X). B: Western blot detection of C9orf72 protein expression. C: Correlation between C9orf72 protein expression and sperm progressive motility in participants. ***Represents \\u003cem\\u003ep\\u003c/em\\u003e\\u0026lt;0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"OnlineFigure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3351258/v1/acd1214bb0b33e3452d3ffc7.png\"},{\"id\":44146718,\"identity\":\"087f5ded-331d-4e93-be60-08f308516fda\",\"added_by\":\"auto\",\"created_at\":\"2023-10-05 15:36:30\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":358610,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eOverexpression of C9orf72 inhibits proliferation in spermatogonia (GC-1 spg)\\u003c/p\\u003e\\n\\u003cp\\u003eA: RT‒PCR analysis of C9orf72 mRNA expression; B: Western blot detection of C9orf72 protein expression; C: Grayscale analysis and statistical evaluation; D: Cell viability assessment using the CCK8 assay; E: Flow cytometry analysis of cell apoptosis; F: Flow cytometry analysis of ROS levels. ***Compared to the NC group, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026lt;0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"OnlineFigure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3351258/v1/1392f1e5534d53cd60f9bff0.png\"},{\"id\":44145800,\"identity\":\"c7087e6e-d935-4681-b845-ebd144a9bfdb\",\"added_by\":\"auto\",\"created_at\":\"2023-10-05 15:28:30\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":769896,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eC9orf72 overexpression impairs mitochondrial membrane potential and reduces mitochondrial quantity in spermatogonia\\u003c/p\\u003e\\n\\u003cp\\u003eA: Observation of mitochondrial membrane potential after JC-1 staining (400X); B: Visualization of mitochondrial quantity after cell cytoskeleton and mitochondrial staining (400X).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"OnlineFigure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3351258/v1/6f2455e33f5f3c0753cf10a9.png\"},{\"id\":44145803,\"identity\":\"5fd741a3-5abf-41d5-a322-5d2c6165ea7b\",\"added_by\":\"auto\",\"created_at\":\"2023-10-05 15:28:30\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":264348,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eC9orf72 overexpression promotes mitophagy levels in spermatogonia\\u003c/p\\u003e\\n\\u003cp\\u003eA: Observation of LC-3-labeled autophagosomes and mitochondrial staining (1500X); B: Western blot detection of mitochondria-related proteins. ***Compared to the NC group, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026lt;0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"OnlineFigure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3351258/v1/673870c77fcb0d337a9e9b3d.png\"},{\"id\":44145804,\"identity\":\"7d8c6eaf-9cef-40b3-9eab-228353548b3c\",\"added_by\":\"auto\",\"created_at\":\"2023-10-05 15:28:30\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1467312,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eC9orf72 overexpression inhibits glucose metabolism levels in spermatogonia\\u003c/p\\u003e\\n\\u003cp\\u003eA: Glucose concentration measurement at 0 h and 24 h in cells; B: Glucose uptake assessment at 24 h in cells; C: Western blot analysis of glucose metabolism-related proteins. **Compared to the NC group, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026lt;0.01. ***Compared to the NC group, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026lt;0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"OnlineFigure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3351258/v1/ad2a7db5f7ed0365ab6eeb9e.png\"},{\"id\":44145802,\"identity\":\"80397ba5-843e-4b0a-991e-c8c91fb08bfb\",\"added_by\":\"auto\",\"created_at\":\"2023-10-05 15:28:30\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":323355,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eMitophagy inhibitor reverses apoptosis of spermatogonia induced by C9orf72 overexpression. ***Compared to the NC group, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026lt;0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"OnlineFigure61.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3351258/v1/4b3c3f9dd7349cf7f817f969.png\"},{\"id\":45431531,\"identity\":\"36619e39-d1c4-4de4-8946-d0b0792a08f0\",\"added_by\":\"auto\",\"created_at\":\"2023-10-30 08:37:21\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1934792,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3351258/v1/04c6a325-2fdc-4209-ae87-c2d12e10db84.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"C9orf72 Overexpression in Asthenozoospermia: Implications for Spermatogonia Proliferation through mitophagy and glucose metabolism\",\"fulltext\":[{\"header\":\"1. Background\",\"content\":\"\\u003cp\\u003eAsthenozoospermia, characterized by reduced sperm motility, is one of the most common types of male infertility, accounting for 20\\u0026ndash;40% of male infertility cases[1]. Diagnosis of asthenospermia is based on the reporting of progressive motility (PR) of sperm less than 32% in two or more semen analyses, while all other parameters are within the normal range based on the fifth edition of the World Health Organization (WHO) semen analysis criteria[2,3]. The etiology of asthenospermia is complex and can be investigated through auxiliary examinations such as semen analysis, reproductive endocrine hormone examination, imaging examination, and genetic testing. However, the causes and pathogenesis of 30\\u0026ndash;40% of asthenospermia cases remain unclear [4]. Asthenospermia may be associated with defects in flagella or cilia structure, ion channel stability, gene mutations, adverse exposure (such as smoking, alcohol consumption, and pesticide exposure), and mitochondrial ATP production function [5]. Damage to mitochondrial membrane integrity and sheath function is one of the main characteristics of decreased sperm motility, as part of the energy required for movement is provided by mitochondria [6]. Currently, there are no effective clinical treatments for asthenospermia, and some asthenospermia patients are often treated with drugs combined with traditional Chinese and Western medicine and surgery, but the efficacy of these treatments is not definitive. Many infertile couples have to resort to assisted reproductive techniques, which are expensive and may bring unforeseeable complications (for example, salpingitis, endometriosis, etc.)