{"paper_id":"23a27aaa-e740-4303-9187-06b4a5444d20","body_text":"Using bar-seq as a proxy to study population... | F1000Research <!-- --> <!-- --> <!-- This is commented out to fix display problems on mobile devices. We may use it again once we implement a responsive design that supports native device resolutions. --> \"use strict\";function _typeof(t){return(_typeof=\"function\"==typeof Symbol&&\"symbol\"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&\"function\"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?\"symbol\":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement(\"iframe\");r.style.cssText=\"display:none\",r.name=\"__tcfapiLocator\",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&\"boolean\"==typeof n[3]&&(e=n[3],\"function\"==typeof n[2]&&n[2](\"set\",!0)):\"ping\"===n[0]?\"function\"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:\"stub\"}):o.push(n)},n.addEventListener(\"message\",(function(t){var e=\"string\"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n=\"object\"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,\"*\")}),n.parameter)}),!1))};\"undefined\"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:[\"bam.nr-data.net\"]}}; ;NREUM.loader_config={accountID:\"438030\",trustKey:\"438030\",agentID:\"772317073\",licenseKey:\"97f8f67f26\",applicationID:\"772317073\"} ;NREUM.info={beacon:\"bam.nr-data.net\",errorBeacon:\"bam.nr-data.net\",licenseKey:\"97f8f67f26\",applicationID:\"772317073\",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{\"use strict\";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error(\"All info objects require an agent identifier!\");if(!a[e])throw new Error(\"Info for \".concat(e,\" was never set\"));return a[e]}function c(e,t){if(!e)throw new Error(\"All info objects require an agent identifier!\");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],\"info\")}var u=r(7056);const d=()=>{const e={blockSelector:\"[data-nr-block]\",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:\"*\",maskAllInputs:!0,get blockClass(){return\"nr-block\"},get ignoreClass(){return\"nr-ignore\"},get maskTextClass(){return\"nr-mask\"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=\",\".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error(\"All configuration objects require an agent identifier!\");if(!f[e])throw new Error(\"Configuration for \".concat(e,\" was never set\"));return f[e]}function h(e,t){if(!e)throw new Error(\"All configuration objects require an agent identifier!\");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],\"config\")}function g(e,t){if(!e)throw new Error(\"All configuration objects require an agent identifier!\");var r=l(e);if(r){for(var n=t.split(\".\"),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||\"object\"!=typeof e)return(0,n.Z)(\"Setting a Configurable requires an object as input\");if(!t||\"object\"!=typeof t)return(0,n.Z)(\"Setting a Configurable requires a model to set its initial properties\");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{\"object\"==typeof e[a]&&\"object\"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)(\"An error occurred while setting a property of a Configurable\",e)}return r}catch(e){(0,n.Z)(\"An error occured while setting a Configurable\",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n=\"1.236.0\",i=\"PROD\",o=\"CDN\"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n=\"undefined\"!=typeof window&&!!window.document,i=\"undefined\"!=typeof WorkerGlobalScope&&(\"undefined\"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||\"undefined\"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:\"undefined\"!=typeof WorkerGlobalScope&&(\"undefined\"!=typeof self&&self instanceof WorkerGlobalScope&&self||\"undefined\"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=\"\"+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&\"undefined\"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\\s](\\d+\\.\\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:\"\",ee:void 0};class o{constructor(e){try{if(\"object\"!=typeof e)return(0,n.Z)(\"shared context requires an object as input\");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)(\"An error occured while setting SharedContext\",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:\"\",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:\"feature\";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s=\"nr@context\";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&\"object\"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;f<d;f++)s[f].apply(a,r);var l=T()[c[e]];return l&&l.push([p,e,r,a]),a}}function b(e,t){n[e]=w(e).concat(t)}function y(e,t){var r=n[e];if(r)for(var i=0;i {r.d(t,{E:()=>n,p:()=>i});var n=r(2177).ee.get(\"handle\");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o=\"feature\"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener(\"test\",null,e),n._A.removeEventListener(\"test\",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i=\"xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx\";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split(\"\").map((e=>\"x\"===e?o(t,++r).toString(16):\"y\"===e?(3&o()|8).toString(16):e)).join(\"\")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n=\"NRBA\",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||\"\").indexOf(\"data:\"))return{protocol:\"data\"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement(\"a\"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split(\"://\");!o.port&&a[1]&&(o.port=a[1].split(\"/\")[0].split(\"@\").pop().split(\":\")[1]),o.port&&\"0\"!==o.port||(o.port=\"https\"===a[0]?\"443\":\"80\"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],\"/\"!==o.pathname.charAt(0)&&(o.pathname=\"/\"+o.pathname);var s=!t.protocol||\":\"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),\"/\"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){\"function\"==typeof console.warn&&(console.warn(\"New Relic: \".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&\"object\"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)(\"feat-\"+t,[],void 0,e,r):(0,i.p)(\"block-\"+t,[],void 0,e,r),(0,i.p)(\"rumresp-\"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)(\"feat-\"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)(\"rumresp-\"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if(\"object\"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit(\"internal-error\",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return\"undefined\"==typeof document||\"complete\"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)(\"load\",e,t)}function a(e){if(i())return e();(0,n.iz)(\"DOMContentLoaded\",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:\"bam.nr-data.net\",errorBeacon:\"bam.nr-data.net\"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)(\"visibilitychange\",(function(){if(t)return void(\"hidden\"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i=\"nr@original\";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n=\"\");var a,s,c,u=\"-\"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,\"fetch\",y),t.on(y+\"end\",(function(e,r){var n=this;if(r){var i=r.headers.get(\"content-length\");null!==i&&(n.rxSize=i),t.emit(y+\"done\",[null,r],n)}else t.emit(y+\"done\",[e],n)})),t}const O={},j=[\"pushState\",\"replaceState\"];function S(e){const t=function(e){return(e||n.ee).get(\"history\")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,\"-\")),t}var P=r(3239);const C={},R=[\"appendChild\",\"insertBefore\",\"replaceChild\"];function I(e){const t=function(e){return(e||n.ee).get(\"jsonp\")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\\.([^.]+)/,a=/^(\\w+)(\\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,\"dom-\"),t.on(\"dom-start\",(function(e){!function(e){if(!e||\"string\"!=typeof e.nodeName||\"script\"!==e.nodeName.toLowerCase())return;if(\"function\"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if(\"function\"!=typeof u.parent[u.key])return;var d={};function f(){t.emit(\"jsonp-end\",[],d),e.removeEventListener(\"load\",f,(0,P.m$)(!1)),e.removeEventListener(\"error\",l,(0,P.m$)(!1))}function l(){t.emit(\"jsonp-error\",[],d),t.emit(\"jsonp-end\",[],d),e.removeEventListener(\"load\",f,(0,P.m$)(!1)),e.removeEventListener(\"error\",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],\"cb-\",d),e.addEventListener(\"load\",f,(0,P.m$)(!1)),e.addEventListener(\"error\",l,(0,P.m$)(!1)),t.emit(\"new-jsonp\",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get(\"mutation\")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,\"fn-\")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get(\"promise\")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,\"executor-\",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,\"name\",{value:\"Promise\"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),[\"all\",\"race\"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a(\"all\"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit(\"propagate\",[null,!i],o,!1,!1),i=i||!e}}}})),[\"resolve\",\"reject\"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit(\"propagate\",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,[\"onreadystatechange\"],\"fn-\",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit(\"xhr-resolved\",[],e)),i.inPlace(e,f,\"fn-\",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,\"-xhr-\",E),r.on(\"send-xhr-start\",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on(\"open-xhr-start\",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on(\"fn-end\",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i=\"nr@seenError\"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i=\"sm\",o=\"cm\",a=\"storeSupportabilityMetrics\",s=\"storeEventMetrics\"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i=\"firstbyte\",o=\"domcontent\",a=\"windowload\"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i=\"bstResource\",o=\"resource\",a=\"-start\",s=\"-end\",c=\"fn\"+a,u=\"fn\"+s,d=\"pushState\"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=[\"click\",\"submit\",\"keypress\",\"keydown\",\"keyup\",\"change\"],a=999,s=\"fn-start\",c=\"fn-end\",u=\"cb-start\",d=\"api-ixn-\",f=\"remaining\",l=\"interaction\",h=\"spaNode\",g=\"jsonpNode\",p=\"fetch-start\",m=\"fetch-done\",v=\"fetch-body-\",b=\"jsonp-end\",y=n.Yu.ST,w=\"-start\",x=\"-end\",A=\"-body\",E=\"cb\"+x,T=\"jsTime\",_=\"fetch\"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();[\"setErrorHandler\",\"finished\",\"addToTrace\",\"inlineHit\",\"addRelease\",\"addPageAction\",\"setCurrentRouteName\",\"setPageViewName\",\"setCustomAttribute\",\"interaction\",\"noticeError\",\"setUserId\"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,\"api\");const h={};var g=a.ee.get(e),p=g.get(\"tracer\"),m=\"api-\",v=m+\"ixn-\";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?\"session\":void 0)(t,r)}function y(){}[\"setErrorHandler\",\"finished\",\"addToTrace\",\"inlineHit\",\"addRelease\"].forEach((e=>h[e]=x(m,e,!0,\"api\"))),h.addPageAction=x(m,\"addPageAction\",!0,n.D.pageAction),h.setCurrentRouteName=x(m,\"routeName\",!0,n.D.spa),h.setPageViewName=function(t,r){if(\"string\"==typeof t)return\"/\"!==t.charAt(0)&&(t=\"/\"+t),(0,i.OP)(e).customTransaction=(r||\"http://custom.transaction\")+t,x(m,\"setPageViewName\",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if(\"string\"==typeof e){if([\"string\",\"number\"].includes(typeof t)||null===t)return b(e,t,\"setCustomAttribute\",r);(0,f.Z)(\"Failed to execute setCustomAttribute.\\nNon-null value must be a string or number type, but a type of was provided.\"))}else(0,f.Z)(\"Failed to execute setCustomAttribute.\\nName must be a string type, but a type of was provided.\"))},h.setUserId=function(e){if(\"string\"==typeof e||null===e)return b(\"enduser.id\",e,\"setUserId\",!0);(0,f.Z)(\"Failed to execute setUserId.\\nNon-null value must be a string type, but a type of was provided.\"))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a=\"function\"==typeof t;return(0,o.p)(v+\"tracer\",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?\"\":\"no-\")+\"fn-start\",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit(\"fn-err\",[arguments,this,\"string\"==typeof e?new Error(e):e],r),e}finally{p.emit(\"fn-end\",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,[\"API/\"+t+\"/called\"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,\"api\")})).catch((()=>(0,f.Z)(\"Downloading runtime APIs failed...\")))}return[\"actionText\",\"setName\",\"setAttribute\",\"save\",\"ignore\",\"onEnd\",\"getContext\",\"end\",\"get\"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){\"string\"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,[\"API/noticeError/called\"],void 0,n.D.metrics,g),(0,o.p)(\"err\",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,\"api\"),(0,h.Qy)(e,A,\"exposed\"),(0,h.EZ)(\"activatedFeatures\",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:\"ajax\",jserrors:\"jserrors\",metrics:\"metrics\",pageAction:\"page_action\",pageViewEvent:\"page_view_event\",pageViewTiming:\"page_view_timing\",sessionReplay:\"session_replay\",sessionTrace:\"session_trace\",spa:\"spa\"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:\"page_action-aggregate\",147:\"metrics-aggregate\",242:\"session-manager\",317:\"jserrors-aggregate\",348:\"page_view_timing-aggregate\",412:\"lazy-feature-loader\",439:\"async-api\",538:\"recorder\",590:\"session_replay-aggregate\",675:\"compressor\",733:\"session_trace-aggregate\",786:\"page_view_event-aggregate\",873:\"spa-aggregate\",898:\"ajax-aggregate\"}[e]||e)+\".\"+{78:\"ac76d497\",147:\"3dc53903\",148:\"1a20d5fe\",242:\"2a64278a\",317:\"49e41428\",348:\"bd6de33a\",412:\"2f55ce66\",439:\"30bd804e\",538:\"1b18459f\",590:\"cf0efb30\",675:\"ae9f91a8\",733:\"83105561\",786:\"06482edd\",860:\"03a8b7a5\",873:\"e6b09d52\",898:\"998ef92b\"}[e]+\"-1.236.0.min.js\"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t=\"NRBA:\",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName(\"script\"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:\"timeout\",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{\"undefined\"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:\"Module\"}),Object.defineProperty(e,\"__esModule\",{value:!0})},i.j=364,i.p=\"https://js-agent.newrelic.com/\",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&(\"load\"===r.type?\"missing\":r.type),a=r&&r.target&&r.target.src;s.message=\"Loading chunk \"+t+\" failed.\\n(\"+o+\": \"+a+\")\",s.name=\"ChunkLoadError\",s.type=o,s.request=a,n[1](s)}}),\"chunk-\"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,\"\".concat(e,\".enabled\"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,\"privacy.cookies_enabled\");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)(\"A problem occurred when starting up session manager. This page will not start or extend any session.\",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,\"aggregate\");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)(\"Downloading and initializing \".concat(this.featureName,\" failed...