{"paper_id":"266f56fc-c8af-41b0-a44e-a541adb9a94f","body_text":"Isolation, Partial Purification and Characterization of a Novel Restriction Enzyme from Pseudomonas Anguilliseptica | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Isolation, Partial Purification and Characterization of a Novel Restriction Enzyme from Pseudomonas Anguilliseptica Swarna Nirosha Jayasinghe Pathirana, Don Anushka Sandaruwan Elvitigala, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-600889/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Type II restriction enzymes (REs) which can cleave double stranded DNA in a sequence specific manner have many applications in recombinant DNA technology and are considered the work horses of molecular biology. Soil and water samples were screened for isolation of bacteria, harboring restriction enzymes. Cell lysates of isolated bacteria were incubated with unmethylated λ DNA, followed by analysis by agarose gel electrophoresis. The presence of distinct banding patterns indicated the presence of REs. Nine putative isolates harboring REs were morphologically and molecularly characterized using 16S rRNA analysis and belonged to four different genera ( Acinetobacter, Lysinibacillus, Pseudomonas, and Brevibacillus ). A Hin dIII like restriction digestion profile was observed in a lysate of a soil bacterium belonging to genus Pseudomonas . Based on 16S rRNA analysis, the bacterial species was identified as P. angulliseptica. The enzyme was partially purified and optimum conditions for enzyme activity and its recognition sequence were determined. The enzyme showed optimum activity at 40 0 C and was stable at 40 ° C for 20 minutes without the DNA substrate. The Recognition sequence of the enzyme was determined and found to be 5’AAGCT 3’ indicating it to be an isoschizomer of Hin dIII. The whole genome of the Pseudomonas species was sequenced and the coding sequence of the gene for the putative Hin dIII isoschizomer was identified together with other genes encoding putative REs. The gene coding for the Hin dIII isoschizomer was analyzed in silico and its homology and evolutionary relationship to other known isoschizomers of Hin dIII were determined. The enzyme was tentatively designated as Pan I. General Microbiology Restriction Enzymes HindIII Isoschizomer Pseudomonas angulliseptica Whole-genome sequencing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1.0 Introduction All living organisms face the challenge of survival and threats posed by their pathogens. Bacteria exert different mechanisms for their survival, one of which is driven by ‘restriction enzymes’ (REs) or ‘restriction endonucleases’ (REases) which represent a type of bacterial immune system, dedicated to shielding them from phage attack. REs restricts growth of phages by cleaving double-stranded phage DNA at precise nucleotide positions. Methyltransferases (MTases) modify bacterial DNA at sequences recognized by REases to prevent self-cleavage of its own genome. Collectively, these two enzymes form the “restriction-modification (R-M) system” in bacteria (Williams 2003 ). The recognition sites of REases generally contain variable numbers of base pairs (four, six or eight) (Wilson and Murray 1991 ). There are four major types of REs, namely, type I, II, III and IV, categorized according to their structure, recognition site, cleavage site, cofactor(s), and activator(s) (Williams 2003 ; Sistla and Rao 2004 ; Loenen et al. 2014b ). While they have the ability to cleave double-stranded DNA in a sequence-specific manner, irrespective of the source of DNA; with the advent of recombinant DNA technology, extensive research is being carried out worldwide for isolation, purification, and characterization of novel REs. Current trends in restriction enzyme research encompass the use of protein engineering and fusions to produce enzymes with novel endonuclease activities (Di Felice et al. 2019 ). Type II REs represent the highest number of characterized REs to date. Over 300 Type II REs, with > 200 dissimilar sequence-specificities, are commercially available (Loenen et al. 2014b , a ). These constitute a very diverse group of proteins in terms of size and amino acid sequence, organization of the domains and protein subunit composition, co-factor requirement for enzymatic activity and reaction mechanisms (Pingoud et al. 2005 ; Loenen et al. 2014a ). Type II REs are fundamental tools in DNA manipulation and play an important role in genetic engineering and molecular biology (Williams 2003 ), because they have the ability to cleave DNA at defined positions close to or within their recognition sequences producing distinct reproducible banding patterns on agarose gels (Roberts 1976 ). Generally, they identify short, palindromic, 4–8 base pair (bp) sequences (Pingoud and Jeltsch 2001 ; Pingoud et al. 2014 ) and cleave DNA in the presence of Mg 2+ . Type II REases are the most commonly used group of enzymes in laboratories for gene cloning, DNA analysis, library preparation, diagnostic purposes, etc. Their sizes range from 250–350 amino acids and are the simplest and smallest among the REases. REases that identify the same DNA sequence, irrespective of the site at which they cleave the DNA are designated as ‘isoschizomers’(Pingoud et al. 2014 ), while the first enzyme which revealed the recognition sequence is known as the prototype. Among the type II REases, the enzyme Hin d III was isolated from the bacterium Haemophilus influenzae , serotype d (Pingoud et al. 2014 ) and is used extensively in genetic engineering and molecular biology. Isoschizomers of Hin d III REase reported to date are listed in the REBASE database (Kazennova et al. 1982 ; Mise and Nakajima 1984 ). In this study, an isolate of Pseudomonas anguilliseptica was identified from a soil sample and was found to produce an isoschizomer of Hin dIII. The enzyme was extracted from the bacterium, partially purified, functionally characterized and tentatively designated as Pan I. Furthermore, through whole-genome sequencing the putative gene encoding the enzyme was identified and molecularly characterized using different in-silico tools. 2.0 Materials And Methods 2.1 Sample collection, Isolation of bacteria from soil samples, Screening isolated bacteria for REs and Characterization of restriction enzyme-producing bacteria. Soil samples were collected using sterile 50 mL conical tubes from different regions of the country, transported to the laboratory and stored at 4 0 C to isolate bacteria. One gram of each soil sample was vigorously mixed with 5 mL of sterile PBS (1X: 137 mM NaCl, 2.7 mM KCl, 8 mM Na 2 HPO 4 , and 2 mM KH 2 PO 4 ) separately and a 100 µL aliquot was serially diluted (10 − 1 to 10 − 10 ) using PBS. An aliquot (100 µL) from each dilution was spread on Luria-Bertani (LB) agar plates and incubated at 37 0 C, and observed daily for a week. Well-isolated colonies were picked for screening. Well isolated colonies were separately inoculated into 5 mL LB broth and grown overnight. The cultures were then centrifuged at 3500 rpm for 30 minutes and cell pellets were washed with TME buffer (50 mM Tris-HCl, 20 mM MgCl 2 and 0.1 mM EDTA, pH 7.5) and then centrifuged again using the same conditions. Cell pellets were then re-suspended in 500 µL of TME buffer along with 0.5µL of β-mercaptoethanol. The cell suspensions were then disrupted by cold sonication (3x 2second pulses with 15 second intervals in between) and then centrifuged (18000 g /3 min/ 4°C) followed by careful separation of the supernatant. The supernatant of each cell lysate was then screened for REs as follows; A 30 µL of reaction mixture (digestion mixture) containing 5.0 µL of cell lysate, 1X Multicore (MC) buffer (Promega), 0.5 µg of un-methylated λ DNA and deionized water was incubated at 37ºC for 3 h. Aliquots (15 µL) from the above reaction mixtures were electrophoresed on a 0.8% agarose gel and visualized under a UV trans-illuminator for the presence of distinct banding patterns. Several isolates displayed distinct DNA banding patterns on agarose gel electrophoresis. The colony and cellular morphology, including shape, height, margin, surface refraction, opacity and color of the bacterial colony was observed as described elsewhere. (Bhumbla and Bhumbla 2018 ). An isolate designated ‘MatS1’ was selected for further analysis. The MatS1 isolate was molecularly identified at the species level using 16S rRNA gene sequence analysis by employing the universal primers (RNABR1 – AGAGTTTGATCCTGGCTCAG and RNABR2- AAGGAGGTGATCCAGCC) in a standard PCR amplification reaction (Weisburg et al. 1991 ) followed by sequence verification of the amplicon. 2.2 Partial purification of MatS1 lysate, Determination of the recognition sequence, Endonuclease activity assays, Enzyme activity in commercially available buffers, Determination of optimum temperature, Thermal stability of the partially purified enzyme. Partial purification of MatS1 by size exclusion filtration was carried out using molecular weight cut-off filters (Vivaspin 6 – Sigma-Aldrich) according to the manufacturer’s instructions. Briefly, a cell free lysate of MatS1 was prepared as described above for screening (Sect. 2.3 ) and 2 mL was filtered through a 50 kDa molecular weight cut off filter and the enzyme activity of the retentate and filtrate determined. The filtrate was then passed through 30 kDa molecular weight cut off filter and enzyme activity were assayed in both the filtrate and retentate. To determine the recognition sequence, λ DNA (0.5 µg) was incubated with 5.0 µL of a lysate of MatS1 at 37°C for 3 h. Several reactions were carried out and the digestion mixtures were pooled, phenol chloroform extracted, precipitated and resuspended in TE buffer (pH 7.9). An aliquot of this DNA was treated with Taq polymerase (5 U) in a reaction mixture containing 2mM dNTPs and 1X PCR buffer, for 20 minutes at 72 0 C to fill in any 3′ recessed ends and to add an ‘A’ residue to the 3’ end of the DNA fragments to facilitate TA cloning. The DNA fragments were then resolved on an agarose gel and fragments less than 2000 bp in size were excised from the gel. Excised fragments were purified using Wizard® SV gel and PCR clean up system (Promega), according to manufacturer’s instructions. Purified fragments were then ligated to pGEM-T easy vector (Promega) and transformed in E.Coli (JM109) competent cells. Recombinant plasmid DNA was prepared from recombinant clones and the ends of the insert sequenced using the dideoxy method (Macrogen- Korea). Activity assays were carried out using the partially purified enzyme (5 µL) and unmethylated λ DNA (0.7 µg) as a substrate in a 30 µL reaction volume for 2 h. The cleavage products were then resolved on a 0.8 % agarose gel and the relative activities were evaluated based on the intensities of the DNA bands. Enzyme activity in several commercially available buffers (Promega - Table 1 ) were determined as follows; λ DNA (0.7 µg) was digested with 5.0 µL of the purified lysate in the respective buffer (1X) for 2 h at 37 ºC in a 30 µL reaction mixture. The resulting DNA fragments were then resolved on a 0.8 % agarose gel and the intensity of the resolved bands were determined using IMAGEJ software ( https://imagej.nih.gov/ij/download.html ). The relative enzyme activity was determined based on the intensities of the cleaved DNA fragments. Table 1 Composition of commercially available restriction endonuclease buffers (1X) (Promega). Buffer pH at 37 0 C Tris HCl (mM) MgCl 2 (mM) NaCl (mM) KCl (mM) DTT (mM) B 7.5 6 6 50 - 1 D 7.9 6 6 150 - 1 E 7.5 6 6 100 - 1 H 7.5 90 10 50 - - J 7.5 10 7 - 50 1 K 7.4 10 10 - 150 1 MC 25 mM Tris acetate (pH 7.5 at 37°C), 100 mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT Lambda DNA (0.7 µg) was digested in a reaction mixture (30 µL) containing 1X MC buffer (Promega), 5 µL of the partially purified enzyme, at temperatures ranging from 0 to 90 ºC (0, 20, 37, 40, 50, 60, 70, 80 and 90 ºC) for 2 h. The digestion mixture was then electrophoresed on 0.8 % agarose gel and the optimum temperature was determined based on the intensity of the bands produced. The partially purified enzyme was pre-incubated at different temperatures (0, 20, 37, 40, 50, 60, 70, 80 and 90 0 C) for 20 minutes and restriction digestion reactions were carried out as described above (Sect. 2.8.2). 