[7]. Therefore, in-depth research on the regulation and energy mechanism of sperm mitochondrial function may be the key to treating asthenospermia [8\\u0026ndash;10]. Therefore, investigating the role of C9orf72 in the pathogenesis of asthenozoospermia may provide new insights into this condition.\\u003c/p\\u003e \\u003cp\\u003eAutophagy is an important pathway wherein cells rely on lysosomes to degrade proteins and organelles [11,12]. The degradation of mitochondria through autophagy is specifically referred to as mitophagy [13]. Mitophagy regulates the quality and quantity of mitochondria and is thus crucial in maintaining mitochondrial homeostasis [14]. Metabolic disruption mediated by mitophagy is considered one of the main causes of asthenozoospermia [15]. Currently, it is believed that the classical pathways of mitophagy mainly include the PINK1/Parkin pathway and the BNIP3/BNIP3L pathway[14,16].\\u003c/p\\u003e \\u003cp\\u003eIn previous research conducted by our group, it was found that C9orf72 (GenBank ID: NM_028466.2) is significantly overexpressed in seminal extracellular vesicles of asthenospermia patients and may affect the occurrence and development of asthenospermia [17]. C9orf72 is a guanine nucleotide exchange factor, and its GGGGCC repeat expansion is a common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), which has attracted attention from many researchers [18\\u0026ndash;20]. Studies have shown that C9orf72 can regulate the initiation of autophagy by interacting with the Rab1a-ULK1 complex [21], and the C9orf72-SMCR8 complex can also regulate the protein kinase activity of ULK1/ATG1 by interacting with the complex, functioning as a regulator of autophagy initiation [22]. However, the regulation of mitophagy by C9orf72 has not yet been reported. Recent studies have shown that C9orf72, as a mitochondrial membrane-binding protein, regulates energy homeostasis by stabilizing mitochondrial complex I assembly [23]. In addition, C9orf72 is involved in the transport of mitochondrial destruction to the metabolic demand site [24]. Glucose metabolism is crucial for sperm energy production and function, affecting sperm motility [25,26]. However, whether C9orf72 promotes the development of asthenospermia by inhibiting spermatogonia proliferation through mitophagy and glucose metabolism has not been reported. This study aims to investigate the expression of C9orf72 in asthenospermia patients, its impact on spermatogonia proliferation, and whether C9orf72 influences spermatogonia proliferation through mitochondrial autophagy and glucose metabolism. To provide a theoretical basis for a comprehensive understanding of the functional mechanisms through which C9orf72 regulates asthenospermia and for targeted clinical interventions in asthenospermia.\\u003c/p\\u003e\"},{\"header\":\"2. Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1 Subjects\\u003c/h2\\u003e \\u003cp\\u003eThe human semen samples involved in this study were obtained from the Hainan Women and Children's Medical Center. All procedures related to this study complied with the Helsinki Declaration and were approved by the Ethics Committee of the Hainan Women and Children's Medical Center (Approval No. 2021-033). All the subjects of this study were informed of the experimental details and signed informed consent forms. Semen samples were excluded if any of the following parameters were abnormal: fructose level, acid phosphatase level, liquefaction time, pH value, sperm morphology, and α-glucosidase level. Twenty-seven seminal samples with asthenospermia were included in this study, and the inclusion criteria for asthenospermia were as follows: (1) progressive motility less than 32% in two consecutive semen analyses; (2) normal levels of sex hormones, such as follicle-stimulating hormone, testosterone, and estradiol; (3) no abnormalities found on physical examination of the urinary and reproductive systems; and (4) complete medical records and follow-up information. Thirty-one normal control seminal samples were included in this study, and the inclusion criteria for the control group were as follows: (1) progressive motility of semen greater than or equal to 32%; (2) normal levels of sex hormones, such as follicle-stimulating hormone, testosterone, and estradiol; (3) no obvious abnormalities found in the clinical examination indicators; and (4) complete medical records and follow-up information.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2 Immunofluorescence\\u003c/h2\\u003e \\u003cp\\u003eFresh semen samples were collected using a sterile collection tube. The semen was added to a flat-bottomed centrifuge tube containing PBS buffer, mixed gently, and centrifuged at 3000 rpm for 15 min. The supernatant was discarded, and the semen was fixed with a 4% paraformaldehyde solution at room temperature for 30 min. Finally, the fixed semen was evenly spread on a glass slide and air-dried naturally at room temperature or in a 37℃ incubator to prepare semen smears using similar methods for preparing GC-1 spg cell smears. After air-drying and washing with PBS, the semen smears or cell smears were blocked with goat serum for 2 h, followed by incubation with C9orf72 (ab308169, 1: 250), LC3 (ab192890, 1: 250) or TOM20 (ab56783 1: 250) primary antibodies overnight. After washing, the smears were incubated with fluorescent secondary antibodies (Beyotime, anti-rabbit A0516, anti-mouse A0521, 1: 250) at room temperature and finally stained with DAPI nuclear dye (Sigma‒Aldrich, D9542). The fluorescence images were observed and captured using a confocal laser scanning microscope (Leica, TCS SP2).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 Western blot analysis\\u003c/h2\\u003e \\u003cp\\u003eSemen or cells were lysed on ice for 30 min in RIPA cell lysis buffer (Thermo Fisher Scientific, 89900, USA), followed by centrifugation at 12,000 rpm and 4\\u0026deg;C for 15 min to obtain the cell total protein. Protein concentration was measured by the BCA (Thermo Fisher Scientific, 23225, USA) method. Total protein (50 \\u0026micro;g) was separated by 10% SDS‒PAGE (Bio-Rad, 1610184, USA) and transferred onto a PVDF membrane (Millipore, IPVH00010, USA), which was blocked at room temperature with 5% nonfat milk for 2 h. The membrane was probed with C9orf72 (Abcam, ab308169, 1: 500), LC3 (Abcam, ab192890, 1: 2000), p62 (Abcam, ab109012, 1: 10000), BNIP3 (Abcam, ab10433, 2 \\u0026micro;g/ml), PINK1 (Abcam, ab216144, 1: 1000), GLUT1 (Abcam, ab115730, 1: 100000), GLUT3 (Abcam, ab314193, 1: 1000), HK2 (Abcam, ab209847, 1: 1000), LDHA (Abcam, ab52488, 1: 5000) or GAPDH (Abcam, ab8245, 1: 1000) primary antibodies targeting the protein of interest overnight, followed by washing with TBST three times for 10 min each. Then, the membrane was incubated with HRP-conjugated secondary antibodies (Thermo Pierce, 31210, 1:5000) at room temperature for 1 h, followed by washing with TBST three times for 10 min each. ECL reagents (Thermo Fisher, 32106) were used for luminescence detection and imaging, GAPDH expression was used as an internal reference for relative protein expression, and ImageJ software (National Institutes of Health, V1.8.0.112) was used for analysis in normalization.