\"),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,\"session_trace.enabled\")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),(\"undefined\"==typeof PerformanceNavigationTiming||c.Tt)&&\"undefined\"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)(\"timing\",[\"load\",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if(\"count\"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r=\"\",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean(\"hidden\"===document.visibilityState),(0,N.N)((()=>(0,s.p)(\"docHidden\",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)(\"pagehide\",(()=>(0,s.p)(\"winPagehide\",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem(\"__nr_flags\").split(\",\"),console&&\"function\"==typeof console.log&&(L.console=!0,-1!==R.indexOf(\"dev\")&&(L.dev=!0),-1!==R.indexOf(\"nr_dev\")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on(\"internal-error\",(function(e){z(e.stack)})),L.dev&&H.ee.on(\"fn-err\",(function(e,t,r){z(r.stack)})),L.dev&&(z(\"NR AGENT IN DEVELOPMENT MODE\"),z(\"flags: \"+(0,b.D)(L,(function(e,t){return e})).join(\", \")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on(\"fn-start\",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on(\"fn-err\",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)(\"err\",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on(\"fn-end\",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on(\"internal-error\",(function(t){(0,s.p)(\"ierr\",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener(\"unhandledrejection\",(t=>{const r=function(e){let t=\"Unhandled Promise Rejection: \";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)(\"err\",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){\"function\"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)(\"err\",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)(\"ierr\",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||\"Uncaught error with no additional information\",this.sourceURL=t,this.line=r}let U=1;const q=\"nr@id\";function G(e){const t=typeof e;return!e||\"object\"!==t&&\"function\"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if(\"string\"==typeof e&&e.length)return e.length;if(\"object\"==typeof e){if(\"undefined\"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if(\"undefined\"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!(\"undefined\"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||\"\").toString()||null,i=(r.agentID||\"\").toString()||null,o=(r.trustKey||\"\").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return\"00-\"+t+\"-\"+e+\"-01\"}generateTraceContextStateHeader(e,t,r,n,i){return i+\"@nr=0-1-\"+r+\"-\"+n+\"-\"+e+\"----\"+t}generateTraceHeader(e,t,r,n,i,o){if(!(\"function\"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:\"Browser\",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,\"distributed_tracing\")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener(\"load\",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener(\"progress\",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader(\"X-NewRelic-ID\",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader(\"newrelic\",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader(\"traceparent\",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader(\"tracestate\",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{\"abort\"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),(\"load\"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||\"function\"!=typeof t.onload)&&\"function\"==typeof o.end)&&o.end(t)}catch(e){try{n.emit(\"internal-error\",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set(\"newrelic\",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set(\"traceparent\",t.traceContextParentHeader),t.traceContextStateHeader&&e.set(\"tracestate\",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;\"string\"==typeof i?r=i:\"object\"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&\"object\"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(\"\"+(i&&i instanceof Y&&i.method||n.method||\"GET\")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,\"string\"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i(\"xhr\",[this.params,o,this.startTime,this.endTime,\"fetch\"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||\"agent\")),this.start()):(0,l.Z)(\"Failed to initial the agent. Could not determine the runtime environment.\")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t=\"features\";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)(\"\".concat(t.featureName,\" is enabled but one or more dependent features has been disabled (\").concat((0,D.P)(n),\"). This may cause unintended consequences or missing data...\")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)(\"Failed to initialize all enabled instrument classes (agent aborted) -\",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)(\"bst\",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)(\"bstHist\",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get(\"tracer\"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get(\"events\"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit(\"newURL\",[\"\"+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,\"xhr-resolved\"],this.featureName),f.buffer([ve],this.featureName),u.buffer([\"setTimeout\"+le,\"clearTimeout\"+fe,ve],this.featureName),d.buffer([ve,\"new-xhr\",\"send-xhr\"+fe],this.featureName),l.buffer([me+fe,me+\"-done\",me+he+fe,me+he+le],this.featureName),h.buffer([\"newURL\"],this.featureName),g.buffer([ve],this.featureName),s.buffer([\"propagate\",be,ge,\"executor-err\",\"resolve\"+fe],this.featureName),o.buffer([ve,\"no-\"+ve],this.featureName),a.buffer([\"new-jsonp\",\"cb-start\",\"jsonp-error\",\"jsonp-end\"],this.featureName),y(l,me+fe),y(l,me+\"-done\"),y(a,\"new-jsonp\"),y(a,\"jsonp-end\"),y(a,\"cb-start\"),h.on(\"pushState-end\",m),h.on(\"replaceState-end\",m),window.addEventListener(\"hashchange\",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener(\"load\",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener(\"popstate\",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:\"spa\"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is \"complete\" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event \"completion\" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', \"PixelInitialized\", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research <input type=\"hidden\" id=\"meta-article-title\" value=\"Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during infection of mammalian cells\" /> { \"@context\": \"https://schema.org\", \"@type\": \"ScholarlyArticle\", \"mainEntityOfPage\": { \"@type\": \"WebPage\", \"@id\": \"https://f1000research.com/articles/14-1476\" }, \"headline\": \"Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during...\", \"datePublished\": \"2025-12-31T07:57:35\", \"dateModified\": \"2025-12-31T07:57:35\", \"author\": [ { \"@type\": \"Person\", \"name\": \"Kayleigh Earle\" }, { \"@type\": \"Person\", \"name\": \"Sébastien C. Ortiz\" }, { \"@type\": \"Person\", \"name\": \"Clara Valero\" }, { \"@type\": \"Person\", \"name\": \"Margherita Bertuzzi\" }, { \"@type\": \"Person\", \"name\": \"Paul Bowyer\" }, { \"@type\": \"Person\", \"name\": \"Michael J Bromley\" }, { \"@type\": \"Person\", \"name\": \"Sara Gago\" } ], \"publisher\": { \"@type\": \"Organization\", \"name\": \"F1000Research\", \"logo\": { \"@type\": \"ImageObject\", \"url\": \"https://f1000research.com/img/AMP/F1000Research_image.png\", \"height\": 480, \"width\": 60 } }, \"image\": { \"@type\": \"ImageObject\", \"url\": \"https://f1000research.com/img/AMP/F1000Research_image.png\", \"height\": 1200, \"width\": 150 }, \"description\": \" Background Pulmonary infections caused by Aspergillus fumigatus are a global health concern. In the lungs, A. fumigatus employs a variety of virulence and adaptation mechanisms that allows it to survive and evade local immune responses. A. fumigatus protein kinases co-ordinately regulate adaptation to the lung environment and antifungal agents. However, to improve our understanding of the role of these fungal protein kinases in subverting the antifungal responses exhibited by specific host cells, in vitro infection models should be developed. Here, we describe a functional genomics approach to evaluate the role of A. fumigatus protein kinases upon infection of airway epithelial cells, leveraging the use of our existing library of A. fumigatus deletion mutants for kinase functions and bar-seq. Methods We infected A549 alveolar epithelial cells with a pool of 111 A. fumigatus barcoded null mutant strains in genes encoding protein kinases and used bar-seq to identify which of these are involved in fungal survival upon A549 infection. To assess the optimal method for understanding host-pathogen interactions, three approaches aimed at removing extracellular conidia were evaluated: pharmacological treatment with the antifungal nystatin, washes of unbound conidia, and differential fluorescent staining of extracellular and intracellular conidia followed by cell sorting. The identified candidates were further validated using targeted approaches. Results Our data revealed new roles for A. fumigatus protein kinases during infection of airway epithelial cells. Modification of the experimental setup allowed us to differentiate between the genes associated with uptake and those required to withstand other stresses imposed by exposure to mammalian cells. Conclusions This protocol provides a new platform to ascribe pathogenicity-associated functions to A. fumigatus genes and allows prioritization for downstream experiments in mice, potentially reducing the number of studies needed in live animals. This is particularly pertinent, as genome-wide barcoded collections with thousands of strains have become available. \" } { \"@context\": \"http://schema.org\", \"@type\": \"BreadcrumbList\", \"itemListElement\": [ { \"@type\": \"ListItem\", \"position\": \"1\", \"item\": { \"@id\": \"https://f1000research.com/\", \"name\": \"Home\" } }, { \"@type\": \"ListItem\", \"position\": \"2\", \"item\": { \"@id\": \"https://f1000research.com/browse/articles\", \"name\": \"Browse\" } }, { \"@type\": \"ListItem\", \"position\": \"3\", \"item\": { \"@id\": \"https://f1000research.com/articles/14-1476\", \"name\": \"Using bar-seq as a proxy to study population dynamics of Aspergillus...\" } } ] } Home Browse Using bar-seq as a proxy to study population dynamics of Aspergillus... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Earle K, Ortiz SC, Valero C et al. Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during infection of mammalian cells [version 1; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 14 :1476 ( https://doi.org/10.12688/f1000research.172319.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Method Article Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during infection of mammalian cells [version 1; peer review: 1 approved, 2 approved with reservations] Kayleigh Earle 1 , Sébastien C. Ortiz https://orcid.org/0000-0002-4403-9519 1 , Clara Valero 1 , [...] Margherita Bertuzzi 1 , Paul Bowyer 1 , Michael J Bromley 1 , Sara Gago https://orcid.org/0000-0002-7027-4598 1 Kayleigh Earle 1 , Sébastien C. Ortiz https://orcid.org/0000-0002-4403-9519 1 , [...] Clara Valero 1 , Margherita Bertuzzi 1 , Paul Bowyer 1 , Michael J Bromley 1 , Sara Gago https://orcid.org/0000-0002-7027-4598 1 PUBLISHED 31 Dec 2025 Author details Author details 1 Manchester Fungal Infection Group, School of Biological Sciences, The University of Manchester, Manchester, England, M13 9NT, UK Kayleigh Earle Roles: Formal Analysis, Investigation, Methodology, Visualization, Writing – Original Draft Preparation Sébastien C. Ortiz Roles: Investigation, Methodology, Writing – Review & Editing Clara Valero Roles: Formal Analysis, Investigation, Validation, Writing – Review & Editing Margherita Bertuzzi Roles: Conceptualization, Funding Acquisition, Resources, Supervision, Writing – Review & Editing Paul Bowyer Roles: Conceptualization, Data Curation, Funding Acquisition, Project Administration, Supervision, Writing – Review & Editing Michael J Bromley Roles: Conceptualization, Data Curation, Funding Acquisition, Methodology, Resources, Writing – Review & Editing Sara Gago Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Supervision, Validation, Visualization, Writing – Original Draft Preparation OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the NC3Rs gateway. Abstract Background Pulmonary infections caused by Aspergillus fumigatus are a global health concern. In the lungs, A. fumigatus employs a variety of virulence and adaptation mechanisms that allows it to survive and evade local immune responses. A. fumigatus protein kinases co-ordinately regulate adaptation to the lung environment and antifungal agents. However, to improve our understanding of the role of these fungal protein kinases in subverting the antifungal responses exhibited by specific host cells, in vitro infection models should be developed. Here, we describe a functional genomics approach to evaluate the role of A. fumigatus protein kinases upon infection of airway epithelial cells, leveraging the use of our existing library of A. fumigatus deletion mutants for kinase functions and bar-seq. Methods We infected A549 alveolar epithelial cells with a pool of 111 A. fumigatus barcoded null mutant strains in genes encoding protein kinases and used bar-seq to identify which of these are involved in fungal survival upon A549 infection. To assess the optimal method for understanding host-pathogen interactions, three approaches aimed at removing extracellular conidia were evaluated: pharmacological treatment with the antifungal nystatin, washes of unbound conidia, and differential fluorescent staining of extracellular and intracellular conidia followed by cell sorting. The identified candidates were further validated using targeted approaches. Results Our data revealed new roles for A. fumigatus protein kinases during infection of airway epithelial cells. Modification of the experimental setup allowed us to differentiate between the genes associated with uptake and those required to withstand other stresses imposed by exposure to mammalian cells. Conclusions This protocol provides a new platform to ascribe pathogenicity-associated functions to A. fumigatus genes and allows prioritization for downstream experiments in mice, potentially reducing the number of studies needed in live animals. This is particularly pertinent, as genome-wide barcoded collections with thousands of strains have become available. READ ALL READ LESS Keywords Aspergillus fumigatus, epithelial cells, bar-seq, infection model Corresponding Author(s) Sara Gago ( [email protected] ) Close Corresponding author: Sara Gago Competing interests: In the last 5 years SG has delivered educative talks for Gilead outside the submitted work. MB is the director of inpepcide Ltd, an antifungal drug discovery company, and he has received research funding from F2G Ltd. MB also acted as a consultant for Rostra Tx Ltd. Grant information: This work was supported by grants to PB, SG and MB (NC/T001798/1), MBe from the Medical Research Council (MRC New Investigator Research Grant MR/V031287/1). This work was also funded by the Wellcome Trust under the project numbers 208396/Z/17/Z (to MB and PB) and 219551/Z/19/Z (to M.J.B.