2.3 Whole-genome sequencing of MatS1 and In-silico characterization of the Pan I gene Genomic DNA was extracted from the isolated Pseudomonas sp . using the DNeasy Blood & Tissue Kit, as per manufactures instructions (Qiagen – USA). The DNA was then de novo sequenced using PacBio technology (GeneWiz - China). Briefly, genomic DNA was sheared and 20 Kb double-stranded DNA fragments were selected, end repaired and ligated with universal hairpin adapters. SMRTbell library was constructed and sequenced in PacBio RSII SMRT (Mccarthy 2010 ) sequencer. PacBio reads were assembled using PBcR of WGS-Assembler 8.2 (Berlin et al. 2015 ). The Glimmer (Delcher et al. 2007 ) gene-finding software was used for the identification of coding genes. The coding genes were annotated against the NR database of the National Center for Biotechnology Information (NCBI), using BLAST. Based on the alignments obtained from NCBI Genbank sequence database with the contiguous sequences of MatS1 whole genome using BLAST, a homolog which codes a Hin dIII like endonuclease was identified. The corresponding amino acid sequence of the homolog was obtained by using Uni-pro-U-GENE software (Okonechnikov et al. 2012 ) and substrate (DNA) binding sites were predicted by COACH online server (Yang et al. 2013 ). Sequence comparison studies of predicted protein sequence with its homologs were performed using the Clustal-Omega ( https://www.ebi.ac.uk/Tools/msa/clustalo/ ) and EMBOSS-Needle ( https://www.ebi.ac.uk/Tools/psa/emboss_needle/ ) sequence alignment programs. With the objective of investigating the evolutionary relationship with its counterpart molecules, phylogenetic analysis of the identified sequence (MatS1- Hin dIII) was carried out using the Neighbor-joining method with bootstrapping values taken from 1000 replicates, using Molecular Evolutionary Genetics Analysis (MEGA) software, version 6 (Tamura et al. 2013 ). Characteristic signatures of the MatS1 Hin dIII like protein sequence were predicted by the ExPASy-prosite server ( http://prosite.expasy.org ) and some of the physicochemical properties were identified using the ExPASy ProtParam tool ( http://web.expasy.org/protparam ). Tertiary structure of the enzyme was predicted by I-TASSER online server (Yang and Zhang 2015 ) along with the potential ligand binding sites and the corresponding ligands and visualized using PyMol (v1.3) molecular visualization software. 3.0 Results And Discussion When the cell-free extracts of bacterial isolates were separately incubated with un-methylated lambda DNA (Promega), a banding pattern similar to that of lambda DNA cleaved with commercially available Hin dIII was observed (Fig. 1 ) with one isolate. This was designated as MatS1 and selected for further analysis. MatS1was found to be a Gram negative rod shaped bacterium, dark orange in color and the colony was sticky, shiny, circular, raised with entire margin and swarming. Analysis of the sequence of 16S rRNA gene using BLAST confirmed the isolate to be a strain of Pseudomonas anguilliseptica , evidenced by a 99.6% sequence identity with Pseudomonas anguilliseptica VITEPRRL6 strain (GenBank ID - KR149276). Therefore, the Hin dIII like enzyme of MatS1 was tentatively designated as Pan I. This is a first report of a HindIII like enzyme characterized from the genus Pseudomonas . Partial purification of MatS1was carried out by size exclusion, using molecular weight cut off filters. Lambda DNA cleavage by concentrated lysate using 50 and 30 kDa molecular weight cut-off filters displayed two different banding patterns (Fig. 2 ). A banding pattern similar to that of λ DNA cleaved by Hin dIII was observed in the retentate of the 30 kDa filter and filtrate of the 50 kDa filter, suggesting the molecular weight of the Hin dIII like enzyme of MatS1 to lie between 30 and 50 kDa. Moreover, the observed cleavage pattern of λ DNA with the retentate of the 50 kDa filter indicates the presence of other restriction enzymes with different specificities and molecular weights above 50 kDa. This observation was further confirmed by the whole genome sequence analysis of MatS1, which indicated the presence of other genes encoding putative restriction enzymes. The recognition sequence of RE of MatS1 ( Pan I) was determined by cloning and sequencing the ends of λ DNA fragments produced by digestion of λ DNA with partially purified Pan I. The recognition sequence was found to be “AAGCTT”. Partially purified PanI was active in most of the commercially available buffers including buffer B, which is the optimum buffer for commercially available Hin dIII (Promega). However, optimum activity of Pan I was observed in multi-core (MC) buffer (Fig. 3 ), which contained 10 mM Mg 2+ as a divalent cation and 100 mM K + as a monovalent cation and a pH of 7.5 (Table 1 ). The optimum temperature of the partially purified enzyme appeared to be between 37ºC to 50ºC (Fig. 4 ). The highest intensity of the banding pattern was observed at 40 0 C. Above 70ºC the activity decreased and detectable activity was observed even at 80ºC, suggesting its functionality even under extreme temperatures. A previously reported, isoschizomers of Hin dIII; Eco VIII also showed optimal activity at 48°C, aligning with our observations (Mise and Nakajima 1984 ). To determine the thermal stability of Pan I without the DNA substrate, partially purified enzyme was pre-incubated at different temperatures. The enzyme was found to be stable up to 40 0 C for 20 minutes without the DNA substrate (Fig. 5 ). Whole-genome sequence analysis of MatS1 revealed the presence of a complete coding sequence of a gene having a high degree of similarity to known genes encoding Hin dIII family enzymes, reported in NCBI-GenBank database; further confirming that partially purified Pan I in MatS1 is an isoschizomer of Hin d III. The sequence information of Pan I was deposited in NCBI GenBank database (GenBank ID - MW140018). The complete putative ORF of Pan I was 912 bp and encodes a protein of 304 amino acids with a predicted molecular weight of ~ 34.6 kDa and a theoretical iso-electric point of 6.18. This predicted molecular weight is in agreement with the empirically estimated range of molecular weight (30–50 kDa) of partially purified Pan I. The protein sequence has a region that resembles the partially conserved Hin dIII endonuclease superfamily signature (residues 13–292) and several conserved substrate binding sites (DNA) as predicted by COACH online server (Fig. 8 - (Yang et al. 2013 ). Based on the pairwise sequence alignment, Pan I shared significant sequence relatedness with its bacterial counterparts with a maximum similarity of 89.1 % and identity of 76.3 % with that of Cylindrospermopsis raciborskii , validating its homology to known Hin dIII counterparts (Table 2 ). T able 2. Percentage similarity and identity of Pan I with different homologues. Species name Restriction Endonuclease (RE) NCBI_GenBank Accession Number Length (amino acids) % Identity % Similarity Cylindrospermopsis raciborskii Hin dIII family WP071241953 304 76.3 89.1 Pseudomonas mygdali Hin dIII family WP057425488 304 73.1 85.6 Pseudomonas meliae Hin dIII family WP054991699 304 73.1 85.2 Thermoflexibacter ruber Hin dIII family WP091549217 304 69.2 82.6 Chlorobi bacterium OLB4 Hin dIII family KXK03935 304 66.9 82.6 Bacteroidetes bacterium RIFCSPLOWO2 RE OFY69087 304 66.6 82.6 Ignavibacteria bacterium RE OIO24181 304 65.2 82.3 Bacteroidales bacterium Barb6XT Hin dIII family WP066182127 304 62.3 80.7 Planktothrix sp. PCC 11201 Hin dIII family WP079679536 304 61.3 78.7 Geminocystis herdmanii Hin dIII family WP017294927 304 60.3 78.0 Arthrospira Hin dIII family WP006621132 304 60.3 77.0 Oscillatoria acuminate Hin dIII family WP015150672 304 59.0 77.7 Chlorobi bacterium OLB7 Hin dIII family KXK52534 303 58.6 79.3 Enterobacteriaceae Hin dIII family WP015059042 307 55.8 73.2 Aquamicrobium aerolatum Hin dIII family WP091525013 304 55.1 71.8 Escherichia coli Hin dIII family WP024235892 308 54.4 72.2 Escherichia coli (Plasmid) Eco VIII AAA91203 333 51.5 67.6 In the phylogenetic reconstruction, PanI was clustered with known bacterial Hin dIII family enzymes (Fig. 7 ). According to the tree topology, Pan I was closely clustered with Pseudomonas Hin dIII homologs. However, it showed its highest evolutionary relationship to its counterpart in C. raciborskii , by forming a sub-clade with it in the main cluster which also harbors Hin dIII family enzymes of Pseudomonas species, with high bootstrapping support (85). This pattern of clustering suggests a possible horizontal gene transfer event between P. anguliseptica and C. raciborskii with respect to Hin dIII like protein coding gene, which is also further reinforced by the pronounced sequence identity of Pan I with C. raciborskii HindIII family protein, compared to those from other two Pseudomonas species (Table 2 ). However, further investigations are warranted for the validation of this likelihood. I-TASSER online server predicted the tertiary structure of Pan I based on 10 threading templates identified from the research Collaboratory for Structural Bioinformatics (RCSB) protein data bank, of which the normalized Z score of the threading alignments was between 2.27 to 11.92, confirming the credibility of each alignment. The most reliable model with a substantial global accuracy, measured by C-score (1.00) with estimated TM-score of 0.85 ± 0.08 and RMSD of 4.2 ± 2.8 A was selected for visualization on PyMol software. According to the generated model, Pan I consists of 15 α-helices and 1 β pleated sheet with five strands (Fig. 8 A). However, the monomeric form of the empirically determined crystal structure of Hin dIII was found to be made up of 16 α-helices and 2 β pleated sheets; one with two strands, and the other with five strands (Watanabe et al. 2009 ). Thus, comparison of these two structures suggests that the five stranded β pleated sheet is conserved in Pan I. Moreover, in compliance with the Hin dIII crystal structure, the first strand of the five stranded β sheet is oriented in a parallel direction with the fifth strand in the predicted tertiary structure of Pan I As a part of the computer based simulation performed by I-TASSER, potential DNA substrate binding sites were predicted based on the modeled tertiary structure of Pan I along with the three dimensional structure of the enzyme - cognate DNA complex, by using COBOLT and COFACTOR algorithms (Yang et al. 2013 ). The most reliable prediction with the highest C-score (0.55) and cluster size (35) consists of 8 potential DNA binding residues, namely from the N terminal, Ser-31, Thr-69, Asp-67, Lys-72, Ala-127, Asn-129, Lys-131 and Lys-284 with a binding probability of over 0.5 (Fig. 8 B). The repeated occurrence of positively charged amino acid, Lys in the binding site indicates potentially strong interactions between negatively charged DNA and the enzyme via formation of ionic bonds. As expected, the cognate stretches of DNA which overlaps with the active site of the enzyme was predicted to bear the consensus Hin dIII recognition sequence ‘AAGCTT’ validating the empirically determined recognition sequence of Pan I. Conclusions REs are powerful tools used in molecular biology and genetic engineering. In this study, several soil and water samples were screened for the isolation of restriction enzyme producing bacteria. Potent Hin dIII like activity was observed in the cell-free extract of an isolate designated MatS1 and was identified as a novel strain of Pseudomonas anguilliseptica through 16S rRNA analysis. The restriction enzyme isolated from this organism was designated as Pan I. The isolated enzyme was partially purified and characterized in relation to its recognition sequence and optimum reaction conditions for DNA digestion. The recognition sequence was found to be 5′AAGCTT 3′ and revealed Pan 1 to be an isoschizomer of Hin dIII. The whole genome of MatS1 was sequenced and the gene for Pan I was identified and characterized. Declarations Acknowledgments We are grateful to Mr. H. M. J. C. B. Herath, Dr. Y.C. Guruge, Mr. Chatura Samarasinghe, Mr. Charitha Samarasinghe, Mrs. Padmini Wijenayake and Mr. K.M.Karunajeewa for their generous assistance in collecting soil and water samples for the study and Dr. (Mrs.) W.W.P. Rodrigo for her kind assistance in Bioinfomatic analysis. This research study was supported by a grant (RG/2014/BT/2) from National Science Foundation, Sri Lanka. Funding This research study was supported by a grant (RG/2014/BT/2) from the National Science Foundation, Sri Lanka. Competing interests The authors Swarna Nirosha Jayasinghe Pathirana, Don Anushka Sandaruwan Elvitigala, Chandrika Malkanthi Nanayakkara, Prashanth Suravajhala, Sanath Rajapakse, Gardhi Hettiarachchige Chamari Madhu Hettiarachchi and Naduviladath Vishwanath Chandrasekharan declare that they have no competing interests. Availability of data and materials Not applicable Code availability Not applicable CRediT authorship contribution statement Swarna Nirosha Jayasinghe Pathirana: Data curation, Investigations, Formal analysis, Methodology, Project administration, Writing original draft; Don Anushka Sandaruwan Elvitigala : Formal analysis; Methodology; Writing-review and editing; Chandrika Malkanthi Nanayakkara: Writing-review and editing, Supervision, Methodology; Prashanth Suravajhala : Writing-review and editing, methodology, Formal analysis; Sanath Rajapakse: Writing-review and editing, methodology, Resources, Supervision; Gardhi Hettiarachchige Chamari Madhu Hettiarachchi: Funding acquisition, Project administration, Supervision, Methodology; Naduviladath Vishwanath Chandrasekharan: Conceptualization, Funding acquisition, Data curation, Formal analysis, Methodology, Project administration, Resources, Writing-review and editing, Supervision References Berlin K, Koren S, Chin CS et al (2015) Assembling large genomes with single-molecule sequencing and locality-sensitive hashing. Nat Biotechnol 33:623–630. https://doi.org/10.1038/nbt.3238 Bhumbla U, Bhumbla U (2018) Gram’s Staining. In: Workbook for Practical Microbiology. Jaypee Brothers Medical Publishers (P) Ltd., pp 30–30 Delcher AL, Bratke KA, Powers EC, Salzberg SL (2007) Identifying bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics 23:673–679. https://doi.org/10.1093/bioinformatics/btm009 Di Felice F, Micheli G, Camilloni G (2019) Review Restriction enzymes and their use in molecular biology: An overview. J Biosci 44:. https://doi.org/10.1007/s12038-019-9856-8 Kazennova EV, Tarasov AP, Mileikovskaia MM, Tsevetkova NV (1982) Isolation and purification of restriction endonuclease BpeI from Bordetella pertussis. ZH Mikrobiol Epidemiol immunnobiol 6:56–57 Loenen WAM, Dryden DTF, Raleigh EA et al (2014a) Highlights of the DNA cutters: A short history of the restriction enzymes. Nucleic Acids Res 42:3–19. https://doi.org/10.1093/nar/gkt990 Loenen WAM, Dryden DTF, Raleigh EA, Wilson GG (2014b) Type I restriction enzymes and their relatives. Nucleic Acids Res 42:20–44. https://doi.org/10.1093/nar/gkt847 Mccarthy A (2010) Third generation DNA sequencing: Pacific biosciences’ single molecule real time technology. Chem Biol 17:675–676 Mise K, Nakajima K (1984) Isolation of restriction enzyme EcoVIII, an isoschizomer of Hin dIII, produced by Escherichia coli E1585-68. Gene 30:79–85. https://doi.org/10.1016/0378-1119(84)90107-0 Okonechnikov K, Golosova O, Fursov M et al (2012) Unipro UGENE: A unified bioinformatics toolkit. Bioinformatics 28:1166–1167 Pingoud A, Fuxreiter M, Pingoud V, Wende W (2005) Type II restriction endonucleases: Structure and mechanism. Cell Mol Life Sci 62:685–707 Pingoud A, Jeltsch A (2001) Structure and function of type II restriction endonucleases. Nucleic Acids Res 29:3705–3727 Pingoud A, Wilson GG, Wende W (2014) Type II restriction endonucleases–a historical perspective and more. Nucleic Acids Res 42:7489–7527. https://doi.org/10.1093/nar/gku447 Roberts RJ (1976) Restriction endonucleases. CRC Crit Rev Biochem 4:123–164 Sistla S, Rao DN (2004) S-Adenosyl-L-methionine-dependent restriction enzymes. Crit Rev Biochem Mol Biol 39:1–19 Tamura K, Stecher G, Peterson D et al (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–2729. https://doi.org/10.1093/molbev/mst197 Watanabe N, Takasaki Y, Sato C et al (2009) Structures of restriction endonuclease Hin dIII in complex with its cognate DNA and divalent cations. Acta Crystallogr Sect D Biol Crystallogr 65:1326–1333. https://doi.org/10.1107/S0907444909041134 Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173:697–703. https://doi.org/10.1128/jb.173.2.697-703.1991 Williams RJ (2003) Restriction endonucleases: classification, properties, and applications. Mol Biotechnol 23:225–243 Wilson GG, Murray NE (1991) Restriction and modification systems. Annu Rev Genet 25:585–627. https://doi.org/10.1146/annurev.ge.25.120191.003101 Yang J, Roy A, Zhang Y (2013) BioLiP: A semi-manually curated database for biologically relevant ligand-protein interactions. Nucleic Acids Res 41:. https://doi.org/10.1093/nar/gks966 Yang J, Zhang Y (2015) I-TASSER server: New development for protein structure and function predictions. Nucleic Acids Res 43:W174–W181. https://doi.org/10.1093/nar/gkv342 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-600889\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":33191310,\"identity\":\"b52cddf9-643c-4ef6-aef8-a42ffe0b0382\",\"order_by\":0,\"name\":\"Swarna Nirosha Jayasinghe Pathirana\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABMElEQVRIie3PsWqDQBjA8TsOdNFkVQLNKygOJdA0rxJxTbNkKbTQk4PLYjLbyVfoFLpVOTCL0LVwHerSWZcSSyg9pQ5Fa9dC/YP6edxPOQD6+v5iSFwQl5MCwvIxRBCHmRgk+TcifRF9TdzULxdQx59qUmUke2Ip9ddaOpXVNC3uz5fDYBOxy+vnMXiy6ejsfTceIACzfNEgEyJblpo4Ky0ezKMkfjVdX5CLLTcpAki/3TWIwSRpBCmycawYEZYYJFpJPC4WxXHUdqIX9MYOKvLBZrQkE4/PuoimUmbflcQVg6dExAIHbncQZKl0vzLjhSBb5viy66YbzB2KIGk9y2MM04JeLU9YYuX4jU0fmPwSHo58GqxJlOVNUjf//gppdcc/7m8ScOza3NfX1/fP+gRB23PZRpid+AAAAABJRU5ErkJggg==\",\"orcid\":\"https://orcid.org/0000-0002-8013-2147\",\"institution\":\"University of Colombo\",\"correspondingAuthor\":true,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Swarna\",\"middleName\":\"Nirosha Jayasinghe\",\"lastName\":\"Pathirana\",\"suffix\":\"\"},{\"id\":33191311,\"identity\":\"5d71e097-36fb-49ba-a27a-5209a3cc9694\",\"order_by\":1,\"name\":\"Don Anushka Sandaruwan Elvitigala\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Colombo\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Don\",\"middleName\":\"Anushka Sandaruwan\",\"lastName\":\"Elvitigala\",\"suffix\":\"\"},{\"id\":33191312,\"identity\":\"884bbc4a-dbd7-4f95-80ec-0dde1f4fc1ed\",\"order_by\":2,\"name\":\"Chandrika Malkanthi Nanayakkara\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Colombo\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chandrika\",\"middleName\":\"Malkanthi\",\"lastName\":\"Nanayakkara\",\"suffix\":\"\"},{\"id\":33191313,\"identity\":\"6b4a5b03-062f-4248-8233-54c274de42bc\",\"order_by\":3,\"name\":\"Prashanth Suravajhala\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Birla Institute of Scientific Research\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Prashanth\",\"middleName\":\"\",\"lastName\":\"Suravajhala\",\"suffix\":\"\"},{\"id\":33191314,\"identity\":\"d0e0c61e-0461-449f-a50b-60863ce5f4fe\",\"order_by\":4,\"name\":\"Sanath Rajapakse\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Peradeniya\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sanath\",\"middleName\":\"\",\"lastName\":\"Rajapakse\",\"suffix\":\"\"},{\"id\":33191315,\"identity\":\"468148c4-6812-40b9-a0e8-b77d4b0d6bf0\",\"order_by\":5,\"name\":\"Gardhi Hewage Chamari Madhu Hettiarachchi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Colombo\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Gardhi\",\"middleName\":\"Hewage Chamari Madhu\",\"lastName\":\"Hettiarachchi\",\"suffix\":\"\"},{\"id\":33191316,\"identity\":\"03473f35-c35e-4686-960c-ea6a36823fbc\",\"order_by\":6,\"name\":\"Naduviladath Vishvanath Chandrasekharan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"University of Colombo\",\"correspondingAuthor\":false,\"submittingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Naduviladath\",\"middleName\":\"Vishvanath\",\"lastName\":\"Chandrasekharan\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2021-06-07 22:29:06\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-600889/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-600889/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":10503295,\"identity\":\"9d38e263-02fc-4f0d-9c61-de30fedc19a2\",\"added_by\":\"auto\",\"created_at\":\"2021-06-17 18:38:29\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":90717,\"visible\":true,\"origin\":\"\",\"legend\":\"Screening of MatS1 for REs. Lane 1: Lambda DNA/ HindIII marker. Lane 2: Lambda DNA fragments produced by the REs in MatS1 \",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-600889/v1/2d1a2fef1d3f013b8b183d51.png\"},{\"id\":10503721,\"identity\":\"41b1dcfa-b645-46a4-bf7e-f5163cccb51d\",\"added_by\":\"auto\",\"created_at\":\"2021-06-17 18:41:30\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":164029,\"visible\":true,\"origin\":\"\",\"legend\":\"Partial purification of PanI. Lane 1: Lambda DNA/HindIII marker, Lane2: Restriction digestion of λ DNA treated with MatS1 lysate, concentrated using a 30 kDa molecular weight cut off filter. Lane 3: λ DNA cleaved using the filtrate of the 50 kDa molecular weight cut off filter. Lane 4: λ DNA cleaved using the filtrate of the 30 kDa molecular weight cut off filter. Lane 5: Lambda DNA cleaved with concentrated lysate (retentate) using a 50 kDa molecular weight cut off filter.