{"paper_id":"25dc8835-d4d3-4aa7-a4d7-bc8b1c17b4df","body_text":"Phenotypic diversity and hybridization of wild Saccharomyces for improving bioethanol production | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Phenotypic diversity and hybridization of wild Saccharomyces for improving bioethanol production Ignacio Guarda, Catalina Ardiles, Sebastián Dehnhardt-Amengual, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8138800/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background The transition toward sustainable energy sources requires alternatives to fossil fuels that are both efficient and environmentally friendly. Bioethanol has emerged as a promising substitute for gasoline; however, its production is limited by substrate complexity, fermentation inhibitors, and microbial stress tolerance. Conventional bioethanol relies largely on Saccharomyces cerevisiae , which has a restricted capacity to metabolize pentose sugars and withstand industrial stresses such as high ethanol and osmotic pressure. Expanding the diversity of yeasts used in bioethanol processes may help overcome these limitations. Saccharomyces eubayanus , a wild yeast species from Patagonia, exhibits exceptional tolerance to extreme environments, particularly low temperatures, and shows extensive population genetic and phenotypic diversity. Its adaptability and reproductive compatibility make it a strong candidate for industrial biotechnology applications, including the generation of intraspecific hybrids with enhanced stress resistance and improved fermentative performance. Results In this study, we evaluated the phenotypic diversity of S. eubayanus isolates under conditions relevant to bioethanol fermentation and applied mass-mating approaches to generate hybrids with improved fermentative traits. The resulting strains were assessed for their performance under stressors that mimic second-generation bioethanol production, including high ethanol concentrations, osmotic stress, and inhibitory compounds derived from lignocellulosic biomass pretreatments. Our analysis demonstrated substantial variation among isolates and identified hybrid strains with enhanced tolerance and fermentative potential. Conclusions Our findings highlight the untapped potential of S. eubayanus diversity for bioethanol research and demonstrate the value of mass-mating as a strategy to generate robust, high-performing strains. This work provides a framework for harnessing natural genetic resources to advance efficient, resilient, and sustainable biofuel production. bioethanol production yeast biodiversity Saccharomyces eubayanus intraspecific hybrids stress tolerance Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Background One of the main challenges regarding energy use in the industrial and transportation sectors is the reduction of fossil fuel consumption ( 1 ). The growing demand for environmentally friendly energy sources presents an opportunity to obtain energy from less polluting alternatives ( 2 ). One such option is the production of bioethanol as a substitute for gasoline ( 3 ). Bioethanol is ethanol produced through the use of specific microorganisms ( 4 ), and can be obtained through several approaches ( 5 ). First-generation bioethanol is produced from readily available simple sugars and starch sources such as corn or sugarcane ( 6 ). Second-generation bioethanol is derived from non-food biomass, such as agricultural residues or wood pulp, and requires more complex pre-processing to release fermentable sugars ( 6 , 7 ). Finally, third-generation bioethanol is extracted and purified from microalgae biomass ( 8 ). Essentially, the main difference between first- and second-generation bioethanol lies in the raw material used: first-generation production utilizes simple sugars, whereas second-generation production relies on lignocellulosic materials that are more difficult to break down ( 9 ). These materials, cellulose and hemicellulose, must first be converted into simple sugars such as glucose, fructose, or xylose to enable fermentation into ethanol ( 6 , 10 ). These simple sugars are subsequently fermented into ethanol by yeasts, primarily those belonging to the Saccharomyces genus ( 11 ). Second-generation bioethanol fermentation involves the presence of high salt concentrations and other inhibitory factors, which are typically byproducts of the chemical pretreatment applied to biomass to improve cellulose and hemicellulose accessibility for hydrolysis ( 12 ). Hydrolysates derived from lignocellulosic sources also contain high levels of pentose sugars, particularly xylose, which native strains of S. cerevisiae either inefficiently metabolize or do not consume at all ( 13 ). Nevertheless, a limited set of Saccharomyces strains has been utilized for bioethanol production, limiting the optimization of the bioethanol production process ( 14 ). Exploring the phenotypic diversity of Saccharomyces strains may offer an attractive strategy to identify yeasts with improved traits for bioethanol production, such as enhanced resistance to stressors ( 15 ). In this context, Saccharomyces eubayanus has risen as a valuable resource of genetic and phenotypic diversity. This species was identified in the past decade in Patagonia, where it was isolated from the bark of trees of the Nothofagus genus ( 16 ). One of the most remarkable features of S. eubayanus is its resistance to extreme environments. This yeast is capable of surviving and thriving at very low temperatures ( 16 ), making it an organism of high interest in studies of stress tolerance. Its ability to endure cold conditions presents potential applications in industrial biotechnology, especially for fermentation processes in cold climates, as well as for the development of industrial systems that require robust organisms ( 17 ). The high genetic and phenotypic diversity of S. eubayanus allows its species to adapt and survive across a wide range of environmental conditions, from the temperate climates of central-southern regions of Chile to the extreme environments of southern Patagonia ( 18 ). This variability could be particularly relevant in the context of biofuel production, as certain strains may show enhanced resistance to the harsh conditions of fermentation processes, such as high ethanol concentrations and osmotic stress caused by high sugar levels ( 19 ). Furthermore, the reproductive compatibility among different S. eubayanus strains opens the possibility of generating hybrids with improved phenotypic traits ( 20 ), such as increased resistance to the necessary characteristics for bioethanol production ( 21 ). This genetic and phenotypic diversity is not only crucial for improving industrial strains for biofuel production, but also for optimizing other fermentation processes ( 22 ). The combination of suitable traits in hybrid strains offers an alternative to previously tested approaches, such as experimental evolution, particularly for enhancing ethanol tolerance in this species ( 23 ). In this regard, the manipulation and selection of strains through mating strategies may facilitate the obtention of hybrid strains with enhanced tolerance to adverse conditions, thereby improving the efficiency and sustainability of industrial biofuel production ( 24 ). Exploiting this genetic diversity represents a fundamental strategy for advancing more robust and efficient fermentation processes in the biotech industry. For these reasons, this research aims to evaluate phenotypic traits of S. eubayanus strains, followed by a mass-mating process using selected isolates, to combine desirable characteristics. The main goal is to generate intraspecific hybrids with improved tolerance to bioethanol production conditions and subsequently evaluate their performance under fermentative environments. Methods Strains The utilized strains comprise a set of 79 wild S. eubayanus previously isolated from Chilean Patagonia ( 18 ). The yeasts were maintained on YPD (1% Yeast Extract, 1% Peptone, and 2% Dextrose) agar (1.5%) plates. As a control, the Lager industrial strain S. pastorianus W34/70 ( 25 ) and the native S. cerevisiae SACE-YBS ( 26 ) were utilized. Sporulation rate To induce sporulation, S. eubayanus strains were grown on a medium consisting of 2% potassium acetate (KAc) in 1.5% agar at 20°C for 5 days. After this period, a small sample from each culture plate was collected and diluted to a 1:500 ratio to ensure uniformity and facilitate subsequent analysis. Diluted samples were transferred into 96-well ELISA plates to allow parallel analyses. Sporulation rate was evaluated using a bright-field microscope integrated in the Cytation 3 Cell Imaging Multi-Mode Reader at 200X (Agilent BioTek, USA). The tetrads were identified manually from the acquired images, and the percentage was calculated by comparing the number of cells exhibiting sporulation to the total number of cells observed (at least 100 cells per strain). Phenotypic landscape evaluation The growth of yeast strains under various conditions was evaluated in liquid media. Each strain was assessed for its ability to utilize different carbon sources: 2% maltose, 2% fructose, 2% galactose, 2% sucrose, 2% lactose, 2% raffinose, 2% maltodextrin, 2% xylose, 6 °Brix malt extract, and 2% glycerol. Additional conditions included growth under osmotic stress (20% sorbitol), halotolerance (1.25 mM KCl and 1.25 mM NaCl), and tolerance to cytotoxic agents (7 mM caffeine, 4 mM CuSO₄, 3 mM H₂O₂, 0.5 mM DTT, 0.001% SDS, 200 µg/mL G418, and 1.75 mM p-coumaric acid). Additionally, alcohol tolerance was evaluated using 8% ethanol and 8% methanol. A glucose 2% medium was used as a control condition. Growth was also tested in a synthetic molasses-based medium (SMB) simulating industrial sugarcane fermentation conditions (Table S1 a) ( 27 ). All stress condition media, except those used for carbon source utilization assays, were supplemented with 0.67% YNB- 2% glucose (USBiological, USA), while carbon source media were supplemented only with 0.67% YNB. Before growth measurements, all strains were pre-cultured for 24 h in YNB- 2% glucose at 20°C. For the assay, 5 µL of each pre-inoculum was added to 195 µL of the test medium in 96-well plates, which were then incubated at 25°C. Optical density at 600 nm (OD 600 ) was recorded hourly using a Cytation 3 reader with a BioStack 4 Stacker (Agilent BioTek, USA). Growth curves were used to calculate µmax kinetic parameter using the R package “gcplyr” ( 28 ). The heatmaps were generated using “pheatmap” package with clustering in R. In the same way, the PCA analysis was performed using “prcomp” with the function “fviz_nbclust” in R, to determine the optimal number of groups. Fermentation rate The fermentative capacity of the yeast strains was evaluated by the estimation of CO₂ loss ( 23 ). A pre-inoculum was prepared on YPD liquid medium and incubated for 24 h at 20°C. After incubation, cultures were centrifuged at 3000 × g to pellet the cells. The supernatant was partially removed, and the cells were resuspended in the remaining medium, then diluted 1:500. The cell concentration was determined by using a Neubauer chamber. The strains were inoculated at a concentration of 1.7 × 10⁸ cells/mL in SMB liquid medium and incubated at 12°C. Fermentations were monitored daily for 15 days by measuring the weight loss. This loss corresponds to CO₂ production resulting from sugar fermentation, providing an indirect measure of ethanol production ( 29 ). GFP and mCherry tagged strains The genetic construct for introducing the fluorescent protein gene was derived from pRS426 plasmids previously assembled through in vivo recombination, containing the KanMX-GFP and Hygr-mCherry cassettes ( 30 ). For the insertion of the construct into the S. eubayanus strain via homologous recombination, PCR was performed using high-fidelity Phusion Flash polymerase (Thermo Scientific, USA) with recombination primers containing the additional sequences required for genomic recombination (Table 1 ). For the generation of mutants with the insertion of the fluorescent protein at the HO locus, a transformation was performed using the previously obtained construction in combination with the CRISPR-Cas9 technique to optimize the transformation efficiency ( 20 ). For this purpose, the pAEF plasmid containing the guide RNA sequence gRNA3 directed to the HO locus was used ( 20 ). Table 1 Primers list . Primer Sequence (5’-3’) MATa-eu ACGCCACTCCAAGTAAGAGTCT MATα-eu GCACGGAATATGGGACTACTTC MATfla-eu AGTCACATCAAGATCATTTATG Recombination-F TACATGCTCGCTGTACATGAACTCTGGGATTTGCTTCTCACCATCGAGCTATTTCAAAGAATACGTAAAT Recombination-R CCACATCTATATAGACAACAACCACTTCCACTAGCCTTTAAGCATGCTTTatcgatgaattcgagctcgt Spore isolation Tetrads formation from each selected strain was induced by growing the cultures on 2% potassium acetate agar at 20°C for 5 days. After sporulation, tetrads were sampled and diluted 1:100 in sterile water. Then, 1 µL of zymolyase (USBiological, USA) at 1 µg/mL was added to digest the ascus wall, facilitating the release of individual spores. The mixture was incubated at 37°C for 30 min. Subsequently, glass beads were added, and the mixture was vortexed for 20 s to disaggregate the tetrads. Beads were removed, and 1 mL of sterile water was added to the suspension. Spore enrichment was completed by microfiltration using 5 µm pore-size filters for retaining non-dispersed tetrads and non-sporulated cells (Millex, Ireland). To verify successful isolation of haploid spores, they were plated on YPD agar. Colony PCR was performed to amplify regions of the MAT gene to determine the mating type. For this, colonies were picked up and transferred into 50 mM NaOH, incubated for 5 minutes at 100°C, and centrifuged at 3000 × g for 3 min. The supernatant was transferred to a new tube, and 1 µL was used as DNA template for PCR amplification with MAT -specific primers (see Table 1 ), using GoTaq® Green Master Mix (Promega, USA). Mass-mating and hybrid isolation Once haploid spores were obtained from each of the parental strains of S. eubayanus , equivalent quantities of spores from each parental strain were collected and pooled into a single tube. The resulting mixture was supplemented with liquid YPD medium to a final volume of 5 mL and incubated at 20°C until biomass formation was observed. In parallel, an identical procedure was carried out using the previously described synthetic SMB medium supplemented with 9% ethanol. This enrichment process was repeated twice to favor the propagation of yeast strains with major fitness in this specific medium. After the final enrichment cycle, the yeast population was plated onto YPD agar and SMB agar supplemented with 9% ethanol to obtain individual colonies. Isolated colonies were further analyzed by PCR using the MAT locus to confirm their hybrid nature. Statistical analysis For evaluating the statistical differences, the two-way ANOVA ( 31 ) and Bartlett's test ( 32 ) were utilized. Results Phenotypic landscape of parental S. eubayanus strains One of the main features of wild-type yeast is its ability to undergo sporulation, a key trait for survival in natural environments ( 33 ). To evaluate the diversity of the sporulation performance in the S. eubayanus , 79 strains were cultured on potassium acetate medium. After incubation, the samples were observed under a microscope, and the percentage of formed tetrads (spores) was determined (Fig. 1 A). The S. eubayanus strains exhibited sporulation rates ranging from ~ 50% to ~ 90%, indicating that there exists a differential tendency of the strain to sporulate in this medium (Fig. 1 B and Table S1 b. The five strains with the highest sporulation percentages were CL710.1, CL813.1, CL915.1, and CL1112.1, whereas the five lowest were CL211.3, CL814.1, CL449.1, CL601.1, and CL450.1. The S. eubayanus strains analyzed belong to different sample places in Chile from Talca to Karukinka (35.4° S to 54.0° S). This range encompasses a broad climatic gradient that transitions from a temperate Mediterranean regime in the central region (Talca) to cold temperate and subpolar conditions in the southernmost areas, marked by increasing precipitation, decreasing temperatures, and the influence of strong westerly winds toward higher latitudes (Karukinka) ( 34 ). The differences in the ecological niches may influence the metabolism of each strain, reflecting adaptations to their specific environment ( 35 ). Considering the above, the