{"paper_id":"2523fd2e-e262-4515-ad55-431a93734158","body_text":"Effect of Bacillus coagulans on DSS-Induced Ulcerative Colitis in NMRI Mice Offspring Exposed to a Maternal High-Fat Diet | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Effect of Bacillus coagulans on DSS-Induced Ulcerative Colitis in NMRI Mice Offspring Exposed to a Maternal High-Fat Diet Aylin Jafari, Razieh Mohammad Jafari, Houra Nekounam, Nima Rezaei, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8162313/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Maternal high-fat diet (MHFD) alters the offspring's gut microbiome, impairs intestinal integrity, and increases susceptibility to ulcerative colitis (UC) later in life. As Bacillus coagulans ( B. coagulans ) is known to decrease intestinal inflammation, this study investigated whether its early-life administration could reverse MHFD effects and confer protection against dextran sulfate sodium (DSS)-induced UC. Female NMRI mice were fed a normal chow diet (NCD) or high-fat diet (HFD) during gestation and lactation. Male offspring from the MHFD group received a daily oral gavage of B. coagulans or phosphate-buffered saline (PBS) from postnatal day 21 until week 8. MHFD altered the gut microbiome, decreased expression of tight junction proteins (ZO-1 and Claudin-5), and exacerbated UC severity after DSS induction. Early-life administration of B. coagulans restored the gut microbiome, improved gut integrity, decreased pro-inflammatory cytokines (IL-1β and TNF-α), and protected the MHFD offspring against UC. We conclude that MHFD impairs offspring intestinal integrity and increases UC susceptibility, while early-life B. coagulans intervention restores the gut microbiome, improves intestinal health, and confers protection against UC later in life. Health sciences/Diseases Health sciences/Gastroenterology Biological sciences/Immunology Biological sciences/Microbiology Maternal high-fat diet Offspring Bacillus coagulans Probiotic Ulcerative colitis (UC) Gut microbiome Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Inflammatory bowel disease (IBD) is a chronic immune-mediated disease that involves the gastrointestinal tract. It comprises two main subtypes: ulcerative colitis (UC) and Crohn’s disease (CD) [1]. The prevalence of UC has significantly increased across the world in recent years [2]. There has been a 152% and 142% rise in the prevalence of UC among children aged 2–17 and adults aged 18 and older, respectively [3]. However, there are geographical variations in the incidence, prevalence, and epidemiological characteristics of the disease [2,4]. Currently, UC does not have a definitive cure, and numerous studies have focused on identifying the risk factors that impact the incidence and severity of the disease. Genetic composition, environmental risk factors, certain surgeries like appendectomy, use of some medications such as oral contraceptives, and gut microbiome imbalance, referred to as dysbiosis, can affect an individual’s susceptibility and disease progression [5–9]. Maternal obesity both prior to and during gestation is associated with diverse health complications for the child, such as an elevated risk of hypertension and adverse effects on the offspring’s lung and intestine development [10–12]. Previous studies showed a strong link suggesting that maternal consumption of a high-fat diet (HFD) during gestation and lactation increases the offspring’s susceptibility to UC, both at an early age and later in life [13,14]. Previous results indicate that offspring’s gut microbiome is impacted by maternal high-fat diet (MHFD) [13]. HFD changes the composition of the maternal gut microbiome, resulting in dysbiosis. The maternal gut microbiome transfers to the offspring during gestation and lactation and shapes the infant’s gut microbiome composition in early life [15,16]. A growing body of literature has underscored the role of the gut microbiome in UC [9,17]. Dysbiosis leads to UC in several ways; for example, causing inflammation and affecting the intestinal mucosal structure and function [13,18]. Probiotics have gained significant attention in the past few years due to their ability to correct dysbiosis and regulate the immune system [18]. They produce bacteriocins and other metabolites, affect bile salt metabolism and intestinal intraluminal pH, which ultimately alters the composition of other bacteria and reduces pathogenic bacteria [19]. Bacillus coagulans (B. coagulans) has been shown to be effective in enhancing gut barrier function. Researchers have also highlighted its ability to repair damaged intestinal mucosa and reduce intestinal inflammation [20,21]. This highlights the importance of more research focusing on its ability to alleviate immune-mediated intestinal disorders. The effect of MHFD on offspring susceptibility to UC has been studied by several researchers [13,14], but whether administering B. coagulans to offspring born to mothers with HFD at an early age reverses some of the adverse effects that MHFD has exerted on the offspring’s intestinal health and decreases their susceptibility to UC has not been studied yet. As no current studies have evaluated the effect of early B. coagulans administration to offspring of mothers on a HFD, this study was designed to assess the effect of MHFD on UC susceptibility in NMRI mouse offspring. We also aimed to determine whether early-life B. coagulans could mitigate MHFD-induced dysbiosis and protect against UC later in life. Results Effect of HFD on the maternal and offspring weight: Maternal weight in HFD and NCD groups was monitored weekly from the start of the dietary intervention. No significant difference in weight was observed between the groups at any time point (P > 0.05). Offspring from MHFD and maternal control diet (MCD) groups were weighed regularly. The analysis revealed that MHFD offspring had a significantly higher body weight compared to MCD offspring at 20 days of age (P < 0.0001) (Fig. 1 ). Blood biochemical analysis of lipid-related factors: Blood samples from dams after lactation were analyzed to assess the metabolic impact of the diet. Compared to the NCD group, HFD mothers showed a significant decrease in triglycerides (TG) (P = 0.0039), significant increase in both total cholesterol (P = 0.0010) and HDL-cholesterol (HDL-C) (P = 0.0001) levels (Fig. 2 ).. Effects of MHFD on histologic appearance: H&E staining of offspring colon samples at 3 weeks of age was performed to evaluate the impact of MHFD on intestinal development. Compared to the MCD group, MHFD offspring displayed significantly reduced intestinal wall thickness (P = 0.0409) (Fig. 3 ). These pathological findings indicate that MHFD impairs offspring intestinal development. Evaluation of bacterial composition of mice feces: qRT-PCR analysis of fecal samples at 8 weeks of age revealed that MHFD drastically altered the offspring's gut microbiota. It significantly decreased the abundance of B. coagulans (P = 0.0191), Lactobacillus (P = 0.0077), Bifidobacterium (P = 0.0120), and Bacteroides (P = 0.0045), while significantly increasing the abundance of Firmicutes (P = 0.0170) (Fig. 4 ). Early-life administration of B. coagulans partially restored the depleted bacterial populations and reversed some of the MHFD-induced changes. Notably, the levels of B. coagulans (P = 0.4221), Lactobacillus (P = 0.0816), and Firmicutes (P = 0.4366) in the MHFD + B. coagulans group were not significantly different from those in the MCD group (Fig. 4 ). Western blotting analysis: Western blotting analysis: Western blot analysis of colon samples at 8 weeks showed that MHFD significantly decreased the levels of ZO-1 (P = 0.0002) and Claudin-5 (P = 0.0006). B. coagulans administration significantly increased the expression of these tight junction proteins (ZO1 P = 0.0050; Claudin5 P = 0.0230), in the MHFD group restoring cellular adhesion. Additionally, protein analysis indicated that MHFD significantly increased Ki-67 (P = 0.0076) levels while decreasing MUC-2 (P = 0.0044) (Fig. 5 ). However, no significant difference was found in Ki-67 (P = 0.2480) or MUC-2 (P = 0.0626) levels between the MCD and MHFD + B. coagulans groups. These findings demonstrate that B. coagulans improves gut integrity in offspring compromised by MHFD. Histological evaluation: To evaluate mice’s susceptibility to UC at 8 weeks, offspring from MHFD, MHFD + B. coagulans , and MCD groups received DSS in their drinking water for 6 days. Their colon pathology was compared to that of age-matched MCD mice receiving tap water as control. Following DSS exposure, the MHFD group showed significantly (P = 0.0003) reduced intestinal wall thickness compared to the DSS-treated MCD group. The MHFD + B. coagulans + DSS group exhibited a significantly thicker intestinal wall (P < 0.0001), greater crypt depth (P = 0.0012), increased villus height (P = 0.0104), and a higher number of goblet cells per villus (P = 0.0015) compared to the MHFD + DSS group (Fig. 6 ). These results indicate that early-life B. coagulans administration alleviates MHFD-induced damage and reduces susceptibility to DSS-induced UC. Evaluation of inflammation parameters with ELISA: ELISA assessment of inflammatory markers in colon tissue after DSS treatment revealed that the MHFD + DSS group had significantly higher levels of IL-1β (P = 0.0002) and TNF-α (P = 0.0002) compared to the MCD + DSS group. B. coagulans supplementation significantly reduced these pro-inflammatory cytokines (IL-1β P < 0.0001; TNF-α P < 0.0001) in MHFD offspring. Furthermore, IL-10 levels were significantly (P = 0.0011) increased in the MHFD + B. coagulans + DSS group compared to the MHFD + DSS group (Fig. 7 ). These results demonstrate the anti-inflammatory efficacy of B. coagulans in the colon of MHFD offspring after DSS challenge. Discussion Maternal diet during gestation and lactation significantly impacts the intestinal development of offspring [13]. Given the widespread consumption of a Western-style HFD among adults, it is crucial to investigate its effects on offspring intestinal development and susceptibility to IBD. Furthermore, studies have explored interventional strategies, including probiotic supplementation, to mitigate these effects and confer protection against subsequent intestinal inflammation. Previous research has shown that an HFD during gestation and lactation alters offspring's intestinal development [13,22]. Our study confirmed that a MHFD during gestation and lactation impairs the intestinal development in offspring. The maternal diet during gestation influences their gut microbiome composition, which is transferred to the offspring early in life. This transfer affects the offspring's intestinal mucosal integrity, development, mucosal immune system, and their predisposition to IBD such as UC [23,24]. Studies have shown that the gut microbiome of offspring from the MHFD group is most significantly different from that of the MCD group shortly after the lactation period, and this difference persists even after the offspring switch to a normal chow diet [13,15]. Our study demonstrated that the gut microbiome of offspring from the MHFD group remained different from the MCD group at 8 weeks of age. An HFD alters the composition of gut microbiota; it typically increases the abundance of Firmicutes and decreases Bacteroidetes [25]. Gut bacteria ferment dietary carbohydrates to produce short-chain fatty acids (SCFAs), which serve as an energy source and perform many other functions. Firmicutes produce butyrate and are more effective at extracting energy from food compared to Bacteroidetes, which predominantly produce acetate and propionate. This shift facilitates maximum energy harvest from food and is commonly observed in HFD groups [25,26]. In our study, MHFD increased Firmicutes and decreased Bacteroides , aligning with the reported shift toward a higher Firmicutes/Bacteroidetes ratio. It should be noted that the analysis was specific to the Bacteroides genus and not the entire Bacteroidetes phylum. Our results also showed that MHFD decreases the abundance of Lactobacillus and Bifidobacterium in the offspring's gut. It is important to note that many strains of Lactobacilli can have opposing effects on gut inflammation [27]. Consumption of an HFD may be linked to a decrease in anti-inflammatory Lactobacilli strains [28]. Dysbiosis