\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-600889/v1/d2d9c6538b435a787b98af54.png\"},{\"id\":10503296,\"identity\":\"fde62136-9459-458d-8424-6d68ad7e4e2f\",\"added_by\":\"auto\",\"created_at\":\"2021-06-17 18:38:30\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":21379,\"visible\":true,\"origin\":\"\",\"legend\":\"Determination of the activity of partially purified PanI in different commercially available buffers (Table 1). Percentage (%) activity of the partially purified PanI in different commercially available buffers was determined based on the intensities of the cleaved DNA fragments resolved on a 0.8 % agarose gel and analysed by image J software. Error bars represent SD (n=3) \",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-600889/v1/9a30d25d776dd845ffb02638.png\"},{\"id\":10503128,\"identity\":\"12c4f089-9129-4da3-b90a-8ce2e6da3400\",\"added_by\":\"auto\",\"created_at\":\"2021-06-17 18:35:29\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":19851,\"visible\":true,\"origin\":\"\",\"legend\":\"Determination of optimum temperature of partially purified PanI. Percentage (%) activity of partially purified enzyme at different temperatures varying from 0-90 oC was determined by analysing the intensities of the cleaved DNA fragments resolved on a 0.8 % agarose gel using image J software, Error bars represent SD (n=3)\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-600889/v1/cfda989ef20004b2ff250f71.png\"},{\"id\":10503297,\"identity\":\"5debbd36-bebf-44cb-a33e-32819154d093\",\"added_by\":\"auto\",\"created_at\":\"2021-06-17 18:38:30\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":282521,\"visible\":true,\"origin\":\"\",\"legend\":\"Determination of thermal stability of the partially purified enzyme. Lane 1: λ/HindIII marker, Lanes 2 to 9; fragments of λ DNA produced by restriction digestion reactions performed at 40 0C using partially purified PanI, which was pre-incubated at 0, 20, 37, 40, 50, 60, 70, 80 and 90 0C for 20 minutes, respectively\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-600889/v1/9397d3e8037c6ff2067f720d.png\"},{\"id\":10503132,\"identity\":\"a071f1c3-b8e9-4cfa-a0ab-652ddfdbd29c\",\"added_by\":\"auto\",\"created_at\":\"2021-06-17 18:35:30\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":281315,\"visible\":true,\"origin\":\"\",\"legend\":\"Multiple protein sequence alignment of selected bacterial HindIII like REs including PanI. Completely conserved and partially conserved residues are denoted by (*)/ highlighted in gray and (:) symbols respectively. Hind III superfamily signature is boxed on MatS1 HindIII. Blue color arrows depict the predicted substrate-binding sites.\",\"description\":\"\",\"filename\":\"6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-600889/v1/07fdb65ef9e85cc74886da38.png\"},{\"id\":10503299,\"identity\":\"cbf15ca2-bbf2-4fa1-aead-bd2c626a5868\",\"added_by\":\"auto\",\"created_at\":\"2021-06-17 18:38:30\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":196970,\"visible\":true,\"origin\":\"\",\"legend\":\"Phylogenetic position of PanI was analyzed using MEGA version 6.0 software based on Clustal omega multiple sequence alignment of different bacterial and cyanobacterial HindIII like REs under the neighbor-joining platform. Bootstrap supporting values are denoted at the tree branches and NCBI-GenBank accession numbers of used homologs are listed in Table 2\",\"description\":\"\",\"filename\":\"7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-600889/v1/aa664d6c3706712fb3b07bdf.png\"},{\"id\":10504070,\"identity\":\"d72057bd-bf68-4af7-90b9-4a59aa798a28\",\"added_by\":\"auto\",\"created_at\":\"2021-06-17 18:44:30\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":575671,\"visible\":true,\"origin\":\"\",\"legend\":\"In silico structural and functional annotation of PanI using I-TASSER online server (A) Tertiary structure of PanI predicted by I-TASSER server and visualized by PyMoL v 3.1 software. α-Helices, β –strands and Loops/coil structures are denoted in red, yellow and green, respectively. (B) The predicted complex of PanI-cognate DNA. An enlarged version of active site of the predicted overall structural complex in the top panel is indicated in the bottom panel of the figure. Side chains of the residues in the active site are depicted as stick models in cyan and labeled. The cognate DNA stretch is shown in orange and violet, to indicate sites harboring the recognition sequence (5′AAGCTT3′) and rest of the sequence, respectively\",\"description\":\"\",\"filename\":\"8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-600889/v1/040c063f22b93dd4fb99c130.png\"},{\"id\":15673070,\"identity\":\"c85f14cd-e731-4d50-92ba-fce3539dbbb7\",\"added_by\":\"auto\",\"created_at\":\"2021-11-18 14:16:04\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2244274,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-600889/v1/bbc4f22f-6f95-4169-9496-17d10a2b2bf4.pdf\"}],\"financialInterests\":\"\",\"formattedTitle\":\"\\u003cp\\u003eIsolation, Partial Purification and Characterization of a Novel Restriction Enzyme from \\u003cem\\u003ePseudomonas Anguilliseptica\\u003c/em\\u003e\\u003c/p\\u003e\",\"fulltext\":[{\"header\":\"1.0 Introduction\",\"content\":\" \\u003cp\\u003eAll living organisms face the challenge of survival and threats posed by their pathogens. Bacteria exert different mechanisms for their survival, one of which is driven by \\u0026lsquo;restriction enzymes\\u0026rsquo; (REs) or \\u0026lsquo;restriction endonucleases\\u0026rsquo; (REases) which represent a type of bacterial immune system, dedicated to shielding them from phage attack. REs restricts growth of phages by cleaving double-stranded phage DNA at precise nucleotide positions. Methyltransferases (MTases) modify bacterial DNA at sequences recognized by REases to prevent self-cleavage of its own genome. Collectively, these two enzymes form the \\u0026ldquo;restriction-modification (R-M) system\\u0026rdquo; in bacteria (Williams \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2003\\u003c/span\\u003e). The recognition sites of REases generally contain variable numbers of base pairs (four, six or eight) (Wilson and Murray \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e1991\\u003c/span\\u003e). There are four major types of REs, namely, type I, II, III and IV, categorized according to their structure, recognition site, cleavage site, cofactor(s), and activator(s) (Williams \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2003\\u003c/span\\u003e; Sistla and Rao \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2004\\u003c/span\\u003e; Loenen et al. \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2014b\\u003c/span\\u003e). While they have the ability to cleave double-stranded DNA in a sequence-specific manner, irrespective of the source of DNA; with the advent of recombinant DNA technology, extensive research is being carried out worldwide for isolation, purification, and characterization of novel REs. Current trends in restriction enzyme research encompass the use of protein engineering and fusions to produce enzymes with novel endonuclease activities (Di Felice et al. \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eType II REs represent the highest number of characterized REs to date. Over 300 Type II REs, with \\u0026gt;\\u0026thinsp;200 dissimilar sequence-specificities, are commercially available (Loenen et al. \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2014b\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003ea\\u003c/span\\u003e). These constitute a very diverse group of proteins in terms of size and amino acid sequence, organization of the domains and protein subunit composition, co-factor requirement for enzymatic activity and reaction mechanisms (Pingoud et al. \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e; Loenen et al. \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2014a\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eType II REs are fundamental tools in DNA manipulation and play an important role in genetic engineering and molecular biology (Williams \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2003\\u003c/span\\u003e), because they have the ability to cleave DNA at defined positions close to or within their recognition sequences producing distinct reproducible banding patterns on agarose gels (Roberts \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e1976\\u003c/span\\u003e). Generally, they identify short, palindromic, 4\\u0026ndash;8 base pair (bp) sequences (Pingoud and Jeltsch \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2001\\u003c/span\\u003e; Pingoud et al. \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e) and cleave DNA in the presence of Mg\\u003csup\\u003e2+\\u003c/sup\\u003e. Type II REases are the most commonly used group of enzymes in laboratories for gene cloning, DNA analysis, library preparation, diagnostic purposes, etc. Their sizes range from 250\\u0026ndash;350 amino acids and are the simplest and smallest among the REases. REases that identify the same DNA sequence, irrespective of the site at which they cleave the DNA are designated as \\u0026lsquo;isoschizomers\\u0026rsquo;(Pingoud et al. \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e), while the first enzyme which revealed the recognition sequence is known as the prototype.\\u003c/p\\u003e \\u003cp\\u003eAmong the type II REases, the enzyme \\u003cem\\u003eHin\\u003c/em\\u003ed III was isolated from the bacterium \\u003cem\\u003eHaemophilus influenzae\\u003c/em\\u003e, serotype d (Pingoud et al. \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e) and is used extensively in genetic engineering and molecular biology. Isoschizomers of \\u003cem\\u003eHin\\u003c/em\\u003ed III REase reported to date are listed in the REBASE database (Kazennova et al. \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e1982\\u003c/span\\u003e; Mise and Nakajima \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e1984\\u003c/span\\u003e). In this study, an isolate of \\u003cem\\u003ePseudomonas anguilliseptica\\u003c/em\\u003e was identified from a soil sample and was found to produce an isoschizomer of \\u003cem\\u003eHin\\u003c/em\\u003edIII. The enzyme was extracted from the bacterium, partially purified, functionally characterized and tentatively designated as \\u003cem\\u003ePan\\u003c/em\\u003eI. Furthermore, through whole-genome sequencing the putative gene encoding the enzyme was identified and molecularly characterized using different \\u003cem\\u003ein-silico\\u003c/em\\u003e tools.