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4 Spermatogonia Cultivation\\u003c/h2\\u003e \\u003cp\\u003eMouse spermatogonia GC-1 spg (ATCC, CRL-2053.) was cultured in 1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin solution (Gibco, 11960-044). The cells were incubated at 37\\u0026deg;C with 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e and 95% air.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5 Lentiviral Construction and Transfection\\u003c/h2\\u003e \\u003cp\\u003eThe mouse C9orf72 gene coding region (CDS, GenBank ID: NM_028466.2) sequence was retrieved from the NCBI database (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.ncbi.nlm.nih.gov/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.ncbi.nlm.nih.gov/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). The full-length C9orf72 coding sequence was synthesized and cloned and inserted into the GV358 lentiviral expression vector (Guangzhou Anernor Biotechnology Co., Ltd, GV358). Then, the lentiviral expression vector, viral envelope, and packaging/helper plasmids were cotransfected into 293T cells using Lipofectamine 3000 (Invitrogen, L3000-015). After 48 hours, the supernatant was collected, concentrated, and purified to obtain C9orf72-overexpressing lentivirus and a negative control lentivirus. GC-1 spg cells were transduced with the lentivirus at a multiplicity of infection (MOI) of 50, assisted by polybrene (GeneChem), and subjected to subsequent experiments after 96 hours.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.6 Real-time quantitative PCR (RT‒qPCR) analysis\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA from the sperm or cells was extracted using TRIzol reagent (Invitrogen, 15596018). The RT‒PCR kit was obtained from Takara (RR036A), and all reagents and consumables used were treated to remove RNase. Total RNA was reverse transcribed into cDNA using reverse transcriptase, SYBR Green was used to detect C9orf72 expression, and GAPDH was used as an internal reference. A fluorescence quantitative PCR assay was performed using a fluorescence quantitative PCR instrument (Agilent Stratagene, Mx3000P). After the reaction, the reaction curve was analyzed to obtain the Ct value. The relative expression value was calculated using the 2-ΔΔct method, and each sample was repeated three times. The PCR conditions were as follows: 95℃ for 2 min, 94℃ for 20 s, 58℃ for 20 s, and 72℃ for 20 s, and 40 cycles were performed. Dissociation curve analysis was performed as follows: 94\\u0026deg;C for 30 s, 65\\u0026deg;C for 30 s, and 94\\u0026deg;C for 30 s. The sequences of primers used were as follows: C9orf72 forward primer (5'-3'): GTTCCGTTGTAGTTGGCAGC; C9orf72 reverse primer (5'-3'): CTTGCACAAAGAGTCCCGAT. GAPDH forward primer (5'-3'): AGAGTGTTTCCTCGTCCCGT; GAPDH reverse primer (5'-3'): GAGGTCAATGAAGGGGTCGT.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.7 CCK8 Assay for Cell Viability\\u003c/h2\\u003e \\u003cp\\u003eLog-phase cells were seeded in a 96-well plate at a density of 5 \\u0026times; 10\\u003csup\\u003e3\\u003c/sup\\u003e cells/well and incubated overnight. CCK-8 reagent (Dojindo, CK04) was added, and the cells were incubated for an additional 6 hours. The OD450 values were measured using a spectrophotometer (Shimadzu, Japan, UV-1900) and analyzed. This process was repeated for five consecutive days, with three independent experiments performed.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.8 Flow Cytometry Detection of Cell Apoptosis\\u003c/h2\\u003e \\u003cp\\u003eAfter digestion, log-phase cells were resuspended in PBS. Cells were stained with an Annexin V/PI apoptosis detection kit (BD Biosciences, 556547) and analyzed using flow cytometry (Becton Dickinson Company, USA, FACSAria) to determine the rate of cell apoptosis. When exploring mitophagy inhibition, transfection for 96 h was followed by treatment with 10 \\u0026micro;M mitophagy inhibitor Mdivi-1 (Sigma‒Aldrich, M0199) for 24 h. The experiment was repeated three times.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.9 JC-1 staining experiment\\u003c/h2\\u003e \\u003cp\\u003eMitochondrial membrane potential was determined using the JC-1ochondrial Membrane Potential Assay Kit (Beyotime, C2003S) according to the manufacturer's instructions. First, the JC-1 staining working solution was prepared. Each 1 ml of JC-1 staining working solution contained 5 \\u0026micro;l of JC-1(200X). The spermatogonium was added to a flat-bottomed centrifuge tube containing PBS buffer, mixed gently, and centrifuged at 3000 rpm for 15 min. Add 0.5 ml of JC-1 staining working solution, invert several times to mix, and then incubate at 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e and 37\\u0026deg;C for 20 min. After the incubation period, the sample was centrifuged again at 3000 rpm for 15 min. The supernat discarded, followed by washing twice with JC-1 staining buffer. Finally, resuspend in an appropriate amount of JC-1 staining buffer and observe with a laser confocal microscope(Leica, TCS SP2) for fluorescence observation and result analysis. When detecting JC-1 monomers, the excitation wavelength was set at 490 nm and the emission wavelength was set at 530 nm. When detecting JC-1 polymers, the excitation wavelength was set at 525 nm and the emission wavelength was set at 590 nm. Green fluorescence indicates decreased mitochondrial membrane potential and red fluorescence indicates normal mitochondrial membrane potential.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.10 Mitochondrial Fluorescence Labeling Experiment\\u003c/h2\\u003e \\u003cp\\u003eA solution of Mito-Tracker Red CMXRos mitochondrial red fluorescent probe (Beyotime, C1035) was mixed with 420 \\u0026micro;l of anhydrous DMS to obtain a 200 \\u0026micro;M storage solution. Then, 1 \\u0026micro;l of the 200 \\u0026micro;M storage solution was added to 1 ml of culture medium, which after thorough mixing yielded a 200 nM working solution. When cell growth reached 50%-60%, the culture medium was removed, and the cells were incubated with the pre-warmed working solution at 37℃ for 30 min. Upon successful incubation, the cells were fixed following the same method as used in immunofluorescence procedures. 