impairs the gut barrier. It can facilitate bacterial invasion, leading to the activation of Toll-like receptors (TLRs). This activation triggers the secretion of inflammatory cytokines, intestinal inflammation, and the progression of UC [29]. Intestinal integrity is a key indicator of gut health and plays a critical role in the pathogenesis of UC [30]. MHFD has been shown to decrease tight junction (TJ) proteins in the colon of offspring mice at three weeks of age, indicating impaired gut integrity [13]. Our results revealed that the expression of TJ proteins like ZO-1 and Claudin-5 remains decreased in the colon of 8-week-old offspring from the MHFD group, suggesting this impairment lasts into adulthood. Probiotics are among the most effective dietary interventions for improving gut health. Some probiotics, such as Bifidobacterium , improve intestinal integrity and enhance the expression of TJ proteins [29]. In our study, the expression of ZO-1 and Claudin-5 proteins was elevated by the administration of B. coagulans , thereby restoring the disrupted mucosal integrity caused by MHFD. MUC-2, the primary mucin secreted by goblet cells, forms a protective layer over the intestinal epithelium, which limits contact between the epithelium and microbes. In UC, the number of goblet cells decreases, leading to diminished mucin (like MUC-2) production and a thinner protective layer. This results in increased contact between the gut microbiome and intestinal epithelial cells, which aggravates inflammation and worsens UC [31]. Our study showed that MUC-2 was decreased in the MHFD group, and B. coagulans administration successfully restored its levels. To investigate offspring susceptibility to UC, 8-week-old mice were exposed to a 2.5% DSS solution for 6 days to induce the disease. The results demonstrated that MHFD exacerbates UC in offspring. This was evidenced by pathological changes, including decreased intestinal wall thickness and elevated levels of inflammatory cytokines such as TNF-α and IL-1β compared to the control group following DSS exposure. These findings are consistent with a previous study which reported that MHFD increases susceptibility to and worsens the course of UC in offspring [13]. B. coagulans is a probiotic that has been shown to be effective in relieving the severity of UC. One study demonstrated that administering B. coagulans to mice after UC induction can restore the gut microbiota composition, improve intestinal integrity, and reduce gut inflammation [21]. To investigate whether B. coagulans protects against UC and reverses the effects of MHFD when administered prior to UC induction, a daily dose of 6×10 8 CFU was administered to MHFD group offspring for four weeks before UC was induced. The results showed that B. coagulans protects against UC in this model. In UC, there is overexpression of pro-inflammatory cytokines and an underexpression of anti-inflammatory cytokines. UC promotes prolonged neutrophil survival and secretion of inflammatory cytokines, particularly TNF-α, which can damage intestinal integrity and exacerbate the progression of UC [30]. In UC, mucosal macrophages produce a variety of cytokines, especially from the IL-1 family [30]. One study revealed that IL-1β amplifies intestinal permeability and disrupts epithelial barrier integrity [32]. On the other hand, IL-10 is a crucial anti-inflammatory cytokine that plays an important role in suppressing the secretion of inflammatory cytokines. IL-10 deficiency contributes to heightened secretion of pro-inflammatory cytokines and worsens UC progression [33]. In our study, the inflammatory state of the mouse colon was investigated after UC induction. Analysis showed that MHFD resulted in aggravated inflammation in the offspring's colon compared to the MCD group, which is consistent with previous findings [13]. Furthermore, B. coagulans administration was shown to significantly decrease the levels of TNF-α and IL-1β. As a result, it ameliorated the severity of inflammation and improving the disease course in MHFD offspring. In summary, these results demonstrate that a MHFD alters the offspring's gut microbial composition and increases susceptibility to DSS-induced UC. Moreover, the B. coagulans supplementation was shown to restore gut microbiome and reduce both susceptibility to and severity of UC in MHFD offspring. Methods Chemicals and antibodies: The probiotic was purchased from ParsiLact brand manufactured by Pardis Roshd Mehregan Co. (Shiraz Industrial Estate, Fars, Iran). Each sachet contained 6 \\(\\:\\times\\:\\) 10 9 Bacillus coagulans , 0.5 g dietary fibers (FOS), and 1.46 g Maltodextrin. Dextran sulfate sodium salt (DSS) was purchased from Sigma-Aldrich Co. (St. Louis, MO, USA). Primary antibodies used in the western blot test were as follows: rabbit anti-ZO-1 (Cat No ab314668, Abcam), anti-Claudin-5 (Cat No A95192, Antibodies), anti-Ki-67 (Cat No ab16667, Abcam), anti-MUC-2 (Cat No A91628, Antibodies). Anti-β-actin was used as a loading control antibody (Cat No ab8227, Abcam). A secondary goat anti-rabbit IgG H&L (HRP) (Cat No ab6721, Abcam) was used for detection. The following ELISA kits were used for cytokine quantification according to the manufacturers' protocols: mouse TNF-α (Cat No MTA00B, R&D, USA), IL-10 (Cat No M1000B, R&D, USA), and IL1-β (Cat No MLB00C-1, R&D, USA). Experimental design for mothers: Female NMRI mice weighing 20–25 g were purchased from the Animal Center of the Pharmacology Research Institute at Tehran University of Medical Sciences, Tehran, Iran, and were kept in a controlled environment (21–23°C, 50–60% humidity) under a 12-hour light/dark cycle. Animals were housed four per cage with free access to food and water ad libitum. All procedures involving animals were performed according to the National Research Council's Guide for the Care and Use of Laboratory Animals (8th edition, 2011) and in compliance with the ARRIVE guidelines. This study was approved by the Ethics Committee of Tehran University of Medical Sciences (IR.TUMS.MEDICINE.REC.1402.146). All efforts were made to minimize the number of animals used and their suffering. Female mice were randomly assigned to either an HFD or normal chow diet (NCD) group. The HFD was prepared according to Banakar et al. [34]. A mixture of 15 g of standard laboratory normal chow diet, 10 g of roasted peanuts, 10 g of white chocolate, and 5 g of biscuits with 22% fat was prepared. The quantities of all ingredients were multiplied by ten to prepare a batter, then 20 g of sesame seeds were added to it. The batter was cut into the same shape as the standard chow diet and dried at room temperature. The nutritional composition of the standard chow diet is presented in Supplementary Table S1 online. Mice in the HFD group received the HFD for two weeks prior to gestation. While, mice in the control group were fed a standard chow diet. After two weeks, one male NMRI mouse was introduced to each cage of four female mice. Male mice were fed an NCD before being introduced for mating. Mating was confirmed by checking for a vaginal plug, and upon confirmation of gestation, the male mice were removed from each cage. Each female mouse was then housed individually and weighed on a weekly basis until parturition. HFD-fed mice continued their diet during mating, gestation, and lactation. Subsequently, dams were anesthetized and blood was collected to measure levels of total cholesterol, HDL-cholesterol, LDL-cholesterol, and triglycerides. Experimental design for offspring: After parturition, the offspring were weighed every week, breastfed, and kept with the dam until 21 days of age. At this age (weaning), female offspring were excluded from the experiment, and male offspring from both MHFD and maternal control diet (MCD) groups were separated from the dams. The histological appearance of the colon was compared between these two groups at this time. Male offspring from the MHFD group were randomly allocated into two groups. They received either 0.1 mL of probiotic preparation ( B. coagulans ) (6 × 10 8 CFU) or the same amount of PBS via daily oral gavage. Male offspring from the MCD group as control, received the same amount of PBS. This intervention was continued from postnatal day 21 until 8 weeks of age. All male offspring received an NCD from weaning until the week 8. Mice were weighed on a weekly basis during the daily gavage period. At the beginning of the week 8, the gavage was discontinued. Fecal samples were collected from the MHFD, MHFD + B. coagulans , and MCD groups for qRT-PCR analysis of gut bacteria. Colon tissue samples were also collected from these three groups for Western blot analysis of Claudin-5, ZO-1, MUC-2, and Ki-67 expression. Subsequently, the offspring’s susceptibility to DSS-induced UC was tested. Colitis was induced by drinking a 2.5% (w/v) DSS solution in tap water for 6 days [35]. Control animals received plain tap water. On day 7, mice were anesthetized, and colon samples were collected for histological evaluation and ELISA analysis of IL-1β, IL-10, and TNF-α levels. Experimental groups: Maternal groups : 1. High-fat diet group (HFD) 2. Normal chow diet (NCD) Offspring groups from 21 days to the beginning of the week 8 : 1. MHFD offspring + B. coagulans 2. MHFD offspring + PBS 3. MCD offspring + PBS Groups for colitis induction test at the beginning of the week 8 : 1. MHFD offspring + B. coagulans (pre-treated) + DSS 2. MHFD offspring + PBS (pre-treated) + DSS 3. MCD offspring + PBS (pre-treated) + DSS 4. MCD offspring + PBS (pre-treated) + plain tap water Blood analysis: At the end of the lactation period, dams from the HFD and NCD groups were anesthetized (80 mg/kg of Ketamine and 10 mg/kg of Xylazine). Blood was collected via cardiac puncture and serum levels of total cholesterol, triglycerides (TG), HDL-cholesterol (HDL-C) and, LDL-cholesterol (LDL-C) were measured. Fecal DNA extraction and qRT-PCR: Fecal DNA was extracted using Qiazol (Kiazist, Iran) and chloroform (Dr. Mojallali Industrial Chemical Complex Co., Iran). After purification and washing, the DNA pellet was air-dried and DNA was resuspended in RNase-free water (Thermo, USA) or NaOH and stored at -20°C. For qRT-PCR, reactions contained SYBR Green Master Mix (Addbio, Korea), forward and reverse primers (SinaClon, Iran), nuclease-free water, and cDNA template. All primers were designed using Gene Runner (6.5.52). Reactions were run on a Real-Time PCR system (ABI StepOne, USA). Primer sequences are listed in Table 1 . Table 1 Primers used in qRT-PCR Primers Sequence Bacillus coagulans -F AGAGTTTGATCCTGGCTCAG Bacillus coagulans -R GGTTACCTTGTTACGACTT Lactobacillus -F TGGAAACAGTTGCTAATACCG Lactobacillus -R GTCCATTGTGGAAGATTCCC Bacteroides -F ATAGCCTTTCGAAAGRAAGAT Bacteroides -R CCAGTATCAACTGCAATTTTA Firmicutes-F GGAGYATGTGGTTTAATTCGAAGCA Firmicutes-R AGCTGACGACAACCATGCAC Bifidobacterium -F CTCCTGGAAACGGGTGG Bifidobacterium -R GGTGTTCTTCCCGATATCTACA 16S-F CCTACGGGNGGCWGCAG 16S-R ATTACCGCGGCTGCTGG ELISA: ELISA was performed as previously described [36]. Briefly, the assay diluent was added to the wells, then standards, samples, and controls were added. After incubation and washing, the appropriate conjugate was added. Then, the incubation and washing cycle were repeated. Following the addition of substrate and stop solution, the optical density at 450 nm was determined. Cytokine levels are reported as picograms per milliliter. Tissue and fecal collection: To evaluate histological changes and perform molecular analysis, mice were sacrificed at the end of week 3, the beginning of week 8, and after DSS treatment. Mice were anesthetized with ketamine (80 mg/kg) and xylazine (10 mg/kg, i.p.). For histology, colons were fixed in 4% formalin. Fecal samples collected at week 8 were flash-frozen in liquid nitrogen and stored at -80°C for PCR. Colon samples from week 8 were divided: one half was fixed in formalin for histology, and the other half was frozen for Western blot. Following DSS treatment, colon samples were also divided: one half was fixed for histology and the other half was frozen for ELISA analysis. All procedures involving 4% formalin were performed with appropriate personal protection and ventilation due to its hazardous nature. Microscopic histological analysis: Colon tissue samples were fixed in 4% formalin; then, they were embedded in paraffin and sectioned into 