\\u003c/p\\u003e \"},{\"header\":\"2.0 Materials And Methods\",\"content\":\" \\u003cp\\u003e \\u003cb\\u003e2.1 Sample collection, Isolation of bacteria from soil samples, Screening isolated bacteria for REs and Characterization of restriction enzyme-producing bacteria.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eSoil samples were collected using sterile 50 mL conical tubes from different regions of the country, transported to the laboratory and stored at 4 \\u003csup\\u003e0\\u003c/sup\\u003eC to isolate bacteria. One gram of each soil sample was vigorously mixed with 5 mL of sterile PBS (1X: 137 mM NaCl, 2.7 mM KCl, 8 mM Na\\u003csub\\u003e2\\u003c/sub\\u003eHPO\\u003csub\\u003e4\\u003c/sub\\u003e, and 2 mM KH\\u003csub\\u003e2\\u003c/sub\\u003ePO\\u003csub\\u003e4\\u003c/sub\\u003e) separately and a 100 \\u0026micro;L aliquot was serially diluted (10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;1\\u003c/sup\\u003e to 10\\u003csup\\u003e\\u0026minus;\\u0026thinsp;10\\u003c/sup\\u003e) using PBS. An aliquot (100 \\u0026micro;L) from each dilution was spread on Luria-Bertani (LB) agar plates and incubated at 37 \\u003csup\\u003e0\\u003c/sup\\u003eC, and observed daily for a week. Well-isolated colonies were picked for screening.\\u003c/p\\u003e \\u003cp\\u003eWell isolated colonies were separately inoculated into 5 mL LB broth and grown overnight. The cultures were then centrifuged at 3500 rpm for 30 minutes and cell pellets were washed with TME buffer (50 mM Tris-HCl, 20 mM MgCl\\u003csub\\u003e2\\u003c/sub\\u003e and 0.1 mM EDTA, pH 7.5) and then centrifuged again using the same conditions. Cell pellets were then re-suspended in 500 \\u0026micro;L of TME buffer along with 0.5\\u0026micro;L of β-mercaptoethanol. The cell suspensions were then disrupted by cold sonication (3x 2second pulses with 15 second intervals in between) and then centrifuged (18000 g /3 min/ 4\\u0026deg;C) followed by careful separation of the supernatant. The supernatant of each cell lysate was then screened for REs as follows; A 30 \\u0026micro;L of reaction mixture (digestion mixture) containing 5.0 \\u0026micro;L of cell lysate, 1X Multicore (MC) buffer (Promega), 0.5 \\u0026micro;g of un-methylated λ DNA and deionized water was incubated at 37\\u0026ordm;C for 3 h. Aliquots (15 \\u0026micro;L) from the above reaction mixtures were electrophoresed on a 0.8% agarose gel and visualized under a UV trans-illuminator for the presence of distinct banding patterns.\\u003c/p\\u003e \\u003cp\\u003eSeveral isolates displayed distinct DNA banding patterns on agarose gel electrophoresis. The colony and cellular morphology, including shape, height, margin, surface refraction, opacity and color of the bacterial colony was observed as described elsewhere. (Bhumbla and Bhumbla \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). An isolate designated \\u0026lsquo;MatS1\\u0026rsquo; was selected for further analysis.\\u003c/p\\u003e \\u003cp\\u003eThe MatS1 isolate was molecularly identified at the species level using 16S rRNA gene sequence analysis by employing the universal primers (RNABR1 \\u0026ndash; AGAGTTTGATCCTGGCTCAG and RNABR2- AAGGAGGTGATCCAGCC) in a standard PCR amplification reaction (Weisburg et al. \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e1991\\u003c/span\\u003e) followed by sequence verification of the amplicon.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003e2.2 Partial purification of MatS1 lysate, Determination of the recognition sequence, Endonuclease activity assays, Enzyme activity in commercially available buffers, Determination of optimum temperature, Thermal stability of the partially purified enzyme.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003ePartial purification of MatS1 by size exclusion filtration was carried out using molecular weight cut-off filters (Vivaspin 6 \\u0026ndash; Sigma-Aldrich) according to the manufacturer\\u0026rsquo;s instructions. Briefly, a cell free lysate of MatS1 was prepared as described above for screening (Sect.\\u0026nbsp;\\u003cspan refid=\\\"Sec3\\\" class=\\\"InternalRef\\\"\\u003e2.3\\u003c/span\\u003e) and 2 mL was filtered through a 50 kDa molecular weight cut off filter and the enzyme activity of the retentate and filtrate determined. The filtrate was then passed through 30 kDa molecular weight cut off filter and enzyme activity were assayed in both the filtrate and retentate.\\u003c/p\\u003e \\u003cp\\u003eTo determine the recognition sequence, λ DNA (0.5 \\u0026micro;g) was incubated with 5.0 \\u0026micro;L of a lysate of MatS1 at 37\\u0026deg;C for 3 h. Several reactions were carried out and the digestion mixtures were pooled, phenol chloroform extracted, precipitated and resuspended in TE buffer (pH 7.9). An aliquot of this DNA was treated with Taq polymerase (5 U) in a reaction mixture containing 2mM dNTPs and 1X PCR buffer, for 20 minutes at 72 \\u003csup\\u003e0\\u003c/sup\\u003eC to fill in any 3\\u0026prime; recessed ends and to add an \\u0026lsquo;A\\u0026rsquo; residue to the 3\\u0026rsquo; end of the DNA fragments to facilitate TA cloning. The DNA fragments were then resolved on an agarose gel and fragments less than 2000 bp in size were excised from the gel. Excised fragments were purified using Wizard\\u0026reg; SV gel and PCR clean up system (Promega), according to manufacturer\\u0026rsquo;s instructions. Purified fragments were then ligated to pGEM-T easy vector (Promega) and transformed in \\u003cem\\u003eE.Coli\\u003c/em\\u003e (JM109) competent cells. Recombinant plasmid DNA was prepared from recombinant clones and the ends of the insert sequenced using the dideoxy method (Macrogen- Korea).\\u003c/p\\u003e \\u003cp\\u003eActivity assays were carried out using the partially purified enzyme (5 \\u0026micro;L) and unmethylated λ DNA (0.7 \\u0026micro;g) as a substrate in a 30 \\u0026micro;L reaction volume for 2 h. The cleavage products were then resolved on a 0.8 % agarose gel and the relative activities were evaluated based on the intensities of the DNA bands. Enzyme activity in several commercially available buffers (Promega - Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e) were determined as follows; λ DNA (0.7 \\u0026micro;g) was digested with 5.0 \\u0026micro;L of the purified lysate in the respective buffer (1X) for 2 h at 37 \\u0026ordm;C in a 30 \\u0026micro;L reaction mixture. The resulting DNA fragments were then resolved on a 0.8 % agarose gel and the intensity of the resolved bands were determined using IMAGEJ software (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://imagej.nih.gov/ij/download.html\\u003c/span\\u003e\\u003c/span\\u003e). The relative enzyme activity was determined based on the intensities of the cleaved DNA fragments.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eComposition of commercially available restriction endonuclease buffers (1X) (Promega).\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"7\\\"\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBuffer\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003epH at 37\\u003csup\\u003e0\\u003c/sup\\u003eC\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTris HCl (mM)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003eMgCl\\u003csub\\u003e2\\u003c/sub\\u003e (mM)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003eNaCl (mM)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003eKCl (mM)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003eDTT (mM)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eB\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e7.5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e50\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eD\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e7.9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e150\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eE\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e7.5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e100\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eH\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e7.5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e90\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e50\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eJ\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e7.5\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e7\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e50\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eK\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e7.4\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e-\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e150\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c7\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"6\\\" nameend=\\\"c7\\\" namest=\\\"c2\\\"\\u003e \\u003cp\\u003e25 mM Tris acetate (pH 7.5 at 37\\u0026deg;C), 100 mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eLambda DNA (0.7 \\u0026micro;g) was digested in a reaction mixture (30 \\u0026micro;L) containing 1X MC buffer (Promega), 5 \\u0026micro;L of the partially purified enzyme, at temperatures ranging from 0 to 90 \\u0026ordm;C (0, 20, 37, 40, 50, 60, 70, 80 and 90 \\u0026ordm;C) for 2 h. The digestion mixture was then electrophoresed on 0.8 % agarose gel and the optimum temperature was determined based on the intensity of the bands produced.\\u003c/p\\u003e \\u003cp\\u003eThe partially purified enzyme was pre-incubated at different temperatures (0, 20, 37, 40, 50, 60, 70, 80 and 90\\u003csup\\u003e0\\u003c/sup\\u003eC) for 20 minutes and restriction digestion reactions were carried out as described above (Sect.\\u0026nbsp;2.8.2).\\u003c/p\\u003e \\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e\\u003cb\\u003e2.3 Whole-genome sequencing of MatS1 and\\u003c/b\\u003e \\u003cspan type=\\\"BoldItalic\\\" class=\\\"BoldItalic\\\" name=\\\"Emphasis\\\"\\u003eIn-silico\\u003c/span\\u003e \\u003cb\\u003echaracterization of the\\u003c/b\\u003e \\u003cspan type=\\\"BoldItalic\\\" class=\\\"BoldItalic\\\" name=\\\"Emphasis\\\"\\u003ePan\\u003c/span\\u003e \\u003cb\\u003eI gene\\u003c/b\\u003e\\u003c/h2\\u003e \\u003cp\\u003eGenomic DNA was extracted from the isolated \\u003cem\\u003ePseudomonas sp\\u003c/em\\u003e. using the DNeasy Blood \\u0026amp; Tissue Kit, as per manufactures instructions (Qiagen \\u0026ndash; USA). The DNA was then \\u003cem\\u003ede novo\\u003c/em\\u003e sequenced using PacBio technology (GeneWiz - China). Briefly, genomic DNA was sheared and 20 Kb double-stranded DNA fragments were selected, end repaired and ligated with universal hairpin adapters. SMRTbell library was constructed and sequenced in PacBio RSII SMRT (Mccarthy \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2010\\u003c/span\\u003e) sequencer. PacBio reads were assembled using PBcR of WGS-Assembler 8.2 (Berlin et al. \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e). The Glimmer (Delcher et al. \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2007\\u003c/span\\u003e) gene-finding software was used for the identification of coding genes. The coding genes were annotated against the NR database of the National Center for Biotechnology Information (NCBI), using BLAST.