{"paper_id":"23ddf096-63c1-46c8-9337-cbbb11799ae5","body_text":"1 \n \nEscape from antimicrobial CRISPR-Cas9 in E. coli ST131 depends on the genetic context 1 \nof the target gene. 2 \nRunning title: E. coli ST131 survival of CRISPR-Cas9 antimicrobial. 3 \nClàudia Morros -Bernausa#, Joseph Westleya, Ethan R. Wyrschb, Steven P. Djordjevicb, Lihong 4 \nZhangc, Anne FC. Leonardc, William H. Gazec, David Sünderhaufa, Stineke van Houtea#.   5 \naCentre for Ecology and Conservation, University of Exeter, Environment and Sustainability Institute, Penryn Campus, TR10 9FE, UK.  6 \nbAustralian Institute for Microbiology and Infection, University of Technology Sydney, Ultimo, NSW 2007, Australia. 7 \ncEuropean Centre for Environment and Human Health, University of Exeter Medical School, Environment and Sustainability Institute, 8 \nPenryn Campus, TR10 9FE, UK. 9 \n#Correspondence to: c.morros.lab@gmail.com and c.van-houte@exeter.ac.uk. 10 \nABSTRACT 11 \nEscherichia coli (E. coli) is a common bacterium in the human gut and an important cause of 12 \nintestinal and extraintestinal infections. Some E. coli sequence types (ST) are associated with 13 \nhigh pathogenicity. The Extraintestinal Pathogenic E. coli (ExPEC) ST131 is a globally distributed 14 \nmultidrug-resistant human pathogen associated with urinary tract and bloodstream infections. 15 \nAntibiotic-resistant infections often lead to antibiotic treatment failure, underscoring the need of 16 \ndeveloping alternative treatments. The highly selective antimicrobial potential of CRISPR -Cas9 17 \nhas been demonstrated in a range of model organisms. However, the effectiveness of CRISPR -18 \nCas9 in combating ST131 -associated infections and the consequences of CRISPR -Cas9 19 \ntreatment, such as the emergence of escapers, remains unclear.  20 \nHere, we investigated the antimicrobial activity of CRISPR-Cas9 against ST131 and assessed the 21 \nfrequency and genetic basis of escape. We conjugatively delivered CRISPR -Cas9 to ST131 22 \nisolates which carried cefotaxime-resistance-encoding target gene blaCTX-M-15 in the chromosome 23 \nand characterized escape subpopulations.  Two main types of escapers emerged: blaCTX-M-15-24 \npositive escapers carried dysfunctional CRISPR-Cas9 systems and arose at a ~10-5 frequency. 25 \nInstead, blaCTX-M-15-negative escapers presented chromosomal deletions involving blaCTX-M-15 loss. 26 \nThe frequency of blaCTX-M-15 loss depended on the blaCTX-M-15 genetic context. Specifically, blaCTX-M-27 \n15-negative escapers emerged at low frequency (~10 -5) in isolates where  blaCTX-M-15 was located 28 \ndownstream of insertion sequence (IS) ISEcp1, while escapers emerged with high frequency (~10-29 \n3) in isolates where blaCTX-M-15 was flanked by IS26. This work emphasizes how the genetic context 30 \nof target genes can drive the outcome of CRISPR-Cas9 tools, where the presence of IS 26 may 31 \ndrive increased frequencies of escape.   32 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n2 \n \nIMPORTANCE 33 \nIn the past decade CRISPR-Cas9 has emerged as a n efficient antimicrobial tool capable of 34 \nselective elimination of targeted bacteria. Even though it has been well described that bacteria 35 \ncan evolve to escape targeting by CRISPR-Cas9, the mechanisms of bacterial escape and their 36 \nconsequences remain largely elusive. In this study, we demonstrate the antimicrobial efficacy of 37 \nCRISPR-Cas9 against natural isolates of Escherichia coli ST131, a clinically relevant pathogen, 38 \nand elucidate the mechanism of escape from antimicrobial activity. We identify two  distinct 39 \nmechanisms of escape, which involve either dysfunctional CRISPR -Cas9 activity, or loss of the 40 \ntarget gene (blaCTX-M-15), with the latter occurring at frequencies that depend on the genetic context 41 \nof the target gene. These findings provide important insights into the frequency and mechanisms 42 \nof bacterial escape from CRISPR -Cas9-based antimicrobials and offer a foundation for the 43 \ndevelopment of more effective treatments.  44 \nWord count abstract: 247 45 \nWord count text: 6060  46 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n3 \n \nINTRODUCTION 47 \nAntimicrobial resistance (AMR) is a global health threat. By 2050, up to 8.22 million annual deaths 48 \nare predicted to be associated with AMR (1). The misuse and overuse of antibiotics has drastically 49 \naccelerated the emergence of AMR (2), which contributes to antibiotic treatment failure (3). In 50 \nthis context, Escherichia coli is one of the most important pathogens, accounting for the highest 51 \nnumber of AMR-attributable deaths in 2019  (4). Therefore, it is recognized by the  World Health 52 \nOrganization (WHO) as a priority pathogen for which urgent development of new antimicrobials 53 \nis needed (5).   54 \nExtraintestinal Pathogenic E. coli (ExPEC) strains are among the most common Gram -negative 55 \npathogens in humans  (6). They are associated with numerous types of  infections, including 56 \nurinary tract infections (UTIs), which can develop into bloodstream infections (7–9). Since 2000, 57 \nSequence Type (ST) ST131 is the most common pandemic lineage  in the clinic  (8). The ST131 58 \nlineage represents multidrug-resistant pathogen s frequently associated with extended-59 \nspectrum beta-lactamases (ESBL), aminoglycoside and fluoroquinolone resistance, and several 60 \nvirulence factors (7,9–11). CTX-M enzymes are among the mo st prevalent type of ESBL (12,13), 61 \ndue to their global dissemination (12,14). The genes encoding these enzymes, blaCTX-M genes, are 62 \nfound in both  chromosomes and plasmids  (14,15), often as part of  highly mobile genetic 63 \nstructures, surrounded by  insertion sequences (IS), transposons and integrons (14). These 64 \nmobile genetic elements ( MGEs) not only contribute to AMR mobilisation but can also act as 65 \npromoter sequences, regulating expression levels of surrounding genes (14,16,17). Of these, IS 66 \nare the smallest self -mobilizing units (0.7-2.5 kB) that typically code for a single transposase 67 \n(Tnp), which allows their mobilisation (18,19). Several families of ISs, notably IS Ecp1 and IS26, 68 \nare widely distributed across E. coli ST131 genomes and are frequently located within or flanking 69 \nCTX-M gene structures (20–22). While ISEcp1 is commonly found as a single copy upstream of 70 \nthe AMR gene (14), IS26 is often found in multiple copies of the same orientation that flank the 71 \nAMR gene, in what is known as a pseudo-compound transposon (PCT) (23,24).  72 \nST131-associated infections are difficult to treat. In fact, higher antibiotic treatment failure rates 73 \nhave been reported compared  to non-ST131 infections (25,26). In an urgent need to find 74 \nalternative treatments, CRISPR-Cas9 can be used as a promising novel antimicrobial (27,28). In 75 \nnatural populations, CRISPR -Cas systems act as a prokaryotic  immune system against MGE 76 \ninfections. S ince its discovery CRISPR -Cas9 in particular  has been developed as a highly 77 \nsequence-specificity tool that can recognize a short  (20 bp)  specific DNA sequence and 78 \nsubsequently cleave it (29). The tool combines a single-guide RNA (sgRNA) with a Cas9 nuclease; 79 \nthe sgRNA recognises the target sequence while the Cas9 nuclease executes target cleavage by 80 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n4 \n \nintroducing a blunt-ended double-strand DNA break (DSB) into the target genome (30).  DSBs are 81 \nstrong genotoxic lesions that lead to cell death (31). This highly specific antimicrobial effect of 82 \nCRISPR-Cas9 has been studied extensively over the past ten years (32–36). However, the 83 \nconsequences of CRISPR -Cas9 treatment failur e and the long -term effects of  its use  remain 84 \nlargely unexplored. 85 \nHere, we assessed the antimicrobial potential of  CRISPR-Cas9 targeting blaCTX-M-15, the most 86 \nreported ESBL gene among E. coli ST131 (13). We used a modified version of the broad-host range 87 \nconjugative plasmid pKJK5::csg (37) to deliver CRISPR-Cas9, and programmed CRISPR-Cas9 to 88 \ntarget four different E. coli ST131 isolates derived from human stool  samples (38), all of them 89 \ncarrying a chromosomal copy of blaCTX-M-15. While strong antimicrobial activity was observed, we 90 \nfound escapers of CRISPR -Cas9 targeting for all isolates. We observed  two main types of 91 \nescapers, either presenting dysfunctional CRISPR -Cas9, or chromosomal rearrangements 92 \nleading to loss of the target gene. Interestingly, for the second type of escapers, we found a direct 93 \nimpact of the blaCTX-M-15 genetic context (either surrounded by IS Ecp1 or IS 26) on the  escape 94 \nfrequencies, emphasizing the importance of the genetic context of a target gene on escape from 95 \nCRISPR-Cas9.   96 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n5 \n \nRESULTS 97 \nCRISPR-Cas9 targeting of a chromosomally encoded blaCTX-M-15 gene in human-associated E. 98 \ncoli ST131 isolates causes high levels of sequence-specific killing 99 \nWe used the broad-host range conjugative plasmid pKJK5 as a delivery vector of a CRISPR-Cas9 100 \ncassette (csgc: cas9, sgRNA, gfp and catB), either targeting blaCTX-M-15 (pKJK5::csgc[blaCTX-M-15]) or a 101 \nnon-targeting control (pKJK5::csgc[NT]). We first verified successful delivery of pKJK5::csgc into 102 \na recipient E. coli DH5α lacking blaCTX-M-15, and found no significant differences (p = 0.68) between 103 \ntreatment and control  (Figure 1 ), showing that the delivery efficiency of pKJK5::csgc is 104 \nindependent of the sgRNA target and that the system can be acquired in the absence of a CRISPR-105 \nCas9 target.  