strains were cultivated in liquid media using 96-well microplates to assess differences in phenotypic behavior related to carbon source assimilation and resistance to various stressors, some of which mimic the conditions encountered during bioethanol fermentation ( 36 ). The growth was monitored by measuring OD 600 , and kinetic parameters were calculated from the growth curves. Using the µmax value as a fitness parameter, a heatmap with hierarchical clustering and PCA analysis was performed. For this analysis, growth values of each strain in each condition were normalized to growth in the control medium (YNB-2% Glucose). For a more comprehensive analysis of characteristics, the phenotyping was separated into “carbon sources assimilation” and “stressors resistance”. Heatmap analysis of carbon source assimilation revealed six different clusters (Fig. 2 and Table S1 c, each displaying different phenotypic profiles among the analyzed strains. The heatmap shows a high degree of phenotypic variability, as reflected by the wide range of growth rates (Fig. 2 ). Interestingly, all the members of Cluster A, comprising CL1106.1, CL1110.1, CL607.1, CL610.1, CL821.1, CL906.1, CL815.1, and CL910.1, showed enhanced growth in media containing fructose. Additionally, only some strains of Cluster C show enhanced growth in fructose, but all members were able to grow in this condition, when compared to other Clusters. All strains showed high growth rate in sucrose, maltose, and raffinose, in comparison to other carbon sources such as galactose, sorbitol, and xylose. Interestingly, only Cluster A shows a reduced growth rate in sucrose, maltose, and raffinose, compared with the other clusters. Interestingly, the strains belonging to Cluster B (CL1112.1, CL1004.1, CL1111.1, CL1108.1, and CL1109.1) showed the highest performance in maltodextrin medium. Conversely, Clusters D, E, and F showed a relatively homogeneous phenotypic pattern, with only Cluster D exhibiting enhanced growth in malt extract medium. This observation could reflect a higher resistance of these strains to the major concentration of the malt extract medium (6° brix). Finally, only Cluster A possesses strains (CL607.1, CL610.1, CL1001.1, and CL1010.1) with a higher capacity to grow in the medium that emulates the bioethanol molasses (SMB). Furthermore, the PCA analysis of carbon source assimilation identified four distinct groups (Figure S1 ). Interestingly, one of them comprised strains sharing a similar geographic origin (Group 1). For strain isolation, the southern region of Chile was divided into latitudinal zones (e.g., Region 200, Region 300, etc.), and strains from each zone were assigned numerical codes within the same hundred series ( 18 ). Accordingly, Group 1 mainly comprised strains collected from sites located within the 800 and 900 regions (Figure S1 ). As was mentioned above, the strains were grown in different stressor media that can emulate some of the stresses present in bioethanol fermentation (Fig. 3 , Figure S2 , and Table S1 d). The analysis of the heatmap shows that the strains of Cluster J are evidently more resistant to the reductor effect of DDT in comparison to other Clusters (Fig. 3 ). In the same way, the strains of Cluster G are the only ones that presented a superior growth on SDS in comparison to the other Clusters. Interestingly, most of the strains (Cluster G and H) are tolerant to NaCl and p-coumaric acid, the latter acts as a microbial growth inhibitor and is present in several lignocellulosic agro-industrial wastes. Additionally, the data show that practically all the strains are sensitive to KCl, H 2 O 2, and the antibiotic G418, the latter being particularly relevant if the strains are intended for use in recombinant DNA technologies ( 37 ). Additionally, the PCA analysis of strains growth in different stressors media shows three groups (Figure S2 ). A similar grouping phenomenon was observed compared with the carbon sources grouping, with Group 1 composed of strains from 800 and 900 sampling sites, reinforcing the idea of a correlation between the phenotypic behavior and the sampling environment. Saccharomyces yeasts possess the intrinsic ability to ferment simple sugars into alcohol while maintaining ethanol tolerance ( 38 ). To evaluate this trait, we tested the alcohol tolerance of the strains, a key feature for industrial fermentation. The strains were cultured in YNB-Glucose 2% medium supplemented with 8% ethanol or 8% methanol, and a heatmap with hierarchical clustering based on µmax values was generated (Fig. 4 and Table S1 e. The analysis revealed that Cluster K was the most sensitive to ethanol, whereas Cluster N showed the highest tolerance. Among the latter, the most tolerant strains were CL1112.1, CL1104.1, and CL607.1. In contrast, for methanol tolerance, Cluster O displayed the greatest resistance, followed by Clusters Q and P, with CL814.1, CL816.1, and CL905.1 identified as the most tolerant strains. Based on their growth performance and sporulation capacity, seven S. eubayanus strains were selected as parentals for spore isolation and mass-mating to maximize the obtaining of phenotypic diversity. The rationale was to combine favorable genetic variants within a single genetic background to achieve improved strains for SMB fermentation. The selected strains were CL910.1, CL813.1, CL1112.1, CL824.1, CL1109.1, CL915.1, and CL1002.1, chosen for their enhanced growth in fructose, sucrose, maltodextrin, NaCl, 8% ethanol, p-coumaric acid, and raffinose, respectively. As previously mentioned, the parental strains exhibit differential growth on various carbon sources and stressors, traits that could influence their overall fermentative performance. To assess this capacity, a fermentation was conducted in SMB medium using the selected parental strains. Fermentation rate of parental strains The first step in assessing the fermentative potential of the selected parental strains was to evaluate their growth performance in SMB medium supplemented with 9% ethanol (SMB-9% ethanol). Given this condition, the selected strains will undergo a stringent selective bottleneck in the subsequent experimental stages (Fig. 5 ). As a control, the strains were also cultured in YPD medium. As expected, they displayed superior growth in YPD, a nutrient-rich medium that supports yeast proliferation, compared to SMB-9% ethanol, which poses a stringent condition for microbial growth. Considering the performance in the SMB-9% ethanol medium, strain CL815.1 (1.08 OD/h) showed the lowest growth rate, whereas CL1112.1 (1.27 OD/h) exhibited the highest, likely reflecting its major ethanol tolerance (Fig. 4 ). Fermentation capacity was further evaluated in the SMB medium (Fig. 6 ). Considerable variability in fermentation performance profile was observed among the parental strains, but no significant differences were observed between CL824.1, CL1112.1, CL813.1, CL1102.1, and CL915.1 at the final stage of the fermentation (one-way ANOVA analysis). When compared with the domesticated industrial lager strain W34/70, S. eubayanus showed a similar final fermentation performance but displayed distinct kinetics, being more active during the initial stages of fermentation. The most efficient strain was the wild-type S. cerevisiae SACE-YBS, included as a positive control ( 26 ), which outperformed all other strains in terms of fermentation kinetics. These results underscore the intraspecific variability in fermentation performance profiles and highlight the potential for improving the selected parental strains. Mass-mating and hybrid isolation One of the main challenges of mass-mating is the capability of haploid cells to mate under liquid culture conditions ( 39 ). To evaluate this, the S. eubayanus CL444.1 strain was engineered to express GFP or mCherry by integration at the HO locus. The transformants were sporulated, and segregants of different mating types were isolated by micromanipulation and genotyped to confirm the presence of the GFP and mCherry markers (Table 1 ). Fluorescence expression in the engineered strains was further validated by fluorescence microscopy. To assess the hybridization rate, complementary mating-type strains were co-cultured in YNB supplemented with 2% glucose, and fluorescence signals were monitored over time. To ensure the identification of genuine co-localization events, each fluorescence channel was manually examined to verify exact signal superposition. Under these conditions, early growth phase and low cell density, the proportion of hybrids reached approximately 9% (Figure S3 ). Additionally, the agglomeration phenotype observed in the culture was concordant with that observed in yeasts that are predisposed to carry out mating ( 39 ). Having confirmed the feasibility of mass-mating, the next step was to obtain haploid spores from wild-type parental strains. For this purpose, tetrads were digested with zymolyase, mechanically disrupted, and filtered by size (5 µm), generating a spore-enriched suspension. Individual colonies were then analyzed to confirm their haploid status by PCR of the MAT locus, where haploids display a single band corresponding to one allele. To perform mass-mating assays, haploid cells from each parental strain were mixed in equal proportions and incubated in YNB- 2% glucose medium to promote hybrid formation. Following incubation, colonies were isolated on solid medium. As a control, ten colonies were randomly selected and genotyped by PCR for both MATa and MATα . All tested isolates showed two bands, confirming their diploid status and thereby validating the successful generation of intraspecific hybrids in liquid medium (data not shown). Phenotypic characterization of hybrids One of the primary objectives was to generate hybrids possessing genetic variants well-suited for SMB fermentation. To enrich the hybrid collection with strains exhibiting superior performance, a mixed culture of haploid parental strains was subjected to two successive growth cycles in SMB medium supplemented with 9% ethanol. From this culture, 30 hybrids were isolated for phenotypic characterization under diverse media and fermentation conditions. To evaluate a potential genetic bottleneck effect introduced by the enrichment step in SMB-9% ethanol, a parallel preculture was performed in YPD using the same initial hybrid population under identical conditions. Subsequently, 30 hybrids from each group were selected and cultured in SMB medium containing 9% ethanol (Fig. 7 ). Growth rate analysis revealed significant differences between the variances of the two groups (p-value 0.0002, Bartlett's test). Moreover, hybrids preselected in YPD exhibited greater variability in growth rates, whereas those enriched in SMB-9% ethanol showed more uniform growth, confirming the bottleneck effect of the latter. The hybridization process can generate novel combinations of genetic variants, potentially leading to phenotypic behaviors distinct from those of the parental strains. Consequently, hybrids may exhibit a broad range of fitness changes across different culture conditions. To assess the retention of phenotypic diversity, we performed a comprehensive phenotyping assay (Table S2 a and S2b). PCA of the µmax values across 17 conditions revealed that most hybrids displayed similar phenotypic profiles, except for H7-SMB, H13-SMB, H30-SMB, and H18-YPD (Figures S4 and S5). These findings suggest that the hybridization process generates strains with comparable traits, but certain genetic combinations give rise to hybrids with unique phenotypic characteristics. Some of the remarkable characteristics are a reduced assimilation of fructose in H18-YPD (0.7 OD/h), high H 2 O 2 tolerance in H30-SMB (1.68 OD/h), and a high maltodextrin assimilation capacity in H7-SMB and H13-SBM (1.27 and 1.54 OD/h, respectively). Additionally, to evaluate whether hybrids generated through mass-mating exhibited enhanced fermentation capacity compared to their respective parents, 15 isolates from each of the enrichment conditions were selected. For each group, the 5 highest-growing, 5 intermediate-growing, and 5 lowest-growing performance strains were chosen based on growth data. A wide range of fermentation rates was observed among the groups (Fig. 8 ). Comparing the hybrids with the best parental strain CL824.1, which had the highest fermentation rate in SMB (~ 20 g/L CO 2 loss), the hybrids generally matched the parental fermentation profile after 15 days (Fig. 8 and Figure S6 ). Notably, several hybrids, H2-YPD, H17-YPD, H18-YPD, H12-SMB, H23-SMB, H26-SMB and H30-SMB, exhibited higher total CO₂ production in comparison with the best parental strain (Table S2 c). Among the above, the hybrid H30-SMB showed the greatest improvement in fermentative capacity (28%). These findings demonstrate that intra-species hybridization produces strains with diverse phenotypic behaviors compared to their parental lines, underscoring its remarkable potential as a driver of phenotypic innovation in Saccharomyces . The enrichment of hybrid populations under selective pressure (SMB 9% ethanol) not only shaped a more homogeneous and stress-tolerant phenotype but also unveiled unique combinations of parental alleles that conferred superior fermentative capacity. This selection strategy effectively acted as an evolutionary bottleneck, amplifying the frequency of adaptive genotypes capable of thriving in environments mimicking industrial fermentations. These results provide a foundation for the rational development of next-generation Saccharomyces hybrids, bridging natural adaptation and synthetic breeding to meet the demands of industrial biotechnology. Discussion Our findings revealed that mass-hybridization, followed by targeted selection under restrictive culture conditions, can accelerate the emergence of superior genotypes optimized for bioethanol production. The observation that several hybrids outperformed the best parental strain in CO₂ production underscores the synergistic potential of combining natural genetic diversity with the genetic bottleneck effect. In this context, the evaluation of the sporulation rate of S. eubayanus strains shows that all sporulate after five days under high-stress conditions, specifically in potassium acetate medium. These results are consistent with previous data, which indicate that most wild-type strains conserve sexual reproduction ( 40 ), in contrast to several S. cerevisiae strains that present a high level of domestication ( 26 ). It is well documented that domesticated yeast strains tend to lose certain traits, such as sporulation, that are commonly retained in their wild counterparts ( 40 ). S. eubayanus , as a wild yeast, has not undergone a domestication process, retaining high sporulation capacity in response to nutrient stress ( 41 ). This behavior contrasts with that observed in industrially derived strains from fermentative environments ( 42 ). In such conditions, sporulation becomes metabolically unnecessary and has been progressively lost across generations, allowing yeast to reallocate energy toward traits more beneficial for fermentation, such as flocculation ( 40 , 43 ). During microscopy analysis used to calculate inoculation rate for fermentation, none of the hybrid strains exhibited a flocculent phenotype (data not shown), which means the formation of visible clumps or \"flocs\" in liquid suspension ( 43 ). Flocculation may enhance fermentation efficiency, as cell aggregates are better protected against adverse environmental factors such as pH or temperature fluctuations ( 44 ). Regarding the growth performance of S. eubayanus wild-type strains under stress conditions, the hierarchical clustering and the group PCA analysis revealed clear patterns in the different conditions utilized. Notably, clustering and grouping patterns suggested a relationship between phenotypic behavior and the geographic latitude of the collection site ( 18 ). One key observation is that strains isolated from similar sampling locations tended to cluster together. This could suggest that geographic and environmental factors drive phenotypic variability in natural populations of S. eubayanus , facilitating ecological adaptation. Indeed, strain codes of S. eubayanus correspond to their collection sites ( 18 ), such as “CL1001.1” and “CL1010.1”, belong to Torres del Paine (51°16′00″S 72°21′00″O). These two strains cluster in the same group in carbon sources and