\\u003c/p\\u003e \\u003cp\\u003eBased on the alignments obtained from NCBI Genbank sequence database with the contiguous sequences of MatS1 whole genome using BLAST, a homolog which codes a \\u003cem\\u003eHin\\u003c/em\\u003edIII like endonuclease was identified. The corresponding amino acid sequence of the homolog was obtained by using Uni-pro-U-GENE software (Okonechnikov et al. \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e) and substrate (DNA) binding sites were predicted by COACH online server (Yang et al. \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). Sequence comparison studies of predicted protein sequence with its homologs were performed using the Clustal-Omega (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.ebi.ac.uk/Tools/msa/clustalo/\\u003c/span\\u003e\\u003c/span\\u003e) and EMBOSS-Needle (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.ebi.ac.uk/Tools/psa/emboss_needle/\\u003c/span\\u003e\\u003c/span\\u003e) sequence alignment programs. With the objective of investigating the evolutionary relationship with its counterpart molecules, phylogenetic analysis of the identified sequence (MatS1- \\u003cem\\u003eHin\\u003c/em\\u003edIII) was carried out using the Neighbor-joining method with bootstrapping values taken from 1000 replicates, using Molecular Evolutionary Genetics Analysis (MEGA) software, version 6 (Tamura et al. \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). Characteristic signatures of the MatS1 \\u003cem\\u003eHin\\u003c/em\\u003edIII like protein sequence were predicted by the ExPASy-prosite server (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://prosite.expasy.org\\u003c/span\\u003e\\u003c/span\\u003e) and some of the physicochemical properties were identified using the ExPASy ProtParam tool (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://web.expasy.org/protparam\\u003c/span\\u003e\\u003c/span\\u003e). Tertiary structure of the enzyme was predicted by I-TASSER online server (Yang and Zhang \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e) along with the potential ligand binding sites and the corresponding ligands and visualized using PyMol (v1.3) molecular visualization software.\\u003c/p\\u003e \\u003c/div\\u003e \"},{\"header\":\"3.0 Results And Discussion\",\"content\":\" \\u003cp\\u003eWhen the cell-free extracts of bacterial isolates were separately incubated with un-methylated lambda DNA (Promega), a banding pattern similar to that of lambda DNA cleaved with commercially available \\u003cem\\u003eHin\\u003c/em\\u003edIII was observed (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e) with one isolate. This was designated as MatS1 and selected for further analysis.\\u003c/p\\u003e \\u003cp\\u003eMatS1was found to be a Gram negative rod shaped bacterium, dark orange in color and the colony was sticky, shiny, circular, raised with entire margin and swarming. Analysis of the sequence of 16S rRNA gene using BLAST confirmed the isolate to be a strain of \\u003cem\\u003ePseudomonas anguilliseptica\\u003c/em\\u003e, evidenced by a 99.6% sequence identity with \\u003cem\\u003ePseudomonas anguilliseptica\\u003c/em\\u003e VITEPRRL6 strain (GenBank ID - KR149276). Therefore, the \\u003cem\\u003eHin\\u003c/em\\u003edIII like enzyme of MatS1 was tentatively designated as \\u003cem\\u003ePan\\u003c/em\\u003eI. This is a first report of a \\u003cem\\u003eHindIII\\u003c/em\\u003e like enzyme characterized from the genus \\u003cem\\u003ePseudomonas\\u003c/em\\u003e.\\u003c/p\\u003e \\u003cp\\u003ePartial purification of MatS1was carried out by size exclusion, using molecular weight cut off filters. Lambda DNA cleavage by concentrated lysate using 50 and 30 kDa molecular weight cut-off filters displayed two different banding patterns (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). A banding pattern similar to that of λ DNA cleaved by \\u003cem\\u003eHin\\u003c/em\\u003edIII was observed in the retentate of the 30 kDa filter and filtrate of the 50 kDa filter, suggesting the molecular weight of the \\u003cem\\u003eHin\\u003c/em\\u003edIII like enzyme of MatS1 to lie between 30 and 50 kDa. Moreover, the observed cleavage pattern of λ DNA with the retentate of the 50 kDa filter indicates the presence of other restriction enzymes with different specificities and molecular weights above 50 kDa. This observation was further confirmed by the whole genome sequence analysis of MatS1, which indicated the presence of other genes encoding putative restriction enzymes.\\u003c/p\\u003e \\u003cp\\u003eThe recognition sequence of RE of MatS1 (\\u003cem\\u003ePan\\u003c/em\\u003eI) was determined by cloning and sequencing the ends of λ DNA fragments produced by digestion of λ DNA with partially purified \\u003cem\\u003ePan\\u003c/em\\u003eI. The recognition sequence was found to be \\u0026ldquo;AAGCTT\\u0026rdquo;.\\u003c/p\\u003e \\u003cp\\u003ePartially purified \\u003cem\\u003ePanI\\u003c/em\\u003e was active in most of the commercially available buffers including buffer B, which is the optimum buffer for commercially available \\u003cem\\u003eHin\\u003c/em\\u003edIII (Promega). However, optimum activity of \\u003cem\\u003ePan\\u003c/em\\u003eI was observed in multi-core (MC) buffer (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e), which contained 10 mM Mg\\u003csup\\u003e2+\\u003c/sup\\u003e as a divalent cation and 100 mM K\\u003csup\\u003e+\\u003c/sup\\u003e as a monovalent cation and a pH of 7.5 (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThe optimum temperature of the partially purified enzyme appeared to be between 37\\u0026ordm;C to 50\\u0026ordm;C (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). The highest intensity of the banding pattern was observed at 40 \\u003csup\\u003e0\\u003c/sup\\u003eC. Above 70\\u0026ordm;C the activity decreased and detectable activity was observed even at 80\\u0026ordm;C, suggesting its functionality even under extreme temperatures. A previously reported, isoschizomers of \\u003cem\\u003eHin\\u003c/em\\u003edIII; \\u003cem\\u003eEco\\u003c/em\\u003eVIII also showed optimal activity at 48\\u0026deg;C, aligning with our observations (Mise and Nakajima \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e1984\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eTo determine the thermal stability of \\u003cem\\u003ePan\\u003c/em\\u003eI without the DNA substrate, partially purified enzyme was pre-incubated at different temperatures. The enzyme was found to be stable up to 40 \\u003csup\\u003e0\\u003c/sup\\u003eC for 20 minutes without the DNA substrate (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eWhole-genome sequence analysis of MatS1 revealed the presence of a complete coding sequence of a gene having a high degree of similarity to known genes encoding \\u003cem\\u003eHin\\u003c/em\\u003edIII family enzymes, reported in NCBI-GenBank database; further confirming that partially purified \\u003cem\\u003ePan\\u003c/em\\u003eI in MatS1 is an isoschizomer of \\u003cem\\u003eHin\\u003c/em\\u003ed III. The sequence information of \\u003cem\\u003ePan\\u003c/em\\u003eI was deposited in NCBI GenBank database (GenBank ID - MW140018). The complete putative ORF of \\u003cem\\u003ePan\\u003c/em\\u003eI was 912 bp and encodes a protein of 304 amino acids with a predicted molecular weight of ~\\u0026thinsp;34.6 kDa and a theoretical iso-electric point of 6.18. This predicted molecular weight is in agreement with the empirically estimated range of molecular weight (30\\u0026ndash;50 kDa) of partially purified \\u003cem\\u003ePan\\u003c/em\\u003eI. The protein sequence has a region that resembles the partially conserved \\u003cem\\u003eHin\\u003c/em\\u003edIII endonuclease superfamily signature (residues 13\\u0026ndash;292) and several conserved substrate binding sites (DNA) as predicted by COACH online server (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig10\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003e - (Yang et al. \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). Based on the pairwise sequence alignment, \\u003cem\\u003ePan\\u003c/em\\u003eI shared significant sequence relatedness with its bacterial counterparts with a maximum similarity of 89.1 % and identity of 76.3 % with that of \\u003cem\\u003eCylindrospermopsis raciborskii\\u003c/em\\u003e, validating its homology to known \\u003cem\\u003eHin\\u003c/em\\u003edIII counterparts (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e\\u003cstrong\\u003eT\\u003c/strong\\u003e\\u003cstrong\\u003eable\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;2.\\u003c/strong\\u003e Percentage similarity and identity of\\u0026nbsp;\\u003cem\\u003ePan\\u003c/em\\u003eI\\u0026nbsp;with different homologues.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellpadding=\\\"0\\\" cellspacing=\\\"0\\\" width=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eSpecies name\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eRestriction Endonuclease (RE)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNCBI_GenBank Accession Number\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eLength (amino acids)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e% Identity\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e% Similarity\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eCylindrospermopsis raciborskii\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHin\\u003c/em\\u003edIII family\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eWP071241953\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e76.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e89.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003ePseudomonas mygdali\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHin\\u003c/em\\u003edIII family\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eWP057425488\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e73.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e85.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003ePseudomonas meliae\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHin\\u003c/em\\u003edIII family\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eWP054991699\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e73.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e85.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eThermoflexibacter ruber\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHin\\u003c/em\\u003edIII family\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eWP091549217\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e69.