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2025 Earle K et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Earle K, Ortiz SC, Valero C et al. Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during infection of mammalian cells [version 1; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 14 :1476 ( https://doi.org/10.12688/f1000research.172319.1 ) First published: 31 Dec 2025, 14 :1476 ( https://doi.org/10.12688/f1000research.172319.1 ) Latest published: 31 Dec 2025, 14 :1476 ( https://doi.org/10.12688/f1000research.172319.1 ) Research highlights Scientific benefit(s): • Facilitates the identification of fungal genetic drivers of infection using a high throughput screening approach in mammalian cells. • Can be easily adapted to screen different barcoded null mutant libraries for other pathogens, to understand mechanisms of infection in different cell types or to test drug efficacy during infection. 3Rs benefit(s): • This method can be used to replace the use of animals in the screening of barcoded mutant strains. • Represents an informed approach to select candidate gene deletion mutants for testing in animal models of disease thus facilitating a significant reduction for animal usage. • Provides an ethically sustainable experimental framework to test multiple pathogen/cell line/drug combinations. Practical benefit(s): • Easily adoptable to carry out once barcoded mutant libraries are generated. • High throughput, which can be further scaled up to screen thousands of mutants simultaneously. Current applications: • Identification of potential drivers of disease in Aspergillus fumigatus infections in the lung Potential application(s): • Identification of pathogenicity mechanisms for other microbial pathogens. • Use within industry to assess novel therapies and drug combinations against pathogens. 1. Introduction Aspergillus fumigatus is the causative agent of aspergillosis and has recently been defined as a critical human fungal pathogen by the World Health Organisation. 1 , 2 Aspergillosis is a leading cause of mortality and morbidity in immunosuppressed patients and those with a previous chronic respiratory condition. Treatment is restricted to four antifungal drug families, and drug resistance is becoming a global health problem. 3 Therefore, a comprehensive understanding of the genetic armamentarium utilized by A. fumigatus to overcome antifungal host defenses is required to support the development of new treatments. In the lungs, A. fumigatus co-ordinately regulates multiple fungal adaptation and virulence mechanisms. 4 , 5 This is the case for A. fumigatus protein kinases, which play crucial roles in various cellular processes including growth, stress response, and virulence. 6 – 11 Until recently, our understanding of the A. fumigatus protein kinase complement was inferred from studies based on gene homology in A. nidulans. 12 However, our group recently completed the annotation of protein kinases of A. fumigatus and generated a barcoded null mutant library consisting of 111 strains. 13 Using this library, we demonstrated the utility of bar-seq in identifying genetic drivers of resistance to antifungal drugs and virulence in vivo. 13 Bar-seq has emerged as a useful tool to assess microbial fitness under a range of conditions, 14 and it has been pivotal in assigning new functions and growth phenotypes to genes of different bacterial species in single cultures, 15 co-cultures, 16 and in infection models. 17 In yeast, bar-seq has also been used to elucidate the biological functions of genes and to understand stress responses and mechanisms of drug resistance. 18 – 20 Here, we aimed to optimize a bar-seq protocol to understand which protein kinases are associated with survival within airway epithelial cells. Airway epithelial cells have critical antifungal functions, as they can internalize and kill A. fumigatus spores within mature phagosomes. 4 , 21 – 28 Activation of the antimicrobial responses of airway epithelial cells upon spore challenge also leads to the secretion of immune mediators, which attract professional phagocytes to further aid fungal clearance. 25 The interplay between host and pathogen networks determines the outcome of the infection. A. fumigatus genes important for regulating conidial adhesion, internalization, and killing by airway epithelial cells have been defined by us and others (for review Ref. 29 ). To date, our understanding of Aspergillus factors associated with disease has been determined by assessing fungal infection in immunocompromised hosts using either neutropenic mice or mice with poorly targeted immunosuppression. 30 These experiments are time consuming and costly, and their throughput performance is limited. Therefore, a high-throughput unbiased screening approach that allows the identification of A. fumigatus gene functions for the infection of airway epithelial cells, which can be adapted to other cellular systems, will enable the replacement of virulence studies that are currently based on a single mouse–one fungal strain model. 2. Materials and methods Here, we provide a comprehensive protocol for assigning new functions to A. fumigatus genes in driving airway epithelial cell infection. We have demonstrated the utility of this approach by screening our library of A. fumigatus deletion mutants in genes encoding protein kinases during infection of A549 alveolar epithelial cells. This epithelial cell line has been chosen because it is widely accepted to study the outcomes of fungal interactions with airway epithelial cells, as they produce results that correlate with clinically relevant phenotypes in whole animals and patients. 4 , 22 , 31 Indeed, our group and others have exploited this cell line to identify critical events during the interaction of A. fumigatus with the host. 4 , 21 – 23 , 25 , 26 The overall aim of this experiment was to identify A. fumigatus null mutants of protein kinases that are differentially associated with survival within A549 cells. This protocol has been separated into four major sections, which are summarized in Figure 1 . In section 1, we describe the culture and infection of A549 epithelial cell monolayers with a pool of barcoded A. fumigatus gene-knockout strains. In Section 2, we provide instructions for three different methods of removing extracellular A. fumigatus conidia, as well as comparative analysis, to allow the end-user to select the one that is most appropriate for them. These methods include pharmacological killing of A. fumigatus using nystatin, 26 mechanical removal of extracellular conidia using cell surface washes 23 and differential staining of intracellular and extracellular conidia coupled with fluorescence-activated cell sorting (FACS) of airway epithelial cells. 21 Section 3 describes the extraction of genomic fungal DNA from A. fumigatus conidia within airway epithelial cells, and the preparation of a library for next-generation sequencing. Section 4 describes the bioinformatics pipeline used to analyze sequencing outputs, as well as the suggested validation experiments. Finally, we provide a dedicated section to validate the experiments to confirm the bar-seq observations. Figure 1. Schematic showing how competitive fitness analysis of deletion library was carried out. 111 A. fumigatus protein kinase deletion mutants were obtained from the COFUN library. Strains were grown, and spores were harvested, counted and normalised to generate a pool of mutants. The pool was used to infect A549 airway epithelial cells at multiplicity of infection (MOI) of 1. The cells were then incubated for 6 h before the extracellular spores were removed via a) Nystatin treatment, b) Washing or c) FACS processing. These three experiments were carried out independently. Fresh media was then added, and the cells were incubated overnight to allow mycelia to grow. The mycelia were then harvested, DNA was extracted, and the barcoded region of each mutant was amplified via enrichment PCR. The library was prepared, samples were sequenced, and relative fitness was calculated using DESeq2 on raw counts. Results were normalised to the initial inoculum to keep consistency across methods. A list of all the software, reagents, suppliers, and product codes can be found in Table 1 . Table 1. Reagents, equipment, suppliers and catalogue numbers for all reagents used in this methods manuscript. Catalogue number is placed in brackets. Item Supplier and catalogue number A. fumigatus culture and spore preparation Sabouraud Dextrose agar Oxoid (CM0041) Phosphate buffered saline Sigma-Aldrich (P4417) Tween-20 Sigma-Aldrich (P1379) Miracloth Millipore Limited (475855) Epithelial cell culture A549 human lung epithelial cells ATCC (CCL-185) [Obtained from Merk Cat Number 86012804-1VL Lot (18F020)] DMEM-high glucose Sigma-Aldrich (D6429) T25 cm 2 flasks Corning (430639) Penicillin-Streptomycin Sigma-Aldrich (P4333) Foetal bovine serum Sigma-Aldrich (F7524) Trypsin-EDTA Sigma-Aldrich (T4049) Sample preparation for removal of extracellular conidia Nystatin Sigma-Aldrich (N6261) Fluorescein isothiocyanate (FITC) Sigma-Aldrich (F7250) Calcofluor white stain Sigma-Aldrich (18909) 10X Annexin V Binding buffer Abcam (ab14084) Sodium carbonate concentrate Sigma-Aldrich (56169) 50 ml falcon tube Corning (CLS430829) FluoroBrite™ DMEM Thermo Fisher Scientific (A1896701) DNA extraction CTAB DNA Extraction Buffer Serva (39809.01) Glass beads, acid-washed Sigma-Aldrich (G1145) RNase A Qiagen (19101) Chloroform:isoamyl alcohol (24:1) Sigma-Aldrich (C0549) Isopropanol Sigma-Aldrich (34863) Nuclease free H 2 O Sigma-Aldrich (3098) Library preparation for sequencing Phusion Hot Start II High-Fidelity PCR Master Thermo Fisher Scientific (F566S) Forward/Reverse primers for enrichment PCR Integrated DNA Technologies AMpure XP beads Beckman Coulter (A63881) Nextera XT DNA Library Preparation Kit Illumina (FC-131-1096) Nextera XT Index Kit v2 Set A Illumina (FC-131-2001) iSeq 100 i1 Reagent v2 (Cartridge and Flow cell Illumina (20031371) 2x KAPA HiFi HotStart ReadyMix Roche (KK2601) Qubit dsDNA HS-Assay-Kit Thermo Fisher Scientific (Q32851) PhiX Control v3 Illumina (FC-110-3001) Software Version CUTADAPT v.4.9 Bowtie2 v. 2.5.0 SAMtools v.1.2 DEseq2 v.1.38.3 Pheatmap (RStudio) v.1.0.12 GraphPad Prism v.10.4.2 2.1 Infection of cells with a barcoded library of deletion mutant A. fumigatus strains 2.1.1 Preparation of the A. fumigatus library pool The A. fumigatus kinase deletion mutant collection was previously generated using a high-throughput gene knockout method developed by our group, which combines fusion PCR to generate gene replacement cassettes with a multi-well transformation procedure. Our step-by-step protocol for the generation of A. fumigatus deletion mutants was comprehensively described by Zhao et al . 32 and the composition of the full library, including the lists of primers used, was described by van Rhijn et al . 13 1. Use sterile 10 μl loops to streak 111 A. fumigatus null mutant strains individually from glycerol stocks stored at -80°C. Strains were streaked onto 10 ml of Sabouraud Dextrose agar, poured into T25 cm 2 flasks, and incubated for 3 days at 37°C. 2. Harvest conidia by adding ~10 ml of 0.01% phosphate buffered saline - Tween-20 (PBS-T) to T25 cm 2 flasks and shaking gently to dislodge the conidia. Filter through Miracloth to remove mycelia and collect the conidia suspension in a falcon tube. 3. Quantify conidia using a Fuchs-Rosenthal haemocytometer 4. The concentration was normalized to 5 × 10 8 spores/ml and all strains were pooled into a single tube. Note. Although A. fumigatus deletion mutant strains carry a hygromycin resistance cassette, we do not recommend growing the mutants in media with hygromycin before infection experiments, as this may induce stress that affects conidiation. Note. It is critical that no mycelia are transferred to subsequent experiments, as this may create bias in bar-seq experiments. Therefore, we advise that conidia should not be dislodged from the media by scraping. 2.1.2 Seeding and infection of cells 1. Seed A549 (ATCC CCL-185) airway epithelial cells (7 × 10 5 ) in 5 ml of supplemented DMEM (sDMEM) in T25 cm 2 flasks (we recommend 3-5 flasks per infection condition). sDMEM consisted of DMEM, 1% penicillin/streptomycin cocktail, and 10% fetal bovine serum (FBS). 2. Incubate the cells for 48 h at 37°C and 5% CO 2 to achieve confluency. Note. Before infection, using a light microscope check that there are not dead cells floating, that sings of vacuolisation in the cells are not visible and that monolayers are ~90% confluent. If enrichment of A. fumigatus conidia that has been internalized by A549 cells is performed by FACS, the A. fumigatus pool must be stained prior to infection of epithelial cells (described in section 2.2.3). 3. Remove old media from flasks using a sterile stripette and replace it with 5 ml of fresh sDMEM containing A. fumigatus spores adjusted to an MOI of 1. a. Prepare A. fumigatus inoculum in 50 ml tubes and aliquote into T25 cm 2 flasks containing confluent monolayers to reduce variation in the infectious dose between flasks. Note: Confluent monolayers of A549 cells in T25 tissue culture flasks contain approximately 2.8×10 6 cells. Therefore, to achieve an MOI of 1, cells were infected with 2.8×10 6 spores. 4. Incubate at 37°C and 5% CO 2 for 6 h to allow spore to be internalised. 2.2 Enrichment of A. fumigatus mutants internalised by airway epithelial cells To identify the most suitable method for removing extracellular conidia, we assessed three different approaches: 2.2.1) nystatin treatment of infected monolayers to kill extracellular A. fumigatus spores, 2.2.2) Washes of infected monolayers to remove unbound extracellular spores, and 2.2.3) differential fluorescence staining and fluorescence-activated cell sorting (FACS) of cells to select for internalized FITC-labelled A. fumigatus spores. 2.2.1 Nystatin treatment 1. Remove sDMEM from flask using a sterile stripette. 2. Wash cells gently three times with sDMEM pre-warmed at 37°C. 3. Nystatin (50 μg/ml final concentration) was added to 5 ml of sDMEM in flasks. 33 4. Incubate cells for 1 h at 37°C, 5% CO 2 to kill extracellular spores (note nystatin is expected to be excluded from mammalian cells; hence, internalized spores should remain viable). 