5 \\u0026micro;g/ml Tubulin primary antibody (Abcam, ab7291) was added and incubated overnight at 4℃. After washing with PBS, an appropriately diluted fluorescent secondary antibody (Beyotime, anti-rabbit A0516, anti-mouse A0521, 1: 250) was added and incubated for 1 hour at room temperature in the dark. The cells were then washed three times with PBS. DAPI was added and incubated in the dark for 5 min for nuclear staining, followed by washing with PBS to remove excess DAPI. Finally, the fluorescence images were observed and captured using a confocal laser scanning microscope (Leica, TCS SP2).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.11 ROS assay\\u003c/h2\\u003e \\u003cp\\u003eTo assess ROS levels via flow cytometry, cells were first harvested and counted, adjusting the cell density to 1x10\\u003csup\\u003e6\\u003c/sup\\u003e cells/mL. The cells were then incubated with 10 \\u0026micro;M DCFH-DA (2',7'-dichlorofluorescein diacetate) from the ROS Assay Kit (Beyotime, S0033) for 20 min at 37\\u0026deg;C in a humidified 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e atmosphere. After incubation, the cells were washed twice with ice-cold PBS by centrifugation at 300 x g for 5 min to remove excess dye. Subsequently, the cells were resuspended in PBS, and their fluorescence intensity was immediately measured using a flow cytometer (Becton Dickinson Company, USA, FACSAria) equipped with a 488 nm excitation laser and a 530 nm bandpass filter.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.12 Cell Glucose Content Detection\\u003c/h2\\u003e \\u003cp\\u003eTo determine the cellular glucose levels, cells were first harvested and counted, adjusting the cell density to 1x10\\u003csup\\u003e6\\u003c/sup\\u003e cells/mL. At 0 and 24 hours, the cells were then washed twice with ice-cold PBS by centrifugation at 300 x g for 5 min and lysed using the glucose assay buffer provided in the Glucose Uptake Assay Kit (BioVision, K606-100). The lysates were clarified by centrifugation at 10,000 x g for 5 min at 4\\u0026deg;C, and the supernatants were collected for analysis. Subsequently, the samples were loaded into a 96-well plate, and the assay reagents from the kit were added according to the manufacturer's instructions. After a designated incubation time, the absorbance was measured using a spectrophotometer (Shimadzu Corporation, Japan, UV-1900) at 412 nm, and the corresponding glucose concentration was calculated based on the standard curve.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.13 Statistical Analysis\\u003c/h2\\u003e \\u003cp\\u003eGraphPad Prism software (GraphPad Software, USA, v9.0) was employed for statistical analysis and data visualization through plotting. Data are presented as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation (mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SD). Pearson's correlation coefficient was used to analyze the relationships between variables. Differences among multiple groups were assessed using ordinary one-way ANOVA, while differences in multiple indicators across various groups were examined with two-way ANOVA. A \\u003cem\\u003ep\\u003c/em\\u003e value\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered statistically significant.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.1 C9orf72 is significantly upregulated in asthenozoospermic semen and negatively associated with sperm progressive motility\\u003c/h2\\u003e \\u003cp\\u003eWe collected semen samples from 27 patients with asthenospermia and 31 healthy males for our study. Immunofluorescence was conducted to observe the protein expression of C9orf72 in the two groups separately. The results demonstrated that the expression of C9orf72 was significantly higher in the asthenospermic group than in the normal group, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA. Western blot analysis was performed to detect the protein expression of C9orf72, and the differences in C9orf72 protein expression between groups were analyzed along with the correlation with progressive motility rate (last recorded value). The Western blot results revealed a significantly higher relative expression of C9orf72 protein in the asthenospermic group than in the normal group (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001), as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB. Correlation analysis indicated a significant negative correlation between C9orf72 protein expression and the progressive motility rate (r=-0.9126, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001), as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.2 Overexpression of C9orf72 Inhibits Proliferation in Spermatogonia\\u003c/h2\\u003e \\u003cp\\u003eThe GC-1 spg line was derived from mouse spermatogonia. After transfecting GC-1 spg cells with C9orf72-overexpressing lentivirus and a negative control, C9orf72 mRNA expression was detected by RT‒PCR, C9orf72 protein expression was assessed by Western blotting, cell viability changes were evaluated using the CCK8 assay, and alterations in cell apoptosis and ROS levels were examined by flow cytometry. The results showed that, compared to the negative control group (NC), the relative expression of C9orf72 mRNA in the C9orf72-overexpressing lentivirus-transfected group (C9orf72) was significantly increased (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA), as was the relative expression of C9orf72 protein (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, as shown in Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB and \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC). Moreover, cell viability was significantly reduced (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD), and both the rate of cell apoptosis (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE) and ROS levels (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eF) were significantly elevated.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.3 Overexpression of C9orf72 Enhances Mitophagy in Spermatogonia.