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e82.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eChlorobi bacterium OLB4\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHin\\u003c/em\\u003edIII family\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eKXK03935\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e66.9\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e82.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eBacteroidetes bacterium RIFCSPLOWO2\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003eRE\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eOFY69087\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e66.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e82.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eIgnavibacteria bacterium\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003eRE\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eOIO24181\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e65.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e82.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eBacteroidales bacterium Barb6XT\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHin\\u003c/em\\u003edIII family\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eWP066182127\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e62.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e80.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003ePlanktothrix sp. PCC 11201\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHin\\u003c/em\\u003edIII family\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eWP079679536\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e61.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e78.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eGeminocystis herdmanii\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHin\\u003c/em\\u003edIII family\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eWP017294927\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e60.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e78.0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003e\\u0026nbsp;Arthrospira\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHin\\u003c/em\\u003edIII family\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eWP006621132\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e60.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e77.0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eOscillatoria acuminate\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHin\\u003c/em\\u003edIII family\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eWP015150672\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e59.0\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e77.7\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eChlorobi bacterium OLB7\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHin\\u003c/em\\u003edIII family\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eKXK52534\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e303\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e58.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e79.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eEnterobacteriaceae\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHin\\u003c/em\\u003edIII family\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eWP015059042\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e307\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e55.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e73.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eAquamicrobium aerolatum\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHin\\u003c/em\\u003edIII family\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eWP091525013\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e304\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e55.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e71.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eEscherichia coli\\u003c/em\\u003e\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eHin\\u003c/em\\u003edIII family\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eWP024235892\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e308\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e54.4\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e72.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"31.947483588621445%\\\"\\u003e\\n \\u003col\\u003e\\n \\u003cli\\u003e\\u003cem\\u003eEscherichia coli\\u003c/em\\u003e (Plasmid)\\u003c/li\\u003e\\n \\u003c/ol\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"15.973741794310722%\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eEco\\u003c/em\\u003eVIII\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"16.849015317286653%\\\"\\u003e\\n \\u003cp\\u003eAAA91203\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"13.238512035010942%\\\"\\u003e\\n \\u003cp\\u003e333\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"9.956236323851204%\\\"\\u003e\\n \\u003cp\\u003e51.5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd valign=\\\"top\\\" width=\\\"12.035010940919037%\\\"\\u003e\\n \\u003cp\\u003e67.6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\u003cp\\u003eIn the phylogenetic reconstruction, \\u003cem\\u003ePanI\\u003c/em\\u003e was clustered with known bacterial \\u003cem\\u003eHin\\u003c/em\\u003edIII family enzymes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e). According to the tree topology, \\u003cem\\u003ePan\\u003c/em\\u003eI was closely clustered with \\u003cem\\u003ePseudomonas Hin\\u003c/em\\u003edIII homologs. However, it showed its highest evolutionary relationship to its counterpart in C. \\u003cem\\u003eraciborskii\\u003c/em\\u003e, by forming a sub-clade with it in the main cluster which also harbors \\u003cem\\u003eHin\\u003c/em\\u003edIII family enzymes of \\u003cem\\u003ePseudomonas\\u003c/em\\u003e species, with high bootstrapping support (85).\\u003c/p\\u003e \\u003cp\\u003eThis pattern of clustering suggests a possible horizontal gene transfer event between \\u003cem\\u003eP. anguliseptica and C. raciborskii\\u003c/em\\u003e with respect to \\u003cem\\u003eHin\\u003c/em\\u003edIII like protein coding gene, which is also further reinforced by the pronounced sequence identity of \\u003cem\\u003ePan\\u003c/em\\u003eI with \\u003cem\\u003eC. raciborskii\\u003c/em\\u003e HindIII family protein, compared to those from other two \\u003cem\\u003ePseudomonas\\u003c/em\\u003e species (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). However, further investigations are warranted for the validation of this likelihood.\\u003c/p\\u003e \\u003cp\\u003eI-TASSER online server predicted the tertiary structure of \\u003cem\\u003ePan\\u003c/em\\u003eI based on 10 threading templates identified from the research Collaboratory for Structural Bioinformatics (RCSB) protein data bank, of which the normalized Z score of the threading alignments was between 2.27 to 11.92, confirming the credibility of each alignment. The most reliable model with a substantial global accuracy, measured by C-score (1.00) with estimated TM-score of 0.85\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.08 and RMSD of 4.2\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.8 A was selected for visualization on PyMol software.\\u003c/p\\u003e \\u003cp\\u003eAccording to the generated model, \\u003cem\\u003ePan\\u003c/em\\u003eI consists of 15 α-helices and 1 β pleated sheet with five strands (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig10\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eA). However, the monomeric form of the empirically determined crystal structure of \\u003cem\\u003eHin\\u003c/em\\u003edIII was found to be made up of 16 α-helices and 2 β pleated sheets; one with two strands, and the other with five strands (Watanabe et al. \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e2009\\u003c/span\\u003e). Thus, comparison of these two structures suggests that the five stranded β pleated sheet is conserved in \\u003cem\\u003ePan\\u003c/em\\u003e I. Moreover, in compliance with the \\u003cem\\u003eHin\\u003c/em\\u003edIII crystal structure, the first strand of the five stranded β sheet is oriented in a parallel direction with the fifth strand in the predicted tertiary structure of \\u003cem\\u003ePan\\u003c/em\\u003eI\\u003c/p\\u003e \\u003cp\\u003eAs a part of the computer based simulation performed by I-TASSER, potential DNA substrate binding sites were predicted based on the modeled tertiary structure of \\u003cem\\u003ePan\\u003c/em\\u003eI along with the three dimensional structure of the enzyme - cognate DNA complex, by using COBOLT and COFACTOR algorithms (Yang et al. \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). The most reliable prediction with the highest C-score (0.55) and cluster size (35) consists of 8 potential DNA binding residues, namely from the N terminal, Ser-31, Thr-69, Asp-67, Lys-72, Ala-127, Asn-129, Lys-131 and Lys-284 with a binding probability of over 0.5 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig10\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eB). The repeated occurrence of positively charged amino acid, Lys in the binding site indicates potentially strong interactions between negatively charged DNA and the enzyme via formation of ionic bonds. As expected, the cognate stretches of DNA which overlaps with the active site of the enzyme was predicted to bear the consensus \\u003cem\\u003eHin\\u003c/em\\u003edIII recognition sequence \\u0026lsquo;AAGCTT\\u0026rsquo; validating the empirically determined recognition sequence of \\u003cem\\u003ePan\\u003c/em\\u003eI.\\u003c/p\\u003e\"},{\"header\":\"Conclusions\",\"content\":\" \\u003cp\\u003eREs are powerful tools used in molecular biology and genetic engineering. In this study, several soil and water samples were screened for the isolation of restriction enzyme producing bacteria. Potent \\u003cem\\u003eHin\\u003c/em\\u003edIII like activity was observed in the cell-free extract of an isolate designated MatS1 and was identified as a novel strain of \\u003cem\\u003ePseudomonas anguilliseptica\\u003c/em\\u003e through 16S rRNA analysis. The restriction enzyme isolated from this organism was designated as \\u003cem\\u003ePan\\u003c/em\\u003eI. The isolated enzyme was partially purified and characterized in relation to its recognition sequence and optimum reaction conditions for DNA digestion. The recognition sequence was found to be 5\\u0026prime;AAGCTT 3\\u0026prime; and revealed \\u003cem\\u003ePan\\u003c/em\\u003e1 to be an isoschizomer of \\u003cem\\u003eHin\\u003c/em\\u003edIII. The whole genome of MatS1 was sequenced and the gene for \\u003cem\\u003ePan\\u003c/em\\u003eI was identified and characterized.\\u003c/p\\u003e \"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe are grateful to Mr. H. M. J. C. B. Herath, Dr. Y.C. Guruge, Mr. Chatura Samarasinghe, Mr. Charitha Samarasinghe, Mrs. Padmini Wijenayake and Mr. K.M.Karunajeewa for their generous assistance in collecting soil and water samples for the study and Dr. (Mrs.) W.W.P. Rodrigo for her kind assistance in Bioinfomatic analysis. This research study was supported by a grant (RG/2014/BT/2) from National Science Foundation, Sri Lanka.