5. Use a sterile stripette to remove sDMEM with nystatin, and to wash cells three times with PBS pre-warmed at 37°C to ensure drug is removed. 6. Then, add 5 ml of sDMEM and incubate the flask for 16 h at 37°C and 5% CO 2 to allow intracellular A. fumigatus strains that have not been killed by A549 cells to grow. 2.2.2 Washing 1. Remove media from flasks and discard. 2. Add 5 ml of pre-warmed sDMEM to flasks, being careful not to disrupt cell monolayers. Gently swirl media around flask and remove it. Repeat this process for a total of 3 washes. 3. After final wash, remove sDMEM and replace with 5 ml of fresh sDMEM. 4. Incubate flasks for a further 16 h at 37°C and 5% CO 2 to allow intracellular A. fumigatus strains that have not been killed by A549 cells to grow. 2.2.3 Fluorescence-activated cell sorting (FACS) 2.2.3.1 Fluorescein isothiocyanate (FITC) staining of pool (prior to infection) 1. The A. fumigatus library pool was centrifuged at 2,000 g for 3 min at room temperature , and the supernatant was discarded. 2. The pellet was then resuspended in 0.1 mg/ml FITC prepared in 0.1 M Na 2 CO 3 and incubated in the dark for 30 min at 30°C. 3. Wash spores three times in 500 μl PBS, discarding supernatant each time. 4. The A. fumigatus library pool was resuspended in 1 ml PBS and counted using a hemocytometer. 2.2.3.2 Sample preparation for FACS (after 6 h of infection) 1. Label a 50 ml tube for each T25 cm 2 flask. 2. Remove media from flasks and transfer to corresponding 50 ml tube. 3. The cells were gently rinsed with 5 ml of pre-warmed PBS and transferred to a 50 ml tube containing media. 4. Add 3 ml of Trypsin-EDTA to T25 cm 2 flasks and incubate at 37°C and 5% CO 2 for 5 min to detach the airway epithelial cell monolayer. 5. During this time prepare staining mix as described in 2.3.3, to identify extracellular spores. 6. Check the cells are fully detached using a light microscope before adding 3 ml of sDMEM to neutralize the trypsin-EDTA. 7. Transfer cell suspension to corresponding 50 ml tube. 8. Centrifuge the cell suspension at 520 × g for 3 min at room temperature before carefully pouring the supernatant. 9. The pellet was gently resuspended in a small volume of liquid and transferred to a sterile 1.5 ml tube. 10. Centrifuge cells at 240 g for 3 mins at room temperature and discard supernatant. 11. The cells were resuspended in 500 μl of the staining mix and incubated in the dark for 5 min. 12. Centrifuge samples at 240 g for 3 mins at room temperature and discard supernatant. 13. Resuspend cells in 500 μl of pre-warmed PBS and centrifuge again. 14. After the final centrifugation, the PBS was removed, and the cells were resuspended in 200 μl of pre-warmed PBS and kept on ice. 2.2.3.3 Preparation of staining mix 1. Dissolve 8 mg of Calcofluor White (CFW), which binds to chitin in fungal conidia, 1 ml of FluoroBrite media. 2. Dilute this stock 1:10 in FluoroBrite media to generate a 0.8 mg/ml stock. 3. In a 15 ml tube combine 500 μL Annexin V binding buffer with 5 μl of 0.8 mg/ml CFW per sample. A fresh working stock was prepared for each experiment and wrapped in foil to protect it from light. 2.2.3.4 FACS 1. A BD Influx Cell Sorter was used to sort epithelial cells that contained internalized A. fumigatus spores using a modified version of the gating strategy described in. 22 Unlike 22 the knockout library was constructed in a non-fluorescent background; therefore, A. fumigatus pooled mutants were pre-stained with FITC prior to infection. Epithelial cells that had internalized A. fumigatus were defined as FITC + /CFW - , whereas epithelial cells that had A. fumigatus attached to their surface were defined as FITC + /CFW + and were excluded. 2. For each T25 cm 2 flask, 10,000 epithelial cells containing A. fumigatus (stained FITC + /CFW - ) were sorted into a 1.5 ml tube containing 500 μl of sterile H 2 O. a. 10,000 epithelial cells were selected to ensure the adequate coverage of the A. fumigatus deletion library. The number of cells required depended on the number of mutants in the library. We aimed to obtain an approximate representation of 100 spores per mutant. 3. Vortex the 1.5 ml tubes containing the sorted samples to ensure that the epithelial cells are lysed and the internalized spores are freed. Transfer the 500 μl sample back into a T25 cm 2 flask containing 5 ml of fresh sDMEM and incubate for a further 16 h at 37°C, 5% CO 2. 2.3 Next-generation sequencing library preparation 2.3.1 Collection of mycelia 1. Collect fungal biomass into 15 ml tubes using a cell scraper. 2. Samples were centrifuged at 2,000 × g for 3 min at room temperature and as much liquid as possible was discarded. 3. Freeze overnight at -80°C. 4. Freeze dry samples to remove the remaining liquid (this allows multiple samples to be processed simultaneously, but a liquid nitrogen grinding method can also be used). 5. Grind frozen biomass into a fine powder using a pestle and mortar. 2.3.2 Extraction of fungal DNA Note. In addition to extracting DNA from the A. fumigatus pools collected following infection, DNA should also be extracted directly from the pool of spores used to infect cells. This serves as a control to represent the actual composition of the pool. 1. The freeze-dried mycelia were resuspended in 1 ml of cetyltrimethylammonium bromide (CTAB) extraction buffer (2% CTAB, 20 mM EDTA·Na 2 ·2H 2 O, 1.4 M NaCl, and 100 mM Tris, pH 8). When the liquid nitrogen grinding method was used, approximately 100 mg of ground mycelia was resuspended in 1 ml of CTAB buffer. 2. Transfer sample to a screw cap tube containing HCl washed glass beads. 3. The samples were bead-beaten using a Fastprep-24 instrument for 20 s at 4 s/m and incubated at 65°C for 10 min on a heat block. This step was repeated three times. 4. The sample was incubated at room temperature for 5 min before centrifuging for 5 min at 10,000 × g. 5. Transfer 700 μL of the supernatant to a sterile 2 ml tube and add 4 μL of RNase A (100 mg/ml). 6. Incubate sample at 37°C for 20 min. 7. Then, 700 μL of chloroform:isoamyl alcohol (24:1) was added to the sample and vortexed for 10 s. 8. The sample was centrifuged for 2 min at 10,000 × g, and ~600 μL of the aqueous phase was transferred to a sterile 2 ml tube. The transferred sample should be clear and this step should be repeated if it remains cloudy. 9. Then, 360 μL of isopropanol was added to the sample and inverted a few times to mix. The samples were kept on ice from this point onwards. 10. Centrifuge for 10 min at 10,000 g at 4°C, and discard supernatant. This should be performed carefully to avoid dislodging pellets. 11. The pellet was washed twice with 500 μL 70% ethanol and allowed to air-dry at room temperature. 12. Once the ethanol had fully evaporated, the DNA was resuspended in 20 μL of molecular grade nuclease-free H 2 O. 2.3.3 Sequencing preparation A) Enrichment of barcode region in deletion mutants 1. Amplify the barcode region of mutants by PCR ( Table 2 ) using universal primers that include Nextera compatible adapters (underlined): PCREnrichFw5′- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG CCGGCTCGGTAACAGAACTA -3′ PCREnrichRv 5′- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG GGTCGTTGTAGGGGCTGTAT -3′ 2. Check PCR product (264 bp) using 1% agarose gel. B) Clean-up of PCR product using AMPure XP beads 1. Transfer 18 μl of PCR product to a 1.5 ml tube containing 0.8X AMPure beads and mix gently by pipetting up and down ten times. This process removes fragments of < 200 bp. 2. Incubate samples at room temperature for 5 min. 3. Place tubes on a magnetic stand for 2 min to allow beads to separate. 4. Discard supernatants and wash beads twice with freshly prepared 80% ethanol. 5. Air-dry the beads for 10 min, remove the tubes from the magnetic stand, and add 36 μl of nuclease-free water. The beads were checked periodically to prevent overdrying. 6. Gently pipette up and down ten times to resuspend the beads fully. 7. The samples were incubated at room temperature for 2 min and then returned to a magnetic stand for 2 min. 8. The beads were allowed to separate and 30 μL of the eluates was transferred to new tubes. samples can be kept at -20°C until further use. C) Next-generation sequencing library preparation 1. The amplicon library is prepared using Nextera XT v2 DNA Library Prep Kit according to the manufacturer’s protocol summarized in Table 3 . Note. For iSeq100, it is necessary to ensure that at least one index does not start with two G bases; otherwise, it cannot be called effectively. See the Illumina guide to determine which Nextera XT Index Primer combinations are suitable for your samples. 2. Check PCR product (280 bp) using 1% agarose gel. D) Second clean-up of PCR product using AMPure XP beads 1. Transfer 30 μl of PCR product to a tube containing 33 μl of AMPure XP beads and mix gently by pipetting up and down ten times. 2. Incubate samples at room temperature for 5 min. 3. Place tubes on a magnetic stand for 2 min to allow beads to separate. 4. Remove supernatants and wash beads twice with freshly prepared 80% ethanol. 5. Air-dry the beads for 10 min, remove the tubes from the magnetic stand, and add 36 μl of nuclease-free water. The beads were checked periodically to prevent overdrying. 6. Gently pipette up and down ten times to resuspend the beads fully. 7. The samples were incubated at room temperature for 2 min and then returned to a magnetic stand for 2 min. 8. The beads were allowed to separate and 25 μL of the eluates was transferred to new tubes. samples can be kept at -20°C until further use. E) Library quantification and sequencing Note. Because the A. fumigatus knockout kinome library contains only 111 individual mutants, samples can be run using an Illumina iSeq-100 platform. For larger libraries, platforms with increased sequencing capacity should be considered. 1. Quantify samples using Qubit dsDNA HS-Assay-Kit following manufacturer’s instructions. 2. Calculate molar concentration of DNA based on amplicon size after index PCR reaction. a. Molar concentration in nM = (concentration in ng/μL) / (660 g/mol × average library size) × 10 6 3. Dilute samples to 1 nM in 10 mM Tris pH 8.5. 4. Add 5 μl of each sample together in a single tube. 5. Dilute pooled samples from 1 nM to 50 pM in 10 mM Tris pH 8.5. 6. Spike samples with 5-20% PhiX Control library to increase the diversity of the sequencing pool. 7. Load 20 μL of 50 pM libraries with PhiX control into an iSeq-100 reagent cartridge (Illumina) and sequence on an iSeq-100 platform to generate 2 × 150 bp paired-end reads. Table 2. PCR reaction protocol and PCR conditions for barcode enrichment. Final concentration for primers is shown in brackets. Reagent Volume 2X Phusion Master Mix 20 μl Forward/Reverse Primer 2 μl (5 μM) DNA 4 μl PCR water 22 μl PCR conditions Initial step 98°C 30 s 35 cycles 98°C 5 s 55°C 30 s 72°C 1 min Final step 72°C 10 min Table 3. PCR reaction protocol and PCR conditions for library preparation. Reagent Volume 2X KAPA HiFi HotStart ReadyMix 25 μl Nextera XT Index Primer 1 (N7xx)/Nextera XT Index Primer 2 (S5xx) 5 μl Cleaned PCR product (obtained in 3.3B) 5 μl PCR grade water 10 μl PCR conditions Initial step 95°C 3 mins 8 cycles 95°C 30 s 55°C 30 s 72°C 30 s Final step 72°C mins 2.4 Bioinformatic analysis and validation experiments 2.4.1 Computational analysis Note: All codes for the analysis and plots are available in Ref. 34 . 1. FASTQ files were obtained from the BaseSpace Sequence Hub (Illumina) and checked for quality using FastQC. Poor quality reads were discarded. 2. Raw sequencing reads were trimmed using CUDADAPT (v.4.9) which removes the adapter sequence GGTAACAGAACTA from the 3′ end of the reads and discard reads shorter than 21 bp and longer than 23 bp. 3. Generate an index file with the AFUB number and a unique barcode sequence for each mutant strain. Bowtie2 (version 2.5.0) was used to map the reads to this index. 4. SAM tools (v.1.2.) was utilised to convert and index SAM files to BAM format and obtain counts using the Perl script. 5. DESeq2 (v. 1.38.3) was used to calculate the differential barcode counts for each mutant on a condition versus standard basis (default settings). A comprehensive explanation of this can be found in Ref. 35 . 6. Log-transform normalized counts were produced by DESeq2 and plotted using pheatmap (v. 1.0.12) or GraphPad Prism v10 (La Joya, CA, USA) ( Figure 2 ). Figure 2. Bar-seq of A. fumigatus allows the identification of mutants that are differently fit to grow in the presence of airway epithelial cells. (A) Heatmap of fitness for each A. fumigatus protein kinase null mutant relative to T0 . Relative fitness values was calculated by DESeq2, comparing barcode counts obtained from A549 cells infected with the pool for 16 hours following removal of extracellular conidia by Nystatin treatment, PBS washes or FACS sorting. 103 individual mutants were detected. (B) Global correlation analyses of population dynamics of A. fumigatus deletion mutant libraries during infection of A549 cells and removal of extracellular conidia by nystatin treatment, washing the epithelial monolayer or sorting the population of cell containing internalised spores. Spearman correlation index (rs) and P values are shown for each comparison. 2.4.2 Validation of observations Having identified those A. fumigatus individual mutants that are differentially abundant, carry out validation of the results utilizing killing experiments. 23 i. Seed 7.5×10 4 A549 cells in 500 microlitres of sDMEM and incubate for 48 h at 37°C and 5% CO 2. At this point, cells were 90% confluent. ii. Before infection, the media was changed, and the cells were exposed to 50 μL of A. fumigatus spores containing 10 6 spores. iii. Incubate infected cells for 4 h at 37°C, 5% CO 2 , wash extracellular spores with pre-warmed PBS, and add 500 μL of sDMEM. Infected cells were incubated for an additional 12 h. iv. Serial dilutions of the cell wash were made and plated on Sabouraud Agar plates to calculate spore input. Incubate the plates for 24 h at 37°C. v. After the cell incubation, the medium was removed, 500 μL of sterile deionized water was added, and serial dilutions were made. 50 μL of each serial dilution were plated on Sabouraud Agar plates and incubated for 24 h at 37°C. vi. Spore survival for each individual mutant and parental strain was calculated. Experiments were carried out in biological and technical triplicates. Note: Growth rate analyses of individual mutants in culture media are recommended to ensure that the observed phenotypes are not a result of mutant growth defects. 2.5 Statistical analysis • Spearman correlation tests were performed to determine the consistency across methods. Analyses were performed using GraphPad Prism v10 (La Jolla, CA, USA). • Statistical differences in abundance for each mutant were determined using Bowtie 2 as described above. • One-way ANOVA with Geisser-Greenhouse (repetitive measurements) and Dunnett’s correction (multiple comparisons) were performed to determine differences in fungal survival and growth rates between mutants and controls. • P<0.05 or Padj<0.05 were considered for statistical significance. 