stressors phenotyping. Another example is the “CL702.1” and “CL705.1”, from Talca (35°25′37″S 71°39′56″O), that cluster together in carbon sources and stressors culture conditions. This issue supports the idea that S. eubayanus strains exhibit some degree of geographic structure relationship in their phenotypic traits, not necessarily related to the respective genetic population ( 18 ). Phenotypic variability in this species has previously been reported, particularly in traits such as fermentation capacity, metabolite production, and aroma profiles across genetically distinct individuals ( 45 ). However, there exist significant knowledge gaps regarding how these phenotypes relate to geographic origin. The clustering of strains by locality may reflect ecological adaptation to local nutrients, as specific sugar availability, or stressors like extreme temperatures and pH fluctuations ( 46 ). A more detailed analysis of the relationship between S. eubayanus and its ecological niche could provide important insights into how wild yeasts adapt to their native environments. Genotypic analysis of the mating assays did not reveal haploid strains among the hybrid samples. This was evidenced by the presence of both mating-type genes, MATa and MATα , in the isolates, confirming the success of the mass-mating process. Furthermore, fermentation kinetics provided additional support for this assumption. The differences observed between the fermentation profiles of hybrids and their parental strains strongly indicate effective genetic recombination between the parental genomes (Fig. 6 , Fig. 8 , and Figure S6 ). The fermentative profiles of hybrids diverged from the parental strains, indicating that hybrids exhibit phenotypic traits that are not present in the original strains due to the interaction of hybrid genomes ( 47 ), reinforcing the idea that new phenotypic traits have emerged from the recombination of parental genomes ( 47 ). Consistently, growth data obtained in both YPD and SMB media support these observations. The differences in growth between the hybrids and parental strains under selective media conditions indicate that the hybrids possess distinct phenotypic characteristics, reaffirming the hybridization phenomenon (Fig. 5 and Fig. 7 ). These findings underscore the importance of using “sexually competent” strains to maximize genetic exploration and adaptability of Saccharomyces species for fermentation processes such as biofuel production. This approach aligns with other studies showing successful interspecies hybridization. For instance, a study involving the mating of S. cerevisiae strains engineered for xylose fermentation with other Saccharomyces species demonstrated an effective genetic combination ( 48 ). In the above study, through adaptive evolution, hybrid strains were adapted to media with conditions similar to those used in the present research, retained tolerance to hydrolysates, and exhibited improved fermentation traits compared to their ancestral synthetic hybrids ( 48 ). Considering the fermentation on SMB media, several S. eubayanus hybrids showed significantly higher CO₂ production compared to the best parental strain CL824.1. This finding suggests that genetic recombination between S. eubayanus strains from different phenotypic clusters can generate hybrids with superior fermentation traits for bioethanol production. Unlike domesticated S. cerevisiae strains, the wild yeast S. eubayanus has not undergone centuries of artificial selection, potentially granting it greater flexibility and adaptability to extreme fermentation conditions ( 49 ). As such, S. eubayanus may still be below its biological performance threshold and could continue improving its CO₂ production capacity, reflecting greater adaptive potential. Conclusions In summary, our study tested the hypothesis that yeast strains of the Saccharomyces genus, exhibiting resistance to various stressors (commonly encountered in industrial fermentations), could combine desirable traits for bioethanol production through sexual reproduction. The results support this hypothesis, showing that the S. eubayanus hybrids were successfully obtained, exhibiting superior performance compared to their parental strains under stress conditions typically found in bioethanol production environments. These findings represent a significant advancement in the development of more robust and efficient yeast strains for industrial bioethanol, potentially contributing to greater sustainability and efficiency in bioenergy fermentation processes. Declarations Funding This work was supported by the National Association of Research and Development (ANID) with the FONDECYT Iniciación Grant N° 11240430, FONDECYT Grant N° 1251234, and Programa Iniciativa Científica Milenio - ICN17_022. Acknowledgements We thank Ph.D. Francisco Cubillos for kindly providing the S. eubayanus strains used in this study. Author contributions Conceptualization: I.G., S.D., and W.M. Formal analysis: I.G., C.A., and W.M. Investigation: I.G., C.A., S.D., I.A., V.Z., and W.M. Writing—original draft: I.G., and W.M. Writing—review & editing: V.Z., LF.L., and W.M. Data availability Data used for heatmaps and PCA are included within the supplementary information files. Additional raw datasets (e.g., OD600 raw data) are available from the corresponding author upon request. Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare no competing interest. References Liu Y, Cruz-Morales P, Zargar A, Belcher MS, Pang B, Englund E, et al. Biofuels for a sustainable future. Cell. 2021;184(6):1636-47. Attanayake K, Wickramage I, Samarasinghe U, Ranmini Y, Ehalapitiya S, Jayathilaka R, et al. Renewable energy as a solution to climate change: Insights from a comprehensive study across nations. PLoS One. 2024;19(6):e0299807. Demirbas A. Biofuels securing the planet’s future energy needs. Energy Conversion and Management. 2009;50(9):2239-49. Yaverino-Gutiérrez MA, Wong AYCH, Ibarra-Muñoz LA, Chávez ACF, Sosa-Martínez JD, Tagle-Pedroza AS, et al. Perspectives and Progress in Bioethanol Processing and Social Economic Impacts. Sustainability-Basel. 2024;16(2). Devi A, Bajar S, Sihag P, Sheikh ZUD, Singh A, Kaur J, et al. A panoramic view of technological landscape for bioethanol production from various generations of feedstocks. Bioengineered. 2023;14(1):81-112. Ho DP, Ngo HH, Guo W. A mini review on renewable sources for biofuel. Bioresour Technol. 2014;169:742-9. Nigam PS, Singh A. Production of liquid biofuels from renewable resources. Prog Energ Combust. 2011;37(1):52-68. Brennan L, Owende P. Biofuels from microalgae-A review of technologies for production, processing, and extractions of biofuels and co-products. Renew Sust Energ Rev. 2010;14(2):557-77. Igwebuike CM, Awad S, Andrès Y. Renewable Energy Potential: Second-Generation Biomass as Feedstock for Bioethanol Production. Molecules. 2024;29(7):1619. Caballero-Sanchez L, Lázaro-Mixteco PE, Vargas-Tah A, Castro-Montoya AJ. Pilot-scale bioethanol production from the starch of avocado seeds using a combination of dilute acid-based hydrolysis and alcoholic fermentation by Saccharomyces cerevisiae. Microb Cell Fact. 2023;22(1). Mohd Azhar SH, Abdulla R, Jambo SA, Marbawi H, Gansau JA, Mohd Faik AA, et al. Yeasts in sustainable bioethanol production: A review. Biochemistry and Biophysics Reports. 2017;10:52-61. Basso LC, Basso TO, Rocha SN. Ethanol Production in Brazil: The Industrial Process and Its Impact on Yeast Fermentation. Biofuel Production - Recent Developments and Prospects. 2011:85-100. Jeffries TW. Engineering yeasts for xylose metabolism. Curr Opin Biotech. 2006;17(3):320-6. Jansen MLA, Bracher JM, Papapetridis I, Verhoeven MD, de Bruijn H, de Waal PP, et al. Saccharomyces cerevisiae strains for second-generation ethanol production: from academic exploration to industrial implementation. FEMS Yeast Res. 2017;17(5). Mukherjee V, Steensels J, Lievens B, Van de Voorde I, Verplaetse A, Aerts G, et al. Phenotypic evaluation of natural and industrial yeasts for different traits desirable in industrial bioethanol production. Appl Microbiol Biot. 2014;98(22):9483-98. Libkind D, Hittinger CT, Valério E, Gonçalves C, Dover J, Johnston M, et al. Microbe domestication and the identification of the wild genetic stock of lager-brewing yeast. P Natl Acad Sci USA. 2011;108(35):14539-44. Kumari M, Padhi S, Sharma S, Phukon LC, Singh SP, Rai AK. Biotechnological potential of psychrophilic microorganisms as the source of cold-active enzymes in food processing applications. 3 Biotech. 2021;11(11). Nespolo RF, Villarroel CA, Oporto CI, Tapia SM, Vega-Macaya F, Urbina K, et al. An Out-of-Patagonia migration explains the worldwide diversity and distribution of lineages. Plos Genet. 2020;16(5). de Souza JP, do Prado CD, Eleutherio ECA, Bonatto D, Malavazi I, da Cunha AF. Improvement of of Brazilian bioethanol production - Challenges and perspectives on the identification and genetic modification of new strains of yeasts isolated during ethanol process. Fungal Biol-Uk. 2018;122(6):583-91. Molinet J, Urbina K, Villegas C, Abarca V, Oporto CI, Villarreal P, et al. A Saccharomyces eubayanus haploid resource for research studies. Sci Rep. 2022;12(1):5976. Eardley J, Timson DJ. Yeast Cellular Stress: Impacts on Bioethanol Production. Fermentation. 2020;6(4):109. Mukherjee V, Radecka D, Aerts G, Verstrepen KJ, Lievens B, Thevelein JM. Phenotypic landscape of non-conventional yeast species for different stress tolerance traits desirable in bioethanol fermentation. Biotechnology for Biofuels. 2017;10(1):216. Mardones W, Villarroel CA, Abarca V, Urbina K, Pena TA, Molinet J, et al. Rapid selection response to ethanol in Saccharomyces eubayanus emulates the domestication process under brewing conditions. Microb Biotechnol. 2022;15(3):967-84. Sipiczki M. Yeast two- and three-species hybrids and high-sugar fermentation. Microb Biotechnol. 2019;12(6):1101-8. Ribeiro N, Linforth R, Powell CD, Fisk ID. Influence of essential inorganic elements on flavour formation during yeast fermentation. Food Chem. 2021;361. Peter J, De Chiara M, Friedrich A, Yue JX, Pflieger D, Bergstrom A, et al. Genome evolution across 1,011 Saccharomyces cerevisiae isolates. Nature. 2018;556(7701):339-44. Lino FSO, Basso TO, Sommer MOA. A synthetic medium to simulate sugarcane molasses. Biotechnol Biofuels. 2018;11:221. Blazanin M. gcplyr: an R package for microbial growth curve data analysis. BMC Bioinformatics. 2024;25(1):232. Boulton R, Nelson J, Knoesen A. A Review of Sensors for the Monitoring, Modeling, and Control of Commercial Wine Fermentations. Fermentation-Basel. 2025;11(6). Rojas V, Larrondo LF. Coupling Cell Communication and Optogenetics: Implementation of a Light-Inducible Intercellular System in Yeast. Acs Synth Biol. 2022;12(1):71-82. Kim HY. Statistical notes for clinical researchers: Two-way analysis of variance (ANOVA)-exploring possible interaction between factors. Restor Dent Endod. 2014;39(2):143-7. Odoi B, Twumasi-Ankrah S, Samita S, Al-Hassan S. The Efficiency of Bartlett's Test using Different forms of Residuals for Testing Homogeneity of Variance in Single and Factorial Experiments-A Simulation Study. Sci Afr. 2022;17. Knight SJ, Goddard MR. Sporulation in soil as an overwinter survival strategy in. Fems Yeast Res. 2016;16(1). Sarricolea P, Herrera-Ossandon M, Meseguer-Ruiz O. Climatic regionalisation of continental Chile. J Maps. 2017;13(2):66-73. Wang HY, Nielsen J, Zhou YJJ, Lu HZ. Yeast adapts to diverse ecological niches driven by genomics and metabolic reprogramming. P Natl Acad Sci USA. 2025;122(32). Auesukaree C. Molecular mechanisms of the yeast adaptive response and tolerance to stresses encountered during ethanol fermentation. J Biosci Bioeng. 2017;124(2):133-42. Scholar E. Geneticin. In: Enna SJ, Bylund DB, editors. xPharm: The Comprehensive Pharmacology Reference. New York: Elsevier; 2007. p. 1-2. Pérez D, Jaehde I, Guillamón JM, Heras JM, Querol A. Screening of Saccharomyces strains for the capacity to produce desirable fermentative compounds under the influence of different nitrogen sources in synthetic wine fermentations. Food Microbiology. 2021;97:103763. Arras SDM, Hibbard TR, Mitsugi-McHattie L, Woods MA, Johnson CE, Munkacsi A, et al. Creeping yeast: a simple, cheap and robust protocol for the identification of mating type in Saccharomyces cerevisiae. FEMS Yeast Res. 2022;22(1). De Chiara M, Barré BP, Persson K, Irizar A, Vischioni C, Khaiwal S, et al. Domestication reprogrammed the budding yeast life cycle. Nature Ecology & Evolution. 2022;6(4):448-60. Herskowitz I. Life cycle of the budding yeast Saccharomyces cerevisiae. Microbiol Rev. 1988;52(4):536-53. Paulino de Souza J, Dias do Prado C, Eleutherio ECA, Bonatto D, Malavazi I, Ferreira da Cunha A. Improvement of Brazilian bioethanol production - Challenges and perspectives on the identification and genetic modification of new strains of Saccharomyces cerevisiae yeasts isolated during ethanol process. Fungal Biol. 2018;122(6):583-91. Soares EV. Flocculation in Saccharomyces cerevisiae: a review. J Appl Microbiol. 2011;110(1):1-18. Verstrepen KJ, Derdelinckx G, Verachtert H, Delvaux FR. Yeast flocculation: what brewers should know. Applied Microbiology and Biotechnology. 2003;61(3):197-205. Mardones W, Villarroel CA, Krogerus K, Tapia SM, Urbina K, Oporto CI, et al. Molecular profiling of beer wort fermentation diversity across natural Saccharomyces eubayanus isolates. Microb Biotechnol. 2020;13(4):1012-25. Alvarez R, Garces F, Louis EJ, Dequin S, Camarasa C. Beyond S. cerevisiae for winemaking: Fermentation-related trait diversity in the genus Saccharomyces. Food Microbiol. 2023;113:104270. Perez-Traves L, Lopes CA, Gonzalez R, Barrio E, Querol A. Physiological and genomic characterisation of Saccharomyces cerevisiae hybrids with improved fermentation performance and mannoprotein release capacity. Int J Food Microbiol. 2015;205:30-40. Peris D, Moriarty RV, Alexander WG, Baker E, Sylvester K, Sardi M, et al. Hybridization and adaptive evolution of diverse Saccharomyces species for cellulosic biofuel production. Biotechnol Biofuels. 2017;10:78. Raas MWD, Dutheil JY. The rate of adaptive molecular evolution in wild and domesticated Saccharomyces cerevisiae populations. Molecular Ecology. 2024;33(10):e16980. Additional Declarations No competing interests reported. Supplementary Files FigureS1.pdf FigureS4.pdf FigureS3.pdf FigureS2.pdf FigureS5.pdf FigureS6.pdf TableS1.xlsx TableS2.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-8138800\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":569032998,\"identity\":\"07c49fe5-5129-4a61-92d0-086807b92b6a\",\"order_by\":0,\"name\":\"Ignacio Guarda\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Millennium Institute for Integrative Biology (iBio)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ignacio\",\"middleName\":\"\",\"lastName\":\"Guarda\",\"suffix\":\"\"},{\"id\":569032999,\"identity\":\"bb7d4a52-dc4b-475a-af69-b7846d2bce0c\",\"order_by\":1,\"name\":\"Catalina Ardiles\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Millennium Institute for Integrative Biology (iBio)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Catalina\",\"middleName\":\"\",\"lastName\":\"Ardiles\",\"suffix\":\"\"},{\"id\":569033001,\"identity\":\"2c158b88-ec8f-45be-a37c-e81a5ce030ce\",\"order_by\":2,\"name\":\"Sebastián Dehnhardt-Amengual\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Millennium Institute for Integrative Biology (iBio)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sebastián\",\"middleName\":\"\",\"lastName\":\"Dehnhardt-Amengual\",\"suffix\":\"\"},{\"id\":569033002,\"identity\":\"beb7c3bf-24c0-4fb1-a4ea-65d393f2bf98\",\"order_by\":3,\"name\":\"Isidora Achiardi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Millennium Institute for Integrative Biology (iBio)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Isidora\",\"middleName\":\"\",\"lastName\":\"Achiardi\",\"suffix\":\"\"},{\"id\":569033003,\"identity\":\"b13597dc-dc78-45cf-81dc-05201adc9d01\",\"order_by\":4,\"name\":\"Vasni Zavaleta\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Millennium Institute for Integrative Biology (iBio)\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Vasni\",\"middleName\":\"\",\"lastName\":\"Zavaleta\",\"suffix\":\"\"},{\"id\":569033005,\"identity\":\"3c15bebc-101e-4254-831d-da3377a6b90d\",\"order_by\":5,\"name\":\"Luis F. Larrondo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Pontificia Universidad Católica de Chile\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Luis\",\"middleName\":\"F.