4µm slices. A pathologist blinded to the type of the treatment evaluated these samples for parameters such as Chiu score, villus height, and crypt depth. Chiu scoring was done according to the grading system briefly discussed here: 0 is normal mucosal villi; 1 is development of subepithelial space; 2 is further extension of subepithelial space and moderate epithelial layer lifting; 3 is massive epithelial lifting; 4 is severely damaged villi with dilated capillaries; and 5 is disintegration of lamina propria and ulceration [37]. Western blot: Proteins were extracted from tissues using Pro-PRE™ lysis buffer (iNtRON Biotechnology, Korea). After determining the protein concentration by BCA assay (iNtRON Biotechnology, Korea) and spectrophotometry (Smartspec Plus spectrophotometer, Bio-Rad), lysates were separated by SDS-PAGE. Afterwards, they were transferred to PVDF membranes (Bio-Rad Laboratories, CA, USA). Membranes were then blocked with 5% BSA (Sigma-Aldrich, MO, USA), they were then probed with primary and secondary antibodies. Densitometric analysis was performed using Gel Analyzer version 2010 software (NIH, USA). Data analysis: Data were analyzed using GraphPad Prism (version 8.0.2). All data are presented as the mean ± standard deviation (SD) from three independent biological replicates (n = 3 animals per group). For comparisons between two groups (e.g., maternal lipid profiles, offspring intestinal development at week 3), an unpaired, two-tailed t-test was used alongside an F-test to compare variances. For comparisons among three or more groups (e.g., cytokine levels, protein expression), an ordinary one-way ANOVA was used, followed by Tukey's post-hoc test for multiple comparisons. The use of ANOVA with Tukey's test controls the Type I error rate for multiple comparisons. For data with two independent variables (e.g., body weight over time), a two-way ANOVA was used, followed by Sidak's multiple comparisons test. A p-value of less than 0.05 (P < 0.05) was considered statistically significant. The actual P value for each comparison is reported in the Results section and the figure legends. Declarations Funding declaration This study was funded by the Experimental Medicine Research Center, Tehran University of Medical Sciences (Grant number 1402-1-209-66272). Additional information: The authors declare that they have no conflict of interest. Author Contribution A.J.: Conceptualization, Methodology, Investigation, Formal analysis, Writing – Original Draft, Visualization.R.M.J.: Methodology, Validation, Writing – Review &amp; Editing.H.N.: Writing – Review &amp; Editing.N.R.: Writing – Review &amp; Editing, Supervision.A.R.D.: Supervision, Project administration, Funding acquisition. Acknowledgement This study was supported by the Experimental Medicine Research Center, Tehran University of Medical Sciences (Grant number 1402-1-209-66272). Data Availability The datasets of the current study are available from the corresponding author on reasonable request. References Ungaro, R., Mehandru, S., Allen, P. B., Peyrin-Biroulet, L. & Colombel, J. F. Ulcerative colitis. Lancet 389 , 1756–1770 (2017). Yamazaki, M., Chung, H., Xu, Y. & Qiu, H. Trends in the prevalence and incidence of ulcerative colitis in Japan and the US. Int. J. Colorectal Dis. 38 , 135 (2023). Ye, Y., Manne, S., Treem, W. R. & Bennett, D. Prevalence of inflammatory bowel disease in pediatric and adult populations: recent estimates from large national databases in the United States, 2007–2016. Inflammatory Bowel Diseases 26 , 619–625 (2019). Park, J. & Cheon, J. H. Incidence and prevalence of inflammatory bowel disease across Asia. Yonsei Med. J. 62 , 99–108 (2021). Sun, Y. et al. The contribution of genetic risk and lifestyle factors in the development of adult-onset inflammatory bowel disease: a prospective cohort study. Am. J. Gastroenterol. 118 , 511–522 (2023). Singh, N. & Bernstein, C. N. Environmental risk factors for inflammatory bowel disease. United European Gastroenterol. J. 10 , 1047–1053 (2022). Du, L. & Ha, C. Epidemiology and pathogenesis of ulcerative colitis. Gastroenterology Clinics of North America 49 , 643–654 (2020). Pasvol, T. J., Bloom, S., Segal, A. W., Rait, G. & Horsfall, L. Use of contraceptives and risk of inflammatory bowel disease: a nested case-control study. Aliment. Pharmacol. Ther. 55 , 318–326 (2022). Guo, X. Y., Liu, X. J. & Hao, J. Y. Gut microbiota in ulcerative colitis: insights on pathogenesis and treatment. J. Dig. Dis. 21 , 147–159 (2020). Tain, Y. L. & Hsu, C. N. Maternal high-fat diet and offspring hypertension. Int. J. Mol. Sci. 23 , 8179 (2022). Heyob, K. M. et al. Maternal high-fat diet alters lung development and function in the offspring. Am. J. Physiol. Lung Cell Mol. Physiol. 317 , L167-l174 (2019). Słupecka-Ziemilska, M., Grzesiak, P., Kowalczyk, P., Wychowański, P. & Woliński, J. Maternal high-fat diet exposure during gestation and lactation affects intestinal development in suckling rats. Front. Physiol. 12 , 693150 (2021). Xie, R. et al. Maternal high fat diet alters gut microbiota of offspring and exacerbates DSS-induced colitis in adulthood. Front. Immunol. 9 , 2608 (2018). Bibi, S., Kang, Y., Du, M. & Zhu, M. J. Maternal high-fat diet consumption enhances offspring susceptibility to DSS-induced colitis in mice. Obesity 25 , 901–908 (2017). Chu, D. M., Meyer, K. M., Prince, A. L. & Aagaard, K. M. Impact of maternal nutrition in pregnancy and lactation on offspring gut microbial composition and function. Gut Microbes 7 , 459–470 (2016). Meng, L. et al. Gut-mammary pathway: breast milk microbiota as a mediator of maternal gut microbiota transfer to the infant gut. Journal of Functional Foods 124 , 106620 (2025). Franzosa, E. A. et al. Gut microbiome structure and metabolic activity in inflammatory bowel disease. Nat. Microbiol. 4 , 293–305 (2019). Roy, S. & Dhaneshwar, S. Role of prebiotics, probiotics, and synbiotics in management of inflammatory bowel disease: current perspectives. World J. Gastroenterol. 29 , 2078–2100 (2023). Plaza-Diaz, J., Ruiz-Ojeda, F. J., Gil-Campos, M. & Gil, A. Mechanisms of action of probiotics. Adv. Nutr. 10 , S49-s66 (2019). Zhao, Z. et al. Bacillus coagulans MZY531 alleviates intestinal mucosal injury in immunosuppressive mice via modulating intestinal barrier, inflammatory response, and gut microbiota. Sci. Rep. 13 , 11181 (2023). Liu, Z. et al. Bacillus coagulans in combination with chitooligosaccharides regulates gut microbiota and ameliorates the DSS-induced colitis in mice. Microbiol. Spectr. 10 , e0064122 (2022). Sun, Y. et al. Maternal high-fat diet disrupts intestinal mucus barrier of offspring by regulating gut immune receptor LRRC19. Communications Biology 8 , 420 (2025). Al Rubaye, H., Adamson, C. C. & Jadavji, N. M. The role of maternal diet on offspring gut microbiota development: a review. J. Neurosci. Res. 99 , 284–293 (2021). Mak, J. W. Y., Lo, A. T. W. & Ng, S. C. Early life factors, diet and microbiome, and risk of inflammatory bowel disease. J. Can. Assoc. Gastroenterol. 8 , S44-s50 (2025). Magne, F. et al. The firmicutes/bacteroidetes ratio: a relevant marker of gut dysbiosis in obese patients? Nutrients 12 , 1474 (2020). Murphy, E. A., Velazquez, K. T. & Herbert, K. M. Influence of high-fat diet on gut microbiota: a driving force for chronic disease risk. Curr. Opin. Clin. Nutr. Metab. Care 18 , 515–520 (2015). Li, C., Peng, K., Xiao, S., Long, Y. & Yu, Q. The role of Lactobacillus in inflammatory bowel disease: from actualities to prospects. Cell Death Discovery 9 , 361 (2023). Sun, J. et al. High-fat-diet–induced obesity is associated with decreased antiinflammatory Lactobacillus reuteri sensitive to oxidative stress in mouse Peyer's patches. Nutrition 32 , 265–272 (2016). Di Vincenzo, F., Del Gaudio, A., Petito, V., Lopetuso, L. R. & Scaldaferri, F. Gut microbiota, intestinal permeability, and systemic inflammation: a narrative review. Intern. Emerg. Med. 19 , 275–293 (2024). Porter, R. J., Kalla, R. & Ho, G. T. Ulcerative colitis: recent advances in the understanding of disease pathogenesis. F1000Res 9 , F1000 Faculty Rev-294 (2020). Bankole, E., Read, E., Curtis, M. A., Neves, J. F. & Garnett, J. A. The relationship between mucins and ulcerative colitis: a systematic review. J. Clin. Med. 10 , 1935 (2021). Rawat, M. et al. IL1B increases intestinal tight junction permeability by up-regulation of MIR200C-3p, which degrades occludin mRNA. Gastroenterology 159 , 1375–1389 (2020). Kaur, A. & Goggolidou, P. Ulcerative colitis: understanding its cellular pathology could provide insights into novel therapies. J. Inflamm. 17 , 15 (2020). Banakar, F. et al. Hydro alcoholic green tea extract effect on high fat diet treated NMRI mice and 3T3L1 cells. J. Diabetes Metab. Disord. 20 , 641–648 (2021). Zhu, Y. et al. Intestinal epithelium-specific knockout of the cytochrome P450 reductase gene exacerbates dextran sulfate sodium-induced colitis. J. Pharmacol. Exp. Ther. 354 , 10–17 (2015). Lesani, A. et al. Acute anticonvulsant effects of dapsone on PTZ- and MES-induced seizures in mice: NLRP3 inflammasome inhibition and Nrf2/HO-1 pathway preservation. Pharmacol. Rep. 77 , 450–462 (2025). Zhang, J., Liu, T., Xue, T. & Jia, Z. Paricalcitol alleviates intestinal ischemia-reperfusion injury via inhibition of the ATF4-CHOP pathway. Front. Pharmacol. 16 , 1529343 (2025). Additional Declarations No competing interests reported. Supplementary Files supplementaryinformation.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-8162313\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":634112440,\"identity\":\"084632ef-aa14-4245-b63a-44a8a1c05823\",\"order_by\":0,\"name\":\"Aylin Jafari\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tehran University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Aylin\",\"middleName\":\"\",\"lastName\":\"Jafari\",\"suffix\":\"\"},{\"id\":634112445,\"identity\":\"98646100-f71d-4e2e-b1d5-a590b0cc25f9\",\"order_by\":1,\"name\":\"Razieh Mohammad Jafari\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tehran University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Razieh\",\"middleName\":\"Mohammad\",\"lastName\":\"Jafari\",\"suffix\":\"\"},{\"id\":634112447,\"identity\":\"b2eff1de-3cf6-42fe-b340-6497c5d8452c\",\"order_by\":2,\"name\":\"Houra Nekounam\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tehran University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Houra\",\"middleName\":\"\",\"lastName\":\"Nekounam\",\"suffix\":\"\"},{\"id\":634112449,\"identity\":\"6626516d-c9b7-4d44-b5a1-019b034b2872\",\"order_by\":3,\"name\":\"Nima Rezaei\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tehran University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Nima\",\"middleName\":\"\",\"lastName\":\"Rezaei\",\"suffix\":\"\"},{\"id\":634112451,\"identity\":\"cfeb3592-3f26-44a7-8f74-bebf9dc35d94\",\"order_by\":4,\"name\":\"Ahmad Reza Dehpour\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwElEQVRIiWNgGAWjYBACewYeMC3HAGUQBoYNEJXGxGsxOABRmdhAvJbjvccefGy7l77h+NmDDz4w2MnpNhDScuZcuuHMtuLcDWfykg1nMCQbmx0gpOVGjpk0b1tC7oYDQAYPw4HEbQS13H8D1pJucP4NsVpu8IC1JICtI0qLYU+OueGMcwmGM2+8MTacYUCEX+zZz5g9+FCWIM93PsfwwYcKOzmCWoCADUwqgFUaEFaO0CLfQJzqUTAKRsEoGIEAAKo6QzVdezpeAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Tehran University of Medical Sciences\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Ahmad\",\"middleName\":\"Reza\",\"lastName\":\"Dehpour\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-11-20 08:38:36\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-8162313/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-8162313/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":108545348,\"identity\":\"358b5ef5-72b4-4d6e-8449-cb9c035150bd\",\"added_by\":\"auto\",\"created_at\":\"2026-05-05 20:19:27\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":57061,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMaternal and offspring body weights from both the HFD and NCD groups were assessed and compared\\u003c/strong\\u003e. (a) Offspring body weight in the MHFD (n=3) and MCD (n=3) groups. (at day 20, P\\u0026lt;0.0001, Two-way ANOVA with Sidak’s multiple comparisons test). (b) Maternal weight in the HFD (n=3) and NCD (n=3) groups. No significant differences were found at any time point (Two-way ANOVA with Sidak’s multiple comparisons test). Data are presented as mean and error ± SD. MCD maternal control diet MHFD maternal high-fat diet NCD normal chow diet HFD high-fat diet \\u003csup\\u003e*\\u003c/sup\\u003eP\\u0026lt;0.05 \\u003csup\\u003e**\\u003c/sup\\u003eP\\u0026lt;0.01 \\u003csup\\u003e***\\u003c/sup\\u003eP\\u0026lt;0.001 \\u003csup\\u003e****\\u003c/sup\\u003eP\\u0026lt;0.0001\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Picture1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8162313/v1/35b83b0bca6c778471d451af.jpg\"},{\"id\":108545350,\"identity\":\"5233e8bc-7f24-4ff1-84ee-1e149926e66b\",\"added_by\":\"auto\",\"created_at\":\"2026-05-05 20:19:27\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":293232,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eHFD altered the maternal serum lipid profile.