{"paper_id":"234f8d08-2b41-4026-aa20-9c5ea2b5e23c","body_text":"LINC00162 Silencing Enhances Sorafenib Sensitivity and Inhibits Thyroid Cancer Cells Progression through Modulation of MAPK Signaling and Apoptosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article LINC00162 Silencing Enhances Sorafenib Sensitivity and Inhibits Thyroid Cancer Cells Progression through Modulation of MAPK Signaling and Apoptosis Maryam Hejazi, Seyedeh Zahra, Saba Abedimanesh, Ramin Heshmat, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6159534/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 13 Aug, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Many studies have reported aberrant expression of the lncRNAs and indicated their role in cancer progression and drug resistance across various cancers. In this study, we aimed to evaluate the effect of the LINC00162 lncRNA in the chemosensitivity of thyroid cancer cells, both individually and in combination with sorafenib on various biological processes. In this regard, we conducted our experiments in several groups: 1) LINC00162 siRNA transfected cells, 2) Sorafenib treated cells, 3) Cells that received siRNA transfection and sorafenib treatment combination 4) Control group. MTT assay results revealed that siRNA-mediated silencing of the LINC00162 reduced the viability of the BC-PAP thyroid cancer cells, and increased the sensitivity of the cancerous cells to sorafenib by reducing its IC50. Flow cytometry assessment of apoptosis and cell cycle progression indicated that LINC00162 silencing induced apoptosis and Sub-G1 cell cycle arrest while its combination with sorafenib significantly increased apoptosis rate and also arrested cells in the G2-M phase in addition to Sub-G1 phase. This combination treatment increased the expression of apoptosis-related genes Bax, Caspase3, and Caspase9 while decreasing Bcl-2 expression. Additionally, significant inhibition of cell-cycle related gene c-myc and upregulation of p53 were observed following combination treatment. Furthermore, the combination therapy reduced the migration of the BC-PAP cells through the downregulation of MMP-3 and MMP-9. Colony sizes and numbers also decreased following siRNA-mediated silencing of LINC00162 and sorafenib treatment. qRT-PCR analysis of stemness-involved genes, including Nanog, Sox2, Cd44, and CD133 confirmed colony formation assay’s findings. To understand the underlying mechanisms of LINC0162 lncRNA in thyroid cancer progression, we evaluated the expression of the MAPK pathway genes. Our finding indicated that LINC00162 silencing, in combination with sorafenib, reduced the expression of the MAPK, RAS, and RAF genes. From our findings, we can be conclude that LINC00162 silencing individually and combined with sorafenib reduced the progression and viability of thyroid cancer cells through modulating genes involved in key pathways and could be considered a new therapeutic approach in papillary thyroid cancer (PTC) treatment. Biological sciences/Cancer Biological sciences/Cell biology LINC00162 Thyroid Cancer Sorafenib Chemosensitivity MAPK Pathway Apoptosis Autophagy lncRNA Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 1. Introduction Thyroid cancer, ranked as the 9th most prevalent cancer, accounted for 586,000 cases globally in 2020 [ 1 ]. The incident rate of thyroid cancer in affluent and medium-income countries has steadily increased from 1998 to 2012 [ 2 ]. Differentiated thyroid cancer (DTC) as a subtype of thyroid cancer consists of papillary thyroid cancer (PTC) and follicular thyroid cancer (FTC) [ 3 ]. Common tumor treatments such as radiotherapy, surgery, and also radioactive iodine (RAI) are being used in DTC patients [ 4 ]. Among various histological subtypes of thyroid cancer, PTC, which accounts for 80% of cases, has the highest incidents compared to other subtypes. [ 5 , 6 ]. Despite the low mortality rates associated with PTC, its aggressive nature leads to recurrence and metastasis, potentially resulting in death [ 7 ]. Therefore, investigating the underlying mechanisms and developing novel therapies are essential for thyroid cancer treatment. . Increased activation of the mitogen-activated protein kinase (MAPK) pathway is observed in various cancers, including PTC. Point mutations of the RAS and BRAF genes, which activate the MAPK pathway, have been identified in two-thirds of PTC. The kinase cascades involving RAS – RAF – MEK, and ERK are elevates following MAPK activation [ 8 ]. In this regard, novel therapies targeting the MAPK pathway could enhance the survival of patients. Sorafenib (Nexavar, BAY 43-9006), is a new molecular targeted therapy currently used for treatment of thyroid cancer. The efficiency of Sorafenib in thyroid cancer patients was demonstrated by two phase II clinical trials [ 9 , 10 ]. Sorafenib functions as a multikinase inhibitor, targeting serine/threonine kinases RAF1, as well as targets VEGF receptors (VEGF-R) 1 to 3, platelet-derived growth factor receptor (PDGFR), RET, and c-KIT [ 10 , 11 ]. However, Sorafenib only improves the progression-free survival rate for 5 months compared to the placebo in patients with radioactive iodine refractory locally advanced or metastatic differentiated thyroid cancer. Also, adverse effects, particularly hand-foot skin reaction, led to decreasing the drug dose, interruptions, and discontinuation of clinical trials. Other side effects of Sorafenib include diarrhea, fatigue, alopecia, and weight loss [ 12 ]. In this context, combining Sorafenib with other molecular agents and targeted therapies may enhance efficiency and reduce the required dose of chemotherapy drugs, potentially improving treatment outcomes. Noncoding RNAs (ncRNAs), which constitute 90% of the genome, cannot encode proteins. Based on their sizes, ncRNAs are categorized into two subunits: short ncRNAs (including small interfering RNA, PIWI-interacting RNAs, and miRNAs) and long ncRNAs (LncRNAs). ncRNAs are involved in various biological processes, including cell differentiation, inflammation, glucose metabolism and different types of cancers [ 13 – 15 ]. LncRNAs, which are 200 nucleotides in length, can regulate the activity and binding of transcription factors. They also modulate the stability of mRNA directly or through interacting with miRNAs and preventing their binding to mRNA [ 16 ]. Dysregulated expression of lncRNA’s has been observed in various cancers. Their altered expression can act as an oncogene role or contribute to tumorigenesis and the development of malignancies [ 17 ]. Various studies investigated the role of different lncRNAs in thyroid cancer, reporting their involvement in oncogenesis, metastasis, apoptosis, and invasion of thyroid cancer [ 18 , 19 ]. For instance, a study demonstrated the prognostic role of MIAT lncRNA in PTC, revealing that MIAT lncRNA enhances PTC cell invasion through the miR-150/EZH2 signaling pathway [ 18 ]. Also, overexpression of IQCH-AS1 lncRNA, which is downregulated in doxorubicin-resistant thyroid cancer cells, sensitized these cancerous cells to doxorubicin [ 20 ]. In 2016, Piipponen et al. introduced lincRNA PICSAR (P38 Inhibited Cutaneous Squamous cell carcinoma-associated lincRNA), also known as LINC00162. They found that this previously uncharacterized lncRNA is overexpressed in Keratinocyte-derived cutaneous squamous cell carcinoma. They reported that lncRNA PICSAR promotes cSCC progression through the ERK1/2 pathway, and knockdown of this lncRNA inhibited migration and invasion of the cSCC cells [ 21 ]. Furthermore, it was reported that PICSAR enhances the expression of the PI3K/AKT/mTOR by targeting miR-588, promoting hepatocellular carcinoma [ 22 ]. Moreover, the role of the lncRNA LINC00162 in various malignancies, including pancreatic cancer, hepatocellular carcinoma, and bladder cancer, has been demonstrated [ 22 – 24 ]. In our previous study, bioinformatic analysis and tissue data revealed increased expression of LINC00162 in thyroid cancer tissue. These findings are currently under review for publication and will be available in the near future. However, there is no study on the role of the lncRNA LINC00162 in thyroid cancer and its role in the chemosensitivity of chemotherapy drugs. Thus, in the present study, we first investigated the effect of the lncRNA PICSAR silencing on thyroid cancer cell viability. Next, we examined its role in the sensitivity of the thyroid cancer cells to Sorafenib. Finally, we investigated the effect of the LINC00162 silencing, Sorafenib treatment, and combination therapy on the progression, apoptosis, cell cycle, and invasion of the BC-PAP thyroid cancer cells, while also evaluating the expression of the genes involved in these pathways. Furthermore, we analyzed the expression of the stemness-related genes and genes involved in the MAPK pathway. Results obtained from our study revealed that lncRNA LINC00162 silencing increases the sensitivity of BC-PAP cancer cells to Sorafenib. Also, the combination of the LINC00162 siRNA and Sorafenib reduces viability, progression, and invasion of cancerous cells. Taken together, lncRNA PICSAR silencing can be utilized individually in treating thyroid cancer; also, by enhancing the chemosensitivity of thyroid cancer cells, combination therapy can be considered as a new therapeutic intervention in thyroid cancer treatment. 