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis research study was supported by a grant (RG/2014/BT/2) from the National Science Foundation, Sri Lanka.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors\\u0026nbsp;Swarna Nirosha Jayasinghe Pathirana, Don Anushka Sandaruwan Elvitigala, Chandrika Malkanthi Nanayakkara,\\u0026nbsp;Prashanth Suravajhala, Sanath Rajapakse,\\u003csup\\u003e\\u0026nbsp;\\u003c/sup\\u003eGardhi Hettiarachchige Chamari Madhu Hettiarachchi and Naduviladath Vishwanath Chandrasekharan\\u0026nbsp;declare that they have no competing interests.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCode availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCRediT authorship contribution statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eSwarna Nirosha Jayasinghe Pathirana:\\u003c/strong\\u003e Data curation, Investigations, Formal analysis, Methodology, Project administration, Writing\\u0026nbsp;original draft; \\u003cstrong\\u003eDon Anushka Sandaruwan Elvitigala\\u003c/strong\\u003e: Formal analysis; Methodology; Writing-review and editing; \\u003cstrong\\u003eChandrika Malkanthi Nanayakkara:\\u003c/strong\\u003e\\u003csup\\u003e\\u0026nbsp;\\u003c/sup\\u003eWriting-review and editing, Supervision, Methodology; \\u003cstrong\\u003ePrashanth Suravajhala\\u003c/strong\\u003e: Writing-review and editing, methodology, Formal analysis; \\u003cstrong\\u003eSanath Rajapakse:\\u003c/strong\\u003e Writing-review and editing, methodology, Resources, Supervision; \\u003cstrong\\u003eGardhi Hettiarachchige Chamari Madhu Hettiarachchi:\\u003c/strong\\u003e Funding acquisition, Project administration, Supervision, Methodology; \\u003cstrong\\u003eNaduviladath Vishwanath Chandrasekharan:\\u003c/strong\\u003e Conceptualization, Funding acquisition, Data curation, Formal analysis, Methodology, Project administration, Resources, Writing-review and editing, Supervision\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eBerlin K, Koren S, Chin CS et al (2015) Assembling large genomes with single-molecule sequencing and locality-sensitive hashing. Nat Biotechnol 33:623\\u0026ndash;630. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/nbt.3238\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBhumbla U, Bhumbla U (2018) Gram\\u0026rsquo;s Staining. In: Workbook for Practical Microbiology. Jaypee Brothers Medical Publishers (P) Ltd., pp\\u0026nbsp;30\\u0026ndash;30\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDelcher AL, Bratke KA, Powers EC, Salzberg SL (2007) Identifying bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics 23:673\\u0026ndash;679. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1093/bioinformatics/btm009\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDi Felice F, Micheli G, Camilloni G (2019) Review Restriction enzymes and their use in molecular biology: An overview. J Biosci 44:. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s12038-019-9856-8\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKazennova EV, Tarasov AP, Mileikovskaia MM, Tsevetkova NV (1982) Isolation and purification of restriction endonuclease BpeI from Bordetella pertussis. ZH Mikrobiol Epidemiol immunnobiol 6:56\\u0026ndash;57\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLoenen WAM, Dryden DTF, Raleigh EA et al (2014a) Highlights of the DNA cutters: A short history of the restriction enzymes. Nucleic Acids Res 42:3\\u0026ndash;19. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1093/nar/gkt990\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLoenen WAM, Dryden DTF, Raleigh EA, Wilson GG (2014b) Type I restriction enzymes and their relatives. Nucleic Acids Res 42:20\\u0026ndash;44. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1093/nar/gkt847\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMccarthy A (2010) Third generation DNA sequencing: Pacific biosciences\\u0026rsquo; single molecule real time technology. Chem Biol 17:675\\u0026ndash;676\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMise K, Nakajima K (1984) Isolation of restriction enzyme EcoVIII, an isoschizomer of \\u003cem\\u003eHin\\u003c/em\\u003edIII, produced by \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e E1585-68. Gene 30:79\\u0026ndash;85. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/0378-1119(84)90107-0\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOkonechnikov K, Golosova O, Fursov M et al (2012) Unipro UGENE: A unified bioinformatics toolkit. Bioinformatics 28:1166\\u0026ndash;1167\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePingoud A, Fuxreiter M, Pingoud V, Wende W (2005) Type II restriction endonucleases: Structure and mechanism. Cell Mol Life Sci 62:685\\u0026ndash;707\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePingoud A, Jeltsch A (2001) Structure and function of type II restriction endonucleases. Nucleic Acids Res 29:3705\\u0026ndash;3727\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePingoud A, Wilson GG, Wende W (2014) Type II restriction endonucleases\\u0026ndash;a historical perspective and more. Nucleic Acids Res 42:7489\\u0026ndash;7527. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1093/nar/gku447\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRoberts RJ (1976) Restriction endonucleases. CRC Crit Rev Biochem 4:123\\u0026ndash;164\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSistla S, Rao DN (2004) S-Adenosyl-L-methionine-dependent restriction enzymes. Crit Rev Biochem Mol Biol 39:1\\u0026ndash;19\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTamura K, Stecher G, Peterson D et al (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725\\u0026ndash;2729. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1093/molbev/mst197\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWatanabe N, Takasaki Y, Sato C et al (2009) Structures of restriction endonuclease \\u003cem\\u003eHin\\u003c/em\\u003edIII in complex with its cognate DNA and divalent cations. Acta Crystallogr Sect D Biol Crystallogr 65:1326\\u0026ndash;1333. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1107/S0907444909041134\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWeisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173:697\\u0026ndash;703. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1128/jb.173.2.697-703.1991\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWilliams RJ (2003) Restriction endonucleases: classification, properties, and applications. Mol Biotechnol 23:225\\u0026ndash;243\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWilson GG, Murray NE (1991) Restriction and modification systems. Annu Rev Genet 25:585\\u0026ndash;627. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1146/annurev.ge.25.120191.003101\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYang J, Roy A, Zhang Y (2013) BioLiP: A semi-manually curated database for biologically relevant ligand-protein interactions. Nucleic Acids Res 41:. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1093/nar/gks966\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYang J, Zhang Y (2015) I-TASSER server: New development for protein structure and function predictions. Nucleic Acids Res 43:W174\\u0026ndash;W181. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1093/nar/gkv342\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Restriction Enzymes, HindIII Isoschizomer, Pseudomonas angulliseptica, Whole-genome sequencing\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-600889/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-600889/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eType II restriction enzymes (REs) which can cleave double stranded DNA in a sequence specific manner have many applications in recombinant DNA technology and are considered the work horses of molecular biology. Soil and water samples were screened for isolation of bacteria, harboring restriction enzymes. Cell lysates of isolated bacteria were incubated with unmethylated λ DNA, followed by analysis by agarose gel electrophoresis. The presence of distinct banding patterns indicated the presence of REs.\\u0026nbsp;Nine putative isolates harboring REs were morphologically and molecularly characterized using 16S rRNA analysis and belonged to four different genera (\\u003cem\\u003eAcinetobacter, Lysinibacillus, Pseudomonas, \\u003c/em\\u003eand \\u003cem\\u003eBrevibacillus\\u003c/em\\u003e). \\u0026nbsp;\\u0026nbsp;\\u003c/p\\u003e\\u003cp\\u003eA\\u003cem\\u003e Hin\\u003c/em\\u003edIII like restriction digestion profile was observed in a lysate of a soil bacterium belonging \\u0026nbsp;\\u0026nbsp;\\u0026nbsp;\\u0026nbsp;to genus \\u003cem\\u003ePseudomonas\\u003c/em\\u003e. Based on 16S rRNA analysis, the bacterial species was identified as \\u003cem\\u003eP. angulliseptica. \\u003c/em\\u003eThe enzyme was partially purified and optimum conditions for enzyme activity and its recognition sequence were determined. The enzyme showed optimum activity at 40 \\u003csup\\u003e0\\u003c/sup\\u003eC and was stable at 40 \\u003csup\\u003e°\\u003c/sup\\u003eC for 20 minutes without the DNA substrate. The Recognition sequence of the enzyme was determined and found to be 5’AAGCT 3’ indicating it to be an isoschizomer of \\u003cem\\u003eHin\\u003c/em\\u003edIII.\\u0026nbsp;\\u0026nbsp;\\u0026nbsp;\\u0026nbsp;\\u003c/p\\u003e\\u003cp\\u003eThe whole genome of the \\u003cem\\u003ePseudomonas\\u003c/em\\u003e species was sequenced and the coding sequence of the gene for the putative \\u003cem\\u003eHin\\u003c/em\\u003edIII isoschizomer was identified together with other genes encoding putative REs. The gene coding for the \\u003cem\\u003eHin\\u003c/em\\u003edIII isoschizomer was analyzed \\u003cem\\u003ein silico\\u003c/em\\u003e and its homology and evolutionary relationship to other known isoschizomers of \\u003cem\\u003eHin\\u003c/em\\u003edIII were determined. The enzyme was tentatively designated as \\u003cem\\u003ePan\\u003c/em\\u003eI.\\u0026nbsp;\\u003c/p\\u003e\",\"manuscriptTitle\":\"Isolation, Partial Purification and Characterization of a Novel Restriction Enzyme from Pseudomonas Anguilliseptica\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2021-06-17 18:35:28\",\"doi\":\"10.21203/rs.3.rs-600889/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"c46db70e-905a-4e59-96f3-45c20f5f3936\",\"owner\":[],\"postedDate\":\"June 17th, 2021\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":5081410,\"name\":\"General Microbiology\"}],\"tags\":[],\"updatedAt\":\"2021-06-25T08:22:06+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2021-06-17 18:35:28\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-600889\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-600889\",\"identity\":\"rs-600889\",\"version\":[\"v1\"]},\"buildId\":\"7rjqhiLT3MXkJMwkYKINL\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}