\\u003c/strong\\u003e (a) Serum levels of triglycerides (TG) (P= 0.0039), (b) total cholesterol (P= 0.0010), (c) HDL-cholesterol (HDL-C) (P= 0.0001), and (d) LDL-cholesterol (LDL-C) (P= 0.1101) were measured after lactation (n=3 per group; two-tailed unpaired t-test). Data are presented as mean ± SD. NCD normal chow diet HFD high-fat diet \\u003csup\\u003e*\\u003c/sup\\u003eP\\u0026lt;0.05 \\u003csup\\u003e**\\u003c/sup\\u003eP\\u0026lt;0.01 \\u003csup\\u003e***\\u003c/sup\\u003eP\\u0026lt;0.001 \\u003csup\\u003e****\\u003c/sup\\u003eP\\u0026lt;0.0001\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Picture2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8162313/v1/072db57619b926897a1873e4.jpg\"},{\"id\":108804254,\"identity\":\"74a8984e-7a3f-4630-a817-05954f34f0eb\",\"added_by\":\"auto\",\"created_at\":\"2026-05-08 15:18:29\",\"extension\":\"jpg\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":410105,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMHFD impairs offspring colon development at 3 weeks of age\\u003c/strong\\u003e. Representative hematoxylin and eosin (H\\u0026amp;E)-stained sections of the colon from (a) MCD and (b) MHFD offspring (scale bar = 200 µm ×40 magnification). Quantitative analysis of (c) Chiu score (P= 0.1583), (d) intestinal wall thickness (P= 0.0409), (e) villus height (P= 0.1154), (f) crypt depth (P= 0.0863), and (g) number of goblet cells per villus (P= 0.0750) (n=3 per group; two-tailed unpaired t-test) are shown. Data are presented as mean ± SD. MCD maternal control diet MHFD maternal high-fat diet \\u003csup\\u003e*\\u003c/sup\\u003eP\\u0026lt;0.05 \\u003csup\\u003e**\\u003c/sup\\u003eP\\u0026lt;0.01 \\u003csup\\u003e***\\u003c/sup\\u003eP\\u0026lt;0.001 \\u003csup\\u003e****\\u003c/sup\\u003eP\\u0026lt;0.0001\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Picture3.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8162313/v1/d5d78345b2deb109af23c4fa.jpg\"},{\"id\":108545351,\"identity\":\"5a041ede-aea6-4d4a-9721-c35fe36538af\",\"added_by\":\"auto\",\"created_at\":\"2026-05-05 20:19:27\",\"extension\":\"jpg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":257805,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eEarly-life administration of\\u0026nbsp;B. coagulans\\u0026nbsp;restores the gut microbiota composition altered by a MHFD.\\u003c/strong\\u003e\\u0026nbsp;Bacterial abundance in cecal feces was assessed by qRT-PCR (n=3 per group). Relative levels of\\u0026nbsp;(a)\\u0026nbsp;Bacillus coagulans \\u0026nbsp;\\u0026nbsp;(MCD vs. MHFD P= 0.0191; MCD vs. MHFD+B.co P= 0.4221; MHFD vs. MHFD+B.co P= 0.0976),\\u0026nbsp;(b)\\u003cstrong\\u003e \\u003c/strong\\u003eLactobacillus \\u003cstrong\\u003e(\\u003c/strong\\u003eMCD vs. MHFD P= 0.0077; MCD vs. MHFD+B.co P= 0.0816; MHFD vs. MHFD+B.co P= 0.1799),\\u0026nbsp;(c)\\u0026nbsp;Bacteroides\\u003cstrong\\u003e \\u003c/strong\\u003e(MCD vs. MHFD P= 0.0045; MCD vs. MHFD+B.co P= 0.0384; MHFD vs. MHFD+B.co P= 0.1953),\\u0026nbsp;(d)\\u0026nbsp;Firmicutes (MCD vs. MHFD P= 0.0170; MCD vs. MHFD+B.co P= 0.4366; MHFD vs. MHFD+B.co P= 0.0827), and\\u0026nbsp;(e)\\u0026nbsp;Bifidobacterium (MCD vs. MHFD P= 0.0120; MCD vs. MHFD+B.co P= 0.0460; MHFD vs. MHFD+B.co P= 0.5127)\\u0026nbsp;are shown for the MCD MHFD and MHFD+B.co groups (n=3 per group). Statistical analyses were performed using one-way ANOVA with Tukey's post-hoc test. Data are presented as mean ± SD. MCD maternal control diet MHFD maternal high-fat diet MHFD+B.co maternal high-fat diet plus\\u0026nbsp;B. coagulans\\u0026nbsp;administration \\u003csup\\u003e*\\u003c/sup\\u003eP\\u0026lt;0.05 \\u003csup\\u003e**\\u003c/sup\\u003eP\\u0026lt;0.01 \\u003csup\\u003e***\\u003c/sup\\u003eP\\u0026lt;0.001 \\u003csup\\u003e****\\u003c/sup\\u003eP\\u0026lt;0.0001\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Picture4.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8162313/v1/993d49d1e9e01fc5ae4fa782.jpg\"},{\"id\":108804338,\"identity\":\"eba6ce23-1b66-4499-bce9-11a9e62dc049\",\"added_by\":\"auto\",\"created_at\":\"2026-05-08 15:19:26\",\"extension\":\"jpg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":255895,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMHFD compromises colonic gut integrity which is restored by\\u0026nbsp;B. coagulans\\u0026nbsp;supplementation.\\u003c/strong\\u003e\\u0026nbsp;(a)\\u0026nbsp;Representative Western blot of tight junction proteins and proliferation marker from one of three independent biological replicates (n=3 per group). Uncropped blots are available in Supplementary Fig. S1 online. The blot was probed for Ki-67 (~358 kDa), ZO-1 (~140 kDa), Muc-2 (isoforms ~130/110 kDa), Claudin-5 (~23 kDa), and β-actin (42 kDa loading control) Molecular weights are estimates based on migration relative to protein standards and predicted sizes. The Ki-67 band migrated above the 250 kDa marker consistent with its predicted molecular weight of ~358 kDa. Densitometric analysis of\\u0026nbsp;(b)\\u0026nbsp;MUC-2 (MCD vs. MHFD P= 0.0044; MCD vs. MHFD+B.co P= 0.0626; MHFD vs. MHFD+B.co P= 0.1122),\\u0026nbsp;(c)\\u0026nbsp;ZO-1 (MCD vs. MHFD P= 0.0002; MCD vs. MHFD+B.co P= 0.0089; MHFD vs. MHFD+B.co P= 0.0050),\\u0026nbsp;(d)\\u0026nbsp;Claudin-5 (MCD vs. MHFD P= 0.0006; MCD vs. MHFD+B.co P= 0.0156; MHFD vs. MHFD+B.co P= 0.0230), and\\u0026nbsp;(e)\\u0026nbsp;Ki-67 protein (MCD vs. MHFD P= 0.0076; MCD vs. MHFD+B.co P= 0.2480; MHFD vs. MHFD+B.co P= 0.0584) levels. Statistical analyses were performed using one-way ANOVA with Tukey's post-hoc test. Data are presented as mean ± SD. MCD maternal control diet MHFD maternal high-fat diet MHFD+B.co\\u0026nbsp;maternal high-fat diet plus\\u0026nbsp;B. coagulans\\u0026nbsp;administration\\u003csup\\u003e *\\u003c/sup\\u003eP\\u0026lt;0.05 \\u003csup\\u003e**\\u003c/sup\\u003eP\\u0026lt;0.01 \\u003csup\\u003e***\\u003c/sup\\u003eP\\u0026lt;0.001 \\u003csup\\u003e****\\u003c/sup\\u003eP\\u0026lt;0.0001\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Picture5.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8162313/v1/3dcc5facc6cb458eeaf1ec04.jpg\"},{\"id\":108545353,\"identity\":\"d3ccc622-68f3-44b4-bb77-89dcda1bd99b\",\"added_by\":\"auto\",\"created_at\":\"2026-05-05 20:19:27\",\"extension\":\"jpg\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":584547,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eB.coagulans\\u0026nbsp;protects against DSS-induced ulcerative colitis in offspring exposed to a MHFD.\\u003c/strong\\u003e\\u0026nbsp;Mice from the MHFD MHFD+B.co\\u0026nbsp;and MCD groups were administered DSS to compare colitis severity. Representative H\\u0026amp;E-stained colon sections (×40 magnification scale bar = 200 µm) from\\u0026nbsp;(a)\\u0026nbsp;MCD\\u0026nbsp;(b)\\u0026nbsp;MCD+DSS\\u0026nbsp;(c)\\u0026nbsp;MHFD+DSS and\\u0026nbsp;(d)\\u0026nbsp;MHFD+B.co +DSS\\u0026nbsp;groups Quantitative analysis of\\u0026nbsp;(e)\\u0026nbsp;Chiu score (MCD vs. MCD+DSS P= 0.0186; MCD vs. MHFD+DSS P= 0.1442; MCD vs. MHFD+B.co+DSS P\\u0026gt;0.9999; MCD+DSS vs. MHFD+DSS P= 0.4958; MCD+DSS vs. MHFD+B.co+DSS P= 0.0186;\\u0026nbsp; MHFD+DSS vs. MHFD+B.co+DSS P= 0.1442), (f)\\u0026nbsp;number of goblet cells per villus (MCD vs. MCD+DSS P\\u0026lt;0.0001; MCD vs. MHFD+DSS P= 0.2970; MCD vs. MHFD+B.co+DSS P= 0.0002; MCD+DSS vs. MHFD+DSS P= 0.0002; MCD+DSS vs. MHFD+B.co+DSS P= 0.1730;\\u0026nbsp; MHFD+DSS vs. MHFD+B.co+DSS P= 0.0015), (g)\\u0026nbsp;villus height (MCD vs. MCD+DSS P= 0.0011; MCD vs. MHFD+DSS P= 0.0223; MCD vs. MHFD+B.co+DSS P= 0.9381; MCD+DSS vs. MHFD+DSS P= 0.1444; MCD+DSS vs. MHFD+B.co+DSS P= 0.0006;\\u0026nbsp; MHFD+DSS vs. MHFD+B.co+DSS P= 0.0104), (h)\\u0026nbsp;crypt depth (MCD vs. MCD+DSS P= 0.0002; MCD vs. MHFD+DSS P= 0.0020; MCD vs. MHFD+B.co+DSS P= 0.9681; MCD+DSS vs. MHFD+DSS P= 0.1469; MCD+DSS vs. MHFD+B.co+DSS P= 0.0001;\\u0026nbsp; MHFD+DSS vs. MHFD+B.co+DSS P= 0.0012), and\\u0026nbsp;(i)\\u0026nbsp;intestinal wall thickness (MCD vs. MCD+DSS P= 0.0052; MCD vs. MHFD+DSS P\\u0026lt;0.0001; MCD vs. MHFD+B.co+DSS P= 0.0328; MCD+DSS vs. MHFD+DSS P= 0.0003; MCD+DSS vs. MHFD+B.co+DSS P= 0.0001;\\u0026nbsp; MHFD+DSS vs. MHFD+B.co+DSS P\\u0026lt;0.0001) (n=3 per group). Statistical analyses were performed using one-way ANOVA with Tukey's post-hoc test. Data are presented as mean ± SD. MCD maternal control diet MHFD maternal high-fat diet MHFD+B.co\\u0026nbsp;maternal high-fat diet plus\\u0026nbsp;B. coagulans\\u0026nbsp;administration DSS dextran sulfate sodium \\u003csup\\u003e*\\u003c/sup\\u003eP\\u0026lt;0.05 \\u003csup\\u003e**\\u003c/sup\\u003eP\\u0026lt;0.01 \\u003csup\\u003e***\\u003c/sup\\u003eP\\u0026lt;0.001 \\u003csup\\u003e****\\u003c/sup\\u003eP\\u0026lt;0.0001\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Picture6.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8162313/v1/884394095c8b450266326083.jpg\"},{\"id\":108804676,\"identity\":\"2bc531cd-a463-4215-89dc-7c305183fc07\",\"added_by\":\"auto\",\"created_at\":\"2026-05-08 15:22:43\",\"extension\":\"jpg\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":235600,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eB. coagulans\\u0026nbsp;ameliorates DSS-induced colonic inflammation\\u003c/strong\\u003e. Cytokine levels in colon tissue were measured by ELISA following DSS exposure\\u0026nbsp;(a)\\u0026nbsp;IL-1β (MCD vs. MCD+DSS P= 0.0010; MCD vs. MHFD+DSS P\\u0026lt;0.0001; MCD vs. MHFD+B.co+DSS P= 0.2124; MCD+DSS vs. MHFD+DSS P= 0.0002; MCD+DSS vs. MHFD+B.co+DSS P= 0.0135;\\u0026nbsp; MHFD+DSS vs. MHFD+B.co+DSS P \\u0026lt;0.0001)\\u0026nbsp;(b)\\u0026nbsp;IL-10 (MCD vs. MCD+DSS P= 0.0002; MCD vs. MHFD+DSS P\\u0026lt;0.0001; MCD vs. MHFD+B.co+DSS P= 0.0242; MCD+DSS vs. MHFD+DSS P= 0.2071; MCD+DSS vs. MHFD+B.co+DSS P= 0.0155;\\u0026nbsp; MHFD+DSS vs. MHFD+B.co+DSS P= 0.0011), and\\u0026nbsp;(c)\\u0026nbsp;TNF-α (MCD vs. MCD+DSS P\\u0026lt;0.0001; MCD vs. MHFD+DSS P\\u0026lt;0.0001; MCD vs. MHFD+B.co+DSS P=0.0007; MCD+DSS vs. MHFD+DSS P= 0.0002; MCD+DSS vs. MHFD+B.co+DSS P\\u0026lt;0.0001;\\u0026nbsp; MHFD+DSS vs. MHFD+B.co+DSS P\\u0026lt;0.0001) levels in the indicated groups (n=3 per group). Statistical analyses were performed using one-way ANOVA with Tukey's post-hoc test. Data are presented as mean ± SD. MCD maternal control diet MHFD maternal high-fat diet MHFD+B.co\\u0026nbsp;maternal high-fat diet plus\\u0026nbsp;B. coagulans\\u0026nbsp;administration DSS dextran sulfate sodium \\u003csup\\u003e*\\u003c/sup\\u003eP\\u0026lt;0.05 \\u003csup\\u003e**\\u003c/sup\\u003eP\\u0026lt;0.01 \\u003csup\\u003e***\\u003c/sup\\u003eP\\u0026lt;0.001 \\u003csup\\u003e****\\u003c/sup\\u003eP\\u0026lt;0.0001\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Picture7.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8162313/v1/ed816db4922e580469966249.jpg\"},{\"id\":109465414,\"identity\":\"8b2fe248-dea6-4066-bbf3-e08a573f3aa8\",\"added_by\":\"auto\",\"created_at\":\"2026-05-18 11:56:20\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2360584,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8162313/v1/6ad502dd-a0be-4e2b-9943-89b6d9aa83f2.pdf\"},{\"id\":108804325,\"identity\":\"da35c257-2309-4fc8-817a-4c60fb79ed77\",\"added_by\":\"auto\",\"created_at\":\"2026-05-08 15:19:20\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":936136,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"supplementaryinformation.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8162313/v1/abbf36247f5851a5abb4ee41.