106 \nNext, we assessed CRISPR-Cas9 targeting activity in four E. coli ST131 isolates (Ecp1-I, Ecp1-II, 107 \n26-I and 26 -II); which all carry a single chromosomally encoded blaCTX-M-15 copy. Completed 108 \ngenome sequences were generated for all four isolates to enable us to have an unambiguous 109 \nassessment of blaCTX-M-15 location and copy number. Across isolates, pKJK5::csgc[NT] achieved 110 \nsignificantly higher conjugation efficiencies  (ranging from 15 ± 8% to 58 ± 11%)) than 111 \npKJK5::csgc[blaCTX-M-15] (ranging from 0.002 ± 0.0007% to 0.062 ± 0.03%; p<0.001) (Figure 1). This 112 \ndifference was attributed to the non-viability of transconjugants when CRISPR-Cas9 targets the 113 \nchromosomally encoded blaCTX-M-15.  114 \n 115 \nFigure 1 : Conjugation efficiencies for either pKJK5::csgc[NT] (purple) or pKJK5::csgc[ blaCTX-M-15] ( white) across 116 \ndifferent recipients : either E. coli DH5α, lacking blaCTX-M-15, or  the respective E. coli ST131 isolates, all with a 117 \nchromosomally encoded blaCTX-M-15. Conjugation efficiencies were calculated dividing the number of transconjugants 118 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n6 \n \nby the number of recipients. The c onjugation efficiencies from the five replicates are represented as circles and the 119 \ncolour represents the replicate number. The distinct colours assigned to each replicate in the pKJK5::csgc[blaCTX-M-15] 120 \ntreatment facilitates tracking the replicate origin of the escapers throughout the manuscript. The means of the 121 \nconjugation efficiencies are represented as triangles ± standard deviation (bars). p-values <0.001 (***), non-significant 122 \n(ns).  123 \nWhile strong CRISPR-Cas9 antimicrobial activity  was demonstrated , all isolates contained 124 \nsubpopulations of E. coli ST131 transconjugants (escapers) able to survive acquisition of  125 \npKJK5::csgc[blaCTX-M-15]. 126 \nOverall escape frequencies varied across isolates ( (4.53 ± 5.30) x 10 -5 to (4.23 ± 1.95) x 10 -3) 127 \n(Figure 2A). To better understand the genetic basis of escape and their relative contribution to 128 \nthe overall escape frequencies, we determined cefotaxime resistance phenotypes for each of the 129 \nescapers, since resistance to cefotaxime is known to be conferred by CTX-M enzymes (15,39). 130 \nThis showed that both  cefotaxime-resistant and cefotaxime-sensitive escapers were found 131 \nacross isolates (Supplementary figure 3), revealing that  E. coli ST131 could escape from 132 \nCRISPR-Cas9 while either maintaining or losing the target gene.  133 \n 134 \nFigure 2: Mean escape frequencies from the CRISPR -Cas9 treatment for the four E. coli ST131 isolates. A) Overall 135 \nescape frequencies independent of the cefotaxime resistance phenotype. These frequencies were calculated as the 136 \nrelative conjugation efficiency between the conjugation efficiency of pKJK5::csgc[blaCTX-M-15] for each replicate and the 137 \naverage conjugation efficiency of pKJK5::csgc[NT]. B-C) Cefotaxime-resistant (B) and -sensitive (C) escape 138 \nfrequencies. The escape frequencies for each phenotype were determined as the relative conjugation efficiency 139 \nbetween the cefotaxime-resistant or cefotaxime-sensitive conjugation efficiencies of pKJK5::csgc[ blaCTX-M-15] for each 140 \nreplicate and the average conjugation efficiency of pKJK5::csgc[NT].  The escape frequencies from the five replicates 141 \nare represented as circles and the colour represents the replicate number. The mean escape frequencies, which 142 \ninclude replicates with no escapers for a specific phenotype, are represented as triangles ± standard deviation (bars). 143 \nReplicate 4 from isolate Ecp1-II was excluded from cefotaxime-resistant and cefotaxime-sensitive escape frequencies 144 \nas only one escaper could be directly recovered from the filter mating assay. p-values <0.001 (***). 145 \nCefotaxime-resistant escapers have dysfunctional CRISPR-Cas9 systems. 146 \n*** \n*** \n*** \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n7 \n \nCefotaxime-resistant escape frequencies  were generally low ( ~10-5) but  showed significant 147 \nvariation across isolates (Figure 2B; p<0.001). Post-hoc testing revealed this was due to isolate 148 \n26-I having a significantly lower escape frequency than all others (p<0.001). Nevertheless, the 149 \nescape frequencies for isolates 26 -I and 26 -II should be interpreted cautiously, as only few 150 \nescapers were detected, and their presence was inconsistent across replica tes (Figure 2B and 151 \nSupplementary figure 3). Therefore, in-depth analysis  of cefotaxime -resistant escapers was 152 \nonly performed for  isolates Ecp1-I and Ecp 1-II. First, we sequenced the blaCTX-M-15 gene to 153 \ngenetically confirm the cefotaxime -resistant phenotypes and found no mutations in the target 154 \nsite or PAM. We then hypothesized that escapers likely survived CRISPR-Cas9 targeting through 155 \nacquiring mutations in cas9 and/or sgRNA (csgc) on the pKJK5::csgc[blaCTX-M-15]. To address this, 156 \nwe assessed CRISPR-Cas9 integrity  using PCR . All transconjugants from the pKJK5::csgc[NT] 157 \ncontrol showed expected blaCTX-M-15 and csgc amplicons, but deletions, duplications, and partial 158 \nor complete lack of amplification within cas9 and/or sgRNA were found for 48% (Ecp1-I) and 64% 159 \n(Ecp1-II) of the escapers (Supplementary figure 4A). Furthermore, one Ecp1-II escaper exhibited 160 \nan IS150 transposition into cas9. While IS150 is present in both the donor (K-12 MG1655) and the 161 \nrecipient (ST131 isolate Ecp1 -II) genome, the presence of a single nucleotide polymorphism 162 \nunique for IS150 in the K -12 genome suggested that the transposition into pKJK5::csg[ blaCTX-M-15] 163 \noccurred in the donor prior to its delivery to Ecp1 -II. The different mutations were distributed 164 \nacross the cas9 and sgRNA sequence (Supplementary figure 4B-C), with no obvious patterns 165 \nrevealed except for a hotspot in the  α-helical lobe  found in escapers from isolate Ecp1 -I 166 \n(Supplementary figure 4B) (40). 167 \nThose escapers that did not exhibit identifiable csgc mutations were subjected to a phenotypic 168 \nCRISPR-Cas9 functionality assay. We mated escapers with a donor bacterium bearing either 169 \ntargeted plasmid pCTX15 (carrying the wildtype blaCTX-M-15) or untargeted plasmid pCTRL 170 \n(Supplementary figure 5A ) and calculated their relative conjugation efficiencies 171 \n(pCTRL/pCTX15). Cefotaxime -sensitive escapers lacking blaCTX-M-15 were used as potential 172 \npositive CRISPR-Cas9 controls. For both Ecp1-I and Ecp1-II most cefotaxime-sensitive escapers 173 \ndemonstrated protection against pCTX15 ( Supplementary figure 5B-C). In contrast, no 174 \nprotection was observed for cefotaxime-resistant escape rs (Supplementary figure 5B-C), 175 \nindicating dysfunctional CRISPR -Cas9 activity. Only one cefotaxime -resistant escaper (5.10 176 \nEcp1-II) showed a relative conjugation efficiency for all the replicates compatible with functional 177 \nCRISPR-Cas9 activity  (Supplementary figure 5C), which could indicate coexistence of the 178 \nwildtype blaCTX-M-15 and a functional pKJK5::csgc[blaCTX-M-15]. This escaper showed no mutations in 179 \nblaCTX-M-15, and short-read WGS did not reveal  relevant mutations in pKJK5::csgc[blaCTX-M-15] that 180 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n8 \n \ncould interfere with CRISPR -Cas9 activity . Therefore, coexistence could be attributed to an 181 \nunknown mechanism.   182 \nTo summarize, we found that cefotaxime-resistant escape frequencies were ~10-5 across isolates 183 \nand all the escapers carried blaCTX-M-15 with no mutations in the protospacer or PAM sequence . 184 \nUsing genotypic and phenotypic screening, we attributed cell survival to dysfunctional CRISPR-185 \nCas9 systems.  186 \nCefotaxime-sensitive escapers lost blaCTX-M-15 in a manner dependent on its genetic 187 \ncontext.   188 \nTo understand the  differential cefotaxime-sensitive escape frequencies found across isolates 189 \n(Figure 2 C), w e sought to understand the genetic context of  blaCTX-M-15. Long-read genome 190 \nanalyses of the ancestral untreated isolates revealed three different genetic contexts. In isolates 191 \nEcp1-I and Ecp1-II, blaCTX-M-15 is found downstream of an insertion sequence (IS)  ISEcp1, which 192 \ndisrupts lacY in the lac operon (Figure 3A). In contrast, isolates 26-I and 26-II carry blaCTX-M-15 193 \nflanked by two IS 26 copies of the same orientation , in a pseudo-compound transposon (PCT) 194 \n(18,23). This blaCTX-M-15 PCT is found surrounded by  either two or three additional IS26 copies 195 \nrespectively, creating two slightly distinct overall IS26-contained sequences. These sequences 196 \nshare the same genome location in both isolates , disrupting a gene of  unknown function 197 \n(EC958_2451) (Figure 3B-C). Significant differences were found between cefotaxime -sensitive 198 \nescape frequencies of the three genetic contexts (p -values for each combination < 0.001) . 