\\u003c/h2\\u003e \\u003cp\\u003eFollowing transfection of GC-1 spg cells with C9orf72-overexpressing lentivirus and negative control, mitochondrial membrane potential changes were observed after JC-1 staining. Tubulin-labeled cytoskeleton and MitoTracker Red CMXRos-labeled mitochondria were used to visualize mitochondrial alterations. Autophagosomes labeled with LC-3 and MitoTracker Red CMXRos-labeled mitochondria were employed to observe colocalization and quantity changes of autophagosomes and mitochondria. Western blotting was performed to detect the expression of mitophagy-related proteins (LC3, p62, PINK1 and BNIP3). The results showed that in the C9orf72-overexpressing lentivirus-transfected group (C9orf72), compared to the negative control group (NC), the amount of JC-1 monomers (green) increased and JC-1 aggregates (red) decreased, indicating a reduction in mitochondrial membrane potential (as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA); Simultaneously, the number of MitoTracker Red CMXRos-labeled mitochondria (red) decreased (as shown in Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB and \\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA), while the level of LC-3-labeled autophagy (green) increased, and autophagosomes colocalized with mitochondria (as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). Additionally, the ratio of LC3Ⅱ/Ⅰ (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001), PINK1 (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001), and BNIP3 (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) protein expression in the C9orf72 group was significantly elevated relative to that in the NC group, and p62 protein expression was significantly reduced (p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) (as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB). In summary, overexpression of C9orf72 decreased mitochondrial membrane potential, reduced mitochondrial number, increased autophagosome formation, induced autophagosome colocalization with mitochondria, and increased the expression of mitochondrial autophagy-related proteins in GC-1 spg, indicating enhanced mitophagy.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.4 Overexpression of C9orf72 Impairs Glucose Energy Metabolism in Spermatogonia.\\u003c/h2\\u003e \\u003cp\\u003eAfter transfecting GC-1 spg cells with C9orf72-overexpressing lentivirus and negative control, glucose concentrations at 0 and 24 h were measured, and the expression of glucose energy metabolism-related proteins was assessed by Western blotting. The results showed that compared to that in the negative control group (NC), the glucose concentration at 24 h in the C9orf72-overexpressing lentivirus-transfected group (C9orf72) was significantly decreased (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA), indicating a significant increase in glucose uptake at 24 h (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB). Concurrently, the protein expression levels of GLUT1 (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001), GLUT3 (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001), HK2 (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001), and LDHA (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) were significantly reduced in the C9orf72 group (as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.5 Mitophagy Inhibitor Reverse Apoptosis Induced by C9orf72 Overexpression.\\u003c/h2\\u003e \\u003cp\\u003eFollowing transfection of GC-1 spg cells with C9orf72-overexpressing lentivirus and a negative control lentivirus, the cells overexpressing C9orf72 were treated with the mitophagy inhibitor Mdivi-1. The results revealed that, compared to the negative control group (NC), the apoptotic rate significantly increased in the C9orf72-overexpressing lentivirus-transfected group (C9orf72) (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001), consistent with previous research. Moreover, relative to the C9orf72 group, the apoptotic rate was significantly reduced in the C9orf72-overexpressing cells treated with the mitophagy inhibitor Mdivi-1 (C9orf72\\u0026thinsp;+\\u0026thinsp;Mdivi-1) (\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001), as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e. These findings suggest that Mdivi-1, a mitophagy inhibitor, can partially reverse the proapoptotic effects of C9orf72 on GC-1 spg cells.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eAsthenozoospermia, also known as weak sperm motility, is a common etiology of male infertility[27]. The pathogenesis of asthenozoospermia is complex and multifactorial. It involves various biological pathways that regulate sperm production, function, and quality[28]. According to the diagnostic criteria of asthenozoospermia, the percentage of progressive motility (PR) is less than 32%, while other parameters remain normal[29]. Therefore, progressive motility is a critical indicator of this condition. Our study demonstrated that C9orf72 was significantly upregulated in the semen of patients with asthenozoospermia and negatively correlated with progressive motility. These findings suggest that C9orf72 may be a pivotal molecule that promotes asthenozoospermia, as its overexpression impairs the forward motility of sperm, which may be a key factor in the pathogenesis of this condition. Previous studies have shown that the overexpression of C9orf72 may play a critical role in nonobstructive azoospermia[30]. To the best of our knowledge, this is the first report of the association between C9orf72 and asthenozoospermia, suggesting that C9orf72 may be involved in the pathogenesis and progression of asthenozoospermia.\\u003c/p\\u003e \\u003cp\\u003eSpermatogonia are precursor cells of sperm that undergo a series of growth, differentiation, and maturation processes in the testes before developing into mature sperm with reproductive potential[31]. During the developmental process of spermatogonia, their morphology, function, and quantity are controlled by various biological and metabolic factors, including testicular hormones, DNA damage repair, mitochondrial function, and autophagy[32,33]. The proliferation, apoptosis, and differentiation of spermatogonia can impact sperm vitality and ultimately contribute to the development of asthenozoospermia[34]. Studies have shown that Cuscuta chinensis Lam. and Lycium barbarum L. can decrease the proportion of GC-1 spg cells in S phase, increase mitochondrial membrane potential, significantly reduce cell apoptosis, and improve sperm quantity and survival rates, suggesting that this may be one of their mechanisms for treating asthenozoospermia[35]. In this study, we found that overexpression of C9orf72 inhibited the proliferation of GC-1 spg cells and promoted their apoptosis and ROS levels. Increased intracellular levels of ROS indicate that the cells are under stress, oxidative imbalance, or metabolic disorders (such as hypoxia or energy deficiency) [36,37]. This finding is consistent with our subsequent discovery that C9orf72 overexpression promotes mitophagy and inhibits glucose metabolism. The overexpression of C9orf72 inhibits spermatogonia proliferation, potentially constituting a pivotal mechanism through which C9orf72 contributes to asthenozoospermia.