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Effect of Bacillus coagulans on DSS-Induced Ulcerative Colitis in NMRI Mice Offspring Exposed to a Maternal High-Fat Diet\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eInflammatory bowel disease (IBD) is a chronic immune-mediated disease that involves the gastrointestinal tract. It comprises two main subtypes: ulcerative colitis (UC) and Crohn\\u0026rsquo;s disease (CD) [1]. The prevalence of UC has significantly increased across the world in recent years [2]. There has been a 152% and 142% rise in the prevalence of UC among children aged 2\\u0026ndash;17 and adults aged 18 and older, respectively [3]. However, there are geographical variations in the incidence, prevalence, and epidemiological characteristics of the disease [2,4]. Currently, UC does not have a definitive cure, and numerous studies have focused on identifying the risk factors that impact the incidence and severity of the disease. Genetic composition, environmental risk factors, certain surgeries like appendectomy, use of some medications such as oral contraceptives, and gut microbiome imbalance, referred to as dysbiosis, can affect an individual\\u0026rsquo;s susceptibility and disease progression [5\\u0026ndash;9].\\u003c/p\\u003e \\u003cp\\u003eMaternal obesity both prior to and during gestation is associated with diverse health complications for the child, such as an elevated risk of hypertension and adverse effects on the offspring\\u0026rsquo;s lung and intestine development [10\\u0026ndash;12]. Previous studies showed a strong link suggesting that maternal consumption of a high-fat diet (HFD) during gestation and lactation increases the offspring\\u0026rsquo;s susceptibility to UC, both at an early age and later in life [13,14]. Previous results indicate that offspring\\u0026rsquo;s gut microbiome is impacted by maternal high-fat diet (MHFD) [13]. HFD changes the composition of the maternal gut microbiome, resulting in dysbiosis. The maternal gut microbiome transfers to the offspring during gestation and lactation and shapes the infant\\u0026rsquo;s gut microbiome composition in early life [15,16]. A growing body of literature has underscored the role of the gut microbiome in UC [9,17]. Dysbiosis leads to UC in several ways; for example, causing inflammation and affecting the intestinal mucosal structure and function [13,18].\\u003c/p\\u003e \\u003cp\\u003eProbiotics have gained significant attention in the past few years due to their ability to correct dysbiosis and regulate the immune system [18]. They produce bacteriocins and other metabolites, affect bile salt metabolism and intestinal intraluminal pH, which ultimately alters the composition of other bacteria and reduces pathogenic bacteria [19].\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eBacillus coagulans (B. coagulans)\\u003c/em\\u003e has been shown to be effective in enhancing gut barrier function. Researchers have also highlighted its ability to repair damaged intestinal mucosa and reduce intestinal inflammation [20,21]. This highlights the importance of more research focusing on its ability to alleviate immune-mediated intestinal disorders.\\u003c/p\\u003e \\u003cp\\u003eThe effect of MHFD on offspring susceptibility to UC has been studied by several researchers [13,14], but whether administering \\u003cem\\u003eB. coagulans\\u003c/em\\u003e to offspring born to mothers with HFD at an early age reverses some of the adverse effects that MHFD has exerted on the offspring\\u0026rsquo;s intestinal health and decreases their susceptibility to UC has not been studied yet.\\u003c/p\\u003e \\u003cp\\u003eAs no current studies have evaluated the effect of early \\u003cem\\u003eB. coagulans\\u003c/em\\u003e administration to offspring of mothers on a HFD, this study was designed to assess the effect of MHFD on UC susceptibility in NMRI mouse offspring. We also aimed to determine whether early-life \\u003cem\\u003eB. coagulans\\u003c/em\\u003e could mitigate MHFD-induced dysbiosis and protect against UC later in life.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eEffect of HFD on the maternal and offspring weight:\\u003c/h2\\u003e \\u003cp\\u003eMaternal weight in HFD and NCD groups was monitored weekly from the start of the dietary intervention. No significant difference in weight was observed between the groups at any time point (P\\u0026thinsp;\\u0026gt;\\u0026thinsp;0.05). Offspring from MHFD and maternal control diet (MCD) groups were weighed regularly. The analysis revealed that MHFD offspring had a significantly higher body weight compared to MCD offspring at 20 days of age (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eBlood biochemical analysis of lipid-related factors:\\u003c/h3\\u003e\\n\\u003cp\\u003eBlood samples from dams after lactation were analyzed to assess the metabolic impact of the diet. Compared to the NCD group, HFD mothers showed a significant decrease in triglycerides (TG) (P\\u0026thinsp;=\\u0026thinsp;0.0039), significant increase in both total cholesterol (P\\u0026thinsp;=\\u0026thinsp;0.0010) and HDL-cholesterol (HDL-C) (P\\u0026thinsp;=\\u0026thinsp;0.0001) levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e)..\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\\n\\u003ch3\\u003eEffects of MHFD on histologic appearance:\\u003c/h3\\u003e\\n\\u003cp\\u003eH\\u0026amp;E staining of offspring colon samples at 3 weeks of age was performed to evaluate the impact of MHFD on intestinal development. Compared to the MCD group, MHFD offspring displayed significantly reduced intestinal wall thickness (P\\u0026thinsp;=\\u0026thinsp;0.0409) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). These pathological findings indicate that MHFD impairs offspring intestinal development.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\\n\\u003ch3\\u003eEvaluation of bacterial composition of mice feces:\\u003c/h3\\u003e\\n\\u003cp\\u003eqRT-PCR analysis of fecal samples at 8 weeks of age revealed that MHFD drastically altered the offspring's gut microbiota. It significantly decreased the abundance of \\u003cem\\u003eB. coagulans\\u003c/em\\u003e (P\\u0026thinsp;=\\u0026thinsp;0.0191), \\u003cem\\u003eLactobacillus\\u003c/em\\u003e (P\\u0026thinsp;=\\u0026thinsp;0.0077), \\u003cem\\u003eBifidobacterium\\u003c/em\\u003e (P\\u0026thinsp;=\\u0026thinsp;0.0120), and \\u003cem\\u003eBacteroides\\u003c/em\\u003e (P\\u0026thinsp;=\\u0026thinsp;0.0045), while significantly increasing the abundance of Firmicutes (P\\u0026thinsp;=\\u0026thinsp;0.0170) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). Early-life administration of \\u003cem\\u003eB. coagulans\\u003c/em\\u003e partially restored the depleted bacterial populations and reversed some of the MHFD-induced changes. Notably, the levels of \\u003cem\\u003eB. coagulans\\u003c/em\\u003e (P\\u0026thinsp;=\\u0026thinsp;0.4221), \\u003cem\\u003eLactobacillus\\u003c/em\\u003e (P\\u0026thinsp;=\\u0026thinsp;0.0816), and Firmicutes (P\\u0026thinsp;=\\u0026thinsp;0.4366) in the MHFD\\u0026thinsp;+\\u0026thinsp;\\u003cem\\u003eB. coagulans\\u003c/em\\u003e group were not significantly different from those in the MCD group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\\n\\u003ch3\\u003eWestern blotting analysis:\\u003c/h3\\u003e\\n\\u003cdiv class=\\\"Heading\\\"\\u003eWestern blotting analysis:\\u003c/div\\u003e \\u003cp\\u003eWestern blot analysis of colon samples at 8 weeks showed that MHFD significantly decreased the levels of ZO-1 (P\\u0026thinsp;=\\u0026thinsp;0.0002) and Claudin-5 (P\\u0026thinsp;=\\u0026thinsp;0.0006). \\u003cem\\u003eB. coagulans\\u003c/em\\u003e administration significantly increased the expression of these tight junction proteins (ZO1 P\\u0026thinsp;=\\u0026thinsp;0.0050; Claudin5 P\\u0026thinsp;=\\u0026thinsp;0.0230), in the MHFD group restoring cellular adhesion. Additionally, protein analysis indicated that MHFD significantly increased Ki-67 (P\\u0026thinsp;=\\u0026thinsp;0.0076) levels while decreasing MUC-2 (P\\u0026thinsp;=\\u0026thinsp;0.0044) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e). However, no significant difference was found in Ki-67 (P\\u0026thinsp;=\\u0026thinsp;0.2480) or MUC-2 (P\\u0026thinsp;=\\u0026thinsp;0.0626) levels between the MCD and MHFD\\u0026thinsp;+\\u0026thinsp;\\u003cem\\u003eB. coagulans\\u003c/em\\u003e groups. These findings demonstrate that \\u003cem\\u003eB. coagulans\\u003c/em\\u003e improves gut integrity in offspring compromised by MHFD.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eHistological evaluation:\\u003c/h2\\u003e \\u003cp\\u003eTo evaluate mice\\u0026rsquo;s susceptibility to UC at 8 weeks, offspring from MHFD, MHFD\\u0026thinsp;+\\u0026thinsp;\\u003cem\\u003eB. coagulans\\u003c/em\\u003e, and MCD groups received DSS in their drinking water for 6 days. Their colon pathology was compared to that of age-matched MCD mice receiving tap water as control. Following DSS exposure, the MHFD group showed significantly (P\\u0026thinsp;=\\u0026thinsp;0.0003) reduced intestinal wall thickness compared to the DSS-treated MCD group. The MHFD\\u0026thinsp;+\\u0026thinsp;\\u003cem\\u003eB. coagulans\\u003c/em\\u003e\\u0026thinsp;+\\u0026thinsp;DSS group exhibited a significantly thicker intestinal wall (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001), greater crypt depth (P\\u0026thinsp;=\\u0026thinsp;0.0012), increased villus height (P\\u0026thinsp;=\\u0026thinsp;0.0104), and a higher number of goblet cells per villus (P\\u0026thinsp;=\\u0026thinsp;0.0015) compared to the MHFD\\u0026thinsp;+\\u0026thinsp;DSS group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). These results indicate that early-life \\u003cem\\u003eB. coagulans\\u003c/em\\u003e administration alleviates MHFD-induced damage and reduces susceptibility to DSS-induced UC.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eEvaluation of inflammation parameters with ELISA:\\u003c/h3\\u003e\\n\\u003cp\\u003eELISA assessment of inflammatory markers in colon tissue after DSS treatment revealed that the MHFD\\u0026thinsp;+\\u0026thinsp;DSS group had significantly higher levels of IL-1β (P\\u0026thinsp;=\\u0026thinsp;0.0002) and TNF-α (P\\u0026thinsp;=\\u0026thinsp;0.0002) compared to the MCD\\u0026thinsp;+\\u0026thinsp;DSS group. \\u003cem\\u003eB. coagulans\\u003c/em\\u003e supplementation significantly reduced these pro-inflammatory cytokines (IL-1β P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001; TNF-α P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) in MHFD offspring. Furthermore, IL-10 levels were significantly (P\\u0026thinsp;=\\u0026thinsp;0.0011) increased in the MHFD\\u0026thinsp;+\\u0026thinsp;\\u003cem\\u003eB. coagulans\\u003c/em\\u003e\\u0026thinsp;+\\u0026thinsp;DSS group compared to the MHFD\\u0026thinsp;+\\u0026thinsp;DSS group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e). These results demonstrate the anti-inflammatory efficacy of \\u003cem\\u003eB. coagulans\\u003c/em\\u003e in the colon of MHFD offspring after DSS challenge.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eMaternal diet during gestation and lactation significantly impacts the intestinal development of offspring [13]. Given the widespread consumption of a Western-style HFD among adults, it is crucial to investigate its effects on offspring intestinal development and susceptibility to IBD. Furthermore, studies have explored interventional strategies, including probiotic supplementation, to mitigate these effects and confer protection against subsequent intestinal inflammation. Previous research has shown that an HFD during gestation and lactation alters offspring's intestinal development [13,22]. Our study confirmed that a MHFD during gestation and lactation impairs the intestinal development in offspring.\\u003c/p\\u003e \\u003cp\\u003eThe maternal diet during gestation influences their gut microbiome composition, which is transferred to the offspring early in life. This transfer affects the offspring's intestinal mucosal integrity, development, mucosal immune system, and their predisposition to IBD such as UC [23,24]. Studies have shown that the gut microbiome of offspring from the MHFD group is most significantly different from that of the MCD group shortly after the lactation period, and this difference persists even after the offspring switch to a normal chow diet [13,15]. Our study demonstrated that the gut microbiome of offspring from the MHFD group remained different from the MCD group at 8 weeks of age.