199 \nIsolates with an ISEcp1 genetic context showed significantly lower cefotaxime-sensitive escape 200 \nfrequencies than isolate 26-I (4-copy IS26 context), which in turn had a significantly lower escape 201 \nfrequency than isolate 26 -II (5-copy IS26 context). Overall, this indicates a significantly higher 202 \nescape frequency through loss of blaCTX-M-15 in isolates with an IS26 genetic context compared to 203 \nISEcp1. Consequently, different approaches were employed to characterize the escapers based 204 \non their genetic context. 205 \n 206 \n 207 \n 208 \n 209 \n 210 \n 211 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n9 \n \n 212 \nFigure 3: Genetic context of blaCTX-M-15 (orange arrow) for the four E. coli ST131 isolates, ORFs and gene distances not 213 \ndrawn to scale. A) Isolate Ecp1-I and Ecp1-II share the same ISEcp1 genetic context disrupting a lacY gene. The lacZ 214 \ngene is found 1.2 kB upstream of the ISEcp1.  ISEcp1 is represented as a yellow arrow box. B-C) IS26 genetic contexts 215 \nfor isolates 26-I (B) and 26-II (C), with a blaCTX-M-15 pseudo-compound transposon (PCT). For both isolates, the respective 216 \noverall IS26-contained sequences are  found disrupting the gene  with unknow function ( EC958_2451), shown in the 217 \nfigure as 2451. The two Tn3, shown as pink boxes, represent a single Tn3 split into two truncated ORFs, likely due to 218 \nIS26 disruption that led to an inversion of one of the parts . IS26 is represented as a green arrow box. 2453 and 2456 219 \nrepresent the genes EC958_2453 and EC958_2456. 220 \nAn ISEcp1 genetic context is associated with large-scale genomic deletions alongside blaCTX-221 \nM-15 loss. 222 \nFor cefotaxime-sensitive escapers from Ecp1-I (n=19) and Ecp1-II (n=19) (Supplementary figure 223 \n3), PCR and subsequent Sanger sequencing of the amplicons revealed complete loss of ISEcp1 224 \n+ blaCTX-M-15 for most of the escapers  (n=36) and partial deletions including the protospacer 225 \nsequence (the 20 bp targeted by pKJK5::csgc[blaCTX-M-15]) for the remaining escapers  (n=2) 226 \n(Supplementary figure 6A).  227 \nTo better characterize the  dimensions of the ISEcp1 + blaCTX-M-15 deletions, a β-galactosidase 228 \nassay was performed, taking advantage of the proximal lacZ gene (Figure 3A). This enzymatic 229 \nassay allows phenotypic screening of blue or white colonies based on presence  or absence, 230 \nrespectively, of β-galactosidase, the enzyme encoded by lacZ. A negative phenotype (white) 231 \nindicated deletions of IS Ecp1 + blaCTX-M-15 together with lacZ (Supplementary figure 6B). In 232 \ncontrast, a positive phenotype (blue) delimited the start of the deletion within 1.2 kB (somewhere 233 \nin between lacZ and ISEcp1) (Supplementary figure 6C). Both phenotypes were observed across 234 \nescapers, with β-galactosidase-negative escapers being more abundant (n=30) (Supplementary 235 \nC) Isolate 26-II \nblaCTX-M-15 PCT \nA) Isolates Ecp1-I and Ecp1-II \nlacZ                 lacY      ISEcp1 blaCTX-M-15 \n        IS26   aac(6’)-Ib blaOXA-1 catB        IS26   blaCTX-M-15   Tn3          IS26      Tn3       IS26    2451 \nB) Isolate 26-I \n           IS26  aac(6’)-Ib blaOXA-1 catB    IS26   yokD tmrB  ISKpn11  IS26       Tn3        IS26       Tn3     blaCTX-M-15     IS26    2451   2453 2456 \nblaCTX-M-15 PCT \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n10 \n \nfigure 6D). Short-read WGS was performed on a representative escaper from each phenotype 236 \nand isolate to confirm their genotypic basis. 237 \nAdditionally, all cefotaxime-sensitive escapers from Ecp1 -I and Ecp1 -II were subjected to both 238 \nthe csgc genotypic and phenotypic CRISPR-Cas9 functionality assay  previously described. All 239 \nescapers showed csgc amplicons of expected lengths. In the phenotypic assay most showed 240 \nfunctional CRISPR -Cas9 systems (n=32). Nevertheless, a small subset  showed dysfunctional 241 \nCRISPR-Cas9 activity (n=6), highlighting that both the loss of blaCTX-M-15 and the presence of a 242 \ndysfunctional system can co-occur (Supplementary figure 5B-C).  243 \nAn IS 26 genetic context is associated with small-scale genomic deletions of blaCTX-M-15 244 \nfacilitated by the presence of two flanking IS26 copies.  245 \nFor isolates 26-I and 26-II, both with an IS26 genetic context, 26-II was chosen as a representative 246 \nfor further study due to its higher IS26 load (Figure 3 B-C). First, hybrid WGS was performed for a 247 \nsubset of escapers (n=10) which revealed either the deletion of the blaCTX-M-15 PCT (n=8) or larger 248 \ndeletions including downstream chromosomal sequences (n=2). All the deletions led to a single 249 \nremaining IS26 chromosomal copy from the two original ones.   250 \nWe used these representative data to inform PCRs assaying  the deletion of the blaCTX-M-15 PCT 251 \n(Supplementary figure 7A) in all the cefotaxime-sensitive escapers (n=98). The ancestral isolate 252 \nand the cefotaxime-resistant escapers (used as positive controls ) showed the expected 4.9 kB 253 \namplicon covering the blaCTX-M-15 PCT alongside a smaller amplicon, likely a PCR artefact resulting 254 \nfrom recombination between the multiple copies of IS26. Crucially, cefotaxime-sensitive 255 \nescapers (n=94) lacked the 4.9 kB amplicon and only displayed a 972 bp amplicon, which 256 \ncorresponded to a single IS26 copy in agreement with the deletion of the blaCTX-M-15 PCT observed 257 \nin the WGS  (Supplementary figure 7B). Additionally, 3 escapers, including the two  with larger 258 \ndeletions characterized by WGS, showed no amplicon, agree ing with the presence of larger 259 \ndeletions thus avoiding primer binding (Supplementary figure 7A and C-D). Finally, one escaper 260 \nshowed a <4.9 kb amplicon, likely explained by a partial deletion within blaCTX-M-15, thereby 261 \nconferring loss of the resistant phenotype and escape of CRISPR-Cas9 targeting.  262 \nTo summarize, the emergence of cefotaxime-sensitive escapers was significantly impacted by 263 \nthe genetic context of blaCTX-M-15. While all cefotaxime-sensitive escapers exhibited chromosomal 264 \nrearrangements involving the loss of  blaCTX-M-15, an ISEcp1 genetic context was associated with 265 \nlower escape frequencies and large-scale deletions. In contrast, an IS26 genetic context revealed 266 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n11 \n \nhigher escape fre quencies, primarily driven by small-scale deletions (blaCTX-M-15 PCT) occurring 267 \nbetween the two flanking IS26 elements. 268 \nDISCUSSION 269 \nHere, we demonstrated the sequence-specific antimicrobial activity of CRISPR-Cas9 by targeting 270 \nthe chromosomally encoded ESBL  gene blaCTX-M-15 in human-associated isolates of the E. coli  271 \nlineage ST131. The delivery of a blaCTX-M-15 targeting CRISPR-Cas9 cassette using the broad host-272 \nrange conjugative plasmid pKJK5::csgc achieved a significant reduction (from 236-fold to 22.000-273 \nfold, depending on the isolate ) in conjugation efficiency compared to a non -targeting control, 274 \nexplained by the non -viability of  E. coli  ST131 transconjugants . This demonstrates  the 275 \nantimicrobial use of CRISPR -Cas9 against E. coli ST131 isolates , which can be found in 276 \nantimicrobial resistant UTIs, for which non -antibiotic treatments are urgently needed  (41). 277 \nPromisingly, the use of pKJK5::csgc is compatible with probiotics, which are already prophylactic 278 \nand therapeutic treatment options for recurrent UTIs (42–44). However, we observed widespread 279 \nescape of CRISPR-Cas9 targeting across isolates and identified both escapers that retained the 280 \nblaCTX-M-15 gene and carried dysfunctional CRISPR-Cas9, and escapers that lost blaCTX-M-15 through 281 \nchromosomal rearrangements. Crucially, for the escapers with  blaCTX-M-15 deletions, we found 282 \nsignificantly different escape frequencies depending on the genetic context of the target  gene, 283 \nwith increased escape frequencies (up to 813-fold) when blaCTX-M-15 is found surrounded by two 284 \ncopies of IS26, as part of an IS 26 pseudo-compound transposon (PCT), compared to when it is 285 \nfound downstream of an ISEcp1.  286 \nCefotaxime-resistant (blaCTX-M-15-positive) escapers retained an intact  version of  blaCTX-M-15, 287 \nsuggesting that CRISPR-Cas9 escape through mutations in the protospacer (the 20 bp targeted 288 \nby pKJK5::csgc[blaCTX-M-15]) or protospacer adjacent motif (PAM) sequence is rare in these isolates. 289 \nAs mutations in the target site were previously re ported for other genes (36,45–49), we  290 \nhypothesize that the absence of such escapers in our setup may be attributed to mutations in 291 \nblaCTX-M-15 occurring below the detection limit of the assay (~10-6). Instead, all cefotaxime-resistant 292 \nescapers presented dysfunctional CRISPR -Cas9 systems. In line with previous literature 293 \n(35,45,46,48,50,51), w e found deletions, duplications and insertion s across cas9 and sgRNA. 294 \nInterestingly, we only found one escaper with an IS transposition into cas9, even though this is a 295 \ncommonly reported event  (36,46,47,50,52). To minimize escapers with dysfunctional CRISPR -296 \nCas9 systems, several solutions have been proposed, including the use of multi-target arrays 297 \n(35,36,48), the manipulation of the CRISPR-Cas9 plasmid copy number (50), coupling CRISPR-298 \nCas antimicrobials with CRISPR-regulated toxin-antitoxin systems (ATTACK) (53) or the use of 299 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n12 \n \nnon-DNA based delivery strategies such as nano -sized CRISPR complexes (54), especially as 300 \nplasmid-based delivery relies on often heterogenous transcriptional activity of recipients (55). 