\\u003c/p\\u003e \\u003cp\\u003eMitochondrial function and intact mitochondrial membrane potential are necessary for sperm motility, hyperactivation, energy acquisition, acrosome reaction, and preservation of DNA integrity [38,39]. Therefore, optimal mitochondrial activity is crucial for human sperm function and semen quality, and defects in sperm mitochondrial function can severely impair the energy production required for maintaining sperm motility, which may be one of the fundamental causes of asthenozoospermia [9]. Studies have shown that C9orf72 can regulate autophagy initiation by interacting with the Rab1a-ULK1 complex [21]. Research has shown that Qiangjing tablets ameliorate mouse asthenozoospermia via mitochondrial ubiquitination and mitophagy mediated by LKB1/AMPK/ULK1 signaling[40]. However, there are currently no studies on the regulation of mitophagy by C9orf72. In this study, we found that C9orf72 overexpression promoted mitophagy in spermatogonia (GC-1 spg), leading to decreased mitochondrial membrane potential and mitochondrial quantity. Research has demonstrated the significant role of mitochondrial homeostasis in influencing sperm vitality [15]. While the role of mitophagy in either promoting or inhibiting proliferation remains equivocal, varying regulatory mechanisms may exist among different cell types; nonetheless, mitophagy is widely acknowledged as one of the mechanisms governing proliferation [41,42]. This suggests that the promotion of mitophagy may be one of the key mechanisms through which C9orf72 inhibits spermatogonia proliferation. Moreover, we also found that the mitophagy inhibitor Mdivi-1 could reverse C9orf72 overexpression-induced GC-1 spg cell apoptosis, suggesting that Mdivi-1 may be applied in the treatment of asthenozoospermia induced by C9orf72 overexpression, which requires further research to confirm.\\u003c/p\\u003e \\u003cp\\u003eMitochondria serve as the primary cellular organelle for glucose metabolism and ATP generation, with mitophagy influencing alterations in intracellular glucose metabolism [43]. Glucose-derived ATP functions as an energy source for spermatozoa in a myriad of cellular processes, encompassing cellular competence, motility, hyperactivation, acrosome reaction, and maintenance of the intracellular milieu [44]. Our results showed that overexpression of C9orf72 in GC-1 spg cells led to a decrease in the expression of glucose transporters (GLUT1 and GLUT3), as well as a decrease in the expression of key enzymes involved in glucose metabolism, such as hexokinase 2 (HK2) and lactate dehydrogenase A (LDHA). Additionally, we observed a decrease in the concentration of glucose in the media of cells overexpressing C9orf72. These findings suggest that C9orf72 may play a role in the regulation of glucose metabolism and that its regulation may contribute to the development of asthenozoospermia.\\u003c/p\\u003e\"},{\"header\":\"5. Conclusions\",\"content\":\"\\u003cp\\u003eOur study demonstrates that C9orf72 is significantly overexpressed in semen samples from patients with asthenozoospermia and negatively correlated with sperm forward motility. C9orf72 overexpression inhibits the proliferation of GC-1 spg spermatogonia, and its mechanism may be related to the promotion of mitophagy and inhibition of glucose metabolism, which may represent a new regulatory mechanism underlying asthenozoospermia.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003cstrong\\u003e：\\u003c/strong\\u003eThe human semen samples involved in this study were obtained from the Hainan Women and Children\\u0026apos;s Medical Center. All procedures related to this study complied with the Helsinki Declaration and were approved by the Ethics Committee of the Hainan Women and Children\\u0026apos;s Medical Center (Approval No. 2021-033).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003cstrong\\u003e：\\u003c/strong\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003cstrong\\u003e：\\u003c/strong\\u003eAll data generated or analysed during this study are included in this published article (and its supplementary information files).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003cstrong\\u003e：\\u003c/strong\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding:\\u0026nbsp;\\u003c/strong\\u003eThis work was supported by the Hainan Provincial Natural Science Foundation (822RC857) and the Key R\\u0026amp;D Program of Hainan Province (ZDYF2023SHFZ093).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors\\u0026apos; contributions:\\u003c/strong\\u003e L.H and X.D.C performed cell testing, both of them were \\u0026nbsp;major contributors in writing the manuscript and data analysis. Z.L.Q performed cell culture and material procurement. R.H.L performed mitophagy detection. W.A.G performed western blot detection. L.Y.J performed glucose metabolism detection. L.W.Y performed cell apoptosis assay and was responsible for the revision of the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements:\\u003c/strong\\u003e We would like to express our gratitude to the Natural Science Foundation of Hainan Province (822RC857) and the Key R\\u0026amp;D Program of Hainan Province (ZDYF2023SHFZ093) for providing research funding to this study.