2.6 Experimental design This method is based on the use of the well-characterized A549 alveolar epithelial cell line, as it provides highly reproducible outputs from A. fumigatus -host interactions, which exhibit a high degree of correlation with studies using primary airway epithelial cells and mice. All experiments were conducted with 3-5 technical replicates for each of the 3-5 biological replicates. P-values for test treatments versus controls were calculated through parametric or non-parametric tests according to normality distribution. p<0.05 was utilized in all cases as a threshold for statistical significance. Statistical significance for differential abundance of the null strains was analyzed using Deseq2, as explained above, and a Padj<0.05 is utilised as a statistically significant cutoff. 3. Results Airway epithelial cells are the first point of contact for inhaled A. fumigatus spores with the host; however, our understanding of the fungal drivers of A. fumigatus infection of these cells remains limited. We have previously shown that a barcoded A. fumigatus gene knockout kinase library can be competitively analyzed to identify new genetic drivers of antimicrobial resistance and virulence in vitro and in whole animals. 13 Thus, we performed in vitro competition experiments in the presence of an immortalized epithelial cell line, A549, to investigate the initial steps of A. fumigatus colonization of the lung. To identify individual kinase deletion mutants that are differentially abundant during infection with airway epithelial cells, we utilized three different approaches to remove extracellular A. fumigatus : (i) nystatin treatment, (ii) washing, or (iii) FACS sorting of airway epithelial cells containing A. fumigatus conidia ( Figure 1 ). After infection, fungal DNA was extracted and the ratio of absorbance at 260 nm and 280 nm was confirmed to range from 1.8 to 2 for all samples; DNA was also size separated using gel electrophoresis to confirm integrity. DNA gel electrophoresis after enrichment PCR confirmed amplification of the 280 bp barcode PCR fragment. Gel electrophoresis was performed after indexing and clean-up steps before loading the sample into the sequencer to visually determine the presence of the DNA library (Supplementary Figure 1 , 34 ). The expectation was that all three experiments, which were designed to assess the impact of gene knock-out on a combination of cellular uptake, spore killing, and host fitness, would generate similar outputs; however, this was not the case. Although a reasonable correlation was observed between FACS sorting and spore washing approaches (r s =0.5787), and this correlation was statistically significant (p < 0.0001), no correlation was observed between these approaches and nystatin treatment ( Figure 2 ). This may indicate, contrary to our expectation, that nystatin treatment is not effective at differentiating internalized from external spores. A total of nine null mutants were identified as differentially abundant in the data generated from the washing approach (four increased abundance, five decreased abundance), and 15 mutants were differentially abundant in the FACS data (2 increased, 13 decreased) ( Figure 2C and supplementary Figure 2 , 34 ). To validate the results of these experiments, we selected two A. fumigatus deletion mutants that were either more (ΔAFUB_020560, null in the rck2 ortholog of Saccharomyces cerevisiae 36 ) or less abundant (ΔAFUB_059090 null in the nrc2 ortholog of Neurospora crassa 37 ) in both datasets ( Figure 2B ). Having confirmed that these mutant strains did not show differences in growth compared to the parental strain when grown in culture media ( Figure 3A ), we performed killing assays to assess their susceptibility to exposure to airway epithelial cells ( Figure 3B ). Our data revealed that, consistent with the bar-seq data, the ΔAFUB_020560 mutant was more able to survive within airway epithelial cells than the parental strain, and that the ΔAFUB_059090 mutant was more susceptible to airway epithelial cell killing. Figure 3. Validation of individual A. fumigatus deletion mutant strains in protein kinase functions identified by bar-seq. (A) A. fumigatus survival of individual null mutant strains identified by bar-seq analyses during infection of A549 airway epithelial cells ( n = 3). (B) Growth rate analyses of individual A. fumigatus null mutant strains. * p < 0.05, p < 0.01. Together, our data indicate that analysis of barcoded A. fumigatus deletion libraries allows the identification of the drivers of fungal survival within airway epithelial cells. Our data also show that removal of extracellular conidia via iterative washing or FACS-mediated sorting of airway epithelial cell populations that have internalized A. fumigatus is superior to pharmacological killing of extracellular conidia with nystatin. We recommend the use of FACS-mediated sorting whenever possible as it decreases the likelihood of enriching strains that might not be fully internalized. 4. Discussion To date, much of our understanding of A. fumigatus pathogenicity has been derived from targeted studies using individual knockout mutants in infection experiments. Although effective, this process can be laborious and time-consuming. In contrast, the emergence of bar-seq technologies represents a powerful tool for high-throughput screening of deletion mutants, enabling us to simultaneously ascertain their functions under a variety of different conditions. This technology has been used extensively in both bacteria and other fungal species, primarily to assign functions to uncharacterized genes, investigate tolerance to antimicrobials, and identify targets for novel therapeutics. 15 , 19 , 20 Most recently, functional screens have been carried out in model organisms such as Saccharomyces cerevisiae , Candida albicans, and A. fumigatus to uncover genotypes involved in conferring fitness both in vitro and in vivo. 13 , 38 Phadke et al . 38 carried out a genome-wide screening of S. cerevisiae to identify genes contributing to pathogenicity in a Galleria mellonella infection model, whereas van Rhijn et al. 13 investigated the A. fumigatus kinome to identify genes that promote hypersensitivity to azoles and fitness defects in a murine host. However, the applicability of bar-seq to investigate the genetic armamentarium A. fumigatus that can survive within host immune cells has not been explored. In our study, we optimized an experimental approach to screen barcoded mutant libraries during infection of airway epithelial cells. We comparatively analyzed the performance of three methods commonly used to remove extracellular conidia in A. fumigatus infection experiments (see Methods section 2). Our data suggest that nystatin treatment might not completely remove extracellular A. fumigatus , thus failing to accurately resolve A. fumigatus protein kinases and facilitating fungal survival within airway epithelial cells. This might result from the use of nystatin at fungistatic rather than fungicidal concentrations to avoid toxicity to host cells. 33 In contrast, we found a significant positive correlation for the identification of A. fumigatus kinase genes contributing to fitness during in vitro infection when extracellular conidia were removed either by washing or FACS. Indeed, in addition to the identification of mutants that could be internalized and persist, washing of the cell monolayer also enriched the results with deletion strains, which might have an increased ability to adhere to the cell, which is an important step in colonization. Conversely, FACS included only deletion strains that were internalized by epithelial cells, producing a cleaner set of results. Extended data 34 showing the mean number of reads for each mutant (see Earle F1000 NC3Rs Gateway Raw Data, Supplementary Figures 2A-C tabs) supports this theory, with a much larger number of reads obtained for the washing condition compared to FACS. Nevertheless, validation experiments specifically quantifying the adhesion of the mutants are necessary to confirm this. However, the use of FACS is limited to locations where this technology is available. We have also uncovered important factors to consider during experimental design, including ensuring sufficient cells are sorted during FACS to ensure that each mutant is sufficiently represented in the final dataset and to prevent a lack of experimental power due to the low number of barcode sequencing reads. We recommend that when using a sorting approach, at least 100 host cells per A. fumigatus deletion mutant are sorted to have sufficient sequence coverage per mutant strain. However, a titration experiment may need to be carried out when using barcoded mutant libraries with an increased number of strains. To conclusively identify the role of the discovery factors in fitness during infection of airway epithelial cells, a validation experiment must be designed. This experiment needs to be focused on confirming (i) that the mutants identified are not differentially fit to grow in the presence of airway epithelial cells due to growth defects, and (ii) that the identified mutants retain their fitness phenotype when analyzed individually in infection experiments. For the first point, users might be interested in including a control to analyze the fitness of the pool in culture media alone. For the purpose of this paper, we chose to compare with the initial mutant pool alone, as our aim was to perform correlation analysis across the three different methodologies, which provided a consistent starting point. Moreover, the library utilized in these experiments has already been extensively characterized for growth defects in previously published studies. 13 Second, we have assigned new roles to two A. fumigatus protein kinases in fitness during infection of airway epithelial cells, providing a strong foundation for further investigations on these targets identified in our screens. In Saccharomyces cerevisiae the rck2 gene 36 regulates oxidative and osmotic stress; however, whether this is the case in A. fumigatus should be determined. The A. fumigatus gene AFUB_059090 encodes a protein kinase that is the nrc2 ortholog of Saccharomyces cerevisiae. In yeast, null mutants of this gene produce conidia that do not mature normally and hyphae that are thinner. 37 Although we have not explored these phenotypes in detail in A. fumigatus it might be the case that these morphological changes facilitate spore killing by airway epithelial cells, resulting in fitness deficiency. From a 3Rs perspective, it is crucial to emphasize that the use of this high-throughput technology in our cell culture system will allow the complete replacement of the use of animals for screening purposes, while enabling a significant reduction in the number of fungal strains that need to be tested in animals for full characterization. For example, assessing the individual role of virulence of the 111 A. fumigatus mutant strains in the kinome library using an immunosuppressed mouse model of invasive aspergillosis would require the use of 1221 mice (111 groups of 11 mice). However, the same approach using in vitro competitive fitness would require the use of only 10 T-25 tissue culture flasks and will allow us to triage those strains to be studied in an animal model, potentially leading to a 97% reduction in mice used (three groups of 11 mice). By coupling the use of this methodology with isogenic cell systems deficient in particular host antifungal gene functions (e.g., ZNF77, 24 p11 31 ) we will also be able to identify the mechanisms of fungal infection in genetically susceptible populations. Similarly, this methodology could be applied to understand the specific mechanisms of fungal pathogenicity using primary cells from aspergillosis in at-risk patient cohorts (e.g., those with chronic respiratory conditions or cystic fibrosis). Our group has pioneered the development of the A. fumigatus whole-genome knockout library (COFUN), which consists of more than 6,000 barcoded deletion mutants in individual genes. Evaluation of virulence defects for each mutant in this collection would require the use of approximately 66,000 mice, using existing technologies. However, the same approach using in vitro competitive fitness would require the use of a handful of tissue culture flasks and would allow us to triage those strains to be studied in an animal model. For example, if 10 mutant strains are identified in in vitro screening, assessing those strains for virulence in an animal model would require only 110 mice (85% reduction). Overall, this study presents an optimized method for high-throughput screening of barcoded A. fumigatus mutant libraries to identify novel fungal genes that confer fitness in mammalian cells. The methodology proposed here is very versatile, and the current efforts for the generation of the A. fumigatus whole genome knockout library (COFUN library) offer new opportunities for genome-wide analyses of A. fumigatus drivers of infection with mammalian cells. Combining bar-seq and functional validation experiments, we will be able to streamline the identification of A. fumigatus deletion mutants involved in pathogenesis and reduce the number of strains to be tested in in vivo models of disease. Data availability Underlying data FigShare: Supplementary Material and raw data for “Bar-seq analysis of Aspergillus fumigatus kinome library during infection of airway epithelial cells”. University of Manchester https://doi.org/10.48420/30449888 . 34 The project contains the following underlying data: • Earle F1000 Gate Away Data.xls (raw data for figures). Extended data FigShare: Supplementary Material and raw data for “Bar-seq analysis of Aspergillus fumigatus kinome library during infection of airway epithelial cells”. University of Manchester https://doi.org/10.48420/30449888 . 34 This project contains the following extended data: • Earle F1000 Supplementary Figures.pdf (Supplementary Figures 1 & 2) • Earle F1000 Code Deseq2.txt (R code for Deseq2 analysis) • Earle F1000 Code Volcano Plot.txt (R code to do Volcano plots shown in Supplementary Figure 2) • Earle F1000 Code Heatmap.txt (R code to do Heatmap as shown in Figure 1) • Earle F1000 Code get_txt IDs for genes of interest (R code to get IDs for genes of interest) • Earle F1000 kinasebc.txt (list of barcodes for individual deletion mutants in the kinase library) • Earle F1000 Code get counts.txt (R code to retrieve gene counts) Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0). Acknowledgements We would like to thank Dr. Gareth Howell and his team at the Flow Cytometry Core Facility, University of Manchester, for their technical assistance, and Dr. Katie Bates from the NC3Rs Research Office for providing feedback to this manuscript. References 1. Fisher MC, Denning DW: The WHO fungal priority pathogens list as a game-changer. Nat. Rev. Microbiol. 