301 \nHowever, the optimal solution to this problem has yet to be established. 302 \nIn contrast, cefotaxime-sensitive escapers revealed blaCTX-M-15 deletions, and this loss of the target 303 \ngene occurred in significantly higher frequencies (up to 813-fold) for isolates with an IS26 genetic 304 \ncontext compared to an IS Ecp1 genetic context. The observed blaCTX-M-15 deletions were likely 305 \ndriven by homologous recombination (HR) , which could either occur in the pre-existing 306 \npopulation leading to positively selected genotypes upon CRISPR-Cas9 exposure, or as a DNA-307 \ndamage repair mechanism after CRISPR-Cas9 targeting and a subsequent triggering of the SOS 308 \nresponse (33,36,56). Escapers with s uccessful DNA-damage repair could be associated with 309 \nweaker CRISPR-Cas9 activity (33), poor sgRNA folding (57) or expression (58) and/or variability in 310 \nthe host DNA damage tolerance and responses (59). Deletions of blaCTX-M-15 compatible with HR 311 \nwere observed across isolates. For isolates Ecp1-I and Ecp1 -II, sequencing of few cefotaxime-312 \nsensitive escapers revealed deletions with border homology (9 -11 bp), likely indicating HR.  In 313 \nisolate 26 -II, the most common deletion observed among cefotaxime -sensitive escapers (a  314 \ndeletion of the  blaCTX-M-15 PCT leaving a single IS 26 copy in the chromosome ; Supplementary 315 \nfigure 7B), is consistent with the product  of HR between the two directly oriented IS26 copies 316 \n(60–62) (Supplementary figure 8A-B). Recombination be fore CRISPR -Cas9 cleavag e would 317 \nrelease a  circular molecule  carrying blaCTX-M-15, known as a translocatable unit (TU)  318 \n(18,24,60,63,64), (Supplementary figure 8A) which is expected to be readily lost in absence of 319 \nself-replicative features (60) or through active targeting by CRISPR-Cas9. CRISPR-Cas9 cleavage 320 \nof intermediate circular molecules from similar excised MGEs has been recently reported (65). 321 \nOverall, the higher escape frequencies observed in an IS26 genetic context could be attributed to 322 \nthe homology found between the several IS26 copies (Figure 3 B-C), which may facilitate HR. In 323 \nfact, HR between homologous IS elements is a common driver of chromosomal rearrangements 324 \nin E. coli (66). 325 \nAlternatively, blaCTX-M-15 loss could be driven by an incomplete IS-mediated blaCTX-M-15 mobilization. 326 \nEvidence of this was found in escapers from isolate 26-II with larger blaCTX-M-15 deletions lacking 327 \nhomology in the borders  (Supplementary figure 7C-D). These deletions likely resulted from a 328 \nTnp26-dependent intramolecular copy-in mobilisation (24,67), in where the  downstream genes 329 \nEC958_2453 and EC958_2456 would have been used as respective intramolecular target s to 330 \nmediate chromosomal excision , releasing a TU carrying  the enclosed sequence (60) 331 \n(Supplementary figure 8CI-II), which would be readily lost or targeted by CRISPR -Cas9. This 332 \nmobilization pattern could also contribute to escapers with a blaCTX-M-15 PCT deletion, if using the 333 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n13 \n \nsequence found downstream of the PCT as an intramolecular target site (Supplementary figure 334 \n8CIII). In contrast , we could not find  evidence of blaCTX-M-15 deletions mediated by IS Ecp1 335 \nmobilisation, as ISEcp1 mobilises together with downstream genes  (18,68–71). Therefore, this 336 \nwould only be possible in  lacZ-positive cefotaxime-sensitive escapers , which are a minority 337 \n(Supplementary figure 6D). Sequencing of  two lacZ-positive escapers revealed blaCTX-M-15 338 \ndeletions incompatible with ISEcp1 mobilisation, suggesting that this is not a common escape 339 \nmechanism.  340 \nTo summarize, even though our data does not allow us to discern the exact escape mechanism 341 \nthat leads to chromosomal rearrangements, deletions resulting from both HR and incomplete IS-342 \nmediated blaCTX-M-15 mobilization are not mutually exclusive, and it is likely that the total escape 343 \npopulation is a combinatorial result of these events, each occurring at different frequencies.  344 \nEscapers with chromosomal rearrangements involving the deletion of the target gene have been 345 \nreported for other genes and bacterial species (33,36,49,57,72–74), including deletions with 346 \nborder homology, suggesting HR (33,75,76). Additionally, some studies have shown a reduction 347 \nin escape frequencies when knocking out (33) or inhibiting (57) expression of RecA, an important 348 \nprotein involved in HR (77) and found in all the ST131 isolates used in this work . Interestingly, 349 \nstudies where the target gene is found within a chromosomally integrated MGE reported escapers 350 \nin which the entire MGE was deleted, similar to the deletions of the blaCTX-M-15 PCT reported here. 351 \nThis occurred when the target genes were in a genomic island flanked by two directly oriented 352 \nIS1193 copies (73), in several pathogenicity islands (49,78) and in prophages (78).  353 \nThe presence of escapers with chromosomal rearrangements after a CRISPR-Cas9 treatment 354 \nmight be especially relevant when occurring at high frequenc ies, as for isolate 26-II (~10-3). The 355 \nemergence of this type of escapers could likely be reduced by choosing target genes independent 356 \nfrom chromosomally integrated MGEs and with genetic contexts that present limited or no 357 \nhomology. In this study , escapers with blaCTX-M-15 loss were resensitized to cefotaxime, which 358 \ncould be a beneficial outcome for antibiotic therapy. However, this type of chromosomal 359 \nrearrangements can also involve loss of other genes, leading to phenotypic changes (73,76).  360 \nFurthermore, d eletions resulting from successful DNA repair after CRISPR -Cas9 cleavage 361 \nthrough HR could be accompanied by mobilisation of other HR-mediated MGEs (18). This might 362 \nbe especially relevant when using CRISPR-Cas9 against AMR-carrying bacteria, which often carry 363 \nMGEs (18). While we did not directly observe this, such far-reaching genomic consequences of 364 \nCRISPR-Cas9 targeting should also be kept in mind when using CRISPR-Cas9 as an editing tool, 365 \nwhich often relies on HR (31,58).  366 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n14 \n \nAltogether, this study showed the antimicrobial activity of CRISPR-Cas9 against the 367 \nchromosomally encoded AMR gene blaCTX-M-15 from human-associated E. coli ST131 isolates and 368 \nidentified escapers resulting from either dysfunctional CRISPR -Cas9 or with chromosomal 369 \nrearrangements that led to the deletion of blaCTX-M-15. Our work showed the impact that the genetic 370 \ncontext of the target gene has on escape frequencies, where an association with IS26 led to a high 371 \nfrequency of blaCTX-M-15 loss. This research underlines the importance of understanding the genetic 372 \nenvironment to be able to  predict the treatment outcome  of CRISPR -Cas9 antimicrobials and 373 \nCRISPR-Cas9 gene editing. Finally, we also want to highlight the potential use of CRISPR-Cas9 as 374 \na tool to better characterize IS mobilization patterns  by studying escapers arising from the 375 \ntargeting of the IS elements or cargo genes.  376 \nMETHODS 377 \nGrowth conditions, buffers and media 378 \nLysogeny broth (LB), either liquid or mixed with agar, was used as growth media. Antibiotics were 379 \nused to ensure plasmid maintenance, select for chromosomal markers or perform phenotypic 380 \nassays at: chloramphenicol (Cm) 25 μg mL-1, gentamicin (Gm), kanamycin (Km) and streptomycin 381 \n(Sm) all 50 μg mL-1, and cefotaxime (CTX) 5 μg mL-1. Glycerol stocks were prepared at 20% (w/v) 382 \nand frozen at -70 oC. Sterile 0.9 % (w/v) NaCl was used as a buffer as indicated. Unless otherwise 383 \nspecified, all kits and reagents were used following manufacturer’s instructions and incubations 384 \nwere performed overnight (O/N) at 37 oC, 180 rpm.  385 \nBacterial strains 386 \nWe selected the E. coli ST131 isolates used in this study (Ecp1-I, Ecp1-II, 26-I and 26-II) based on 387 \nthe genetic context of blaCTX-M-15 (genomes deposited on Gen bank under BioProject 388 \nPRJNA1281408). All the ST131 isolates belong to clade C, the most relevant in the clinic  (79). 389 \nIsolates Ecp1-I, Ecp1-II and 26-I were chromosomally tagged with an aacC1 gene, conferring Gm 390 \nresistance, through electroporation of a Tn5 transposon plasmid pBAMD1-6 (80), followed by PCR 391 \nscreening to confirm absence of residual plasmid as well as competition experiments against the 392 \nrespective ancestral isolates to verify that tagging did not incur a fitness cost. In brief, the 393 \nmodified strains were grown together with their wildtype variants, and colony counts revealed 394 \nsimilar growth. Isolate 26-II was not genetically modified due to intrinsic Gm resistance. E. coli K-395 \n12 MG1655::mCherry (81) was used as CRISPR -Cas9 donor strain because it represses 396 \nexpression of gfp from pKJK5::csgc, which allows us to verify successful plasmid conjugation to 397 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n15 \n \nthe ST131 isolates (presence of transconjugants) by checking gfp expression. Further bacteria 398 \nand plasmid information can be found in Supplementary table 1 and 2, respectively.  