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eKrausz C, et al. Genetics of male infertility. Nat Rev Urol, 2018, 15(6): 369\\u0026ndash;384.doi:10.1038/s41585-018-0003-3\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eEsteves S C. Evolution of the World Health Organization semen analysis manual: where are we? Nature reviews. Urology, 2022, 19(7): 439\\u0026ndash;446.doi:10.1038/s41585-022-00593-2\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eWang C, et al. Evolution of the WHO \\u0026quot;Semen\\u0026quot; processing manual from the first (1980) to the sixth edition (2021). Fertility and sterility, 2022, 117(2): 237\\u0026ndash;245.doi:10.1016/j.fertnstert.2021.11.037\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eMinhas S, et al. European Association of Urology Guidelines on Male Sexual and Reproductive Health: 2021 Update on Male Infertility. European urology, 2021, 80(5): 603\\u0026ndash;620.doi:10.1016/j.eururo.2021.08.014\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eShahrokhi S Z, et al. Asthenozoospermia: Cellular and molecular contributing factors and treatment strategies. Andrologia, 2020, 52(2): e13463.doi:10.1111/and.13463\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eDu Plessis S S, et al. Oxidative phosphorylation versus glycolysis: what fuel do spermatozoa use? Asian J Androl, 2015, 17(2): 230-5.doi:10.4103/1008-682x.135123\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eKiani A K, et al. Complications related to in vitro reproductive techniques support the implementation of natural procreative technologies. Acta bio-medica : Atenei Parmensis, 2020, 91(13-s): e2020018.doi:10.23750/abm.v91i13-S.10525\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eVertika S, et al. Mitochondria, spermatogenesis, and male infertility - An update. Mitochondrion, 2020, 54: 26\\u0026ndash;40.doi:10.1016/j.mito.2020.06.003\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eDurairajanayagam D, et al. Causes and consequences of sperm mitochondrial dysfunction. Andrologia, 2021, 53(1): e13666.doi:10.1111/and.13666\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eBarbagallo F, et al. Evaluation of Sperm Mitochondrial Function: A Key Organelle for Sperm Motility. J Clin Med, 2020, 9(2).doi:10.3390/jcm9020363\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eKlionsky D J, et al. Autophagy in major human diseases. The EMBO journal, 2021, 40(19): e108863.doi:10.15252/embj.2021108863\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eGalluzzi L, et al. Autophagy-Independent Functions of the Autophagy Machinery. Cell, 2019, 177(7): 1682\\u0026ndash;1699.doi:10.1016/j.cell.2019.05.026\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eDoblado L, et al. Mitophagy in Human Diseases. International journal of molecular sciences, 2021, 22(8).doi:10.3390/ijms22083903\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eOnishi M, et al. Molecular mechanisms and physiological functions of mitophagy. The EMBO journal, 2021, 40(3): e104705.doi:10.15252/embj.2020104705\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eGupta S, et al. Estrogen-related receptor is critical for testicular mitochondrial homeostasis and sperm motility: a Drosophila-based study. F\\u0026amp;S science, 2022, 3(3): 217\\u0026ndash;227.doi:10.1016/j.xfss.2022.02.003\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eKillackey S A, et al. Mitophagy pathways in health and disease. J. Cell Biol., 2020, 219(11).doi:10.1083/jcb.202004029\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eLu H, et al. RNA-sequencing and bioinformatics analysis of long noncoding RNAs and mRNAs in the asthenozoospermia. Bioscience reports, 2020, 40(7).doi:10.1042/bsr20194041\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eBalendra R, et al. C9orf72-mediated ALS and FTD: multiple pathways to disease. Nat. Rev. Neurol., 2018, 14(9): 544\\u0026ndash;558.doi:10.1038/s41582-018-0047-2\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eSmeyers J, et al. C9ORF72: What It Is, What It Does, and Why It Matters. Front. Cell. Neurosci., 2021, 15: 661447.doi:10.3389/fncel.2021.661447\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003ePang W, et al. Cellular and physiological functions of C9ORF72 and implications for ALS/FTD. J. Neurochem., 2021, 157(3): 334\\u0026ndash;350.doi:10.1111/jnc.15255\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eWebster C P, et al. The C9orf72 protein interacts with Rab1a and the ULK1 complex to regulate initiation of autophagy. EMBO J., 2016, 35(15): 1656-76.doi:10.15252/embj.201694401\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eYang M, et al. A C9ORF72/SMCR8-containing complex regulates ULK1 and plays a dual role in autophagy. Sci Adv, 2016, 2(9): e1601167.doi:10.1126/sciadv.1601167\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eWang T, et al. C9orf72 regulates energy homeostasis by stabilizing mitochondrial complex I assembly. Cell Metab., 2021, 33(3): 531\\u0026ndash;546.e9.doi:10.1016/j.cmet.2021.01.005\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eOakes J A, et al. TBK1: a new player in ALS linking autophagy and neuroinflammation. Mol. Brain, 2017, 10(1): 5.doi:10.1186/s13041-017-0287-x\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eHsiao C H, et al. Mesenchymal stem cells restore the sperm motility from testicular torsion-detorsion injury by regulation of glucose metabolism in sperm. Stem cell research \\u0026amp; therapy, 2019, 10(1): 270.doi:10.1186/s13287-019-1351-5\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eNumata S, et al. The sodium-glucose cotransporter isoform 1 (SGLT-1) is important for sperm energetics, motility, and fertility\\u0026dagger;. Biology of reproduction, 2022, 106(6): 1206\\u0026ndash;1217.doi:10.1093/biolre/ioac052\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eQu R, et al. ADGB variants cause asthenozoospermia and male infertility. Hum. Genet., 2023, 142(6): 735\\u0026ndash;748.doi:10.1007/s00439-023-02546-0\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eTu C, et al. Genetic underpinnings of asthenozoospermia. Best Pract. Res. Clin. Endocrinol. Metab., 2020, 34(6): 101472.doi:10.1016/j.beem.2020.101472\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eCarson S A, et al. Diagnosis and Management of Infertility: A Review. Jama, 2021, 326(1): 65\\u0026ndash;76.doi:10.1001/jama.2021.4788\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eLuo X, et al. Identification of biomarkers associated with macrophage infiltration in non-obstructive azoospermia using single-cell transcriptomic and microarray data. Annals of translational medicine, 2023, 11(2): 55.doi:10.21037/atm-22-5601\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eSaitou M, et al. Mammalian in vitro gametogenesis. Science, 2021, 374(6563): eaaz6830.doi:10.1126/science.aaz6830\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eWang M, et al. Autophagy: a multifaceted player in the fate of sperm. Hum. Reprod. Update, 2022, 28(2): 200\\u0026ndash;231.doi:10.1093/humupd/dmab043\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eRajender S, et