\\u003c/p\\u003e \\u003cp\\u003eAn HFD alters the composition of gut microbiota; it typically increases the abundance of Firmicutes and decreases Bacteroidetes [25]. Gut bacteria ferment dietary carbohydrates to produce short-chain fatty acids (SCFAs), which serve as an energy source and perform many other functions. Firmicutes produce butyrate and are more effective at extracting energy from food compared to Bacteroidetes, which predominantly produce acetate and propionate. This shift facilitates maximum energy harvest from food and is commonly observed in HFD groups [25,26]. In our study, MHFD increased Firmicutes and decreased \\u003cem\\u003eBacteroides\\u003c/em\\u003e, aligning with the reported shift toward a higher Firmicutes/Bacteroidetes ratio. It should be noted that the analysis was specific to the \\u003cem\\u003eBacteroides\\u003c/em\\u003e genus and not the entire Bacteroidetes phylum. Our results also showed that MHFD decreases the abundance of \\u003cem\\u003eLactobacillus\\u003c/em\\u003e and \\u003cem\\u003eBifidobacterium\\u003c/em\\u003e in the offspring's gut. It is important to note that many strains of \\u003cem\\u003eLactobacilli\\u003c/em\\u003e can have opposing effects on gut inflammation [27]. Consumption of an HFD may be linked to a decrease in anti-inflammatory \\u003cem\\u003eLactobacilli\\u003c/em\\u003e strains [28].\\u003c/p\\u003e \\u003cp\\u003eDysbiosis impairs the gut barrier. It can facilitate bacterial invasion, leading to the activation of Toll-like receptors (TLRs). This activation triggers the secretion of inflammatory cytokines, intestinal inflammation, and the progression of UC [29].\\u003c/p\\u003e \\u003cp\\u003eIntestinal integrity is a key indicator of gut health and plays a critical role in the pathogenesis of UC [30]. MHFD has been shown to decrease tight junction (TJ) proteins in the colon of offspring mice at three weeks of age, indicating impaired gut integrity [13]. Our results revealed that the expression of TJ proteins like ZO-1 and Claudin-5 remains decreased in the colon of 8-week-old offspring from the MHFD group, suggesting this impairment lasts into adulthood. Probiotics are among the most effective dietary interventions for improving gut health. Some probiotics, such as \\u003cem\\u003eBifidobacterium\\u003c/em\\u003e, improve intestinal integrity and enhance the expression of TJ proteins [29]. In our study, the expression of ZO-1 and Claudin-5 proteins was elevated by the administration of \\u003cem\\u003eB. coagulans\\u003c/em\\u003e, thereby restoring the disrupted mucosal integrity caused by MHFD.\\u003c/p\\u003e \\u003cp\\u003eMUC-2, the primary mucin secreted by goblet cells, forms a protective layer over the intestinal epithelium, which limits contact between the epithelium and microbes. In UC, the number of goblet cells decreases, leading to diminished mucin (like MUC-2) production and a thinner protective layer. This results in increased contact between the gut microbiome and intestinal epithelial cells, which aggravates inflammation and worsens UC [31]. Our study showed that MUC-2 was decreased in the MHFD group, and \\u003cem\\u003eB. coagulans\\u003c/em\\u003e administration successfully restored its levels.\\u003c/p\\u003e \\u003cp\\u003eTo investigate offspring susceptibility to UC, 8-week-old mice were exposed to a 2.5% DSS solution for 6 days to induce the disease. The results demonstrated that MHFD exacerbates UC in offspring. This was evidenced by pathological changes, including decreased intestinal wall thickness and elevated levels of inflammatory cytokines such as TNF-α and IL-1β compared to the control group following DSS exposure. These findings are consistent with a previous study which reported that MHFD increases susceptibility to and worsens the course of UC in offspring [13].\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eB. coagulans\\u003c/em\\u003e is a probiotic that has been shown to be effective in relieving the severity of UC. One study demonstrated that administering \\u003cem\\u003eB. coagulans\\u003c/em\\u003e to mice after UC induction can restore the gut microbiota composition, improve intestinal integrity, and reduce gut inflammation [21]. To investigate whether \\u003cem\\u003eB. coagulans\\u003c/em\\u003e protects against UC and reverses the effects of MHFD when administered prior to UC induction, a daily dose of 6\\u0026times;10\\u003csup\\u003e8\\u003c/sup\\u003e CFU was administered to MHFD group offspring for four weeks before UC was induced. The results showed that \\u003cem\\u003eB. coagulans\\u003c/em\\u003e protects against UC in this model.\\u003c/p\\u003e \\u003cp\\u003eIn UC, there is overexpression of pro-inflammatory cytokines and an underexpression of anti-inflammatory cytokines. UC promotes prolonged neutrophil survival and secretion of inflammatory cytokines, particularly TNF-α, which can damage intestinal integrity and exacerbate the progression of UC [30]. In UC, mucosal macrophages produce a variety of cytokines, especially from the IL-1 family [30]. One study revealed that IL-1β amplifies intestinal permeability and disrupts epithelial barrier integrity [32]. On the other hand, IL-10 is a crucial anti-inflammatory cytokine that plays an important role in suppressing the secretion of inflammatory cytokines. IL-10 deficiency contributes to heightened secretion of pro-inflammatory cytokines and worsens UC progression [33].\\u003c/p\\u003e \\u003cp\\u003eIn our study, the inflammatory state of the mouse colon was investigated after UC induction. Analysis showed that MHFD resulted in aggravated inflammation in the offspring's colon compared to the MCD group, which is consistent with previous findings [13]. Furthermore, \\u003cem\\u003eB. coagulans\\u003c/em\\u003e administration was shown to significantly decrease the levels of TNF-α and IL-1β. As a result, it ameliorated the severity of inflammation and improving the disease course in MHFD offspring.\\u003c/p\\u003e \\u003cp\\u003eIn summary, these results demonstrate that a MHFD alters the offspring's gut microbial composition and increases susceptibility to DSS-induced UC. Moreover, the \\u003cem\\u003eB. coagulans\\u003c/em\\u003e supplementation was shown to restore gut microbiome and reduce both susceptibility to and severity of UC in MHFD offspring.\\u003c/p\\u003e \"},{\"header\":\"Methods\",\"content\":\"\\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003eChemicals and antibodies:\\u003c/h2\\u003e \\u003cp\\u003eThe probiotic was purchased from ParsiLact brand manufactured by Pardis Roshd Mehregan Co. (Shiraz Industrial Estate, Fars, Iran). Each sachet contained 6 \\u003cspan class=\\\"InlineEquation\\\"\\u003e\\u003cspan class=\\\"mathinline\\\"\\u003e\\\\(\\\\:\\\\times\\\\:\\\\)\\u003c/span\\u003e\\u003c/span\\u003e 10\\u003csup\\u003e9\\u003c/sup\\u003e \\u003cem\\u003eBacillus coagulans\\u003c/em\\u003e, 0.5 g dietary fibers (FOS), and 1.46 g Maltodextrin. Dextran sulfate sodium salt (DSS) was purchased from Sigma-Aldrich Co. (St. Louis, MO, USA).\\u003c/p\\u003e \\u003cp\\u003ePrimary antibodies used in the western blot test were as follows: rabbit anti-ZO-1 (Cat No ab314668, Abcam), anti-Claudin-5 (Cat No A95192, Antibodies), anti-Ki-67 (Cat No ab16667, Abcam), anti-MUC-2 (Cat No A91628, Antibodies). Anti-β-actin was used as a loading control antibody (Cat No ab8227, Abcam). A secondary goat anti-rabbit IgG H\\u0026amp;L (HRP) (Cat No ab6721, Abcam) was used for detection.\\u003c/p\\u003e \\u003cp\\u003eThe following ELISA kits were used for cytokine quantification according to the manufacturers' protocols: mouse TNF-α (Cat No MTA00B, R\\u0026amp;D, USA), IL-10 (Cat No M1000B, R\\u0026amp;D, USA), and IL1-β (Cat No MLB00C-1, R\\u0026amp;D, USA).\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eExperimental design for mothers:\\u003c/h2\\u003e \\u003cp\\u003eFemale NMRI mice weighing 20\\u0026ndash;25 g were purchased from the Animal Center of the Pharmacology Research Institute at Tehran University of Medical Sciences, Tehran, Iran, and were kept in a controlled environment (21\\u0026ndash;23\\u0026deg;C, 50\\u0026ndash;60% humidity) under a 12-hour light/dark cycle. Animals were housed four per cage with free access to food and water ad libitum. All procedures involving animals were performed according to the National Research Council's Guide for the Care and Use of Laboratory Animals (8th edition, 2011) and in compliance with the ARRIVE guidelines. This study was approved by the Ethics Committee of Tehran University of Medical Sciences (IR.TUMS.MEDICINE.REC.1402.146). All efforts were made to minimize the number of animals used and their suffering.\\u003c/p\\u003e \\u003cp\\u003eFemale mice were randomly assigned to either an HFD or normal chow diet (NCD) group. The HFD was prepared according to Banakar et al. [34]. A mixture of 15 g of standard laboratory normal chow diet, 10 g of roasted peanuts, 10 g of white chocolate, and 5 g of biscuits with 22% fat was prepared. The quantities of all ingredients were multiplied by ten to prepare a batter, then 20 g of sesame seeds were added to it. The batter was cut into the same shape as the standard chow diet and dried at room temperature. The nutritional composition of the standard chow diet is presented in Supplementary Table \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e online.\\u003c/p\\u003e \\u003cp\\u003eMice in the HFD group received the HFD for two weeks prior to gestation. While, mice in the control group were fed a standard chow diet. After two weeks, one male NMRI mouse was introduced to each cage of four female mice. Male mice were fed an NCD before being introduced for mating. Mating was confirmed by checking for a vaginal plug, and upon confirmation of gestation, the male mice were removed from each cage. Each female mouse was then housed individually and weighed on a weekly basis until parturition.\\u003c/p\\u003e \\u003cp\\u003eHFD-fed mice continued their diet during mating, gestation, and lactation. Subsequently, dams were anesthetized and blood was collected to measure levels of total cholesterol, HDL-cholesterol, LDL-cholesterol, and triglycerides.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eExperimental design for offspring:\\u003c/h2\\u003e \\u003cp\\u003eAfter parturition, the offspring were weighed every week, breastfed, and kept with the dam until 21 days of age. At this age (weaning), female offspring were excluded from the experiment, and male offspring from both MHFD and maternal control diet (MCD) groups were separated from the dams. The histological appearance of the colon was compared between these two groups at this time.\\u003c/p\\u003e \\u003cp\\u003eMale offspring from the MHFD group were randomly allocated into two groups. They received either 0.1 mL of probiotic preparation (\\u003cem\\u003eB. coagulans\\u003c/em\\u003e) (6 \\u0026times; 10\\u003csup\\u003e8\\u003c/sup\\u003e CFU) or the same amount of PBS via daily oral gavage. Male offspring from the MCD group as control, received the same amount of PBS. This intervention was continued from postnatal day 21 until 8 weeks of age.\\u003c/p\\u003e \\u003cp\\u003eAll male offspring received an NCD from weaning until the week 8. Mice were weighed on a weekly basis during the daily gavage period. At the beginning of the week 8, the gavage was discontinued. Fecal samples were collected from the MHFD, MHFD\\u0026thinsp;+\\u0026thinsp;\\u003cem\\u003eB. coagulans\\u003c/em\\u003e, and MCD groups for qRT-PCR analysis of gut bacteria. Colon tissue samples were also collected from these three groups for Western blot analysis of Claudin-5, ZO-1, MUC-2, and Ki-67 expression.\\u003c/p\\u003e \\u003cp\\u003eSubsequently, the offspring\\u0026rsquo;s susceptibility to DSS-induced UC was tested. Colitis was induced by drinking a 2.5% (w/v) DSS solution in tap water for 6 days [35]. Control animals received plain tap water. On day 7, mice were anesthetized, and colon samples were collected for histological evaluation and ELISA analysis of IL-1β, IL-10, and TNF-α levels.