\",\"lastName\":\"Larrondo\",\"suffix\":\"\"},{\"id\":569033006,\"identity\":\"9f2070b4-414c-4c51-81aa-14c60e7267fc\",\"order_by\":6,\"name\":\"Wladimir Mardones\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBUlEQVRIiWNgGAWjYDACdgYGiQQGCQiHByzSACIPgKWwAmYMLTwHoFqY8WiBc8BagCbg1WJwmPnhjYc5FvkMYoeffXhTcUdOfuYb4w8/au4w8Dfj0sJmbJG4TcKyQTrNeOacM8+MDW7nmEn2HHvGIHEYuxazwwxmEkAtBgzSCcbMvG2HEzdI55gx8DYcZjDA4TCzw+zfoFrSP4O01M+fecb441+8WnhgtuSAbUlguMFjII3PFvvDPMUgvxiwSecUM845c9hww5m0MmmZY4d5cPlFsr19482f2+oM+KXTNzO8qTgsL99+ePPHNzWH5fjbG7DrgQE2dAEe/OpHwSgYBaNgFOADANMRV4IBB5T3AAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Millennium Institute for Integrative Biology (iBio)\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Wladimir\",\"middleName\":\"\",\"lastName\":\"Mardones\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-11-17 20:08:18\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-8138800/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-8138800/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":99499616,\"identity\":\"ef9053c4-66c3-401a-9c85-6acb1f98211a\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:09\",\"extension\":\"docx\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":1373205,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"GuardaManuscriptBBB.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/4ad597cb0d19f62a8ca2104a.docx\"},{\"id\":99499618,\"identity\":\"eb53d97c-762b-4c42-b8d9-b1a0982dc3d5\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:09\",\"extension\":\"json\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":8758,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"bea178b884c14d14891340ebbd6f632d.json\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/841e71395490903e2182d8eb.json\"},{\"id\":99790153,\"identity\":\"c9e07b42-3db1-4961-9b2a-6f1cb497247c\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:56:54\",\"extension\":\"pdf\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":204474,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FigureS1.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/69f0b3ea6f376d80c5cb91f6.pdf\"},{\"id\":99499630,\"identity\":\"43f89832-c337-42a3-a018-0f2fc73c26a1\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:09\",\"extension\":\"pdf\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":173669,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FigureS2.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/a124f38a16639612d4c961fa.pdf\"},{\"id\":99790522,\"identity\":\"26db6921-e3a2-4c71-bbdc-cca0fe2aab22\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:17\",\"extension\":\"pdf\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":139644,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FigureS3.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/34577059d1d4528f9de92023.pdf\"},{\"id\":99499637,\"identity\":\"bbb31356-221f-47ae-8389-2ef4b2b48a25\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"pdf\",\"order_by\":5,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":176917,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FigureS4.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/e2f1e79c69a98f392d91c359.pdf\"},{\"id\":99499634,\"identity\":\"058c22b8-93bc-4cb7-879e-17fec663a467\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"pdf\",\"order_by\":6,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":175038,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FigureS5.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/eb3df1e4da346832c119b92c.pdf\"},{\"id\":99499647,\"identity\":\"c1fb2ca2-8373-486f-b6ba-8d8886e318e8\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"pdf\",\"order_by\":7,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":443880,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FigureS6.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/e85b57a95e2c88303cc66503.pdf\"},{\"id\":99499641,\"identity\":\"f8fc5bbb-ebef-4e47-a64d-f16e512bc430\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"xlsx\",\"order_by\":8,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":58341,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"TableS1.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/0bf1db30f7c7b81008d2f136.xlsx\"},{\"id\":99790743,\"identity\":\"f2f707e1-9b76-4f02-879d-5ebaea776fcf\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:39\",\"extension\":\"xlsx\",\"order_by\":9,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":24931,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"TableS2.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/2a108935cd490a902fcb5b4e.xlsx\"},{\"id\":99791508,\"identity\":\"d3e22bf7-052a-4514-ae20-681559e7d73f\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 13:00:48\",\"extension\":\"xml\",\"order_by\":10,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":125545,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"bea178b884c14d14891340ebbd6f632d1enriched.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/f75108c69550e0f40f8cec6a.xml\"},{\"id\":99791132,\"identity\":\"85404f64-637a-411b-ad9f-4a5108f00c67\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:59:11\",\"extension\":\"jpeg\",\"order_by\":11,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":308909,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage1.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/55d8fe9b7a7d352a6c4d9d23.jpeg\"},{\"id\":99499653,\"identity\":\"5e6bf070-b974-41a1-809a-6f6ac1bcef08\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"jpeg\",\"order_by\":12,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":267754,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage2.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/a9767c77342b7e71f6f9024e.jpeg\"},{\"id\":99791081,\"identity\":\"0cb05f11-3042-42f7-8d1d-fa34581da80e\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:59:05\",\"extension\":\"jpeg\",\"order_by\":13,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":539661,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage3.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/0de579847f502227196111a7.jpeg\"},{\"id\":99790956,\"identity\":\"c306f7de-5d01-4f3f-938d-d87b47137caa\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:54\",\"extension\":\"jpeg\",\"order_by\":14,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":159895,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage4.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/99a8e5eaa3d0e491c94f3787.jpeg\"},{\"id\":99790448,\"identity\":\"9bae4a3a-af9e-4ac9-8e25-b5b19374fa9b\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:11\",\"extension\":\"jpeg\",\"order_by\":15,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":50200,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage5.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/c48990c2a7b1f08f94f3333d.jpeg\"},{\"id\":99499660,\"identity\":\"533bd535-f12b-4aa4-8ed1-1800f7798b74\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"jpeg\",\"order_by\":16,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":102067,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage6.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/60b9897987dc28a71fa08cb2.jpeg\"},{\"id\":99499644,\"identity\":\"7eb909db-63dd-4c1c-9ff2-2170eb067141\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"jpeg\",\"order_by\":17,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":47074,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage7.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/bba4136c74c4e07ca10c5d14.jpeg\"},{\"id\":99791023,\"identity\":\"538854c5-cfe3-4d6b-bc33-b18974c6d526\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:57\",\"extension\":\"jpeg\",\"order_by\":18,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":83210,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"floatimage8.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/c81c2b583c0c43f0d84c36bf.jpeg\"},{\"id\":99499645,\"identity\":\"8977b6c3-496b-41e8-bd72-c1bfc666fe8c\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"png\",\"order_by\":19,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":396445,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/09ba6147606b0ebf943be5df.png\"},{\"id\":99499643,\"identity\":\"2e877a82-d5dd-4583-b79f-8568fb4d0f61\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"png\",\"order_by\":20,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":62036,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/59101e344f7be81d0eb8884b.png\"},{\"id\":99499661,\"identity\":\"468cc31c-c46d-4af1-8196-448b95af371e\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:11\",\"extension\":\"png\",\"order_by\":21,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":92602,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/cd24fa9bf2dd5525bac4d19a.png\"},{\"id\":99790307,\"identity\":\"0c590af0-e036-4cd6-abbd-1bdf9bcb2b43\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:57:41\",\"extension\":\"png\",\"order_by\":22,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":32255,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/1c147f234afa984cb9875604.png\"},{\"id\":99499659,\"identity\":\"a0075d6d-dead-4858-bb95-529c0d060a17\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"png\",\"order_by\":23,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":39798,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/cdf71fbd36b0a0f31cd28a77.png\"},{\"id\":99790662,\"identity\":\"bb260c5f-aefe-46a3-be90-08eed6a6d93e\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:31\",\"extension\":\"png\",\"order_by\":24,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":33255,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/35d4f81cb4433dcd3611073e.png\"},{\"id\":99499657,\"identity\":\"3e1ac61d-cdc2-4e6d-880b-06aa126fe298\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"png\",\"order_by\":25,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":42540,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/ba69a22a29a0102331fab36d.png\"},{\"id\":99499655,\"identity\":\"91e1ae3d-31a0-4892-a5fe-56db8afcb335\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"png\",\"order_by\":26,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":63969,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Onlinefloatimage8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/ed5988e080343decf620e6ba.png\"},{\"id\":99790615,\"identity\":\"0070d721-de7c-437d-97c1-c2fd9135a0a6\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:25\",\"extension\":\"xml\",\"order_by\":27,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":124462,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"bea178b884c14d14891340ebbd6f632d1structuring.xml\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/95532d05d8f7c0a50d408778.xml\"},{\"id\":99790584,\"identity\":\"0f200ad8-9272-4d3d-8b36-4630f30c93f7\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:23\",\"extension\":\"html\",\"order_by\":28,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"acdc-reference\",\"size\":136202,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"earlyproof.html\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/8b29af71231a1686de97872d.html\"},{\"id\":99791453,\"identity\":\"6cb7aa43-7796-473b-8ee3-6f4634ac2fc8\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:59:55\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":386634,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSporulation of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eS. eubayanus\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e strains\\u003c/strong\\u003e. A. The strains were incubated on potassium acetate for 5 days, and tetrad formation was subsequently determined by microscopy (200X). The white box indicates a tetrad from the CL824.1 strain. B. The sporulation rate was evaluated in the 79 \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e strains by counting the number of tetrads after 5 days of incubation in KAc medium.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/c7c09875034400450d1c4db2.png\"},{\"id\":99790592,\"identity\":\"c8d2134b-214b-4b90-bf3e-e17f594e458b\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:23\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":699432,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eGrowth performance of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eS. eubayanus\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e strains under different carbon sources\\u003c/strong\\u003e. Strains were cultured in YNB media supplemented with different carbon sources at 2%, OD\\u003csub\\u003e600\\u003c/sub\\u003e was evaluated over time, and the µmax kinetic parameter was calculated. A heatmap with hierarchical clustering was generated with pheatmap in R using μmax as the growth parameter. The values were normalized using the glucose condition as control, and the z-score of relative growth was calculated.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/7dba39869a4e47c6761dcb0a.png\"},{\"id\":99790944,\"identity\":\"02ca3744-a9ff-42c0-b6a7-941c70c47c91\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:53\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":610157,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eGrowth performance of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eS. eubayanus\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e strains under different stressors\\u003c/strong\\u003e. Strains were cultured in YNB- 2% Glucose media supplemented with different stressors (see Materials and Methods), OD\\u003csub\\u003e600\\u003c/sub\\u003e was evaluated over time, and the µmax kinetic parameter was calculated. A heatmap with hierarchical clustering was generated using μmax as the growth parameter. The values were normalized using the glucose condition as control, and the z-score of relative growth was calculated.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/99d3f379a010d90cf4ea2366.png\"},{\"id\":99499625,\"identity\":\"a5026e35-27e9-4946-803f-31493c2eab81\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:09\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":304566,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eGrowth performance of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eS. eubayanus\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e strains under ethanol and methanol\\u003c/strong\\u003e. Strains were cultured in YNB- 2% Glucose media supplemented with 8% ethanol and 8% methanol. The OD\\u003csub\\u003e600\\u003c/sub\\u003e was evaluated over time, and the µmax kinetic parameter was calculated. A heatmap with hierarchical clustering was generated using μmax as the growth parameter. The values were normalized using the glucose condition as control, and the z-score of μmax was calculated.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/8203e0daeda904d36bad6a98.png\"},{\"id\":99499628,\"identity\":\"0db7ae3b-f80e-4dd7-bb45-24e0a66f276c\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:09\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":98230,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eGrowth rate in YPD and SMB 9% ethanol media for parental strains of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eS. eubayanus\\u003c/strong\\u003e\\u003c/em\\u003e. The OD\\u003csub\\u003e600\\u003c/sub\\u003e was measured over time, and the µmax kinetic parameter was calculated; the values were plotted in a violin graph. The gray dashed line indicates the median value, and the dotted lines indicate the quartiles.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/3a60775f4406d40c9458e362.png\"},{\"id\":99499631,\"identity\":\"8a4bc7aa-24b9-45a6-ac1e-ca0928e6a19f\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:09\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":266671,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eFermentation rates in SMB media for parental yeast strains\\u003c/strong\\u003e. The CO₂ loss was monitored daily over 15 days at 12 °C. The \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e parental strains are indicated in blue, the \\u003cem\\u003eS. pastorianus\\u003c/em\\u003e control strain in red, and the \\u003cem\\u003eS. cerevisiae\\u003c/em\\u003e strain in purple. The fermentative capacity of each strain was evaluated in triplicate.