399 \nDevelopment of the CRISPR-Cas9 system   400 \nTwo CRISPR-Cas9 cassettes were designed with distinct sgRNA targets. The [ blaCTX-M-15] sgRNA 401 \ntargets [CGCGTGATACCACTTCACCT]. This sequence is found within blaCTX-M-15 and followed by a 402 \nprotospacer adjacent motif (PAM) in the E. coli ST131 reference genome (82) and the genome of 403 \nthe four E. coli ST131 isolates used in the study. Furthermore, the sequence showed low  404 \npredicted CRISPR-off target  activity in both CRISPOR (83) and Cas -OFFinder (84). The non -405 \ntargeting [NT] control sgRNA targets random nucleotide sequence [GGTAAGACCATTAGAAGTAG], 406 \n20 bp which we confirmed to be absent from all E. coli ST131 isolates. These cassettes were 407 \ngenerated and transferred into pKJK5, resulting in pKJK5::csgc[ blaCTX-M-15] or [NT], following 408 \nprotocols adopted from (37) (full details in Supplementary method 1 and Supplementary table 409 \n3). 410 \nFilter mating conjugation E. coli K-12 MG1655 (donor) - E. coli ST131 (recipient) 411 \nSingle colonies of donors (MG1655 pKJK5::csgc[ blaCTX-M-15] or [NT]) and recipients ( E. coli 412 \nDH5α::SmR or the respective E. coli ST131 isolates) were grown O/N in 5 mL LB. Donors were 413 \nsupplemented with Cm to avoid segregational loss of pKJK5. Cells were washed twice in 5 mL 414 \nNaCl, followed by OD600 adjustment to 0.5 – 0.6. Recipients were diluted 100-fold in NaCl. Filter 415 \nmating was performed in a Millipore 1225 Sampling Manifold using a sterile Whatman Cyclopore 416 \nClear 0.2 µm 25mm polycarbonate membrane on top of a sterile Whatman glass microfiber filter, 417 \nbinder free, grade GF/C, 25mm. The vacuum manifold was sterilised using ethanol and UV before 418 \nand between batches. Filters were washed by pumping through 2 mL of NaCl. Straight after, 1 mL 419 \nof NaCl, 1 mL of donor and 1 mL of a 100 -fold diluted recipient were pumped through. Five 420 \nbiological replicates were performed for each donor -recipient combination. Additionally, 421 \ncontrols with donor -only, recipient -only and NaCl -only were performed and yielded re sults 422 \nconsistent with expectations, supporting the validity of the experiment. The polycarbonate filters 423 \nwere placed onto 10 % LB -agar plates and incubated for 48 h at 37 oC in the absence of 424 \nantibiotics. Filters were recovered in 3 mL NaCl and vortexed. From the cell suspension, cells 425 \nwere recovered in LB, after which differential selective plating on LB agar was used to quantify 426 \nthe proportion of 1) donors (no antibiotic selection; donors identified by assessing mCherry 427 \nexpression using a stereo fluorescent lamp (Nightsea), 2) recipients (Gm) and 3) transconjugants 428 \n(Gm + Cm). Glycerol stocks were made with the remaining cell suspensions.  429 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n16 \n \nFor each replicate, conjugation efficiency was calculated by dividing transconjugant 430 \nconcentrations (CFU/mL) by recipient concentrations (CFU/mL) and means were determined for 431 \neach isolate and treatment. For each replicate from the pKJK5::csgc[blaCTX-M-15] treatment, escape 432 \nfrequencies were calculated as a relative conjugation efficiency by dividing the conjugation 433 \nefficiency of pKJK5::csgc[blaCTX-M-15] for each replicate with the average conjugation efficiency of 434 \npKJK5::csgc[NT]. The mean escape frequency per isolate was calculated as the average of all five 435 \nbiological replicates.  436 \nRecovery of E. coli ST131 escapers ( E. coli ST131 pKJK5::csgc[blaCTX-M-15]) and phenotypic 437 \nanalysis 438 \nE. coli ST131 pKJK5::csgc[blaCTX-M-15] escapers were recovered on Gm + Cm plates and the 439 \npresence of blaCTX-M-15 was verified based on their cefotaxime resistance profile . To do so, 440 \nindividual clones were replated onto LB agar containing (i) Cm + CTX and (ii) Cm to assess the 441 \ncefotaxime phenotype while ensuring CRISPR -Cas9 plasmid maintenance. Additionally, we 442 \ngenerated glycerol stocks of escapers after O/N incubation in LB + Cm. The same procedure was 443 \nused to select for 100 transconjugants from the non -targeting treatment ( E. coli ST131 444 \npKJK5::csgc[NT]). A visual representation of the filter mating assay and the phenotypic screen of 445 \nthe escapers can be found in Supplementary figure 1. 446 \nTo calculate cefotaxime-resistant and cefotaxime-sensitive escape frequencies, the cefotaxime 447 \nresistance profiles were assessed for all escapers recovered directly from the filter mating assay 448 \nfor isolates Ecp1 -I, Ecp1 -II and 26 -I. For isolate 26 -II, due to the larger size of the escape 449 \npopulation recovered, ten escapers per replicate were randomly selected for resistance profiling. 450 \nThe proportions of each cefotaxime phenotype were then used to estimate cefotaxime-resistant 451 \nand cefotaxime-sensitive transconjugants concentrations (CFU/mL) per replicate. Conjugation 452 \nefficiencies for both phenotypes were calculated by dividing the respective transconjugant 453 \nconcentrations by the recipient concentrations for each replicate of the pKJK5::csgc[ blaCTX-M-15] 454 \ntreatment. Finally, cefotaxime -resistant and cefotaxime -sensitive escape frequencies were 455 \ncalculated as a relative conjugation efficiency by dividing the cefotaxime-resistant or cefotaxime-456 \nsensitive conjugation efficiencies of pKJK5::csgc[ blaCTX-M-15] for each replicate with the average 457 \nconjugation efficiency of pKJK5::csgc[NT]. The mean escape frequency per phenotype and 458 \nisolate was calculated as the average of all biological replicates, including those where no 459 \ncefotaxime-resistant or cefotaxime -sensitive escapers were found. Replicate 4 from isolate 460 \nEcp1-II was excluded from the calculations of cefotaxime -resistant and cefotaxime -sensitive 461 \nescape frequencies as only one escaper was directly recovered from the filter mating assay. 462 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n17 \n \nGenotypic analysis of blaCTX-M-15 463 \nPCR was used to study blaCTX-M-15 presence in escapers. To obtain enough DNA template material, 464 \nfrozen glycerol stocks of escapers were scraped with a pipette tip and the tip was swirled in 10 μL 465 \nwater to suspend attached material. The suspension was then heated to 95 oC for 15 minutes and 466 \ncentrifugated at 3.500 rpm for 5 minutes. For cefotaxime-resistant and cefotaxime -sensitive 467 \nescapers from isolates Ecp1-I and Ecp1 -II, blaCTX-M-15 presence was studied  using primers with 468 \nbinding sites  within the gene ( Supplementary figure 2A). Furthermore, for the cefotaxime-469 \nsensitive escapers primers designed to amplify IS Ecp1 + blaCTX-M-15 were also used 470 \n(Supplementary figure 2A). Phusion High-Fidelity polymerase (Thermo Scientific) was used in 471 \nboth PCRs. Additionally, ExoSAP -cleaned (NEB) PCR amplicons were Sanger sequenced. In 472 \ncefotaxime-sensitive escapers from isolate 26 -II, the deletion of the blaCTX-M-15 PCT was studied 473 \nusing primers annealing outside the PCT ( Supplementary figure 2B) with 1x VeriFi Hot Start 474 \nPolymerase (PCR Biosystems). Across PCRs, when no amplicon was found, 16S PCR or 475 \namplification of other genes were used to verify template presence. Moreover, the respective 476 \nancestral isolates and transconjugants from the non -targeting control ( pKJK5::csgc[NT]) were 477 \nused as positive controls for the presence of blaCTX-M-15. All primers can be found in 478 \nSupplementary table 3.  479 \nGenotypic analysis of CRISPR-Cas9 integrity  480 \nCefotaxime-resistant and cefotaxime-sensitive escapers from isolates Ecp1 -I and Ecp1 -II were 481 \nsubjected to a genotypic CRISPR -Cas9 integrity assay to understand whether mutations had 482 \noccurred in cas9 and/or the sgRNA. Four sets of primers generating overlapping amplicons were 483 \nused, including a region upstream of cas9 and downstream of the sgRNA. Additionally, a fifth set 484 \nwas used to specifically amplify the sgRNA (Supplementary figure 2C). PCRs were performed 485 \nusing 2x PCRBIO Taq Mix Red (PCR Biosystems). Amplicons with unexpected lengths (i.e.  486 \namplicons with an estimated length >60 bp different from the expected amplicon length) were 487 \npurified from the agarose gel using  the Monarch® DNA Gel Extraction Kit Protocol (NEB)  and 488 \nSanger sequenced. Transconjugants from the pKJK5::csgc[NT] control and the ancestral isolates 489 \nwere used as controls, and 16S amplification was used to verify template presence.  DNA 490 \ntemplate for the PCRs was obtained as described above. All primers can be found in 491 \nSupplementary table 3. 492 \nPhenotypic CRISPR-Cas9 functionality assay  493 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n18 \n \nTo check for the presence of dysfunctional CRISPR -Cas9 activity in cefotaxime -resistant 494 \nescapers from isolates Ecp1-I and Ecp1-II that showed expected lengths of csgc amplicons and, 495 \nin cefotaxime-sensitive escapers, a phenotypic CRISPR-Cas9 functionality assay was performed. 