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eExperimental groups:\\u003c/h2\\u003e \\u003cp\\u003e \\u003cb\\u003eMaternal groups\\u003c/b\\u003e:\\u003c/p\\u003e \\u003cp\\u003e \\u003col\\u003e \\u003cspan\\u003e \\u003cli\\u003e \\u003cp\\u003e1. High-fat diet group (HFD)\\u003c/p\\u003e \\u003c/li\\u003e \\u003c/span\\u003e \\u003cspan\\u003e \\u003cli\\u003e \\u003cp\\u003e2. Normal chow diet (NCD)\\u003c/p\\u003e \\u003c/li\\u003e \\u003c/span\\u003e \\u003c/ol\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eOffspring groups from 21 days to the beginning of the week 8\\u003c/b\\u003e:\\u003c/p\\u003e \\u003cp\\u003e \\u003col\\u003e \\u003cspan\\u003e \\u003cli\\u003e \\u003cp\\u003e1. MHFD offspring\\u0026thinsp;+\\u0026thinsp;\\u003cem\\u003eB. coagulans\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/li\\u003e \\u003c/span\\u003e \\u003cspan\\u003e \\u003cli\\u003e \\u003cp\\u003e2. MHFD offspring\\u0026thinsp;+\\u0026thinsp;PBS\\u003c/p\\u003e \\u003c/li\\u003e \\u003c/span\\u003e \\u003cspan\\u003e \\u003cli\\u003e \\u003cp\\u003e3. MCD offspring\\u0026thinsp;+\\u0026thinsp;PBS\\u003c/p\\u003e \\u003c/li\\u003e \\u003c/span\\u003e \\u003c/ol\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eGroups for colitis induction test at the beginning of the week 8\\u003c/b\\u003e:\\u003c/p\\u003e \\u003cp\\u003e \\u003col\\u003e \\u003cspan\\u003e \\u003cli\\u003e \\u003cp\\u003e1. MHFD offspring\\u0026thinsp;+\\u0026thinsp;\\u003cem\\u003eB. coagulans\\u003c/em\\u003e (pre-treated)\\u0026thinsp;+\\u0026thinsp;DSS\\u003c/p\\u003e \\u003c/li\\u003e \\u003c/span\\u003e \\u003cspan\\u003e \\u003cli\\u003e \\u003cp\\u003e2. MHFD offspring\\u0026thinsp;+\\u0026thinsp;PBS (pre-treated)\\u0026thinsp;+\\u0026thinsp;DSS\\u003c/p\\u003e \\u003c/li\\u003e \\u003c/span\\u003e \\u003cspan\\u003e \\u003cli\\u003e \\u003cp\\u003e3. MCD offspring\\u0026thinsp;+\\u0026thinsp;PBS (pre-treated)\\u0026thinsp;+\\u0026thinsp;DSS\\u003c/p\\u003e \\u003c/li\\u003e \\u003c/span\\u003e \\u003cspan\\u003e \\u003cli\\u003e \\u003cp\\u003e4. MCD offspring\\u0026thinsp;+\\u0026thinsp;PBS (pre-treated)\\u0026thinsp;+\\u0026thinsp;plain tap water\\u003c/p\\u003e \\u003c/li\\u003e \\u003c/span\\u003e \\u003c/ol\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eBlood analysis:\\u003c/h2\\u003e \\u003cp\\u003eAt the end of the lactation period, dams from the HFD and NCD groups were anesthetized (80 mg/kg of Ketamine and 10 mg/kg of Xylazine). Blood was collected via cardiac puncture and serum levels of total cholesterol, triglycerides (TG), HDL-cholesterol (HDL-C) and, LDL-cholesterol (LDL-C) were measured.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eFecal DNA extraction and qRT-PCR:\\u003c/h2\\u003e \\u003cp\\u003eFecal DNA was extracted using Qiazol (Kiazist, Iran) and chloroform (Dr. Mojallali Industrial Chemical Complex Co., Iran). After purification and washing, the DNA pellet was air-dried and DNA was resuspended in RNase-free water (Thermo, USA) or NaOH and stored at -20\\u0026deg;C.\\u003c/p\\u003e \\u003cp\\u003eFor qRT-PCR, reactions contained SYBR Green Master Mix (Addbio, Korea), forward and reverse primers (SinaClon, Iran), nuclease-free water, and cDNA template. All primers were designed using Gene Runner (6.5.52). Reactions were run on a Real-Time PCR system (ABI StepOne, USA). Primer sequences are listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimers used in qRT-PCR\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimers\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eSequence\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eBacillus coagulans\\u003c/em\\u003e-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAGAGTTTGATCCTGGCTCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eBacillus coagulans\\u003c/em\\u003e-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGTTACCTTGTTACGACTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eLactobacillus\\u003c/em\\u003e -F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTGGAAACAGTTGCTAATACCG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eLactobacillus\\u003c/em\\u003e -R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGTCCATTGTGGAAGATTCCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eBacteroides\\u003c/em\\u003e-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATAGCCTTTCGAAAGRAAGAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eBacteroides\\u003c/em\\u003e-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCAGTATCAACTGCAATTTTA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eFirmicutes-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGAGYATGTGGTTTAATTCGAAGCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eFirmicutes-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAGCTGACGACAACCATGCAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eBifidobacterium\\u003c/em\\u003e-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCTCCTGGAAACGGGTGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eBifidobacterium\\u003c/em\\u003e-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGTGTTCTTCCCGATATCTACA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e16S-F\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eCCTACGGGNGGCWGCAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e16S-R\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATTACCGCGGCTGCTGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eELISA:\\u003c/h2\\u003e \\u003cp\\u003eELISA was performed as previously described [36]. Briefly, the assay diluent was added to the wells, then standards, samples, and controls were added. After incubation and washing, the appropriate conjugate was added. Then, the incubation and washing cycle were repeated. Following the addition of substrate and stop solution, the optical density at 450 nm was determined. Cytokine levels are reported as picograms per milliliter.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eTissue and fecal collection:\\u003c/h2\\u003e \\u003cp\\u003eTo evaluate histological changes and perform molecular analysis, mice were sacrificed at the end of week 3, the beginning of week 8, and after DSS treatment. Mice were anesthetized with ketamine (80 mg/kg) and xylazine (10 mg/kg, i.p.). For histology, colons were fixed in 4% formalin. Fecal samples collected at week 8 were flash-frozen in liquid nitrogen and stored at -80\\u0026deg;C for PCR. Colon samples from week 8 were divided: one half was fixed in formalin for histology, and the other half was frozen for Western blot. Following DSS treatment, colon samples were also divided: one half was fixed for histology and the other half was frozen for ELISA analysis. All procedures involving 4% formalin were performed with appropriate personal protection and ventilation due to its hazardous nature.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMicroscopic histological analysis:\\u003c/h2\\u003e \\u003cp\\u003eColon tissue samples were fixed in 4% formalin; then, they were embedded in paraffin and sectioned into 4\\u0026micro;m slices. A pathologist blinded to the type of the treatment evaluated these samples for parameters such as Chiu score, villus height, and crypt depth.\\u003c/p\\u003e \\u003cp\\u003eChiu scoring was done according to the grading system briefly discussed here: 0 is normal mucosal villi; 1 is development of subepithelial space; 2 is further extension of subepithelial space and moderate epithelial layer lifting; 3 is massive epithelial lifting; 4 is severely damaged villi with dilated capillaries; and 5 is disintegration of lamina propria and ulceration [37].\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eWestern blot:\\u003c/h2\\u003e \\u003cp\\u003eProteins were extracted from tissues using Pro-PRE\\u0026trade; lysis buffer (iNtRON Biotechnology, Korea). After determining the protein concentration by BCA assay (iNtRON Biotechnology, Korea) and spectrophotometry (Smartspec Plus spectrophotometer, Bio-Rad), lysates were separated by SDS-PAGE. Afterwards, they were transferred to PVDF membranes (Bio-Rad Laboratories, CA, USA). Membranes were then blocked with 5% BSA (Sigma-Aldrich, MO, USA), they were then probed with primary and secondary antibodies. Densitometric analysis was performed using Gel Analyzer version 2010 software (NIH, USA).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec22\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eData analysis:\\u003c/h2\\u003e \\u003cp\\u003eData were analyzed using GraphPad Prism (version 8.0.2). All data are presented as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation (SD) from three independent biological replicates (n\\u0026thinsp;=\\u0026thinsp;3 animals per group). For comparisons between two groups (e.g., maternal lipid profiles, offspring intestinal development at week 3), an unpaired, two-tailed t-test was used alongside an F-test to compare variances. For comparisons among three or more groups (e.g., cytokine levels, protein expression), an ordinary one-way ANOVA was used, followed by Tukey's post-hoc test for multiple comparisons. The use of ANOVA with Tukey's test controls the Type I error rate for multiple comparisons. For data with two independent variables (e.g., body weight over time), a two-way ANOVA was used, followed by Sidak's multiple comparisons test. A p-value of less than 0.05 (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) was considered statistically significant. The actual P value for each comparison is reported in the Results section and the figure legends.\\u003c/p\\u003e\\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\" \\u003cp\\u003e \\u003cb\\u003eFunding declaration\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eThis study was funded by the Experimental Medicine Research Center, Tehran University of Medical Sciences (Grant number 1402-1-209-66272).\\u003c/p\\u003e \\u003cp\\u003e \\u003ch2\\u003eAdditional information:\\u003c/h2\\u003e \\u003cp\\u003eThe authors declare that they have no conflict of interest.\\u003c/p\\u003e \\u003c/p\\u003e\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eA.J.:\\u0026nbsp;Conceptualization, Methodology, Investigation, Formal analysis, Writing \\u0026ndash; Original Draft, Visualization.R.M.J.:\\u0026nbsp;Methodology, Validation, Writing \\u0026ndash; Review \\u0026amp;amp; Editing.H.N.:\\u0026nbsp;Writing \\u0026ndash; Review \\u0026amp;amp; Editing.N.R.:\\u0026nbsp;Writing \\u0026ndash; Review \\u0026amp;amp; Editing, Supervision.A.R.D.:\\u0026nbsp;Supervision, Project administration, Funding acquisition.\\u003c/p\\u003e\\u003ch2\\u003eAcknowledgement\\u003c/h2\\u003e\\u003cp\\u003eThis study was supported by the Experimental Medicine Research Center, Tehran University of Medical Sciences (Grant number 1402-1-209-66272).\\u003c/p\\u003e\\u003ch2\\u003eData Availability\\u003c/h2\\u003e\\u003cp\\u003eThe datasets of the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eUngaro, R., Mehandru, S., Allen, P. B., Peyrin-Biroulet, L. \\u0026amp; Colombel, J. F. Ulcerative colitis. \\u003cem\\u003eLancet\\u003c/em\\u003e \\u003cb\\u003e389\\u003c/b\\u003e, 1756–1770 (2017).\\u003c/li\\u003e\\n\\u003cli\\u003eYamazaki, M., Chung, H., Xu, Y. \\u0026amp; Qiu, H. Trends in the prevalence and incidence of ulcerative colitis in Japan and the US. \\u003cem\\u003eInt. J. Colorectal Dis.\\u003c/em\\u003e \\u003cb\\u003e38\\u003c/b\\u003e, 135 (2023).\\u003c/li\\u003e\\n\\u003cli\\u003eYe, Y., Manne, S., Treem, W. R. \\u0026amp; Bennett, D. Prevalence of inflammatory bowel disease in pediatric and adult populations: recent estimates from large national databases in the United States, 2007–2016. \\u003cem\\u003eInflammatory Bowel Diseases\\u003c/em\\u003e \\u003cb\\u003e26\\u003c/b\\u003e, 619–625 (2019).\\u003c/li\\u003e\\n\\u003cli\\u003ePark, J. \\u0026amp; Cheon, J. H. Incidence and prevalence of inflammatory bowel disease across Asia. \\u003cem\\u003eYonsei Med. J.\\u003c/em\\u003e \\u003cb\\u003e62\\u003c/b\\u003e, 99–108 (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eSun, Y. \\u003cem\\u003eet al.\\u003c/em\\u003e The contribution of genetic risk and lifestyle factors in the development of adult-onset inflammatory bowel disease: a prospective cohort study. \\u003cem\\u003eAm. J. Gastroenterol.\\u003c/em\\u003e \\u003cb\\u003e118\\u003c/b\\u003e, 511–522 (2023).\\u003c/li\\u003e\\n\\u003cli\\u003eSingh, N. \\u0026amp; Bernstein, C. N. Environmental risk factors for inflammatory bowel disease. \\u003cem\\u003eUnited European Gastroenterol. J.