2023; 21 (4): 211–212. PubMed Abstract | Publisher Full Text | Free Full Text 2. Latge JP, Chamilos G: Aspergillus fumigatus and Aspergillosis in 2019. Clin. Microbiol. Rev. 2019; 33 (1). PubMed Abstract | Publisher Full Text | Free Full Text 3. Fisher MC, Alastruey-Izquierdo A, Berman J, et al. : Tackling the emerging threat of antifungal resistance to human health. Nat. Rev. Microbiol. 2022; 20 (9): 557–571. PubMed Abstract | Publisher Full Text | Free Full Text 4. Bertuzzi M, Schrettl M, Alcazar-Fuoli L, et al. : The pH-responsive PacC transcription factor of Aspergillus fumigatus governs epithelial entry and tissue invasion during pulmonary aspergillosis. PLoS Pathog. 2014; 10 (10): e1004413. PubMed Abstract | Publisher Full Text | Free Full Text 5. Irmer H, Tarazona S, Sasse C, et al. : RNAseq analysis of Aspergillus fumigatus in blood reveals a just wait and see resting stage behavior. BMC Genomics. 2015; 16 (1): 640. PubMed Abstract | Publisher Full Text | Free Full Text 6. van de Veerdonk FL , Gresnigt MS, Romani L, et al. : Aspergillus fumigatus morphology and dynamic host interactions. Nat. Rev. Microbiol. 2017; 15 (11): 661–674. PubMed Abstract | Publisher Full Text 7. May GS, Xue T, Kontoyiannis DP, et al. : Mitogen activated protein kinases of Aspergillus fumigatus. Med. Mycol. 2005; 43 Suppl 1 : 83–86. Publisher Full Text 8. Rispail N, Soanes DM, Ant C, et al. : Comparative genomics of MAP kinase and calcium-calcineurin signalling components in plant and human pathogenic fungi. Fungal Genet. Biol. 2009; 46 (4): 287–298. PubMed Abstract | Publisher Full Text 9. Kirkland ME, Stannard M, Kowalski CH, et al. : Host Lung Environment Limits Aspergillus fumigatus Germination through an SskA-Dependent Signaling Response. mSphere. 2021; 6 (6): e0092221. PubMed Abstract | Publisher Full Text | Free Full Text 10. Ross BS, Lofgren LA, Ashare A, et al. : Aspergillus fumigatus In-Host HOG Pathway Mutation for Cystic Fibrosis Lung Microenvironment Persistence. MBio. 2021; 12 (4): e0215321. PubMed Abstract | Publisher Full Text | Free Full Text 11. Valiante V, Macheleidt J, Foge M, et al. : The Aspergillus fumigatus cell wall integrity signaling pathway: drug target, compensatory pathways, and virulence. Front. Microbiol. 2015; 6 : 325. 12. De Souza CP, Hashmi SB, Osmani AH, et al. : Functional analysis of the Aspergillus nidulans kinome. PLoS One. 2013; 8 (3): e58008. PubMed Abstract | Publisher Full Text | Free Full Text 13. van Rhijn N , Zhao C, Al-Furaiji N, et al. : Functional analysis of the Aspergillus fumigatus kinome identifies a druggable DYRK kinase that regulates septal plugging. Nat. Commun. 2024; 15 (1): 4984. PubMed Abstract | Publisher Full Text | Free Full Text 14. Smith AM, Heisler LE, Mellor J, et al. : Quantitative phenotyping via deep barcode sequencing. Genome Res. 2009; 19 (10): 1836–1842. PubMed Abstract | Publisher Full Text | Free Full Text 15. Wetmore KM, Price MN, Waters RJ, et al. : Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons. MBio. 2015; 6 (3): e00306–e00315. PubMed Abstract | Publisher Full Text 16. N’guyen GQ, Jain M, Landry CR, et al. : Mapping Gene-Microbe Interactions: Insights from Functional Genomics Co-culture Experiments between Saccharomyces cerevisiae and Pseudomonas spp. bioRxiv. 2020:2020.06.01.127472. 17. Bucklin A, Lindeque PK, Rodriguez-Ezpeleta N, et al. : Metabarcoding of marine zooplankton: prospects, progress and pitfalls. J. Plankton Res. 2016; 38 (3): 393–400. Publisher Full Text 18. Giaever G, Chu AM, Ni L, et al. : Functional profiling of the Saccharomyces cerevisiae genome. Nature. 2002; 418 (6896): 387–391. Publisher Full Text 19. Payen C, Sunshine AB, Ong GT, et al. : High-Throughput Identification of Adaptive Mutations in Experimentally Evolved Yeast Populations. PLoS Genet. 2016; 12 (10): e1006339. PubMed Abstract | Publisher Full Text | Free Full Text 20. Savitskaya J, Protzko RJ, Li FZ, et al. : Iterative screening methodology enables isolation of strains with improved properties for a FACS-based screen and increased L-DOPA production. Sci. Rep. 2019; 9 (1): 5815. PubMed Abstract | Publisher Full Text | Free Full Text 21. Bertuzzi M, Howell GJ: Single-Cell Analysis of Fungal Uptake in Cultured Airway Epithelial Cells Using Differential Fluorescent Staining and Imaging Flow Cytometry. Methods Mol. Biol. 2021; 2260 : 83–109. PubMed Abstract | Publisher Full Text 22. Bertuzzi M, Howell GJ, Thomson DD, et al. : Epithelial uptake leads to fungal killing in vivo and is aberrant in COPD-derived epithelial cells. iScience. 2024; 27 (6): 109939. PubMed Abstract | Publisher Full Text | Free Full Text 23. Ben-Ghazzi N, Moreno-Velasquez S, Seidel C, et al. : Characterisation of Aspergillus fumigatus Endocytic Trafficking within Airway Epithelial Cells Using High-Resolution Automated Quantitative Confocal Microscopy. J. Fungi (Basel). 2021; 7 (6). Publisher Full Text 24. Gago S, Overton NLD, Ben-Ghazzi N, et al. : Lung colonization by Aspergillus fumigatus is controlled by ZNF77. Nat. Commun. 2018; 9 (1): 3835. PubMed Abstract | Publisher Full Text | Free Full Text 25. Rowley J, Namvar S, Gago S, et al. : Differential Proinflammatory Responses to Aspergillus fumigatus by Airway Epithelial Cells in vitro Are Protease Dependent. J. Fungi (Basel). 2021; 7 (6). Publisher Full Text 26. Seidel C, Moreno-Velasquez SD, Ben-Ghazzi N, et al. : Phagolysosomal Survival Enables Non-lytic Hyphal Escape and Ramification Through Lung Epithelium During Aspergillus fumigatus Infection. Front. Microbiol. 2020; 11 : 1955. PubMed Abstract | Publisher Full Text | Free Full Text 27. Bigot J, Guillot L, Guitard J, et al. : Bronchial Epithelial Cells on the Front Line to Fight Lung Infection-Causing Aspergillus fumigatus. Front. Immunol. 2020; 11 : 1041. PubMed Abstract | Publisher Full Text | Free Full Text 28. Feldman MB, Dutko RA, Wood MA, et al. : Aspergillus fumigatus Cell Wall Promotes Apical Airway Epithelial Recruitment of Human Neutrophils. Infect. Immun. 2020; 88 (2). PubMed Abstract | Publisher Full Text | Free Full Text 29. Earle K, Valero C, Conn DP, et al. : Pathogenicity and virulence of Aspergillus fumigatus. Virulence. 2023; 14 (1): 2172264. PubMed Abstract | Publisher Full Text | Free Full Text 30. Clemons KV, Stevens DA: The contribution of animal models of aspergillosis to understanding pathogenesis, therapy and virulence. Med. Mycol. 2005; 43 (Suppl 1): 101–110. PubMed Abstract | Publisher Full Text 31. Jia LJ, Rafiq M, Radosa L, et al. : Aspergillus fumigatus hijacks human p11 to redirect fungal-containing phagosomes to non-degradative pathway. Cell Host Microbe. 2023; 31 (3): 373–388.e10. PubMed Abstract | Publisher Full Text | Free Full Text 32. Zhao C, Fraczek MG, Dineen L, et al. : High-Throughput Gene Replacement in Aspergillus fumigatus. Curr. Protoc. Microbiol. 2019; 54 (1): e88. PubMed Abstract | Publisher Full Text | Free Full Text 33. Wasylnka JA, Moore MM: Uptake of Aspergillus fumigatus Conidia by phagocytic and nonphagocytic cells in vitro: quantitation using strains expressing green fluorescent protein. Infect. Immun. 2002; 70 (6): 3156–3163. PubMed Abstract | Publisher Full Text | Free Full Text 34. Gago S: Supplementary Material and raw data for bar-seq analysis of Aspergillus fumigatus kinome library during infection of airway epithelial cells. FigShare. 2025. Publisher Full Text 35. Yalamanchili HK, Wan YW, Liu Z: Data Analysis Pipeline for RNA-seq Experiments: From Differential Expression to Cryptic Splicing. Curr. Protoc. Bioinformatics. 2017; 59 : 11 5 1–5 21. Publisher Full Text 36. Melcher ML, Thorner J: Identification and characterization of the CLK1 gene product, a novel CaM kinase-like protein kinase from the yeast Saccharomyces cerevisiae. J. Biol. Chem. 1996; 271 (47): 29958–29968. PubMed Abstract | Publisher Full Text 37. Kothe GO, Free SJ: The isolation and characterization of nrc-1 and nrc-2, two genes encoding protein kinases that control growth and development in Neurospora crassa. Genetics. 1998; 149 (1): 117–130. PubMed Abstract | Publisher Full Text | Free Full Text 38. Phadke SS, Maclean CJ, Zhao SY, et al. : Genome-Wide Screen for Saccharomyces cerevisiae Genes Contributing to Opportunistic Pathogenicity in an Invertebrate Model Host. G3 (Bethesda). 2018; 8 (1): 63–78. PubMed Abstract | Publisher Full Text | Free Full Text Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 31 Dec 2025 ADD YOUR COMMENT Comment Author details Author details 1 Manchester Fungal Infection Group, School of Biological Sciences, The University of Manchester, Manchester, England, M13 9NT, UK Kayleigh Earle Roles: Formal Analysis, Investigation, Methodology, Visualization, Writing – Original Draft Preparation Sébastien C. Ortiz Roles: Investigation, Methodology, Writing – Review & Editing Clara Valero Roles: Formal Analysis, Investigation, Validation, Writing – Review & Editing Margherita Bertuzzi Roles: Conceptualization, Funding Acquisition, Resources, Supervision, Writing – Review & Editing Paul Bowyer Roles: Conceptualization, Data Curation, Funding Acquisition, Project Administration, Supervision, Writing – Review & Editing Michael J Bromley Roles: Conceptualization, Data Curation, Funding Acquisition, Methodology, Resources, Writing – Review & Editing Sara Gago Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Supervision, Validation, Visualization, Writing – Original Draft Preparation Competing interests In the last 5 years SG has delivered educative talks for Gilead outside the submitted work. MB is the director of inpepcide Ltd, an antifungal drug discovery company, and he has received research funding from F2G Ltd. MB also acted as a consultant for Rostra Tx Ltd. Grant information This work was supported by grants to PB, SG and MB (NC/T001798/1), MBe from the Medical Research Council (MRC New Investigator Research Grant MR/V031287/1). This work was also funded by the Wellcome Trust under the project numbers 208396/Z/17/Z (to MB and PB) and 219551/Z/19/Z (to M.J.B.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (1) version 1 Published: 31 Dec 2025, 14:1476 https://doi.org/10.12688/f1000research.172319.1 Copyright © 2025 Earle K et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Earle K, Ortiz SC, Valero C et al. Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during infection of mammalian cells [version 1; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 14 :1476 ( https://doi.org/10.12688/f1000research.172319.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 1 VERSION 1 PUBLISHED 31 Dec 2025 Views 0 Cite How to cite this report: Kerkaert JD. Reviewer Report For: Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during infection of mammalian cells [version 1; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 14 :1476 ( https://doi.org/10.5256/f1000research.190035.r453604 ) The direct URL for this report is: https://f1000research.com/articles/14-1476/v1#referee-response-453604 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 14 Mar 2026 Joshua D Kerkaert , Cornell University, Ithaca, new, USA Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.190035.r453604 Earle et. al. describe a method for barcoded sequencing analysis of Aspergillus fumigatus mutant strains and implement this method using an epithelial cell culture model. While variations of this method have been available in a number of bacterial species for some time ... Continue reading READ ALL Earle et. al. describe a method for barcoded sequencing analysis of Aspergillus fumigatus mutant strains and implement this method using an epithelial cell culture model. While variations of this method have been available in a number of bacterial species for some time now, there is a significant need for development of functional genomics methods in fungal pathogens. Thus, this publication, along with the related publication by van Rhijn et. al., mark a significant advancement to addressing this need. The implementation of the Bar-seq method using an epithelial cell culture model also exemplifies the utility of this method in prioritizing genes and pathways of interest for future validation by in vitro and in vivo studies. The method is presented in a relatively comprehensive manner, and the details necessary to replicate the experiments presented and apply the method to other questions related to the 111 kinase strains are included. While the method as presented is somewhat limited to the 111 kinase strain set, the authors do reference the papers where construction of the strains is outlined (Zhao et. al. and van Rhijn et. al.). Thereby, making it possible to piece together the information necessary to expand the method to either custom strain sets or other strains from the COFUN library when available. The conclusions made throughout are largely supported by the data. Overall, this method has the potential to be a great boon to the A. fumigatus community and beyond. There are several textual issues/errors throughout the paper that should be addressed however: Ideally the raw sequencing data should be archived and the relevant accession information provided. On top of being an important data availability practice, the datasets presented here would make excellent training datasets for the method presented. Coupled with the provided code this would allow interested individuals an opportunity to replicate the results while learning to apply the method to to their own experiments/data. Throughout the manuscript it is unclear what phenotypes are due to a difference in initial uptake by the epithelial cells, versus survival and/or growth after uptake. Given the initial uptake would heavily bias the final population of cells, clarification of interpretation and further discussion on methods to control for this caveat would be useful. The critical control of sequencing the initial mutant pool is mentioned as well as the utility of a culture media condition. However, neither of these two controls account for initial uptake. Thus, a change in relative frequency of a barcode at the end of the experiment, as presented in the manuscript, could either be due to a higher/lower uptake, higher/lower survival from epithelial cell killing, or higher/lower growth rates within the epithelial cells. A relatively straightforward control would be taking samples after washing as this would be the population up taken the epithelial cells. Figure 3 has a duplication of the FC survival vs MFIG001 graph. Additionally, it appears that ∆AFUB_059090 may have slightly increased growth on the image. Is this also true when grown on the cell culture media? If not the relevant text and interpretations should be altered to fit the data. AFUB_059090 also has a white spot on the left of the colony. Is the strain sectoring or is this an artifact of the image and its processing? Pairwise statistical comparisons are performed (presumably using DESeq2). However, the DESeq2 code in the extended data only produces variance-stabalized transformed counts and would not perform statistical analyses as it is currently written. Please update with the lines of code necessary to obtain pairwise comparisons. Some of the text in figures 1 and S2 is too small to read (particularly when printed). It would be helpful to the reader if the text sizes where increased. It would be useful to add the following details relevant to the method presented including: What depth of sequencing should one aim for with a 111 barcode library? For the PCRs in Table 2 and Table 3 is there a specific concentration (or concentration range) used for the template input (DNA in Table 2 and PCR product in Table 3)? If this is not a concern for barcode amplification and library preparation a short statement regarding that would be useful for those replicating the method. What size of beads were used for bead beating? Several text errors can be found throughout the manuscript, some of which could confuse an individual trying to execute this method: 2.4.1 - 2: CUTADAPT not CUDADAPT sings of vacuolization should be signs 2.5: Bowtie2 does not perform statistical analyses. Please update with the program/package/platform/otherwise that was used (presumably DESeq2 in R based on what is stated in 2.6) Figure 2A: several strains are denoted with two \"∆\" signs. If those are not double knockouts please remove the second ∆. Otherwise, state what the second gene knocked out is. nrc2 is initially referred to as an N. crassa gene (proper nomenclature would technically be \"nrc-2\" if this is the case). Later nrc-2 is referred to as an S. cerevisiae gene. Please correct this Supplementary Figure 2: \"Cut-offs of log2FC >2 (pink) or <2 (blue)\" is missing the negative sign Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Partly Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Molecular mycology, metabolism, genetics, pathogenesis of Aspergillus fumigatus. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Kerkaert JD. Reviewer Report For: Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during infection of mammalian cells [version 1; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 14 :1476 ( https://doi.org/10.5256/f1000research.190035.r453604 ) The direct URL for this report is: https://f1000research.com/articles/14-1476/v1#referee-response-453604 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Amaro F. Reviewer Report For: Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during infection of mammalian cells [version 1; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 14 :1476 ( https://doi.org/10.5256/f1000research.190035.r465897 ) The direct URL for this report is: https://f1000research.com/articles/14-1476/v1#referee-response-465897 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 14 Mar 2026 Francisco Amaro , Universidad Complutense de Madrid, Madrid, Spain Approved VIEWS 0 https://doi.org/10.5256/f1000research.190035.r465897 This manuscript presents a highly valuable and well-designed protocol that significantly advances the use of bar-seq approaches to investigate host–pathogen interactions in vitro. The methodology is clearly structured, comprehensive, and carefully optimized, providing practical guidance that will facilitate adoption by ... Continue reading READ ALL This manuscript presents a highly valuable and well-designed protocol that significantly advances the use of bar-seq approaches to investigate host–pathogen interactions in vitro. The methodology is clearly structured, comprehensive, and carefully optimized, providing practical guidance that will facilitate adoption by other laboratories. Importantly, the comparative evaluation of different strategies to remove extracellular conidia and the inclusion of validation steps strengthen the robustness of the workflow. The protocol represents a powerful high-throughput platform to identify genetic determinants of fungal fitness during infection, while also offering important benefits in terms of scalability, versatility, and reduction in animal use. Overall, this work constitutes an important methodological contribution that will be of broad interest to researchers studying fungal pathogenesis and functional genomics. I therefore strongly support the publication of this article after minor revisions. I just have a minor comment. In some paragraphs, the past tense is used, whereas the infinitive form or passive are employed throughout most of the protocol. Two examples are provided below, but additional paragraphs that should be revised for consistency: 1. A BD Influx Cell Sorter was used to sort epithelial cells that contained internalized A. fumigatus spores using a modified version of the gating strategy described in. 22 Unlike 22 the knockout library was constructed in a non-fluorescent background; therefore, A. fumigatus pooled mutants were pre-stained with FITC prior to infection. Epithelial cells that had internalized A. fumigatus were defined as FITC + /CFW - , whereas epithelial cells that had A. fumigatus attached to their surface were defined as FITC + /CFW + and were excluded. · 6. Incubate sample at 37°C for 20 min. · 7. Then, 700 μL of chloroform:isoamyl alcohol (24:1) was added to the sample and vortexed for 10 s. Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Molecular microbiology, bacterial genetics, bacterial pathogenesis, microbial interactions host-pathogen interactions I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Amaro F. Reviewer Report For: Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during infection of mammalian cells [version 1; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 14 :1476 ( https://doi.org/10.5256/f1000research.190035.r465897 ) The direct URL for this report is: https://f1000research.com/articles/14-1476/v1#referee-response-465897 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Beattie S. Reviewer Report For: Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during infection of mammalian cells [version 1; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 14 :1476 ( https://doi.org/10.5256/f1000research.190035.r457192 ) The direct URL for this report is: https://f1000research.com/articles/14-1476/v1#referee-response-457192 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 05 Mar 2026 Sarah Beattie , The University of Iowa, Iowa City, Iowa, USA Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.190035.r457192 This work by Gago et al. describes a bar-seq method for large-scale evaluation of A. fumigatus mutant strain interactions with host cells. There is clear rationale presented for development of this methodology which fills a need in the field ... Continue reading READ ALL This work by Gago et al. describes a bar-seq method for large-scale evaluation of A. fumigatus mutant strain interactions with host cells. There is clear rationale presented for development of this methodology which fills a need in the field for the ability to perform large-scale, parallel fitness comparisons of mutant strains. This method will enable rapid identification of pathogenesis related genes among many uncharacterized genes in A. fumigatus and will ultimately reduce the number of animals required to identify novel genes of interest. Bar-seq in A. fumigatus will have broad applications from host cell interactions to stress- and drug-related phenotypes, identification of mechanism of action of new antifungals, and pathogenesis in animal models. These methods are comprehensive and contain most of the appropriate details to perform the experiments. The authors address important considerations and technical limitations to guide experimental design, data analysis, and interpretations (for example considerations of growth rates in relevant media, avoiding hyphae in conidial preps, etc.). The only notable missing information is mention of amplification bias and steps to mitigate this in library prep and data analysis. Though this method does not describe creation of the barcoded library and this validation may be present elsewhere, methods to address and mitigate amplification bias of individual barcodes should be mentioned and/or cited. Barcode bias can be intrinsic (barcodes with differential amplification efficiency) or condition dependent (based on amplification parameters, temperature ramp rates, variation in component concentration etc). This is an important consideration with BarSeq and will be especially important for people who are using different libraries or developing their own. The authors provided all the source data including raw data generated within and code text for analysis. The conclusions about this method and its performance are supported by the data presented in the article. They present three methods for the identification of intra- vs extra-cellular conidia with comparative analysis of the data with reasonable hypotheses for the observed differences. Overall, this is a rigorous methodology that will have broad use for the study of A. fumigatus . Minor comments: Typo in section 2.1.2 “sings of vacuolization” should be signs Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Partly If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Molecular mycology, antifungal drug discovery and development, pathogenesis of Aspergillus fumigatus I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Beattie S. Reviewer Report For: Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during infection of mammalian cells [version 1; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 14 :1476 ( https://doi.org/10.5256/f1000research.190035.r457192 ) The direct URL for this report is: https://f1000research.com/articles/14-1476/v1#referee-response-457192 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 31 Dec 2025 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 3 Version 1 31 Dec 25 read read read Sarah Beattie , The University of Iowa, Iowa City, USA Francisco Amaro , Universidad Complutense de Madrid, Madrid, Spain Joshua D Kerkaert , Cornell University, Ithaca, USA Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Kerkaert J. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 14 Mar 2026 | for Version 1 Joshua D Kerkaert , Cornell University, Ithaca, new, USA 0 Views copyright © 2026 Kerkaert J. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Earle et. al. describe a method for barcoded sequencing analysis of Aspergillus fumigatus mutant strains and implement this method using an epithelial cell culture model. While variations of this method have been available in a number of bacterial species for some time now, there is a significant need for development of functional genomics methods in fungal pathogens. Thus, this publication, along with the related publication by van Rhijn et. al., mark a significant advancement to addressing this need. The implementation of the Bar-seq method using an epithelial cell culture model also exemplifies the utility of this method in prioritizing genes and pathways of interest for future validation by in vitro and in vivo studies. The method is presented in a relatively comprehensive manner, and the details necessary to replicate the experiments presented and apply the method to other questions related to the 111 kinase strains are included. While the method as presented is somewhat limited to the 111 kinase strain set, the authors do reference the papers where construction of the strains is outlined (Zhao et. al. and van Rhijn et. al.). Thereby, making it possible to piece together the information necessary to expand the method to either custom strain sets or other strains from the COFUN library when available. The conclusions made throughout are largely supported by the data. Overall, this method has the potential to be a great boon to the A. fumigatus community and beyond. There are several textual issues/errors throughout the paper that should be addressed however: Ideally the raw sequencing data should be archived and the relevant accession information provided. On top of being an important data availability practice, the datasets presented here would make excellent training datasets for the method presented. Coupled with the provided code this would allow interested individuals an opportunity to replicate the results while learning to apply the method to to their own experiments/data. Throughout the manuscript it is unclear what phenotypes are due to a difference in initial uptake by the epithelial cells, versus survival and/or growth after uptake. Given the initial uptake would heavily bias the final population of cells, clarification of interpretation and further discussion on methods to control for this caveat would be useful. The critical control of sequencing the initial mutant pool is mentioned as well as the utility of a culture media condition. However, neither of these two controls account for initial uptake. Thus, a change in relative frequency of a barcode at the end of the experiment, as presented in the manuscript, could either be due to a higher/lower uptake, higher/lower survival from epithelial cell killing, or higher/lower growth rates within the epithelial cells. A relatively straightforward control would be taking samples after washing as this would be the population up taken the epithelial cells. Figure 3 has a duplication of the FC survival vs MFIG001 graph. Additionally, it appears that ∆AFUB_059090 may have slightly increased growth on the image. Is this also true when grown on the cell culture media? If not the relevant text and interpretations should be altered to fit the data. AFUB_059090 also has a white spot on the left of the colony. Is the strain sectoring or is this an artifact of the image and its processing? Pairwise statistical comparisons are performed (presumably using DESeq2). However, the DESeq2 code in the extended data only produces variance-stabalized transformed counts and would not perform statistical analyses as it is currently written. Please update with the lines of code necessary to obtain pairwise comparisons. Some of the text in figures 1 and S2 is too small to read (particularly when printed). It would be helpful to the reader if the text sizes where increased. It would be useful to add the following details relevant to the method presented including: What depth of sequencing should one aim for with a 111 barcode library? For the PCRs in Table 2 and Table 3 is there a specific concentration (or concentration range) used for the template input (DNA in Table 2 and PCR product in Table 3)? If this is not a concern for barcode amplification and library preparation a short statement regarding that would be useful for those replicating the method. What size of beads were used for bead beating? Several text errors can be found throughout the manuscript, some of which could confuse an individual trying to execute this method: 2.4.1 - 2: CUTADAPT not CUDADAPT sings of vacuolization should be signs 2.5: Bowtie2 does not perform statistical analyses. Please update with the program/package/platform/otherwise that was used (presumably DESeq2 in R based on what is stated in 2.6) Figure 2A: several strains are denoted with two \"∆\" signs. If those are not double knockouts please remove the second ∆. Otherwise, state what the second gene knocked out is. nrc2 is initially referred to as an N. crassa gene (proper nomenclature would technically be \"nrc-2\" if this is the case). Later nrc-2 is referred to as an S. cerevisiae gene. Please correct this Supplementary Figure 2: \"Cut-offs of log2FC >2 (pink) or <2 (blue)\" is missing the negative sign Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Partly Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Molecular mycology, metabolism, genetics, pathogenesis of Aspergillus fumigatus. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Kerkaert JD. Peer Review Report For: Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during infection of mammalian cells [version 1; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 14 :1476 ( https://doi.org/10.5256/f1000research.190035.r453604) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-1476/v1#referee-response-453604 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Amaro F. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 14 Mar 2026 | for Version 1 Francisco Amaro , Universidad Complutense de Madrid, Madrid, Spain 0 Views copyright © 2026 Amaro F. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This manuscript presents a highly valuable and well-designed protocol that significantly advances the use of bar-seq approaches to investigate host–pathogen interactions in vitro. The methodology is clearly structured, comprehensive, and carefully optimized, providing practical guidance that will facilitate adoption by other laboratories. Importantly, the comparative evaluation of different strategies to remove extracellular conidia and the inclusion of validation steps strengthen the robustness of the workflow. The protocol represents a powerful high-throughput platform to identify genetic determinants of fungal fitness during infection, while also offering important benefits in terms of scalability, versatility, and reduction in animal use. Overall, this work constitutes an important methodological contribution that will be of broad interest to researchers studying fungal pathogenesis and functional genomics. I therefore strongly support the publication of this article after minor revisions. I just have a minor comment. In some paragraphs, the past tense is used, whereas the infinitive form or passive are employed throughout most of the protocol. Two examples are provided below, but additional paragraphs that should be revised for consistency: 1. A BD Influx Cell Sorter was used to sort epithelial cells that contained internalized A. fumigatus spores using a modified version of the gating strategy described in. 22 Unlike 22 the knockout library was constructed in a non-fluorescent background; therefore, A. fumigatus pooled mutants were pre-stained with FITC prior to infection. Epithelial cells that had internalized A. fumigatus were defined as FITC + /CFW - , whereas epithelial cells that had A. fumigatus attached to their surface were defined as FITC + /CFW + and were excluded. · 6. Incubate sample at 37°C for 20 min. · 7. Then, 700 μL of chloroform:isoamyl alcohol (24:1) was added to the sample and vortexed for 10 s. Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Yes If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Molecular microbiology, bacterial genetics, bacterial pathogenesis, microbial interactions host-pathogen interactions I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Amaro F. Peer Review Report For: Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during infection of mammalian cells [version 1; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 14 :1476 ( https://doi.org/10.5256/f1000research.190035.r465897) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-1476/v1#referee-response-465897 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2026 Beattie S. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 05 Mar 2026 | for Version 1 Sarah Beattie , The University of Iowa, Iowa City, Iowa, USA 0 Views copyright © 2026 Beattie S. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This work by Gago et al. describes a bar-seq method for large-scale evaluation of A. fumigatus mutant strain interactions with host cells. There is clear rationale presented for development of this methodology which fills a need in the field for the ability to perform large-scale, parallel fitness comparisons of mutant strains. This method will enable rapid identification of pathogenesis related genes among many uncharacterized genes in A. fumigatus and will ultimately reduce the number of animals required to identify novel genes of interest. Bar-seq in A. fumigatus will have broad applications from host cell interactions to stress- and drug-related phenotypes, identification of mechanism of action of new antifungals, and pathogenesis in animal models. These methods are comprehensive and contain most of the appropriate details to perform the experiments. The authors address important considerations and technical limitations to guide experimental design, data analysis, and interpretations (for example considerations of growth rates in relevant media, avoiding hyphae in conidial preps, etc.). The only notable missing information is mention of amplification bias and steps to mitigate this in library prep and data analysis. Though this method does not describe creation of the barcoded library and this validation may be present elsewhere, methods to address and mitigate amplification bias of individual barcodes should be mentioned and/or cited. Barcode bias can be intrinsic (barcodes with differential amplification efficiency) or condition dependent (based on amplification parameters, temperature ramp rates, variation in component concentration etc). This is an important consideration with BarSeq and will be especially important for people who are using different libraries or developing their own. The authors provided all the source data including raw data generated within and code text for analysis. The conclusions about this method and its performance are supported by the data presented in the article. They present three methods for the identification of intra- vs extra-cellular conidia with comparative analysis of the data with reasonable hypotheses for the observed differences. Overall, this is a rigorous methodology that will have broad use for the study of A. fumigatus . Minor comments: Typo in section 2.1.2 “sings of vacuolization” should be signs Is the rationale for developing the new method (or application) clearly explained? Yes Is the description of the method technically sound? Yes Are sufficient details provided to allow replication of the method development and its use by others? Partly If any results are presented, are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions about the method and its performance adequately supported by the findings presented in the article? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Molecular mycology, antifungal drug discovery and development, pathogenesis of Aspergillus fumigatus I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Beattie S. Peer Review Report For: Using bar-seq as a proxy to study population dynamics of Aspergillus fumigatus deletion libraries during infection of mammalian cells [version 1; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 14 :1476 ( https://doi.org/10.5256/f1000research.190035.r457192) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-1476/v1#referee-response-457192 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = \"Using bar-seq as a proxy to study population...\".replace(\"'\", ''); var linkedInUrl = \"http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/14-1476/v1\" + \"&title=\" + encodeURIComponent(lTitle) + \"&summary=\" + encodeURIComponent('Read the article by '); var deliciousUrl = \"https://del.icio.us/post?url=https://f1000research.com/articles/14-1476/v1&title=\" + encodeURIComponent(lTitle); var redditUrl = \"http://reddit.com/submit?url=https://f1000research.com/articles/14-1476/v1\" + \"&title=\" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Earle K et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : \"facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com\", services_expanded : \"facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com\", services_custom : [ { name: \"LinkedIn\", url: linkedInUrl, icon:\"/img/icon/at_linkedin.svg\" }, { name: \"Mendeley\", url: \"http://www.mendeley.com/import/?url=https://f1000research.com/articles/14-1476/v1/mendeley\", icon:\"/img/icon/at_mendeley.svg\" }, { name: \"Reddit\", url: redditUrl, icon:\"/img/icon/at_reddit.svg\" }, ] }; var addthis_share = { url: \"https://f1000research.com/articles/14-1476\", templates : { twitter : \"Using bar-seq as a proxy to study population dynamics of Aspergillus.... Earle K et al., published by \" + \"@F1000Research\" + \", https://f1000research.com/articles/14-1476/v1\" } }; if (typeof(addthis) != \"undefined\"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(\".f1r-shares-twitter\").attr(\"href\", \"https://twitter.com/intent/tweet?text=\" + addthis_share.templates.twitter); $(\".f1r-shares-facebook\").attr(\"href\", \"https://www.facebook.com/sharer/sharer.php?u=\" + addthis_share.url); $(\".f1r-shares-linkedin\").attr(\"href\", addthis_config.services_custom[0].url); $(\".f1r-shares-reddit\").attr(\"href\", addthis_config.services_custom[2].url); $(\".f1r-shares-mendelay\").attr(\"href\", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(\".addthis_button_expanded\").each(function(){ var count = $(this).text(); if (count !== \"\" && count != \"0\") $(this).removeClass(\"is-hidden\"); else $(this).addClass(\"is-hidden\"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get(\"/articles/acj/172319/190035\") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay(\"articles\", \"article\", \"190035\"); $(document).ready(function() { $( \"#frame1\" ).on('load', function() { var mydiv = $(this).contents().find(\"div\"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(\".interactive-living-figure-label .icon-more-info\"), titleLivingFigure = tooltipLivingFigure.attr(\"title\"); tooltipLivingFigure.simpletip({ fixed: true, position: [\"-115\", \"30\"], baseClass: 'small-tooltip', content:titleLivingFigure + \" \" }); tooltipLivingFigure.removeAttr(\"title\"); $(\"body\").on(\"click\", \".cite-living-figure\", function(e) { e.preventDefault(); var ref = $(this).attr(\"data-ref\"); $(this).closest(\".living-figure-list-container\").find(\"#\" + ref).fadeIn(200); }); $(\"body\").on(\"click\", \".close-cite-living-figure\", function(e) { e.preventDefault(); $(this).closest(\".popup-window-wrapper\").fadeOut(200); }); $(document).on(\"mouseup\", function(e) { var metricsContainer = $(\".article-metrics-popover-wrapper\"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(\".article-metrics-close-button\").click(); } }); var articleId = $('#articleId').val(); if($(\"#main-article-count-box\").attachArticleMetrics) { $(\"#main-article-count-box\").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(\".new_figshare_widget\"); if (figshareWidget.length > 0) { window.figshare.load(\"f1000\", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr(\"figshare_articleId\") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { \"449310\": 0, \"449311\": 0, \"449308\": 0, \"449309\": 0, \"449307\": 0, \"449316\": 0, \"449314\": 0, \"449315\": 0, \"449312\": 0, \"449313\": 0, \"446782\": 0, \"452030\": 0, \"446783\": 0, \"452031\": 0, \"446780\": 0, \"452028\": 0, \"446781\": 0, \"452029\": 0, \"452026\": 0, \"446779\": 0, \"452027\": 0, \"452025\": 0, \"446788\": 0, \"446786\": 0, \"452034\": 0, \"446787\": 0, \"446784\": 0, \"452032\": 0, \"446785\": 0, \"452033\": 0, \"450518\": 0, \"450519\": 0, \"450516\": 0, \"450517\": 0, \"450515\": 0, \"453598\": 0, \"453599\": 0, \"453596\": 0, \"450524\": 0, \"453597\": 0, \"450522\": 0, \"450523\": 0, \"450520\": 0, \"450521\": 0, \"457190\": 0, \"465895\": 0, \"457191\": 0, \"465894\": 0, \"457188\": 0, \"453604\": 15, \"465893\": 0, \"457189\": 0, \"465892\": 0, \"453602\": 0, \"457186\": 0, \"465891\": 0, \"453603\": 0, \"457187\": 0, \"453600\": 0, \"453601\": 0, \"457185\": 0, \"465900\": 0, \"457194\": 0, \"465899\": 0, \"465898\": 0, \"465897\": 9, \"457192\": 13, \"457193\": 0, \"465896\": 0, \"467455\": 0, \"467454\": 0, \"467453\": 0, \"467452\": 0, \"467451\": 0, }; $(\".referee-response-container,.js-referee-report\").each(function(index, el) { var reportId = $(el).attr(\"data-reportid\"), reportCount = reportIds[reportId] || 0; $(el).find(\".comments-count-container,.js-referee-report-views\").html(reportCount); }); var uuidInput = $(\"#article_uuid\"), oldUUId = uuidInput.val(), newUUId = \"341fbec4-d171-4b2c-8203-beb108ef6679\"; uuidInput.val(newUUId); $(\"a[href*='article_uuid=']\").each(function(index, el) { var newHref = $(el).attr(\"href\").replace(oldUUId, newUUId); $(el).attr(\"href\", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: \"f1000research\", displayName: \"F1000Research\", hostName: \"f1000research.com\", id: \"1\", editorialEmail: \"research@f1000.com\", infoEmail: \"info@f1000.com\", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(\".cookie-warning\").is(\":visible\")) { $(\".sticky\").css(\"margin-bottom\", \"35px\"); $(\".devices\").addClass(\"devices-and-cookie-warning\"); } $(\".cookie-warning .close-button\").click(function (e) { $(\".devices\").removeClass(\"devices-and-cookie-warning\"); $(\".sticky\").css(\"margin-bottom\", \"0\"); }); $(\"#tweeter-feed .tweet-message\").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(\".partner\").on(\"mouseenter mouseleave\", function() { $(this).find(\".gray-scale, .colour\").toggleClass(\"is-hidden\"); }); }); <!-- Sign in --> Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $(\"a[id=googleSignInButton]\").click(function(event){ event.preventDefault(); $(\"input[id=oAuthSystem]\").val(\"GOOGLE\"); $(\"form[id=oAuthForm]\").submit(); }); $(\"a[id=facebookSignInButton]\").click(function(event){ event.preventDefault(); $(\"input[id=oAuthSystem]\").val(\"FACEBOOK\"); $(\"form[id=oAuthForm]\").submit(); }); $(\"a[id=orcidSignInButton]\").click(function(event){ event.preventDefault(); $(\"input[id=oAuthSystem]\").val(\"ORCID\"); $(\"form[id=oAuthForm]\").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($(\"#sign-in-form-gfb-popup\")); $(\".target-field\").each(function () { var uris = $(this).val().split(\"/\"); if (uris.pop() === \"login\") { $(this).val(uris.toString().replace(\",\",\"/\")); } }); });","source_license":"CC-BY-4.0","license_restricted":false}