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/431ef017e76633a1f7407f9e.png\"},{\"id\":99790610,\"identity\":\"47879b73-4907-4e6d-91fc-04b190ed034e\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:25\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":91504,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eGrowth evaluation of hybrid isolates in SMB-9% ethanol\\u003c/strong\\u003e. \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e hybrids isolated from YPD and SMB-9% ethanol medium were cultured in SMB-9% ethanol medium. The OD\\u003csub\\u003e600\\u003c/sub\\u003e was measured over time, and the µmax kinetic parameter was calculated. The values were plotted in a violin graph. The gray dashed line indicates the median value, and the dotted lines indicate the quartiles.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/7f1b9074391d64e6dbba3310.png\"},{\"id\":99499639,\"identity\":\"f8532988-2b64-4375-8df3-eaca8759a45b\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":143981,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eFermentation of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eS. eubayanus\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e hybrids on SMB media\\u003c/strong\\u003e. The CO\\u003csub\\u003e2\\u003c/sub\\u003e loss of hybrids was evaluated from the fermentation of SMB media. Total CO₂ loss at day 15 from each replicate of hybrids enriched in YPD and SMB-ethanol was plotted\\u003cem\\u003e.\\u003c/em\\u003e The man value of the CO\\u003csub\\u003e2\\u003c/sub\\u003e loss of the CL824.1\\u003cem\\u003e \\u003c/em\\u003estrain (best parental) is indicated as a dotted line. The gray dashed line indicates the median value, and the dotted lines in the violin indicate the quartiles.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/b590582e683f000615acd8c4.png\"},{\"id\":101520134,\"identity\":\"20062f01-6121-460b-8c56-98146c480c94\",\"added_by\":\"auto\",\"created_at\":\"2026-01-30 16:55:55\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3806341,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/e8807b5e-24f3-4ec6-9d41-8208739bd479.pdf\"},{\"id\":99499621,\"identity\":\"781d01cc-6af3-4ce6-8e53-918d808c1bb5\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:09\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":204474,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FigureS1.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/cbbfc03ac899ebb7273e2943.pdf\"},{\"id\":99790786,\"identity\":\"59d84bb2-0917-495f-a866-9e29ea8139aa\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:42\",\"extension\":\"pdf\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":176917,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FigureS4.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/1ea1829808bac9eeac9ace31.pdf\"},{\"id\":99499624,\"identity\":\"cbd9deb1-a3b9-40b5-a66c-9e1ecc961eae\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:09\",\"extension\":\"pdf\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":139644,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FigureS3.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/145cd6c02aac018ea48b3220.pdf\"},{\"id\":99499626,\"identity\":\"25fd100a-2256-45f2-8150-f11149038e0f\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:09\",\"extension\":\"pdf\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":173669,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FigureS2.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/87a1e4a19c7bdfbf750ad655.pdf\"},{\"id\":99790753,\"identity\":\"c7d7b0fc-0b8e-409f-b16f-4a3fd6134356\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:58:40\",\"extension\":\"pdf\",\"order_by\":4,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":175038,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FigureS5.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/4d6dda48e00dc460d2edb215.pdf\"},{\"id\":99790253,\"identity\":\"1fb597c5-771f-4820-a3aa-e8248aa95b7a\",\"added_by\":\"auto\",\"created_at\":\"2026-01-08 12:57:34\",\"extension\":\"pdf\",\"order_by\":5,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":443880,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"FigureS6.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/32d97eef8372b57766b5171d.pdf\"},{\"id\":99499636,\"identity\":\"246aa9b7-c30b-4203-b5f9-dabdc4467473\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"xlsx\",\"order_by\":6,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":58341,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"TableS1.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/8ac4d989491111b0dfef285b.xlsx\"},{\"id\":99499642,\"identity\":\"3f0f1536-f864-444c-89bf-69058d80ed02\",\"added_by\":\"auto\",\"created_at\":\"2026-01-05 07:14:10\",\"extension\":\"xlsx\",\"order_by\":7,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":24931,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"TableS2.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8138800/v1/2c296ed6dc717233063eb1de.xlsx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Phenotypic diversity and hybridization of wild Saccharomyces for improving bioethanol production\",\"fulltext\":[{\"header\":\"Background\",\"content\":\"\\u003cp\\u003eOne of the main challenges regarding energy use in the industrial and transportation sectors is the reduction of fossil fuel consumption (\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e). The growing demand for environmentally friendly energy sources presents an opportunity to obtain energy from less polluting alternatives (\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e). One such option is the production of bioethanol as a substitute for gasoline (\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e). Bioethanol is ethanol produced through the use of specific microorganisms (\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e), and can be obtained through several approaches (\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e). First-generation bioethanol is produced from readily available simple sugars and starch sources such as corn or sugarcane (\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e). Second-generation bioethanol is derived from non-food biomass, such as agricultural residues or wood pulp, and requires more complex pre-processing to release fermentable sugars (\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e). Finally, third-generation bioethanol is extracted and purified from microalgae biomass (\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e). Essentially, the main difference between first- and second-generation bioethanol lies in the raw material used: first-generation production utilizes simple sugars, whereas second-generation production relies on lignocellulosic materials that are more difficult to break down (\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e). These materials, cellulose and hemicellulose, must first be converted into simple sugars such as glucose, fructose, or xylose to enable fermentation into ethanol (\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e). These simple sugars are subsequently fermented into ethanol by yeasts, primarily those belonging to the \\u003cem\\u003eSaccharomyces\\u003c/em\\u003e genus (\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e). Second-generation bioethanol fermentation involves the presence of high salt concentrations and other inhibitory factors, which are typically byproducts of the chemical pretreatment applied to biomass to improve cellulose and hemicellulose accessibility for hydrolysis (\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e). Hydrolysates derived from lignocellulosic sources also contain high levels of pentose sugars, particularly xylose, which native strains of \\u003cem\\u003eS. cerevisiae\\u003c/em\\u003e either inefficiently metabolize or do not consume at all (\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e). Nevertheless, a limited set of \\u003cem\\u003eSaccharomyces\\u003c/em\\u003e strains has been utilized for bioethanol production, limiting the optimization of the bioethanol production process (\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eExploring the phenotypic diversity of \\u003cem\\u003eSaccharomyces\\u003c/em\\u003e strains may offer an attractive strategy to identify yeasts with improved traits for bioethanol production, such as enhanced resistance to stressors (\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e). In this context, \\u003cem\\u003eSaccharomyces eubayanus\\u003c/em\\u003e has risen as a valuable resource of genetic and phenotypic diversity. This species was identified in the past decade in Patagonia, where it was isolated from the bark of trees of the \\u003cem\\u003eNothofagus\\u003c/em\\u003e genus (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e). One of the most remarkable features of \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e is its resistance to extreme environments. This yeast is capable of surviving and thriving at very low temperatures (\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e), making it an organism of high interest in studies of stress tolerance. Its ability to endure cold conditions presents potential applications in industrial biotechnology, especially for fermentation processes in cold climates, as well as for the development of industrial systems that require robust organisms (\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e). The high genetic and phenotypic diversity of \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e allows its species to adapt and survive across a wide range of environmental conditions, from the temperate climates of central-southern regions of Chile to the extreme environments of southern Patagonia (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e). This variability could be particularly relevant in the context of biofuel production, as certain strains may show enhanced resistance to the harsh conditions of fermentation processes, such as high ethanol concentrations and osmotic stress caused by high sugar levels (\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eFurthermore, the reproductive compatibility among different \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e strains opens the possibility of generating hybrids with improved phenotypic traits (\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e), such as increased resistance to the necessary characteristics for bioethanol production (\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e). This genetic and phenotypic diversity is not only crucial for improving industrial strains for biofuel production, but also for optimizing other fermentation processes (\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e). The combination of suitable traits in hybrid strains offers an alternative to previously tested approaches, such as experimental evolution, particularly for enhancing ethanol tolerance in this species (\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e). In this regard, the manipulation and selection of strains through mating strategies may facilitate the obtention of hybrid strains with enhanced tolerance to adverse conditions, thereby improving the efficiency and sustainability of industrial biofuel production (\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e). Exploiting this genetic diversity represents a fundamental strategy for advancing more robust and efficient fermentation processes in the biotech industry.\\u003c/p\\u003e \\u003cp\\u003eFor these reasons, this research aims to evaluate phenotypic traits of \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e strains, followed by a mass-mating process using selected isolates, to combine desirable characteristics. The main goal is to generate intraspecific hybrids with improved tolerance to bioethanol production conditions and subsequently evaluate their performance under fermentative environments.\\u003c/p\\u003e\"},{\"header\":\"Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStrains\\u003c/h2\\u003e \\u003cp\\u003eThe utilized strains comprise a set of 79 wild \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e previously isolated from Chilean Patagonia (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e). The yeasts were maintained on YPD (1% Yeast Extract, 1% Peptone, and 2% Dextrose) agar (1.5%) plates. As a control, the Lager industrial strain \\u003cem\\u003eS. pastorianus\\u003c/em\\u003e W34/70 (\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e) and the native \\u003cem\\u003eS. cerevisiae\\u003c/em\\u003e SACE-YBS (\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e) were utilized.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eSporulation rate\\u003c/h3\\u003e\\n\\u003cp\\u003eTo induce sporulation, \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e strains were grown on a medium consisting of 2% potassium acetate (KAc) in 1.5% agar at 20\\u0026deg;C for 5 days. After this period, a small sample from each culture plate was collected and diluted to a 1:500 ratio to ensure uniformity and facilitate subsequent analysis. Diluted samples were transferred into 96-well ELISA plates to allow parallel analyses. Sporulation rate was evaluated using a bright-field microscope integrated in the Cytation 3 Cell Imaging Multi-Mode Reader at 200X (Agilent BioTek, USA). The tetrads were identified manually from the acquired images, and the percentage was calculated by comparing the number of cells exhibiting sporulation to the total number of cells observed (at least 100 cells per strain).\\u003c/p\\u003e\\n\\u003ch3\\u003ePhenotypic landscape evaluation\\u003c/h3\\u003e\\n\\u003cp\\u003eThe growth of yeast strains under various conditions was evaluated in liquid media. Each strain was assessed for its ability to utilize different carbon sources: 2% maltose, 2% fructose, 2% galactose, 2% sucrose, 2% lactose, 2% raffinose, 2% maltodextrin, 2% xylose, 6 \\u0026deg;Brix malt extract, and 2% glycerol. Additional conditions included growth under osmotic stress (20% sorbitol), halotolerance (1.25 mM KCl and 1.25 mM NaCl), and tolerance to cytotoxic agents (7 mM caffeine, 4 mM CuSO₄, 3 mM H₂O₂, 0.5 mM DTT, 0.001% SDS, 200 \\u0026micro;g/mL G418, and 1.75 mM p-coumaric acid). Additionally, alcohol tolerance was evaluated using 8% ethanol and 8% methanol. A glucose 2% medium was used as a control condition. Growth was also tested in a synthetic molasses-based medium (SMB) simulating industrial sugarcane fermentation conditions (Table \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003ea) (\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e). All stress condition media, except those used for carbon source utilization assays, were supplemented with 0.67% YNB- 2% glucose (USBiological, USA), while carbon source media were supplemented only with 0.67% YNB. Before growth measurements, all strains were pre-cultured for 24 h in YNB- 2% glucose at 20\\u0026deg;C. For the assay, 5 \\u0026micro;L of each pre-inoculum was added to 195 \\u0026micro;L of the test medium in 96-well plates, which were then incubated at 25\\u0026deg;C. Optical density at 600 nm (OD\\u003csub\\u003e600\\u003c/sub\\u003e) was recorded hourly using a Cytation 3 reader with a BioStack 4 Stacker (Agilent BioTek, USA). Growth curves were used to calculate \\u0026micro;max kinetic parameter using the R package \\u0026ldquo;gcplyr\\u0026rdquo; (\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e). The heatmaps were generated using \\u0026ldquo;pheatmap\\u0026rdquo; package with clustering in R. In the same way, the PCA analysis was performed using \\u0026ldquo;prcomp\\u0026rdquo; with the function \\u0026ldquo;fviz_nbclust\\u0026rdquo; in R, to determine the optimal number of groups.\\u003c/p\\u003e\\n\\u003ch3\\u003eFermentation rate\\u003c/h3\\u003e\\n\\u003cp\\u003eThe fermentative capacity of the yeast strains was evaluated by the estimation of CO₂ loss (\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e). A pre-inoculum was prepared on YPD liquid medium and incubated for 24 h at 20\\u0026deg;C. After incubation, cultures were centrifuged at 3000 \\u0026times; g to pellet the cells. The supernatant was partially removed, and the cells were resuspended in the remaining medium, then diluted 1:500. The cell concentration was determined by using a Neubauer chamber. The strains were inoculated at a concentration of 1.7 \\u0026times; 10⁸ cells/mL in SMB liquid medium and incubated at 12\\u0026deg;C. Fermentations were monitored daily for 15 days by measuring the weight loss. This loss corresponds to CO₂ production resulting from sugar fermentation, providing an indirect measure of ethanol production (\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e).