\\u003c/em\\u003e \\u003cb\\u003e10\\u003c/b\\u003e, 1047–1053 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eDu, L. \\u0026amp; Ha, C. Epidemiology and pathogenesis of ulcerative colitis. \\u003cem\\u003eGastroenterology Clinics of North America\\u003c/em\\u003e \\u003cb\\u003e49\\u003c/b\\u003e, 643–654 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003ePasvol, T. J., Bloom, S., Segal, A. W., Rait, G. \\u0026amp; Horsfall, L. Use of contraceptives and risk of inflammatory bowel disease: a nested case-control study. \\u003cem\\u003eAliment. Pharmacol. Ther.\\u003c/em\\u003e \\u003cb\\u003e55\\u003c/b\\u003e, 318–326 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eGuo, X. Y., Liu, X. J. \\u0026amp; Hao, J. Y. Gut microbiota in ulcerative colitis: insights on pathogenesis and treatment. \\u003cem\\u003eJ. Dig. Dis.\\u003c/em\\u003e \\u003cb\\u003e21\\u003c/b\\u003e, 147–159 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eTain, Y. L. \\u0026amp; Hsu, C. N. Maternal high-fat diet and offspring hypertension. \\u003cem\\u003eInt. J. Mol. Sci.\\u003c/em\\u003e \\u003cb\\u003e23\\u003c/b\\u003e, 8179 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eHeyob, K. M. \\u003cem\\u003eet al.\\u003c/em\\u003e Maternal high-fat diet alters lung development and function in the offspring. \\u003cem\\u003eAm. J. Physiol. Lung Cell Mol. Physiol.\\u003c/em\\u003e \\u003cb\\u003e317\\u003c/b\\u003e, L167-l174 (2019).\\u003c/li\\u003e\\n\\u003cli\\u003eSłupecka-Ziemilska, M., Grzesiak, P., Kowalczyk, P., Wychowański, P. \\u0026amp; Woliński, J. Maternal high-fat diet exposure during gestation and lactation affects intestinal development in suckling rats. \\u003cem\\u003eFront. Physiol.\\u003c/em\\u003e \\u003cb\\u003e12\\u003c/b\\u003e, 693150 (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eXie, R. \\u003cem\\u003eet al.\\u003c/em\\u003e Maternal high fat diet alters gut microbiota of offspring and exacerbates DSS-induced colitis in adulthood. \\u003cem\\u003eFront. Immunol.\\u003c/em\\u003e \\u003cb\\u003e9\\u003c/b\\u003e, 2608 (2018).\\u003c/li\\u003e\\n\\u003cli\\u003eBibi, S., Kang, Y., Du, M. \\u0026amp; Zhu, M. J. Maternal high-fat diet consumption enhances offspring susceptibility to DSS-induced colitis in mice. \\u003cem\\u003eObesity\\u003c/em\\u003e \\u003cb\\u003e25\\u003c/b\\u003e, 901–908 (2017).\\u003c/li\\u003e\\n\\u003cli\\u003eChu, D. M., Meyer, K. M., Prince, A. L. \\u0026amp; Aagaard, K. M. Impact of maternal nutrition in pregnancy and lactation on offspring gut microbial composition and function. \\u003cem\\u003eGut Microbes\\u003c/em\\u003e \\u003cb\\u003e7\\u003c/b\\u003e, 459–470 (2016).\\u003c/li\\u003e\\n\\u003cli\\u003eMeng, L. \\u003cem\\u003eet al.\\u003c/em\\u003e Gut-mammary pathway: breast milk microbiota as a mediator of maternal gut microbiota transfer to the infant gut. \\u003cem\\u003eJournal of Functional Foods\\u003c/em\\u003e \\u003cb\\u003e124\\u003c/b\\u003e, 106620 (2025).\\u003c/li\\u003e\\n\\u003cli\\u003eFranzosa, E. A. \\u003cem\\u003eet al.\\u003c/em\\u003e Gut microbiome structure and metabolic activity in inflammatory bowel disease. \\u003cem\\u003eNat. Microbiol.\\u003c/em\\u003e \\u003cb\\u003e4\\u003c/b\\u003e, 293–305 (2019).\\u003c/li\\u003e\\n\\u003cli\\u003eRoy, S. \\u0026amp; Dhaneshwar, S. Role of prebiotics, probiotics, and synbiotics in management of inflammatory bowel disease: current perspectives. \\u003cem\\u003eWorld J. Gastroenterol.\\u003c/em\\u003e \\u003cb\\u003e29\\u003c/b\\u003e, 2078–2100 (2023).\\u003c/li\\u003e\\n\\u003cli\\u003ePlaza-Diaz, J., Ruiz-Ojeda, F. J., Gil-Campos, M. \\u0026amp; Gil, A. Mechanisms of action of probiotics. \\u003cem\\u003eAdv. Nutr.\\u003c/em\\u003e \\u003cb\\u003e10\\u003c/b\\u003e, S49-s66 (2019).\\u003c/li\\u003e\\n\\u003cli\\u003eZhao, Z. \\u003cem\\u003eet al.\\u003c/em\\u003e Bacillus coagulans MZY531 alleviates intestinal mucosal injury in immunosuppressive mice via modulating intestinal barrier, inflammatory response, and gut microbiota. \\u003cem\\u003eSci. Rep.\\u003c/em\\u003e \\u003cb\\u003e13\\u003c/b\\u003e, 11181 (2023).\\u003c/li\\u003e\\n\\u003cli\\u003eLiu, Z. \\u003cem\\u003eet al.\\u003c/em\\u003e Bacillus coagulans in combination with chitooligosaccharides regulates gut microbiota and ameliorates the DSS-induced colitis in mice. \\u003cem\\u003eMicrobiol. Spectr.\\u003c/em\\u003e \\u003cb\\u003e10\\u003c/b\\u003e, e0064122 (2022).\\u003c/li\\u003e\\n\\u003cli\\u003eSun, Y. \\u003cem\\u003eet al.\\u003c/em\\u003e Maternal high-fat diet disrupts intestinal mucus barrier of offspring by regulating gut immune receptor LRRC19. \\u003cem\\u003eCommunications Biology\\u003c/em\\u003e \\u003cb\\u003e8\\u003c/b\\u003e, 420 (2025).\\u003c/li\\u003e\\n\\u003cli\\u003eAl Rubaye, H., Adamson, C. C. \\u0026amp; Jadavji, N. M. The role of maternal diet on offspring gut microbiota development: a review. \\u003cem\\u003eJ. Neurosci. Res.\\u003c/em\\u003e \\u003cb\\u003e99\\u003c/b\\u003e, 284–293 (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eMak, J. W. Y., Lo, A. T. W. \\u0026amp; Ng, S. C. Early life factors, diet and microbiome, and risk of inflammatory bowel disease. \\u003cem\\u003eJ. Can. Assoc. Gastroenterol.\\u003c/em\\u003e \\u003cb\\u003e8\\u003c/b\\u003e, S44-s50 (2025).\\u003c/li\\u003e\\n\\u003cli\\u003eMagne, F. \\u003cem\\u003eet al.\\u003c/em\\u003e The firmicutes/bacteroidetes ratio: a relevant marker of gut dysbiosis in obese patients? \\u003cem\\u003eNutrients\\u003c/em\\u003e \\u003cb\\u003e12\\u003c/b\\u003e, 1474 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eMurphy, E. A., Velazquez, K. T. \\u0026amp; Herbert, K. M. Influence of high-fat diet on gut microbiota: a driving force for chronic disease risk. \\u003cem\\u003eCurr. Opin. Clin. Nutr. Metab. Care\\u003c/em\\u003e \\u003cb\\u003e18\\u003c/b\\u003e, 515–520 (2015).\\u003c/li\\u003e\\n\\u003cli\\u003eLi, C., Peng, K., Xiao, S., Long, Y. \\u0026amp; Yu, Q. The role of Lactobacillus in inflammatory bowel disease: from actualities to prospects. \\u003cem\\u003eCell Death Discovery\\u003c/em\\u003e \\u003cb\\u003e9\\u003c/b\\u003e, 361 (2023).\\u003c/li\\u003e\\n\\u003cli\\u003eSun, J. \\u003cem\\u003eet al.\\u003c/em\\u003e High-fat-diet–induced obesity is associated with decreased antiinflammatory Lactobacillus reuteri sensitive to oxidative stress in mouse Peyer's patches. \\u003cem\\u003eNutrition\\u003c/em\\u003e \\u003cb\\u003e32\\u003c/b\\u003e, 265–272 (2016).\\u003c/li\\u003e\\n\\u003cli\\u003eDi Vincenzo, F., Del Gaudio, A., Petito, V., Lopetuso, L. R. \\u0026amp; Scaldaferri, F. Gut microbiota, intestinal permeability, and systemic inflammation: a narrative review. \\u003cem\\u003eIntern. Emerg. Med.\\u003c/em\\u003e \\u003cb\\u003e19\\u003c/b\\u003e, 275–293 (2024).\\u003c/li\\u003e\\n\\u003cli\\u003ePorter, R. J., Kalla, R. \\u0026amp; Ho, G. T. Ulcerative colitis: recent advances in the understanding of disease pathogenesis. \\u003cem\\u003eF1000Res\\u003c/em\\u003e \\u003cb\\u003e9\\u003c/b\\u003e, F1000 Faculty Rev-294 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eBankole, E., Read, E., Curtis, M. A., Neves, J. F. \\u0026amp; Garnett, J. A. The relationship between mucins and ulcerative colitis: a systematic review. \\u003cem\\u003eJ. Clin. Med.\\u003c/em\\u003e \\u003cb\\u003e10\\u003c/b\\u003e, 1935 (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eRawat, M. \\u003cem\\u003eet al.\\u003c/em\\u003e IL1B increases intestinal tight junction permeability by up-regulation of MIR200C-3p, which degrades occludin mRNA. \\u003cem\\u003eGastroenterology\\u003c/em\\u003e \\u003cb\\u003e159\\u003c/b\\u003e, 1375–1389 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eKaur, A. \\u0026amp; Goggolidou, P. Ulcerative colitis: understanding its cellular pathology could provide insights into novel therapies. \\u003cem\\u003eJ. Inflamm.\\u003c/em\\u003e \\u003cb\\u003e17\\u003c/b\\u003e, 15 (2020).\\u003c/li\\u003e\\n\\u003cli\\u003eBanakar, F. \\u003cem\\u003eet al.\\u003c/em\\u003e Hydro alcoholic green tea extract effect on high fat diet treated NMRI mice and 3T3L1 cells. \\u003cem\\u003eJ. Diabetes Metab. Disord.\\u003c/em\\u003e \\u003cb\\u003e20\\u003c/b\\u003e, 641–648 (2021).\\u003c/li\\u003e\\n\\u003cli\\u003eZhu, Y. \\u003cem\\u003eet al.\\u003c/em\\u003e Intestinal epithelium-specific knockout of the cytochrome P450 reductase gene exacerbates dextran sulfate sodium-induced colitis. \\u003cem\\u003eJ. Pharmacol. Exp. Ther.\\u003c/em\\u003e \\u003cb\\u003e354\\u003c/b\\u003e, 10–17 (2015).\\u003c/li\\u003e\\n\\u003cli\\u003eLesani, A. \\u003cem\\u003eet al.\\u003c/em\\u003e Acute anticonvulsant effects of dapsone on PTZ- and MES-induced seizures in mice: NLRP3 inflammasome inhibition and Nrf2/HO-1 pathway preservation. \\u003cem\\u003ePharmacol. Rep.\\u003c/em\\u003e \\u003cb\\u003e77\\u003c/b\\u003e, 450–462 (2025).\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, J., Liu, T., Xue, T. \\u0026amp; Jia, Z. Paricalcitol alleviates intestinal ischemia-reperfusion injury via inhibition of the ATF4-CHOP pathway. \\u003cem\\u003eFront. Pharmacol.\\u003c/em\\u003e \\u003cb\\u003e16\\u003c/b\\u003e, 1529343 (2025).\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Maternal high-fat diet, Offspring, Bacillus coagulans, Probiotic, Ulcerative colitis (UC), Gut microbiome\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-8162313/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-8162313/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eMaternal high-fat diet (MHFD) alters the offspring's gut microbiome, impairs intestinal integrity, and increases susceptibility to ulcerative colitis (UC) later in life. As \\u003cem\\u003eBacillus coagulans\\u003c/em\\u003e (\\u003cem\\u003eB. coagulans\\u003c/em\\u003e) is known to decrease intestinal inflammation, this study investigated whether its early-life administration could reverse MHFD effects and confer protection against dextran sulfate sodium (DSS)-induced UC. Female NMRI mice were fed a normal chow diet (NCD) or high-fat diet (HFD) during gestation and lactation. Male offspring from the MHFD group received a daily oral gavage of \\u003cem\\u003eB. coagulans\\u003c/em\\u003e or phosphate-buffered saline (PBS) from postnatal day 21 until week 8. MHFD altered the gut microbiome, decreased expression of tight junction proteins (ZO-1 and Claudin-5), and exacerbated UC severity after DSS induction. Early-life administration of \\u003cem\\u003eB. coagulans\\u003c/em\\u003e restored the gut microbiome, improved gut integrity, decreased pro-inflammatory cytokines (IL-1β and TNF-α), and protected the MHFD offspring against UC. We conclude that MHFD impairs offspring intestinal integrity and increases UC susceptibility, while early-life \\u003cem\\u003eB. coagulans\\u003c/em\\u003e intervention restores the gut microbiome, improves intestinal health, and confers protection against UC later in life.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Effect of Bacillus coagulans on DSS-Induced Ulcerative Colitis in NMRI Mice Offspring Exposed to a Maternal High-Fat Diet\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-05-05 20:19:22\",\"doi\":\"10.21203/rs.3.rs-8162313/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"2846c1ba-bed1-4929-93e4-ca639dd8a053\",\"owner\":[],\"postedDate\":\"May 5th, 2026\",\"published\":true,\"recentEditorialEvents\":[{\"type\":\"decision\",\"content\":\"Rejected\",\"date\":\"2026-05-18T11:40:02+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-17T03:49:30+00:00\",\"index\":104,\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-09T14:04:50+00:00\",\"index\":103,\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"160507174554389468445652685514730956981\",\"date\":\"2026-05-09T11:25:10+00:00\",\"index\":102,\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"110402733998689204669319667916466592172\",\"date\":\"2026-05-04T11:48:13+00:00\",\"index\":99,\"fulltext\":\"\"}],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":67481163,\"name\":\"Health sciences/Diseases\"},{\"id\":67481164,\"name\":\"Health sciences/Gastroenterology\"},{\"id\":67481165,\"name\":\"Biological sciences/Immunology\"},{\"id\":67481166,\"name\":\"Biological sciences/Microbiology\"}],\"tags\":[],\"updatedAt\":\"2026-05-18T11:54:42+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-05-05 20:19:22\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-8162313\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-8162313\",\"identity\":\"rs-8162313\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}