496 \nFor this assay, liquid conjugations were performed with donors harbouring either plasmid 497 \npCTX15, which we engineered to carry blaCTX-M-15, or plasmid pCTRL, which we engineered to carry 498 \na mutated version of blaCTX-M-15 that allows escape from CRISPR -Cas9 targeting through a silent 499 \npoint mutation of the PAM sequence. Specific details about plasmid engineering and the assay 500 \ncan be found in Supplementary method 1 and 2.  501 \nPhenotypic β-galactosidase assay 502 \nTo characterize the IS Ecp1 blaCTX-M-15 deletions found in cefotaxime -sensitive escapers from 503 \nisolates Ecp1-I and Ecp1-II, a phenotypic β-galactosidase assay was performed that makes use 504 \nof the proximity of blaCTX-M-15 to the lacZ gene. Individual escapers were plated onto 0.2 μg mL-1 X-505 \nGal LB-agar plates. Colonies were screened for white (β-galactosidase / lacZ-negative) or blue (β-506 \ngalactosidase / lacZ-positive) phenotypes. Cefotaxime-resistant escapers, transconjugants from 507 \nthe pKJK5::csgc[NT] control and the ancestral isolates were used as positive controls.  508 \nSequencing 509 \nWhole genome sequencing was performed to obtain genomic details of the four E. coli ST131 510 \nancestral isolates and several escapers from the CRISPR -Cas9 treatment. For the ancestral 511 \nisolates, DNA extraction was performed from LB + CTX 3 μg mL-1 ON cultures using FastDNA Spin 512 \nKit (MP Biomedicals). The extracted DNA was treated with 2 μL of RNAseA 20 mg mL -1 for 10 513 \nminutes at 37 oC and purified with SPRISelect  beads (Beckman Coulter). Sequencing libraries 514 \nwere prepared with 2 μg of purified DNA using the ONT Ligation Sequencing Kit (Oxford Nanopore 515 \nTechnologies) and long-read sequencing was performed using PromethION (Exeter Sequencing 516 \nFacility). Genomes were assembled using Unicycler (version 0.5.0) (85), with automated 517 \nannotations generated using RASTtk (86). Short-read WGS (MicrobesNG, Birmingham) was 518 \nperformed for one β-galactosidase-positive and one β-galactosidase-negative cefotaxime -519 \nsensitive escaper from isolates Ecp1 -I and Ecp1 -II. Similarly, short -read WGS (MicrobesNG, 520 \nBirmingham) was also performed for escaper 5.10 from isolate Ecp1 -II. Hybrid WGS 521 \n(MicrobesNG, Birmingham) was performed for ten cefotaxime -sensitive escapers from isolate 522 \n26-II (two per each filter mating replicate) and for one transconjugant from the pKJK5::csgc[NT] 523 \ncontrol. Genome assembly was performed using Flye (87) and the respective deletions were 524 \ncharacterized. Benchling was used for DNA visualization (88).  525 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n19 \n \nData analysis  526 \nData processing, visualisation and statistical analyses were performed in R version 4.4.2 using R 527 \nstudio 2023.9.1.494 (89). Statistical modelling was performed using package lme4 (version 1.1-528 \n37) (90). Data processing and plotting were performed using packages tidyverse (version 2.0.0) 529 \n(91), ggplot2 (version 3.5.1) (92), gggenes (version 0.5.1) (93), patchwork (version 1.3.1) (94) and 530 \ngrid (version 4.4.2) (89). Significance of fixed effects was determined through comparing nested 531 \nmodels using chi -squared tests ( α = 0.05), beginning with a global model that included all 532 \nbiologically relevant fixed effects and interaction terms. Interaction term statistical significance 533 \nwas always tested first, and where interactions were statistically significant, all constituent fixed 534 \neffects were retained in the model. R package DHARMa (version 0.4.6) (95) was used to diagnose 535 \npotential model issues. Specifically, we checked if residuals deviation were deviated from  the 536 \nexpected distribution, if the model had over or under dispersion, if the datasets contained highly 537 \ninfluential outliers, and if the residuals were heteroscedastic. Post-hoc analyses were performed 538 \nusing emmeans (version 1.10.2) (96).  539 \nConjugation efficiency of CRISPR -Cas9 and the cefotaxime -resistant and cefotaxime-sensitive 540 \nescape frequencies were modelled using binomial family generalised linear models (GLMs) and 541 \na logit link function, with the number of colonies counted for the recipients and transconjugants 542 \nas the weights value. Due to large differences in the count of transconjugants between 543 \ntreatments, concentrations of recipients and transconjugants (CFU/mL) were logarithmically 544 \ntransformed (when the dataset included zeros, log10+1 was used).  545 \nOur global model of conjugation efficiency  of CRISPR -Cas9 included the predictor variables 546 \nplasmid identity, isolate identity, and an interaction between plasmid and isolate identity. For the 547 \ncefotaxime-resistant and cefotaxime -sensitive escape frequency analyses we modelled the 548 \npredictor variable  genetic context of the blaCTX-M-15. For the cefotaxime -sensitive escape 549 \nfrequencies, model validation revealed slight deviation in the first quartile of the residuals vs 550 \npredicted plot . However, this model remained the most appropriate, and the large observed 551 \neffect sizes mean it is improbable we are drawing erroneous conclusions from this analysis. For 552 \nthe cefotaxime-resistant escape frequencies, model validation revealed some influential outliers 553 \n(replicates with no escapers) and model optimization was performed removing outliers.  554 \nFor the  phenotypic CRISPR-Cas9 functionality assay  in E. coli K-12 MG1655 carrying either 555 \npKJK5::csgc[NT] or pKJK5::csgc[ blaCTX-M-15] the relative conjugation efficiencies (pCTRL/pCTX15) 556 \nwere modelled using  a Gamma  family GLM with a log link function and  with CRISPR -Cas9 557 \nplasmid as a predictor variable. For the phenotypic CRISPR-Cas9 functionality assay with 558 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n20 \n \nescapers, the data were individually modelled for each isolate. For both datasets, pCTRL/pCTX15 559 \nwas modelled using a Gamma family GLM with a log link function, with cefotaxime phenotype as 560 \na predictor variable. Model validation revealed some heteroscedasticity for isolate Ecp1-II, which 561 \ncould be attributed to the presence of few cefotaxime -sensitive escapers with dysfunctional 562 \nCRISPR-Cas9 systems. Nevertheless, the Gamma GLM remained the most appropriate for our 563 \ndata. 564 \nDATA AVAILABILITY 565 \nThe genome of the E. coli ST131 isolates (Ecp1 -I, Ecp1 -II, 26 -I, 26 -II) were deposited in 566 \nPRJNA1281408. The assembled genomes of escapers with blaCTX-M-15 deletions from isolate s 567 \nEcp1-I, Ecp1-II and 26-II and for escaper 5.10 Ecp1-II can be found in __to be determined__. The 568 \ndata analysis can be found in GitHub __to be determined__.  All the raw data and the full escape 569 \ncharacterization can be found in the raw data excel file  in __to be determined__ . Additional 570 \nexperimental details, methods, tables and figures can be found in the online version of this 571 \narticle.  572 \nACKNOWLEDGEMENTS AND FUNDING 573 \nS.V .H. gratefully acknowledges funding from the Biotechnology and Biological Sciences Research 574 \ncouncil (BBSRC; BB/R010781/1), the Lister Institute for Preventative Medicine, and the Joint 575 \nProgramme Initiative AntiMicrobial Resistance (JPI -AMR) ‘Harissa’ call (MISTAR; 576 \nMR/W031191/1)). D.S was supported in part by grant MR/N0137941/1 for the GW4 BIOMED MRC 577 \nDTP , awarded to the Universities of Bath, Bristol, Cardiff and Exeter from the Medical Research 578 \nCouncil (MRC)/UKRI. Genome sequencing of the ST131 isolates was supported by funding from 579 \nthe Natural Environment Research Council awarded to AFCL (award number NE/R013748/1) and 580 \nutilised equipment funded by the UK Medical Research Council (MRC) Clinical Research 581 \nInfrastructure Initiative (award number MR/M008924/1) . For the purpose of open access, the 582 \nauthor has applied a ‘Creative Commons Attribution (CC BY) licence to any Author Accepted 583 \nManuscript version arising from this submission.   584 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n21 \n \nBibliography  585 \n1. Naghavi M, Vollset SE, Ikuta KS, Swetschinski LR, Gray AP , Wool EE, et al. Global burden of 586 \nbacterial antimicrobial resistance 1990 –2021: a systematic analysis with forecasts to 587 \n2050. The Lancet. 2024 Sep 28;404(10459):1199–226.  588 \n2. Dadgostar P . Antimicrobial Resistance: Implications and Costs. Infect Drug Resist. 2019 589 \nDec 20;Volume 12:3903–10.  590 \n3. Haney EF , Hancock REW. Addressing Antibiotic Failure —Beyond Genetically Encoded 591 \nAntimicrobial Resistance. Front Drug Discov. 2022;2:892975.  592 \n4. Murray CJ, Ikuta KS, Sharara F , Swetschinski L, Robles Aguilar G, Gray A, et al. Global 593 \nburden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet. 594 \n2022;399(10325):629–55.  595 \n5. World Health Organization. Prioritization of pathogens to guide discovery, research and 596 \ndevelopment of new antibiotics for drug -resistant bacterial infections, including 597 \ntuberculosis. 2017.  598 \n6. Poolman JT, Wacker M. Extraintestinal Pathogenic Escherichia coli, a Common Human 599 \nPathogen: Challenges for Vaccine Development and Progress in the Field. J Infect Dis. 600 \n2016 Jan 1;213(1):6–13.  601 \n7. Daga AP , Koga VL, Soncini JGM, de Matos CM, Perugini MRE, Pelisson M, et al. Escherichia 602 \ncoli Bloodstream Infections in Patients at a University Hospital: Virulence Factors and 603 \nClinical Characteristics. Front Cell Infect Microbiol. 