\\u003c/p\\u003e\\n\\u003ch3\\u003eGFP and mCherry tagged strains\\u003c/h3\\u003e\\n\\u003cp\\u003eThe genetic construct for introducing the fluorescent protein gene was derived from pRS426 plasmids previously assembled through \\u003cem\\u003ein vivo\\u003c/em\\u003e recombination, containing the KanMX-GFP and Hygr-mCherry cassettes (\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e). For the insertion of the construct into the \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e strain via homologous recombination, PCR was performed using high-fidelity Phusion Flash polymerase (Thermo Scientific, USA) with recombination primers containing the additional sequences required for genomic recombination (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). For the generation of mutants with the insertion of the fluorescent protein at the \\u003cem\\u003eHO\\u003c/em\\u003e locus, a transformation was performed using the previously obtained construction in combination with the CRISPR-Cas9 technique to optimize the transformation efficiency (\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e). For this purpose, the pAEF plasmid containing the guide RNA sequence gRNA3 directed to the \\u003cem\\u003eHO\\u003c/em\\u003e locus was used (\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003ePrimers list\\u003c/b\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eSequence (5\\u0026rsquo;-3\\u0026rsquo;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMATa-eu\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eACGCCACTCCAAGTAAGAGTCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMATα-eu\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCACGGAATATGGGACTACTTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMATfla-eu\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAGTCACATCAAGATCATTTATG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRecombination-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTACATGCTCGCTGTACATGAACTCTGGGATTTGCTTCTCACCATCGAGCTATTTCAAAGAATACGTAAAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRecombination-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCACATCTATATAGACAACAACCACTTCCACTAGCCTTTAAGCATGCTTTatcgatgaattcgagctcgt\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSpore isolation\\u003c/h2\\u003e \\u003cp\\u003eTetrads formation from each selected strain was induced by growing the cultures on 2% potassium acetate agar at 20\\u0026deg;C for 5 days. After sporulation, tetrads were sampled and diluted 1:100 in sterile water. Then, 1 \\u0026micro;L of zymolyase (USBiological, USA) at 1 \\u0026micro;g/mL was added to digest the ascus wall, facilitating the release of individual spores. The mixture was incubated at 37\\u0026deg;C for 30 min. Subsequently, glass beads were added, and the mixture was vortexed for 20 s to disaggregate the tetrads. Beads were removed, and 1 mL of sterile water was added to the suspension. Spore enrichment was completed by microfiltration using 5 \\u0026micro;m pore-size filters for retaining non-dispersed tetrads and non-sporulated cells (Millex, Ireland). To verify successful isolation of haploid spores, they were plated on YPD agar. Colony PCR was performed to amplify regions of the \\u003cem\\u003eMAT\\u003c/em\\u003e gene to determine the mating type. For this, colonies were picked up and transferred into 50 mM NaOH, incubated for 5 minutes at 100\\u0026deg;C, and centrifuged at 3000 \\u0026times; g for 3 min. The supernatant was transferred to a new tube, and 1 \\u0026micro;L was used as DNA template for PCR amplification with \\u003cem\\u003eMAT\\u003c/em\\u003e-specific primers (see Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e), using GoTaq\\u0026reg; Green Master Mix (Promega, USA).\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eMass-mating and hybrid isolation\\u003c/h3\\u003e\\n\\u003cp\\u003eOnce haploid spores were obtained from each of the parental strains of \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e, equivalent quantities of spores from each parental strain were collected and pooled into a single tube. The resulting mixture was supplemented with liquid YPD medium to a final volume of 5 mL and incubated at 20\\u0026deg;C until biomass formation was observed. In parallel, an identical procedure was carried out using the previously described synthetic SMB medium supplemented with 9% ethanol. This enrichment process was repeated twice to favor the propagation of yeast strains with major fitness in this specific medium. After the final enrichment cycle, the yeast population was plated onto YPD agar and SMB agar supplemented with 9% ethanol to obtain individual colonies. Isolated colonies were further analyzed by PCR using the \\u003cem\\u003eMAT\\u003c/em\\u003e locus to confirm their hybrid nature.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eFor evaluating the statistical differences, the two-way ANOVA (\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e) and Bartlett's test (\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e) were utilized.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePhenotypic landscape of parental S. eubayanus strains\\u003c/h2\\u003e \\u003cp\\u003eOne of the main features of wild-type yeast is its ability to undergo sporulation, a key trait for survival in natural environments (\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e). To evaluate the diversity of the sporulation performance in the \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e, 79 strains were cultured on potassium acetate medium. After incubation, the samples were observed under a microscope, and the percentage of formed tetrads (spores) was determined (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). The \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e strains exhibited sporulation rates ranging from ~\\u0026thinsp;50% to ~\\u0026thinsp;90%, indicating that there exists a differential tendency of the strain to sporulate in this medium (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB and Table \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003eb. The five strains with the highest sporulation percentages were CL710.1, CL813.1, CL915.1, and CL1112.1, whereas the five lowest were CL211.3, CL814.1, CL449.1, CL601.1, and CL450.1.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e strains analyzed belong to different sample places in Chile from Talca to Karukinka (35.4\\u0026deg; S to 54.0\\u0026deg; S). This range encompasses a broad climatic gradient that transitions from a temperate Mediterranean regime in the central region (Talca) to cold temperate and subpolar conditions in the southernmost areas, marked by increasing precipitation, decreasing temperatures, and the influence of strong westerly winds toward higher latitudes (Karukinka) (\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e). The differences in the ecological niches may influence the metabolism of each strain, reflecting adaptations to their specific environment (\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e). Considering the above, the strains were cultivated in liquid media using 96-well microplates to assess differences in phenotypic behavior related to carbon source assimilation and resistance to various stressors, some of which mimic the conditions encountered during bioethanol fermentation (\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e). The growth was monitored by measuring OD\\u003csub\\u003e600\\u003c/sub\\u003e, and kinetic parameters were calculated from the growth curves. Using the \\u0026micro;max value as a fitness parameter, a heatmap with hierarchical clustering and PCA analysis was performed. For this analysis, growth values of each strain in each condition were normalized to growth in the control medium (YNB-2% Glucose). For a more comprehensive analysis of characteristics, the phenotyping was separated into \\u0026ldquo;carbon sources assimilation\\u0026rdquo; and \\u0026ldquo;stressors resistance\\u0026rdquo;. Heatmap analysis of carbon source assimilation revealed six different clusters (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e and Table \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003ec, each displaying different phenotypic profiles among the analyzed strains. The heatmap shows a high degree of phenotypic variability, as reflected by the wide range of growth rates (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e). Interestingly, all the members of Cluster A, comprising CL1106.1, CL1110.1, CL607.1, CL610.1, CL821.1, CL906.1, CL815.1, and CL910.1, showed enhanced growth in media containing fructose. Additionally, only some strains of Cluster C show enhanced growth in fructose, but all members were able to grow in this condition, when compared to other Clusters. All strains showed high growth rate in sucrose, maltose, and raffinose, in comparison to other carbon sources such as galactose, sorbitol, and xylose. Interestingly, only Cluster A shows a reduced growth rate in sucrose, maltose, and raffinose, compared with the other clusters. Interestingly, the strains belonging to Cluster B (CL1112.1, CL1004.1, CL1111.1, CL1108.1, and CL1109.1) showed the highest performance in maltodextrin medium. Conversely, Clusters D, E, and F showed a relatively homogeneous phenotypic pattern, with only Cluster D exhibiting enhanced growth in malt extract medium. This observation could reflect a higher resistance of these strains to the major concentration of the malt extract medium (6\\u0026deg; brix). Finally, only Cluster A possesses strains (CL607.1, CL610.1, CL1001.1, and CL1010.1) with a higher capacity to grow in the medium that emulates the bioethanol molasses (SMB). Furthermore, the PCA analysis of carbon source assimilation identified four distinct groups (Figure \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e). Interestingly, one of them comprised strains sharing a similar geographic origin (Group 1). For strain isolation, the southern region of Chile was divided into latitudinal zones (e.g., Region 200, Region 300, etc.), and strains from each zone were assigned numerical codes within the same hundred series (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e). Accordingly, Group 1 mainly comprised strains collected from sites located within the 800 and 900 regions (Figure \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eAs was mentioned above, the strains were grown in different stressor media that can emulate some of the stresses present in bioethanol fermentation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e, Figure \\u003cspan refid=\\\"MOESM2\\\" class=\\\"InternalRef\\\"\\u003eS2\\u003c/span\\u003e, and Table \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003ed). The analysis of the heatmap shows that the strains of Cluster J are evidently more resistant to the reductor effect of DDT in comparison to other Clusters (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). In the same way, the strains of Cluster G are the only ones that presented a superior growth on SDS in comparison to the other Clusters. Interestingly, most of the strains (Cluster G and H) are tolerant to NaCl and p-coumaric acid, the latter acts as a microbial growth inhibitor and is present in several lignocellulosic agro-industrial wastes. Additionally, the data show that practically all the strains are sensitive to KCl, H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2,\\u003c/sub\\u003e and the antibiotic G418, the latter being particularly relevant if the strains are intended for use in recombinant DNA technologies (\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e). Additionally, the PCA analysis of strains growth in different stressors media shows three groups (Figure \\u003cspan refid=\\\"MOESM2\\\" class=\\\"InternalRef\\\"\\u003eS2\\u003c/span\\u003e). A similar grouping phenomenon was observed compared with the carbon sources grouping, with Group 1 composed of strains from 800 and 900 sampling sites, reinforcing the idea of a correlation between the phenotypic behavior and the sampling environment.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eSaccharomyces\\u003c/em\\u003e yeasts possess the intrinsic ability to ferment simple sugars into alcohol while maintaining ethanol tolerance (\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e). To evaluate this trait, we tested the alcohol tolerance of the strains, a key feature for industrial fermentation. The strains were cultured in YNB-Glucose 2% medium supplemented with 8% ethanol or 8% methanol, and a heatmap with hierarchical clustering based on \\u0026micro;max values was generated (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e and Table \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003ee. The analysis revealed that Cluster K was the most sensitive to ethanol, whereas Cluster N showed the highest tolerance. Among the latter, the most tolerant strains were CL1112.1, CL1104.1, and CL607.1. In contrast, for methanol tolerance, Cluster O displayed the greatest resistance, followed by Clusters Q and P, with CL814.1, CL816.1, and CL905.1 identified as the most tolerant strains.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eBased on their growth performance and sporulation capacity, seven \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e strains were selected as parentals for spore isolation and mass-mating to maximize the obtaining of phenotypic diversity. The rationale was to combine favorable genetic variants within a single genetic background to achieve improved strains for SMB fermentation. The selected strains were CL910.1, CL813.1, CL1112.1, CL824.1, CL1109.1, CL915.1, and CL1002.1, chosen for their enhanced growth in fructose, sucrose, maltodextrin, NaCl, 8% ethanol, p-coumaric acid, and raffinose, respectively. As previously mentioned, the parental strains exhibit differential growth on various carbon sources and stressors, traits that could influence their overall fermentative performance. To assess this capacity, a fermentation was conducted in SMB medium using the selected parental strains.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eFermentation rate of parental strains\\u003c/h2\\u003e \\u003cp\\u003eThe first step in assessing the fermentative potential of the selected parental strains was to evaluate their growth performance in SMB medium supplemented with 9% ethanol (SMB-9% ethanol). Given this condition, the selected strains will undergo a stringent selective bottleneck in the subsequent experimental stages (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e). As a control, the strains were also cultured in YPD medium. As expected, they displayed superior growth in YPD, a nutrient-rich medium that supports yeast proliferation, compared to SMB-9% ethanol, which poses a stringent condition for microbial growth. Considering the performance in the SMB-9% ethanol medium, strain CL815.1 (1.08 OD/h) showed the lowest growth rate, whereas CL1112.1 (1.27 OD/h) exhibited the highest, likely reflecting its major ethanol tolerance (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eFermentation capacity was further evaluated in the SMB medium (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). Considerable variability in fermentation performance profile was observed among the parental strains, but no significant differences were observed between CL824.1, CL1112.1, CL813.1, CL1102.1, and CL915.1 at the final stage of the fermentation (one-way ANOVA analysis). When compared with the domesticated industrial lager strain W34/70, \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e showed a similar final fermentation performance but displayed distinct kinetics, being more active during the initial stages of fermentation. The most efficient strain was the wild-type \\u003cem\\u003eS. cerevisiae\\u003c/em\\u003e SACE-YBS, included as a positive control (\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e), which outperformed all other strains in terms of fermentation kinetics. These results underscore the intraspecific variability in fermentation performance profiles and highlight the potential for improving the selected parental strains.