al. Epigenetics, spermatogenesis and male infertility. Mutat. Res., 2011, 727(3): 62\\u0026ndash;71.doi:10.1016/j.mrrev.2011.04.002\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eOlawuyi T S, et al. Histomorphometric evaluation of seminiferous tubules and stereological assessment of germ cells in testes following administration of aqueous leaf-extract of Lawsonia inermis on aluminium-induced oxidative stress in adult Wistar rats. JBRA assisted reproduction, 2019, 23(1): 24\\u0026ndash;32.doi:10.5935/1518-0557.20180080\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eWang J, et al. To study the mechanism of Cuscuta chinensis Lam. And Lycium barbarum L. in the treatment of asthenospermia based on network pharmacology. J. Ethnopharmacol., 2021, 270: 113790.doi:10.1016/j.jep.2021.113790\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eSchieber M, et al. ROS function in redox signaling and oxidative stress. Curr. Biol., 2014, 24(10): R453-62.doi:10.1016/j.cub.2014.03.034\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eRani V, et al. Oxidative stress and metabolic disorders: Pathogenesis and therapeutic strategies. Life Sci., 2016, 148: 183\\u0026thinsp;\\u0026minus;\\u0026thinsp;93.doi:10.1016/j.lfs.2016.02.002\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eMeyers S, et al. Sperm mitochondrial regulation in motility and fertility in horses. Reprod Domest Anim, 2019, 54 Suppl 3: 22\\u0026ndash;28.doi:10.1111/rda.13461\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eBulkeley E A, et al. Effects from disruption of mitochondrial electron transport chain function on bull sperm motility. Theriogenology, 2021, 176: 63\\u0026ndash;72.doi:10.1016/j.theriogenology.2021.09.015\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eLi G, et al. Qiangjing tablets ameliorate asthenozoospermia via mitochondrial ubiquitination and mitophagy mediated by LKB1/AMPK/ULK1 signaling. Pharmaceutical biology, 2023, 61(1): 271\\u0026ndash;280.doi:10.1080/13880209.2023.2168021\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eHe L, et al. PINK1/Parkin-mediated mitophagy promotes apelin-13-induced vascular smooth muscle cell proliferation by AMPK\\u0026alpha; and exacerbates atherosclerotic lesions. Journal of cellular physiology, 2019, 234(6): 8668\\u0026ndash;8682.doi:10.1002/jcp.27527\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eBoyle K A, et al. Mitochondria-targeted drugs stimulate mitophagy and abrogate colon cancer cell proliferation. The Journal of biological chemistry, 2018, 293(38): 14891\\u0026ndash;14904.doi:10.1074/jbc.RA117.001469\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eMiyazaki N, et al. PINK1-dependent and Parkin-independent mitophagy is involved in reprogramming of glycometabolism in pancreatic cancer cells. Biochem. Biophys. Res. Commun., 2022, 625: 167\\u0026ndash;173.doi:10.1016/j.bbrc.2022.08.004\\u003c/span\\u003e\\u003c/li\\u003e\\n \\u003cli\\u003e\\u003cspan\\u003eMukai C, et al. What sperm can teach us about energy production. Reprod Domest Anim, 2012, 47 Suppl 4(0 4): 164-9.doi:10.1111/j.1439-0531.2012.02071.x\\u003c/span\\u003e\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Asthenozoospermia, Spermatogonial, Proliferation, Mitophagy, Glucose metabolism\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3351258/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3351258/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eThe role of the C9orf72 gene in sperm function and asthenozoospermia remains unclear. This study aimed to investigate whether the expression of C9orf72 was abnormal in patients with asthenozoospermia and its effects on spermatogonia proliferation.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e \\u003cp\\u003eSemen samples were collected from 27 men with asthenozoospermia and 31 normal men. Immunofluorescence and Western blotting were employed to detect the protein expression of C9orf72 in semen samples. Mouse spermatogonia (GC-1 spg) transfected with C9orf72-overexpressing lentivirus were assessed for cell viability, apoptosis, ROS levels, mitochondrial membrane potential changes, colocalization between autophagosomes and mitochondria, glucose content and glucose energy metabolism-related protein expression. The effect of the mitophagy inhibitor Mdivi-1 on C9orf72-induced apoptosis in GC-1 spg cells was investigated.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eThe results showed that the C9orf72 protein was significantly upregulated in asthenozoospermic semen samples and negatively correlated with sperm progressive motility. Overexpression of C9orf72 inhibited proliferation, increased apoptosis, and elevated ROS levels in GC-1 spg cells. Enhanced mitophagy was observed in C9orf72-overexpressing cells, as indicated by mitochondrial membrane potential reduction, decreased MitoTracker Red CMXRos-labeled mitochondria, and increased LC-3-labeled autophagy. Moreover, glucose energy metabolism was impaired in C9orf72-overexpressing cells, with decreased glucose uptake and reduced protein expression of GLUT1, GLUT3, HK2 and LDHA. The mitophagy inhibitor Mdivi-1 partially reversed C9orf72-induced apoptosis in GC-1 spg cells.\\u003c/p\\u003e\\u003ch2\\u003eConclusions\\u003c/h2\\u003e \\u003cp\\u003eThis study demonstrates that C9orf72 is significantly overexpressed in asthenozoospermic semen samples and negatively correlated with sperm progressive motility. C9orf72 overexpression inhibits spermatogonia proliferation, and the mechanism by which it inhibits the proliferation of spermatogonia may be through promoting mitophagy and inhibiting glucose metabolism, representing a potential regulatory mechanism underlying asthenozoospermia.\\u003c/p\\u003e\",\"manuscriptTitle\":\"C9orf72 Overexpression in Asthenozoospermia: Implications for Spermatogonia Proliferation through mitophagy and glucose metabolism\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2023-10-05 15:28:25\",\"doi\":\"10.21203/rs.3.rs-3351258/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"eeca4070-8caf-4fa1-abf6-8e3edaa3b135\",\"owner\":[],\"postedDate\":\"October 5th, 2023\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2023-10-30T08:29:11+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2023-10-05 15:28:25\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3351258\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3351258\",\"identity\":\"rs-3351258\",\"version\":[\"v1\"]},\"buildId\":\"WrCJVZZCHTDjtuVLN7oU0\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}