2019 Jun 6;9:191.  604 \n8. Manges AR, Geum HM, Guo A, Edens TJ, Fibke CD, Pitout JDD. Global Extraintestinal 605 \nPathogenic Escherichia coli (ExPEC) Lineages. Clin Microbiol Rev. 2019 Jun 606 \n12;32(3):e00135-18.  607 \n9. Rogers BA, Sidjabat HE, Paterson DL. Escherichia coli O25b -ST131: a pandemic, 608 \nmultiresistant, community-associated strain. J Antimicrob Chemother. 2011 Jan;66(1):1–609 \n14.  610 \n10. Johnson JR, Johnston B, Clabots C, Kuskowski MA, Castanheira M. Escherichia coli 611 \nsequence type ST131 as the major cause of serious multidrug -resistant E. coli infections 612 \nin the United States. Clin Infect Dis. 2010 Aug 1;51(3):286–94.  613 \n11. Pitout JDD, Finn TJ. The evolutionary puzzle of Escherichia coli ST131. Infect Genet Evol. 614 \n2020 Jul;81:104265.  615 \n12. Cantón R, Coque TM. The CTX -M beta-lactamase pandemic. Curr Opin Microbiol. 2006 616 \nOct;9(5):466–75.  617 \n13. Nicolas-Chanoine MH, Bertrand X, Madec JY . Escherichia coli ST131, an intriguing clonal 618 \ngroup. Clin Microbiol Rev. 2014 Jul;27(3):543–74.  619 \n14. Cantón R, González -Alba JM, Galán JC. CTX-M Enzymes: Origin and Diffusion. Front 620 \nMicrobiol. 2012 Apr 2;3:110.  621 \n15. Rossolini GM, D’Andrea MM, Mugnaioli C. The spread of CTX-M-type extended-spectrum 622 \nbeta-lactamases. Clin Microbiol Infect. 2008 Jan 1;14(Suppl 1):33–41.  623 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n22 \n \n16. Siguier P , Gourbeyre E, Chandler M. Bacterial insertion sequences: their genomic impact 624 \nand diversity. FEMS Microbiol Rev. 2014 Sep;38(5):865–91.  625 \n17. Zhao WH, Hu ZQ. Epidemiology and genetics of CTX-M extended-spectrum β-lactamases 626 \nin Gram-negative bacteria. Crit Rev Microbiol. 2013 Feb;39(1):79–101.  627 \n18. Partridge SR, Kwong SM, Firth N, Jensen SO. Mobile Genetic Elements Associated with 628 \nAntimicrobial Resistance. Clin Microbiol Rev. 2018 Aug 1;31(4):e00088-17.  629 \n19. Mahillon J, Chandler M. Insertion sequences. Microbiol Mol Biol Rev. 1998 Sep;62(3):725–630 \n74.  631 \n20. Pitout JDD, Chen L. The Significance of Epidemic Plasmids in the Success of Multidrug -632 \nResistant Drug Pandemic Extraintestinal Pathogenic Escherichia coli. Infect Dis Ther. 2023 633 \nApr;12(4):1029–41.  634 \n21. Woodford N, Carattoli A, Karisik E, Underwood A, Ellington MJ, Livermore DM. Complete 635 \nnucleotide sequences of plasmids pEK204, pEK499, and pEK516, encoding CTX -M 636 \nenzymes in three major Escherichia coli lineages from the United Kingdom, all belonging 637 \nto the international O25:H4 -ST131 clone. Antimicrob Agents Chemother. 2009 638 \nOct;53(10):4472–82.  639 \n22. Pajand O, Rahimi H, Darabi N, Roudi S, Ghassemi K, Aarestrup FM, et al. Arrangements of 640 \nMobile Genetic Elements among Virotype E Subpopulation of Escherichia coli Sequence 641 \nType 131 Strains with High Antimicrobial Resistance and Virulence Gene Content. 642 \nmSphere. 2021 Aug 25;6(4):e0055021.  643 \n23. Varani A, He S, Siguier P , Ross K, Chandler M. The IS6 family, a clinically important group 644 \nof insertion sequences including IS26. Mob DNA. 2021 Mar;23;12(1):11.  645 \n24. Harmer CJ, Hall RM. IS26 and the IS26 family: versatile resistance gene movers and 646 \ngenome reorganizers. Microbiol Mol Biol Rev. 2024 Jun 27;88(2):e0011922.  647 \n25. Can F , Azap OK, Seref C, Ispir P , Arslan H, Ergonul O. Emerging Escherichia coli 648 \nO25b/ST131 clone predicts treatment failure in urinary tract infections. Clin Infect Dis. 649 \n2015 Feb 15;60(4):523–7.  650 \n26. Syre H, Hetland MAK, Bernhoff E, Bollestad M, Grude N, Simonsen GS, et al. Microbial risk 651 \nfactors for treatment failure of pivmecillinam in community -acquired urinary tract 652 \ninfections caused by ESBL-producing Escherichia coli. APMIS. 2020 Mar;128(3):232–41.  653 \n27. Pursey E, Sünderhauf D, Gaze WH, Westra ER, van Houte S. CRISPR -Cas antimicrobials: 654 \nChallenges and future prospects. PLoS Pathog. 2018 Jun 1;14(6):e1006990.  655 \n28. Mayorga-Ramos A, Zúñiga -Miranda J, Carrera-Pacheco SE, Barba -Ostria C, Guamán LP . 656 \nCRISPR-Cas-Based Antimicrobials: Design, Challenges, and Bacterial Mechanisms of 657 \nResistance. ACS Infect Dis. 2023 Jul 14;9(7):1283–302.  658 \n29. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual-659 \nRNA-guided DNA endonuclease in adaptive bacterial immunity. Science (1979). 2012 Aug 660 \n17;337(6096):816–21.  661 \n30. Jiang F , Doudna JA. CRISPR-Cas9 Structures and Mechanisms. Annu Rev Biophys. 2017 662 \nMay 22;46:505–29.  663 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n23 \n \n31. Xue C, Greene EC. DNA Repair Pathway Choices in CRISPR -Cas9-Mediated Genome 664 \nEditing. Trends Genet. 2021 Jul;37(7):639–56.  665 \n32. Citorik RJ, Mimee  M, Lu TK. Sequence -specific antimicrobials using efficiently delivered 666 \nRNA-guided nucleases. Nat Biotechnol. 2014 Nov;32(11):1141–5.  667 \n33. Cui L, Bikard D. Consequences of Cas9 cleavage in the chromosome of Escherichia coli. 668 \nNucleic Acids Res. 2016 May 19;44(9):4243–51.  669 \n34. Bikard D, Euler CW, Jiang W, Nussenzweig PM, Goldberg GW, Duportet X, et al. Exploiting 670 \nCRISPR-Cas nucleases to produce sequence -specific antimicrobials. Nat Biotechnol. 671 \n2014 Nov;32(11):1146–50.  672 \n35. Uribe R V ., Rathmer C, Jahn LJ, Ellabaan MMH, Li SS, Sommer MOA. Bacterial resistance 673 \nto CRISPR-Cas antimicrobials. Sci Rep. 2021 Dec 1;11(1):17267.  674 \n36. Reuter A, Hilpert C, Dedieu -Berne A, Lematre S, Gueguen E, Launay G, et al. Targeted -675 \nantibacterial-plasmids (TAPs) combining conjugation and CRISPR/Cas systems achieve 676 \nstrain-specific antibacterial activity. Nucleic Acids Res. 2021 Apr 6;49(6):3584–98.  677 \n37. Sünderhauf D, Klümper U, Pursey E, Westra ER, Gaze WH, van Houte S. Removal of AMR 678 \nplasmids using a mobile, broad host -range CRISPR -Cas9 delivery tool. Microbiology 679 \n(Reading). 2023 May;169(5):001334.  680 \n38. Leonard AFC, Zhang L, Balfour AJ, Garside R, Hawkey PM, Murray AK, et al. Exposure to and 681 \ncolonisation by antibiotic -resistant E. coli in UK coastal water users: Environmental 682 \nsurveillance, exposure assessment, and epidemiological study (Beach Bum Survey). 683 \nEnviron Int. 2018 May;114:326–33.  684 \n39. Paterson DL, Bonomo RA. Extended -Spectrum β-Lactamases: a Clinical Update. Clin 685 \nMicrobiol Rev. 2005 Oct;18(4):657–86.  686 \n40. Jinek M, Jiang F , Taylor DW, Sternberg SH, Kaya E, Ma E, et al. Structures of Cas9 687 \nEndonucleases Reveal RNA -Mediated Conformational Activation. Science (1979). 2014 688 \nMar 14;343(6176):1247997–1247997.  689 \n41. Sihra N, Goodman A, Zakri R, Sahai A, Malde S. Nonantibiotic prevention and management 690 \nof recurrent urinary tract infection. Nat Rev Urol. 2018 Dec;15(12):750–76.  691 \n42. Durrani B, Mohammad A, Ljubetic BM, Dobberfuhl AD. The Potential Role of Persister Cells 692 \nin Urinary Tract Infections. Curr Urol Rep. 2023 Nov;24(11):541–51.  693 \n43. Reid G, Bruce AW. Probiotics to prevent urinary tract infections: the rationale and 694 \nevidence. World J Urol. 2006 Feb;24(1):28–32.  695 \n44. Gupta V , Nag D, Garg P . Recurrent Urinary Tract Infections in Women: How Promising is the 696 \nUse of Probiotics? Indian J Med Microbiol. 2017 Jul 1;35(3):347–54.  697 \n45. Jiang W, Bikard D, Cox D, Zhang F , Marraffini LA. RNA-guided editing of bacterial genomes 698 \nusing CRISPR-Cas systems. Nat Biotechnol. 2013 Jan 29;31(3):233–9.  699 \n46. Neil K, Allard N, Roy P , Grenier F , Menendez A, Burrus V , et al. High‐efficiency delivery of 700 \nCRISPR‐Cas9 by engineered probiotics enables precise microbiome editing. Mol Syst Biol. 701 \n2021 Oct;17(10):e10335.  702 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n24 \n \n47. Hamilton TA, Pellegrino GM, Therrien JA, Ham DT, Bartlett PC, Karas BJ, et al. Efficient inter-703 \nspecies conjugative transfer of a CRISPR nuclease for targeted bacterial killing. Nat 704 \nCommun. 2019 Oct 4;10(1):4544.  705 \n48. Gomaa AA, Klumpe HE, Luo ML, Selle K, Barrangou R, Beisel CL. Programmable removal 706 \nof bacterial strains by use of genome - targeting CRISPR -cas systems. mBio. 2014 Jan 707 \n28;5(1):e00928-13.  708 \n49. Vercoe RB, Chang JT, Dy RL, Taylor C, Gristwood T, Clulow JS, et al. Cytotoxic 709 \nChromosomal Targeting by CRISPR/Cas Systems Can Reshape Bacterial Genomes and 710 \nExpel or Remodel Pathogenicity Islands. PLoS Genet. 2013 Apr;9(4):e1003454.  711 \n50. Li Q, Sun M, Lv L, Zuo Y , Zhang S, Zhang Y , et al. Improving the Editing Efficiency of CRISPR-712 \nCas9 by Reducing the Generation of Escapers Based on the Surviving Mechanism. ACS 713 \nSynth Biol. 2023 Mar 17;12(3):672–80.  714 \n51. Aparicio T, de Lorenzo V , Martínez-García E. CRISPR/Cas9-Based Counterselection Boosts 715 \nRecombineering Efficiency in Pseudomonas putida. Biotechnol J. 2018 716 \nMay;13(5):e1700161.  717 \n52. Sheng Y , Wang H, Ou Y , Wu Y , Ding W, Tao M, et al. Insertion sequence transposition 718 \ninactivates CRISPR-Cas immunity. Nat Commun. 2023 Jul 20;14(1):4366.  719 \n53. Wang R, Shu X, Zhao H, Xue Q, Liu C, Wu A, et al. Associate toxin -antitoxin with CRISPR-720 \nCas to kill multidrug-resistant pathogens. Nat Commun. 2023 Apr 12;14(1):2078.  721 \n54. Kang YK, Kwon K, Ryu JS, Lee HN, Park C, Chung HJ. Nonviral Genome Editing Based on a 722 \nPolymer-Derivatized CRISPR Nanocomplex for Targeting Bacterial Pathogens and 723 \nAntibiotic Resistance. Bioconjug Chem. 2017 Apr 19;28(4):957–67.  