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMass-mating and hybrid isolation\\u003c/h2\\u003e \\u003cp\\u003eOne of the main challenges of mass-mating is the capability of haploid cells to mate under liquid culture conditions (\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e). To evaluate this, the \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e CL444.1 strain was engineered to express GFP or mCherry by integration at the \\u003cem\\u003eHO\\u003c/em\\u003e locus. The transformants were sporulated, and segregants of different mating types were isolated by micromanipulation and genotyped to confirm the presence of the GFP and mCherry markers (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). Fluorescence expression in the engineered strains was further validated by fluorescence microscopy. To assess the hybridization rate, complementary mating-type strains were co-cultured in YNB supplemented with 2% glucose, and fluorescence signals were monitored over time. To ensure the identification of genuine co-localization events, each fluorescence channel was manually examined to verify exact signal superposition. Under these conditions, early growth phase and low cell density, the proportion of hybrids reached approximately 9% (Figure \\u003cspan refid=\\\"MOESM3\\\" class=\\\"InternalRef\\\"\\u003eS3\\u003c/span\\u003e). Additionally, the agglomeration phenotype observed in the culture was concordant with that observed in yeasts that are predisposed to carry out mating (\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eHaving confirmed the feasibility of mass-mating, the next step was to obtain haploid spores from wild-type parental strains. For this purpose, tetrads were digested with zymolyase, mechanically disrupted, and filtered by size (5 \\u0026micro;m), generating a spore-enriched suspension. Individual colonies were then analyzed to confirm their haploid status by PCR of the \\u003cem\\u003eMAT\\u003c/em\\u003e locus, where haploids display a single band corresponding to one allele. To perform mass-mating assays, haploid cells from each parental strain were mixed in equal proportions and incubated in YNB- 2% glucose medium to promote hybrid formation. Following incubation, colonies were isolated on solid medium. As a control, ten colonies were randomly selected and genotyped by PCR for both \\u003cem\\u003eMATa\\u003c/em\\u003e and \\u003cem\\u003eMATα\\u003c/em\\u003e. All tested isolates showed two bands, confirming their diploid status and thereby validating the successful generation of intraspecific hybrids in liquid medium (data not shown).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePhenotypic characterization of hybrids\\u003c/h2\\u003e \\u003cp\\u003eOne of the primary objectives was to generate hybrids possessing genetic variants well-suited for SMB fermentation. To enrich the hybrid collection with strains exhibiting superior performance, a mixed culture of haploid parental strains was subjected to two successive growth cycles in SMB medium supplemented with 9% ethanol. From this culture, 30 hybrids were isolated for phenotypic characterization under diverse media and fermentation conditions. To evaluate a potential genetic bottleneck effect introduced by the enrichment step in SMB-9% ethanol, a parallel preculture was performed in YPD using the same initial hybrid population under identical conditions. Subsequently, 30 hybrids from each group were selected and cultured in SMB medium containing 9% ethanol (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e). Growth rate analysis revealed significant differences between the variances of the two groups (p-value 0.0002, Bartlett's test). Moreover, hybrids preselected in YPD exhibited greater variability in growth rates, whereas those enriched in SMB-9% ethanol showed more uniform growth, confirming the bottleneck effect of the latter.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe hybridization process can generate novel combinations of genetic variants, potentially leading to phenotypic behaviors distinct from those of the parental strains. Consequently, hybrids may exhibit a broad range of fitness changes across different culture conditions. To assess the retention of phenotypic diversity, we performed a comprehensive phenotyping assay (Table \\u003cspan refid=\\\"MOESM2\\\" class=\\\"InternalRef\\\"\\u003eS2\\u003c/span\\u003ea and S2b). PCA of the \\u0026micro;max values across 17 conditions revealed that most hybrids displayed similar phenotypic profiles, except for H7-SMB, H13-SMB, H30-SMB, and H18-YPD (Figures \\u003cspan refid=\\\"MOESM4\\\" class=\\\"InternalRef\\\"\\u003eS4\\u003c/span\\u003e and S5). These findings suggest that the hybridization process generates strains with comparable traits, but certain genetic combinations give rise to hybrids with unique phenotypic characteristics. Some of the remarkable characteristics are a reduced assimilation of fructose in H18-YPD (0.7 OD/h), high H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e tolerance in H30-SMB (1.68 OD/h), and a high maltodextrin assimilation capacity in H7-SMB and H13-SBM (1.27 and 1.54 OD/h, respectively).\\u003c/p\\u003e \\u003cp\\u003eAdditionally, to evaluate whether hybrids generated through mass-mating exhibited enhanced fermentation capacity compared to their respective parents, 15 isolates from each of the enrichment conditions were selected. For each group, the 5 highest-growing, 5 intermediate-growing, and 5 lowest-growing performance strains were chosen based on growth data. A wide range of fermentation rates was observed among the groups (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003e). Comparing the hybrids with the best parental strain CL824.1, which had the highest fermentation rate in SMB (~\\u0026thinsp;20 g/L CO\\u003csub\\u003e2\\u003c/sub\\u003e loss), the hybrids generally matched the parental fermentation profile after 15 days (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003e and Figure \\u003cspan refid=\\\"MOESM6\\\" class=\\\"InternalRef\\\"\\u003eS6\\u003c/span\\u003e). Notably, several hybrids, H2-YPD, H17-YPD, H18-YPD, H12-SMB, H23-SMB, H26-SMB and H30-SMB, exhibited higher total CO₂ production in comparison with the best parental strain (Table \\u003cspan refid=\\\"MOESM2\\\" class=\\\"InternalRef\\\"\\u003eS2\\u003c/span\\u003ec). Among the above, the hybrid H30-SMB showed the greatest improvement in fermentative capacity (28%).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eThese findings demonstrate that intra-species hybridization produces strains with diverse phenotypic behaviors compared to their parental lines, underscoring its remarkable potential as a driver of phenotypic innovation in \\u003cem\\u003eSaccharomyces\\u003c/em\\u003e. The enrichment of hybrid populations under selective pressure (SMB 9% ethanol) not only shaped a more homogeneous and stress-tolerant phenotype but also unveiled unique combinations of parental alleles that conferred superior fermentative capacity. This selection strategy effectively acted as an evolutionary bottleneck, amplifying the frequency of adaptive genotypes capable of thriving in environments mimicking industrial fermentations. These results provide a foundation for the rational development of next-generation \\u003cem\\u003eSaccharomyces\\u003c/em\\u003e hybrids, bridging natural adaptation and synthetic breeding to meet the demands of industrial biotechnology.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eOur findings revealed that mass-hybridization, followed by targeted selection under restrictive culture conditions, can accelerate the emergence of superior genotypes optimized for bioethanol production. The observation that several hybrids outperformed the best parental strain in CO₂ production underscores the synergistic potential of combining natural genetic diversity with the genetic bottleneck effect. In this context, the evaluation of the sporulation rate of \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e strains shows that all sporulate after five days under high-stress conditions, specifically in potassium acetate medium. These results are consistent with previous data, which indicate that most wild-type strains conserve sexual reproduction (\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e), in contrast to several \\u003cem\\u003eS. cerevisiae\\u003c/em\\u003e strains that present a high level of domestication (\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e). It is well documented that domesticated yeast strains tend to lose certain traits, such as sporulation, that are commonly retained in their wild counterparts (\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e). \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e, as a wild yeast, has not undergone a domestication process, retaining high sporulation capacity in response to nutrient stress (\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e). This behavior contrasts with that observed in industrially derived strains from fermentative environments (\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e). In such conditions, sporulation becomes metabolically unnecessary and has been progressively lost across generations, allowing yeast to reallocate energy toward traits more beneficial for fermentation, such as flocculation (\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e). During microscopy analysis used to calculate inoculation rate for fermentation, none of the hybrid strains exhibited a flocculent phenotype (data not shown), which means the formation of visible clumps or \\\"flocs\\\" in liquid suspension (\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e). Flocculation may enhance fermentation efficiency, as cell aggregates are better protected against adverse environmental factors such as pH or temperature fluctuations (\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eRegarding the growth performance of \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e wild-type strains under stress conditions, the hierarchical clustering and the group PCA analysis revealed clear patterns in the different conditions utilized. Notably, clustering and grouping patterns suggested a relationship between phenotypic behavior and the geographic latitude of the collection site (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e). One key observation is that strains isolated from similar sampling locations tended to cluster together. This could suggest that geographic and environmental factors drive phenotypic variability in natural populations of \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e, facilitating ecological adaptation. Indeed, strain codes of \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e correspond to their collection sites (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e), such as \\u0026ldquo;CL1001.1\\u0026rdquo; and \\u0026ldquo;CL1010.1\\u0026rdquo;, belong to Torres del Paine (51\\u0026deg;16\\u0026prime;00\\u0026Prime;S 72\\u0026deg;21\\u0026prime;00\\u0026Prime;O). These two strains cluster in the same group in carbon sources and stressors phenotyping. Another example is the \\u0026ldquo;CL702.1\\u0026rdquo; and \\u0026ldquo;CL705.1\\u0026rdquo;, from Talca (35\\u0026deg;25\\u0026prime;37\\u0026Prime;S 71\\u0026deg;39\\u0026prime;56\\u0026Prime;O), that cluster together in carbon sources and stressors culture conditions. This issue supports the idea that \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e strains exhibit some degree of geographic structure relationship in their phenotypic traits, not necessarily related to the respective genetic population (\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003ePhenotypic variability in this species has previously been reported, particularly in traits such as fermentation capacity, metabolite production, and aroma profiles across genetically distinct individuals (\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e). However, there exist significant knowledge gaps regarding how these phenotypes relate to geographic origin. The clustering of strains by locality may reflect ecological adaptation to local nutrients, as specific sugar availability, or stressors like extreme temperatures and pH fluctuations (\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e). A more detailed analysis of the relationship between \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e and its ecological niche could provide important insights into how wild yeasts adapt to their native environments.\\u003c/p\\u003e \\u003cp\\u003eGenotypic analysis of the mating assays did not reveal haploid strains among the hybrid samples. This was evidenced by the presence of both mating-type genes, \\u003cem\\u003eMATa\\u003c/em\\u003e and \\u003cem\\u003eMATα\\u003c/em\\u003e, in the isolates, confirming the success of the mass-mating process. Furthermore, fermentation kinetics provided additional support for this assumption. The differences observed between the fermentation profiles of hybrids and their parental strains strongly indicate effective genetic recombination between the parental genomes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e, Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003e, and Figure \\u003cspan refid=\\\"MOESM6\\\" class=\\\"InternalRef\\\"\\u003eS6\\u003c/span\\u003e). The fermentative profiles of hybrids diverged from the parental strains, indicating that hybrids exhibit phenotypic traits that are not present in the original strains due to the interaction of hybrid genomes (\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e), reinforcing the idea that new phenotypic traits have emerged from the recombination of parental genomes (\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e). Consistently, growth data obtained in both YPD and SMB media support these observations. The differences in growth between the hybrids and parental strains under selective media conditions indicate that the hybrids possess distinct phenotypic characteristics, reaffirming the hybridization phenomenon (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e and Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eThese findings underscore the importance of using \\u0026ldquo;sexually competent\\u0026rdquo; strains to maximize genetic exploration and adaptability of \\u003cem\\u003eSaccharomyces\\u003c/em\\u003e species for fermentation processes such as biofuel production. This approach aligns with other studies showing successful interspecies hybridization. For instance, a study involving the mating of \\u003cem\\u003eS. cerevisiae\\u003c/em\\u003e strains engineered for xylose fermentation with other \\u003cem\\u003eSaccharomyces\\u003c/em\\u003e species demonstrated an effective genetic combination (\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e). In the above study, through adaptive evolution, hybrid strains were adapted to media with conditions similar to those used in the present research, retained tolerance to hydrolysates, and exhibited improved fermentation traits compared to their ancestral synthetic hybrids (\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003eConsidering the fermentation on SMB media, several \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e hybrids showed significantly higher CO₂ production compared to the best parental strain CL824.1. This finding suggests that genetic recombination between \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e strains from different phenotypic clusters can generate hybrids with superior fermentation traits for bioethanol production.\\u003c/p\\u003e \\u003cp\\u003eUnlike domesticated \\u003cem\\u003eS. cerevisiae\\u003c/em\\u003e strains, the wild yeast \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e has not undergone centuries of artificial selection, potentially granting it greater flexibility and adaptability to extreme fermentation conditions (\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e). As such, \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e may still be below its biological performance threshold and could continue improving its CO₂ production capacity, reflecting greater adaptive potential.\\u003c/p\\u003e\"},{\"header\":\"Conclusions\",\"content\":\"\\u003cp\\u003eIn summary, our study tested the hypothesis that yeast strains of the \\u003cem\\u003eSaccharomyces\\u003c/em\\u003e genus, exhibiting resistance to various stressors (commonly encountered in industrial fermentations), could combine desirable traits for bioethanol production through sexual reproduction. The results support this hypothesis, showing that the \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e hybrids were successfully obtained, exhibiting superior performance compared to their parental strains under stress conditions typically found in bioethanol production environments. These findings represent a significant advancement in the development of more robust and efficient yeast strains for industrial bioethanol, potentially contributing to greater sustainability and efficiency in bioenergy fermentation processes.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by the National Association of Research and Development (ANID) with the FONDECYT Iniciaci\\u0026oacute;n Grant N\\u0026deg; 11240430, FONDECYT Grant N\\u0026deg; 1251234, and Programa Iniciativa Cient\\u0026iacute;fica Milenio - ICN17_022.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank Ph.D. Francisco Cubillos for kindly providing the \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e strains used in this study.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eConceptualization: I.G., S.D., and W.M. Formal analysis: \\u0026nbsp; I.G., C.A., and W.M. Investigation: I.G., C.A., S.D., I.A., V.Z., and W.M. Writing\\u0026mdash;original draft: I.G., and W.M. Writing\\u0026mdash;review \\u0026amp; editing: V.Z., LF.L., and W.M.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eData used for heatmaps and PCA are included within the supplementary information files. Additional raw datasets (e.g., OD600 raw data) are available from the corresponding author upon request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eEthics approval and consent to participate\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eConsent for publication\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eCompeting interests\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no competing interest.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eLiu Y, Cruz-Morales P, Zargar A, Belcher MS, Pang B, Englund E, et al. Biofuels for a sustainable future. Cell. 2021;184(6):1636-47.\\u003c/li\\u003e\\n\\u003cli\\u003eAttanayake K, Wickramage I, Samarasinghe U, Ranmini Y, Ehalapitiya S, Jayathilaka R, et al. Renewable energy as a solution to climate change: Insights from a comprehensive study across nations. PLoS One. 2024;19(6):e0299807.\\u003c/li\\u003e\\n\\u003cli\\u003eDemirbas A. Biofuels securing the planet\\u0026rsquo;s future energy needs. Energy Conversion and Management. 2009;50(9):2239-49.\\u003c/li\\u003e\\n\\u003cli\\u003eYaverino-Guti\\u0026eacute;rrez MA, Wong AYCH, Ibarra-Mu\\u0026ntilde;oz LA, Ch\\u0026aacute;vez ACF, Sosa-Mart\\u0026iacute;nez JD, Tagle-Pedroza AS, et al. Perspectives and Progress in Bioethanol Processing and Social Economic Impacts. Sustainability-Basel. 2024;16(2).\\u003c/li\\u003e\\n\\u003cli\\u003eDevi A, Bajar S, Sihag P, Sheikh ZUD, Singh A, Kaur J, et al. A panoramic view of technological landscape for bioethanol production from various generations of feedstocks. Bioengineered. 2023;14(1):81-112.\\u003c/li\\u003e\\n\\u003cli\\u003eHo DP, Ngo HH, Guo W. A mini review on renewable sources for biofuel. Bioresour Technol. 2014;169:742-9.\\u003c/li\\u003e\\n\\u003cli\\u003eNigam PS, Singh A. Production of liquid biofuels from renewable resources. Prog Energ Combust. 2011;37(1):52-68.\\u003c/li\\u003e\\n\\u003cli\\u003eBrennan L, Owende P. Biofuels from microalgae-A review of technologies for production, processing, and extractions of biofuels and co-products. Renew Sust Energ Rev. 2010;14(2):557-77.\\u003c/li\\u003e\\n\\u003cli\\u003eIgwebuike CM, Awad S, Andr\\u0026egrave;s Y. Renewable Energy Potential: Second-Generation Biomass as Feedstock for Bioethanol Production. Molecules. 2024;29(7):1619.\\u003c/li\\u003e\\n\\u003cli\\u003eCaballero-Sanchez L, L\\u0026aacute;zaro-Mixteco PE, Vargas-Tah A, Castro-Montoya AJ. Pilot-scale bioethanol production from the starch of avocado seeds using a combination of dilute acid-based hydrolysis and alcoholic fermentation by Saccharomyces cerevisiae. Microb Cell Fact. 2023;22(1).\\u003c/li\\u003e\\n\\u003cli\\u003eMohd Azhar SH, Abdulla R, Jambo SA, Marbawi H, Gansau JA, Mohd Faik AA, et al. Yeasts in sustainable bioethanol production: A review. Biochemistry and Biophysics Reports. 2017;10:52-61.\\u003c/li\\u003e\\n\\u003cli\\u003eBasso LC, Basso TO, Rocha SN. Ethanol Production in Brazil: The Industrial Process and Its Impact on Yeast Fermentation. Biofuel Production - Recent Developments and Prospects. 2011:85-100.\\u003c/li\\u003e\\n\\u003cli\\u003eJeffries TW. Engineering yeasts for xylose metabolism. Curr Opin Biotech. 2006;17(3):320-6.\\u003c/li\\u003e\\n\\u003cli\\u003eJansen MLA, Bracher JM, Papapetridis I, Verhoeven MD, de Bruijn H, de Waal PP, et al. Saccharomyces cerevisiae strains for second-generation ethanol production: from academic exploration to industrial implementation. FEMS Yeast Res. 2017;17(5).\\u003c/li\\u003e\\n\\u003cli\\u003eMukherjee V, Steensels J, Lievens B, Van de Voorde I, Verplaetse A, Aerts G, et al. Phenotypic evaluation of natural and industrial yeasts for different traits desirable in industrial bioethanol production. Appl Microbiol Biot. 2014;98(22):9483-98.\\u003c/li\\u003e\\n\\u003cli\\u003eLibkind D, Hittinger CT, Val\\u0026eacute;rio E, Gon\\u0026ccedil;alves C, Dover J, Johnston M, et al. Microbe domestication and the identification of the wild genetic stock of lager-brewing yeast. P Natl Acad Sci USA. 2011;108(35):14539-44.\\u003c/li\\u003e\\n\\u003cli\\u003eKumari M, Padhi S, Sharma S, Phukon LC, Singh SP, Rai AK. Biotechnological potential of psychrophilic microorganisms as the source of cold-active enzymes in food processing applications. 3 Biotech. 2021;11(11).\\u003c/li\\u003e\\n\\u003cli\\u003eNespolo RF, Villarroel CA, Oporto CI, Tapia SM, Vega-Macaya F, Urbina K, et al. An Out-of-Patagonia migration explains the worldwide diversity and distribution of lineages. Plos Genet. 2020;16(5).\\u003c/li\\u003e\\n\\u003cli\\u003ede Souza JP, do Prado CD, Eleutherio ECA, Bonatto D, Malavazi I, da Cunha AF. Improvement of of Brazilian bioethanol production - Challenges and perspectives on the identification and genetic modification of new strains of yeasts isolated during ethanol process. Fungal Biol-Uk. 2018;122(6):583-91.\\u003c/li\\u003e\\n\\u003cli\\u003eMolinet J, Urbina K, Villegas C, Abarca V, Oporto CI, Villarreal P, et al. A Saccharomyces eubayanus haploid resource for research studies. Sci Rep. 2022;12(1):5976.\\u003c/li\\u003e\\n\\u003cli\\u003eEardley J, Timson DJ. Yeast Cellular Stress: Impacts on Bioethanol Production. Fermentation. 2020;6(4):109.\\u003c/li\\u003e\\n\\u003cli\\u003eMukherjee V, Radecka D, Aerts G, Verstrepen KJ, Lievens B, Thevelein JM. Phenotypic landscape of non-conventional yeast species for different stress tolerance traits desirable in bioethanol fermentation. Biotechnology for Biofuels. 2017;10(1):216.\\u003c/li\\u003e\\n\\u003cli\\u003eMardones W, Villarroel CA, Abarca V, Urbina K, Pena TA, Molinet J, et al. Rapid selection response to ethanol in Saccharomyces eubayanus emulates the domestication process under brewing conditions. Microb Biotechnol. 2022;15(3):967-84.\\u003c/li\\u003e\\n\\u003cli\\u003eSipiczki M. Yeast two- and three-species hybrids and high-sugar fermentation. Microb Biotechnol. 2019;12(6):1101-8.\\u003c/li\\u003e\\n\\u003cli\\u003eRibeiro N, Linforth R, Powell CD, Fisk ID. Influence of essential inorganic elements on flavour formation during yeast fermentation. Food Chem. 2021;361.\\u003c/li\\u003e\\n\\u003cli\\u003ePeter J, De Chiara M, Friedrich A, Yue JX, Pflieger D, Bergstrom A, et al. Genome evolution across 1,011 Saccharomyces cerevisiae isolates. Nature. 2018;556(7701):339-44.\\u003c/li\\u003e\\n\\u003cli\\u003eLino FSO, Basso TO, Sommer MOA. A synthetic medium to simulate sugarcane molasses. Biotechnol Biofuels. 2018;11:221.\\u003c/li\\u003e\\n\\u003cli\\u003eBlazanin M. gcplyr: an R package for microbial growth curve data analysis. BMC Bioinformatics. 2024;25(1):232.\\u003c/li\\u003e\\n\\u003cli\\u003eBoulton R, Nelson J, Knoesen A. A Review of Sensors for the Monitoring, Modeling, and Control of Commercial Wine Fermentations. Fermentation-Basel. 2025;11(6).\\u003c/li\\u003e\\n\\u003cli\\u003eRojas V, Larrondo LF. Coupling Cell Communication and Optogenetics: Implementation of a Light-Inducible Intercellular System in Yeast. Acs Synth Biol. 2022;12(1):71-82.\\u003c/li\\u003e\\n\\u003cli\\u003eKim HY. Statistical notes for clinical researchers: Two-way analysis of variance (ANOVA)-exploring possible interaction between factors. Restor Dent Endod. 2014;39(2):143-7.\\u003c/li\\u003e\\n\\u003cli\\u003eOdoi B, Twumasi-Ankrah S, Samita S, Al-Hassan S. The Efficiency of Bartlett\\u0026apos;s Test using Different forms of Residuals for Testing Homogeneity of Variance in Single and Factorial Experiments-A Simulation Study. Sci Afr. 2022;17.\\u003c/li\\u003e\\n\\u003cli\\u003eKnight SJ, Goddard MR. Sporulation in soil as an overwinter survival strategy in. Fems Yeast Res. 2016;16(1).\\u003c/li\\u003e\\n\\u003cli\\u003eSarricolea P, Herrera-Ossandon M, Meseguer-Ruiz O. Climatic regionalisation of continental Chile. J Maps. 2017;13(2):66-73.\\u003c/li\\u003e\\n\\u003cli\\u003eWang HY, Nielsen J, Zhou YJJ, Lu HZ. Yeast adapts to diverse ecological niches driven by genomics and metabolic reprogramming. P Natl Acad Sci USA. 2025;122(32).\\u003c/li\\u003e\\n\\u003cli\\u003eAuesukaree C. Molecular mechanisms of the yeast adaptive response and tolerance to stresses encountered during ethanol fermentation. J Biosci Bioeng. 2017;124(2):133-42.\\u003c/li\\u003e\\n\\u003cli\\u003eScholar E. Geneticin. In: Enna SJ, Bylund DB, editors. xPharm: The Comprehensive Pharmacology Reference. New York: Elsevier; 2007. p. 1-2.\\u003c/li\\u003e\\n\\u003cli\\u003eP\\u0026eacute;rez D, Jaehde I, Guillam\\u0026oacute;n JM, Heras JM, Querol A. Screening of Saccharomyces strains for the capacity to produce desirable fermentative compounds under the influence of different nitrogen sources in synthetic wine fermentations. Food Microbiology. 2021;97:103763.\\u003c/li\\u003e\\n\\u003cli\\u003eArras SDM, Hibbard TR, Mitsugi-McHattie L, Woods MA, Johnson CE, Munkacsi A, et al. Creeping yeast: a simple, cheap and robust protocol for the identification of mating type in Saccharomyces cerevisiae. FEMS Yeast Res. 2022;22(1).\\u003c/li\\u003e\\n\\u003cli\\u003eDe Chiara M, Barr\\u0026eacute; BP, Persson K, Irizar A, Vischioni C, Khaiwal S, et al. Domestication reprogrammed the budding yeast life cycle. Nature Ecology \\u0026amp; Evolution. 2022;6(4):448-60.\\u003c/li\\u003e\\n\\u003cli\\u003eHerskowitz I. Life cycle of the budding yeast Saccharomyces cerevisiae. Microbiol Rev. 1988;52(4):536-53.\\u003c/li\\u003e\\n\\u003cli\\u003ePaulino de Souza J, Dias do Prado C, Eleutherio ECA, Bonatto D, Malavazi I, Ferreira da Cunha A. Improvement of Brazilian bioethanol production - Challenges and perspectives on the identification and genetic modification of new strains of Saccharomyces cerevisiae yeasts isolated during ethanol process. Fungal Biol. 2018;122(6):583-91.\\u003c/li\\u003e\\n\\u003cli\\u003eSoares EV. Flocculation in Saccharomyces cerevisiae: a review. J Appl Microbiol. 2011;110(1):1-18.\\u003c/li\\u003e\\n\\u003cli\\u003eVerstrepen KJ, Derdelinckx G, Verachtert H, Delvaux FR. Yeast flocculation: what brewers should know. Applied Microbiology and Biotechnology. 2003;61(3):197-205.\\u003c/li\\u003e\\n\\u003cli\\u003eMardones W, Villarroel CA, Krogerus K, Tapia SM, Urbina K, Oporto CI, et al. Molecular profiling of beer wort fermentation diversity across natural Saccharomyces eubayanus isolates. Microb Biotechnol. 2020;13(4):1012-25.\\u003c/li\\u003e\\n\\u003cli\\u003eAlvarez R, Garces F, Louis EJ, Dequin S, Camarasa C. Beyond S. cerevisiae for winemaking: Fermentation-related trait diversity in the genus Saccharomyces. Food Microbiol. 2023;113:104270.\\u003c/li\\u003e\\n\\u003cli\\u003ePerez-Traves L, Lopes CA, Gonzalez R, Barrio E, Querol A. Physiological and genomic characterisation of Saccharomyces cerevisiae hybrids with improved fermentation performance and mannoprotein release capacity. Int J Food Microbiol. 2015;205:30-40.\\u003c/li\\u003e\\n\\u003cli\\u003ePeris D, Moriarty RV, Alexander WG, Baker E, Sylvester K, Sardi M, et al. Hybridization and adaptive evolution of diverse Saccharomyces species for cellulosic biofuel production. Biotechnol Biofuels. 2017;10:78.\\u003c/li\\u003e\\n\\u003cli\\u003eRaas MWD, Dutheil JY. The rate of adaptive molecular evolution in wild and domesticated Saccharomyces cerevisiae populations. Molecular Ecology. 2024;33(10):e16980.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"bioethanol production, yeast biodiversity, Saccharomyces eubayanus, intraspecific hybrids, stress tolerance\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-8138800/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-8138800/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eThe transition toward sustainable energy sources requires alternatives to fossil fuels that are both efficient and environmentally friendly. Bioethanol has emerged as a promising substitute for gasoline; however, its production is limited by substrate complexity, fermentation inhibitors, and microbial stress tolerance. Conventional bioethanol relies largely on \\u003cem\\u003eSaccharomyces cerevisiae\\u003c/em\\u003e, which has a restricted capacity to metabolize pentose sugars and withstand industrial stresses such as high ethanol and osmotic pressure. Expanding the diversity of yeasts used in bioethanol processes may help overcome these limitations. \\u003cem\\u003eSaccharomyces eubayanus\\u003c/em\\u003e, a wild yeast species from Patagonia, exhibits exceptional tolerance to extreme environments, particularly low temperatures, and shows extensive population genetic and phenotypic diversity. Its adaptability and reproductive compatibility make it a strong candidate for industrial biotechnology applications, including the generation of intraspecific hybrids with enhanced stress resistance and improved fermentative performance.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eIn this study, we evaluated the phenotypic diversity of \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e isolates under conditions relevant to bioethanol fermentation and applied mass-mating approaches to generate hybrids with improved fermentative traits. The resulting strains were assessed for their performance under stressors that mimic second-generation bioethanol production, including high ethanol concentrations, osmotic stress, and inhibitory compounds derived from lignocellulosic biomass pretreatments. Our analysis demonstrated substantial variation among isolates and identified hybrid strains with enhanced tolerance and fermentative potential.\\u003c/p\\u003e\\u003ch2\\u003eConclusions\\u003c/h2\\u003e \\u003cp\\u003eOur findings highlight the untapped potential of \\u003cem\\u003eS. eubayanus\\u003c/em\\u003e diversity for bioethanol research and demonstrate the value of mass-mating as a strategy to generate robust, high-performing strains. This work provides a framework for harnessing natural genetic resources to advance efficient, resilient, and sustainable biofuel production.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Phenotypic diversity and hybridization of wild Saccharomyces for improving bioethanol production\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-01-05 07:14:00\",\"doi\":\"10.21203/rs.3.rs-8138800/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"6f6fa0a4-f539-400a-8738-504fc0d3b46a\",\"owner\":[],\"postedDate\":\"January 5th, 2026\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-03-02T16:12:04+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-01-05 07:14:00\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-8138800\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-8138800\",\"identity\":\"rs-8138800\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}