724 \n55. Cyriaque V , Ibarra-Chávez R, Kuchina A, Seelig G, Nesme J, Madsen JS. Single-cell RNA 725 \nsequencing reveals plasmid constrains bacterial population heterogeneity and identifies 726 \na non-conjugating subpopulation. Nat Commun. 2024;15:5853.  727 \n56. Moreb EA, Hoover B, Yaseen A, Valyasevi N, Roecker Z, Menacho-Melgar R, et al. Managing 728 \nthe SOS Response for Enhanced CRISPR -Cas-Based Recombineering in E. coli through 729 \nTransient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Dec 15;6(12):2209–18.  730 \n57. Vialetto E, Miele S, Goren MG, Yu J, Yu Y , Collias D, et al. Systematic interrogation of CRISPR 731 \nantimicrobials in Klebsiella pneumoniae reveals nuclease-, guide- and strain-dependent 732 \nfeatures influencing antimicrobial activity. Nucleic Acids Res. 2024 Jun 10;52(10):6079 –733 \n91.  734 \n58. Collias D, Vialetto E, Yu J, Co K, Almási É d. H, Rüttiger AS, et al. Systematically attenuating 735 \nDNA targeting enables CRISPR -driven editing in bacteria. Nat Commun. 2023 Feb 736 \n8;14(1):680.  737 \n59. Moreb EA, Hoover B, Yaseen A, Valyasevi N, Roecker Z, Menacho-Melgar R, et al. Managing 738 \nthe SOS Response for Enhanced CRISPR -Cas-Based Recombineering in E. coli through 739 \nTransient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Dec 15;6(12):2209–18.  740 \n60. Harmer CJ, Hall RM. IS26 -Mediated Formation of Transposons Carrying Antibiotic 741 \nResistance Genes. mSphere. 2016 Apr 6;1(2):e00038-16.  742 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n25 \n \n61. Harmer CJ, Hall RM. IS26 -Mediated Precise Excision of the IS26 -aphA1a Translocatable 743 \nUnit. mBio. 2015 Dec 8;6(6):e01866-15.  744 \n62. Aihara M, Gotoh Y , Shirahama S, Matsushima Y , Uchiumi T, Kang D, et al. Generation and 745 \nmaintenance of the circularized multimeric IS26-associated translocatable unit encoding 746 \nmultidrug resistance. Commun Biol. 2024;7:597.  747 \n63. Harmer CJ, Moran RA, Hall RM. Movement of IS26-associated antibiotic resistance genes 748 \noccurs via a translocatable unit that includes a single IS26 and preferentially inserts 749 \nadjacent to another IS26. mBio. 2014 Oct 7;5(5):e01801-14.  750 \n64. Harmer CJ, Moran RA, Hall RM. Movement of IS26-Associated Antibiotic Resistance Genes 751 \nOccurs via a Translocatable Unit That Includes a Single IS26 and Preferentially Inserts 752 \nAdjacent to Another IS26. mBio. 2014 Oct 7;5(5).  753 \n65. Wang P , Du X, Zhao Y , Wang W, Cai T, Tang K, et al. Combining CRISPR/Cas9 and natural 754 \nexcision for the precise and complete removal of mobile genetic elements in bacteria. 755 \nAppl Environ Microbiol. 2024 Apr 1;90(4):e0009524.  756 \n66. Raeside C, Gaffé J, Deatherage DE, Tenaillon O, Briska AM, Ptashkin RN, et al. Large 757 \nchromosomal rearrangements during a long-term evolution experiment with Escherichia 758 \ncoli. mBio. 2014 Sep 9;5(5):e01377-14.  759 \n67. He S, Hickman AB, Varani AM, Siguier P , Chandler M, Dekker JP , et al. Insertion Sequence 760 \nIS26 Reorganizes Plasmids in Clinically Isolated Multidrug -Resistant Bacteria by 761 \nReplicative Transposition. mBio. 2015 Jun 9;6(3):e00762.  762 \n68. Poirel L, Decousser JW, Nordmann P . Insertion Sequence ISEcp1B Is Involved in Expression 763 \nand Mobilization of a blaCTX-M β-Lactamase Gene. Antimicrob Agents Chemother. 2003 764 \nSep;47(9):2938–45.  765 \n69. Zong Z, Partridge SR, Iredell JR. ISEcp1 -Mediated Transposition and Homologous 766 \nRecombination Can Explain the Context of blaCTX -M-62 Linked to qnrB2. Antimicrob 767 \nAgents Chemother. 2010 Jul;54(7):3039–42.  768 \n70. Poirel L, Lartigue MF , Decousser JW, Nordmann P . ISEcp1B -Mediated Transposition of 769 \nblaCTX-M in Escherichia coli. Antimicrob Agents Chemother. 2005 Jan;49(1):447–50.  770 \n71. Wachino JI, Yamane K, Kimura K, Shibata N, Suzuki S, Ike Y , et al. Mode of Transposition 771 \nand Expression of 16S rRNA Methyltransferase Gene rmtC Accompanied by ISEcp1. 772 \nAntimicrob Agents Chemother. 2006 Sep;50(9):3212–5.  773 \n72. Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP , et al. Repurposing 774 \nCRISPR as an RNA -Guided Platform for Sequence -Specific Control of Gene Expression. 775 \nCell. 2013 Feb 28;152(5):1173–83.  776 \n73. Selle K, Klaenhammer TR, Barrangou R. CRISPR -based screening of genomic island 777 \nexcision events in bacteria. Proc Natl Acad Sci U S A. 2015 Jun 30;112(26):8076–81.  778 \n74. Guan J, Wang W, Sun B. Chromosomal Targeting by the Type III-A CRISPR-Cas System Can 779 \nReshape Genomes in Staphylococcus aureus. mSphere. 2017 Nov 15;2(6):e00403-17.  780 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n26 \n \n75. Lam KN, Spanogiannopoulos P , Soto -Perez P , Alexander M, Nalley MJ, Bisanz JE, et al. 781 \nPhage-delivered CRISPR-Cas9 for strain-specific depletion and genomic deletions in the 782 \ngut microbiome. Cell Rep. 2021 Nov 2;37(5):109930.  783 \n76. Cañez C, Selle K, Goh YJ, Barrangou R. Outcomes and characterization of chromosomal 784 \nself-targeting by native CRISPR -Cas systems in Streptococcus thermophilus. FEMS 785 \nMicrobiol Lett. 2019 May 1;366(9):fnz105.  786 \n77. Hu J, Crickard JB. All who wander are not lost: the search for homology during homologous 787 \nrecombination. Biochem Soc Trans. 2024 Feb 28;52(1):367–77.  788 \n78. Wang P , Du X, Zhao Y , Wang W, Cai T, Tang K, et al. Combining CRISPR/Cas9 and natural 789 \nexcision for the precise and complete removal of mobile genetic elements in bacteria. 790 \nAppl Environ Microbiol. 2024 Apr 17;90(4):e0009524.  791 \n79. Kocsis B, Gulyás D, Szabó D. Emergence and Dissemination of Extraintestinal Pathogenic 792 \nHigh-Risk International Clones of Escherichia coli. Life (Basel). 2022 Dec 10;12(12):2077.  793 \n80. Martínez-García E, Aparicio T, de Lorenzo V , Nikel PI. New transposon tools tailored for 794 \nmetabolic engineering of Gram-negative microbial cell factories. Front Bioeng Biotechnol. 795 \n2014 Oct 28;2:46.  796 \n81. Klümper U, Riber L, Dechesne A, Sannazzarro A, Hansen LH, Sørensen SJ, et al. Broad host 797 \nrange plasmids can invade an unexpectedly diverse fraction of a soil bacterial community. 798 \nISME J. 2015;9(4):934–45.  799 \n82. Forde BM, Ben Zakour NL, Stanton -Cook M, Phan MD, Totsika M, Peters KM, et al. The 800 \nComplete Genome Sequence of Escherichia coli EC958: A High Quality Reference 801 \nSequence for the Globally Disseminated Multidrug Resistant E. coli O25b:H4 -ST131 802 \nClone. PLoS One. 2014 Aug 15;9(8):e104400.  803 \n83. Concordet JP , Haeussler M. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome 804 \nediting experiments and screens. Nucleic Acids Res. 2018 Jul 2;46(W1):W242–5.  805 \n84. Bae S, Park J, Kim JS. Cas -OFFinder: a fast and versatile algorithm that searches for 806 \npotential off-target sites of Cas9 RNA -guided endonucleases. Bioinformatics. 2014 May 807 \n15;30(10):1473–5.  808 \n85. Wick RR, Judd LM, Gorrie CL, Holt KE. Unicycler: Resolving bacterial genome assemblies 809 \nfrom short and long sequencing reads. PLoS Comput Biol. 2017 Jun 1;13(6):e1005595.  810 \n86. Brettin T, Davis JJ, Disz T, Edwards RA, Gerdes S, Olsen GJ, et al. RASTtk : A modular and 811 \nextensible implementation of the RAST algorithm for building custom annotation pipelines 812 \nand annotating batches of genomes. Sci Rep. 2015 Feb 10;5:8365.  813 \n87. Kolmogorov M, Yuan J, Lin Y , Pevzner PA. Assembly of long, error-prone reads using repeat 814 \ngraphs. Nat Biotechnol. 2019 May;37(5):540–6.  815 \n88. [Biology Software]. Benchling [Internet]. 2024. Available from: https://benchling.com 816 \n89. Posit team. RStudio: Integrated Development Environment for R [Internet]. Boston, MA: 817 \nPosit Software, PBC; 2023. Available from: http://www.posit.co/ 818 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint \n\n27 \n \n90. Bates D, Mächler M, Bolker BM, Walker SC. Fitting Linear Mixed -Effects Models Using 819 \nlme4. J Stat Softw [Internet]. 2015 Oct 7;67(1):1 –48. Available from: 820 \nhttps://www.jstatsoft.org/article/view/v067i01 821 \n91. Wickham H, Averick M, Bryan J, Chang W, D’ L, Mcgowan A, et al. Welcome to the 822 \nTidyverse. J Open Source Softw [Internet]. 2019 Nov 21;4(43):1686. Available from: 823 \nhttps://joss.theoj.org/papers/10.21105/joss.01686 824 \n92. Hadley Wickham. ggplot2: Elegant Graphics for Data Analysis [Internet]. Springer -Verlag 825 \nNew York; 2016. Available from: https://ggplot2.tidyverse.org 826 \n93. David Wilkins. gggenes: Draw Gene Arrow Maps in “ggplot2” [Internet]. 2020. Available 827 \nfrom: https://CRAN.R-project.org/package=gggenes 828 \n94. Thomas Lin Pedersen. patchwork: The Composer of Plots [Internet]. 2025. Available from: 829 \nhttps://patchwork.data-imaginist.com 830 \n95. Hartig F . DHARMa: Residual Diagnostics for Hierarchical (Multi-Level / Mixed) Regression 831 \nModels. CRAN: Contributed Packages. 2016.  832 \n96. Lenth R V . emmeans: Estimated Marginal Means, aka Least -Squares Means. CRAN: 833 \nContributed Packages. 2017.  834 \n  835 \n.CC-BY 4.0 International licensemade available under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is \nThe copyright holder for this preprintthis version posted August 6, 2025. ; https://doi.org/10.1101/2025.08.04.668416doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}