2. Materials and methods 2.1 Cell culture The BC-PAP cancer cell line of human papillary thyroid cancer was purchased from the National Cell Bank of Iran (Pasteur Institute, Tehran, Iran). The cell line was cultivated in the RPMI 1640 (Gibco, USA) enriched with 10% FBS (Gibco, USA) and penicillin/streptomycin (100 µg/ml and 100 IU/ml, respectively). The cells were kept in an incubator (37 ̊C, 5% CO2, 95% humidity). After reaching 70% confluency, the cells were subcultured using 0.25% trypsin-EDTA (Gibco, USA). 2.2 Transfection efficiency The cells were seeded in a 6-well plate at a density of 2.5*10 5 cells per well. Following the manufacturer's protocol, siRNA labeled with the FITC was transfected into the seeded BC-PAP cells using the Lipofectamine 3000 (Thermo Fisher Scientific). The efficiency of the transfection was evaluated by flow cytometry (Auto-analyzer 10 Miltenyi Biotec, Germany). 2.3 Dose and time optimization of the siRNA The cells were seeded in a 6-well plate at a density of 2.5×10 5 cells per well. 24 hours later, the various doses of 60, 80, and 100 pmol of LINC00162 siRNA targeting the lncRNA, which was synthesized by BIONEER company (Table 1 ), and negative control siRNA (Negative control, 5' UUCUCCGAACGUGUCACGUUU 3'), siRNA guide strand as scramble without any target) transfected into cultured cells using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 6 hours, following the manufacturer’s protocol. Complete media containing 10% FBS were added to each well six hours later. In order to determine the optimum dose and time of the transfection, the levels of the LINC00162 were evaluated after 24, 48, and 72 hours of transfection by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Table 1 siRNA LINC00162 sequence LIINC00162 Sense CUCAGACAUCUGCAGUCACUUCACA Antisense UGUGAAGUGACUGCAGAUGUCUGAGGA 2.4 RNA extraction and qRT-PCR Total RNA of the BC-PAP cells isolated by Trizol RNA extraction kit (GeneAll, Korea). The purity and concentration of the isolated RNAs were determined with a NanoDrop spectrophotometer (Thermo Fisher Scientific Life Sciences, USA) by measuring 260 and 280 nm absorbance. A reverse transcription kit (AddScript cDNA Synthesis Kit) was used in order to synthesize Complementary DNA (cDNA) from 1 microgram of the isolated RNA. Isolated RNAs reverse transcribed into cDNA using a Thermal cycler (Bio Rad, USA). qRT-PCR conducted by qRT-PCR (Roche, Switzerland) and the relative mRNA expression of the lncRNA LINC00162, Bax, Bcl2, Caspase3, Caspase9, P53, c-myc, MAPK, RAS, RAF, Nanog, Sox2, CD44, and CD133. were evaluated (Ampliqon™ RealQ plus 2X Real-Time PCR Master Mix, Denmark) and calculated using the 2 −ΔΔCt method. The expression of the LINC00162 lncRNA and genes were normalized with GAPDH. The sequence of primers used in this experiment was blasted using the NCBI’s Primer-BLAST (Table 2 ). Table 2 Primer Sequences Primers Sequences Bax Forward: 5′ GACTCCCCCCGAGAGGTCTT 3′ Reverse: 5′ ACAGGGCCTTGAGCACCAGTT 3′ Bcl-2 Forward: 5′ CTGTGGATGACTGAGTACCTG 3′ Reverse: 5′ GAGACAGCCAGGAGAAATCA 3 Caspase3 Forward: 5′ GGAAGCGAATCAATGGACTCTGG 3′ Reverse: 5′ GCATCGACATCTGTACCAGACC 3 Caspase9 Forward: 5′ CCAGAGATTCGCAAACCAGAGG 3′ Reverse: 5′ GAGCACCGACATCACCAAATCC 3′ P53 Forward: 5′ CCTCAGCATCTTATCCGAGTGG 3′ Reverse: 5′ TGGATGGTGGTACAGTCAGAGC 3′ CDK1 Forward: 5′ GGAAACCAGGAAGCCTAGCATC 3′ Reverse: 5′ GGATGATTCAGTGCCATTTTGCC 3′ STAT1 Forward: 5′ ATCAGGCTCAGTCGGGGAATA 3′ Reverse: 5′ TGGTCTCGTGTTCTCTGTTCT 3′ c-myc Forward: 5′ AGGCTCTCCTTGCAGCTGCTC 3′ Reverse: 5′ AAGTTCTCCTCCTCGTCGCAGT 3′ Nanog Forward: 5′ CTAAGAGGTGGCAGAAAAACA 3′ Reverse: 5′ CTGGTGGTAGGAAGAGTAAAGG 3′ Sox2 Forward: 5′ ACATGTGAGGGCCGGACAGC 3′ Reverse: 5′ TTGCGTGAGTGTGGATGGGATTGG 3′ CD44 Forward: 5′ CAAGCCACTCCAGGACAAGG 3′ Reverse: 5′ ATCCAAGTGAGGGACTACAACAG 3′ CD133 Forward: 5′ GACCGACTGAGACCCAACATC 3′ Reverse: 5′ GGCTAGTTTTCACGCTGGTCA 3′ MAPK1 Forward: 5′ CCCAAATGCTGACTCCAAAGC 3′ Reverse: 5′ GCTCGTCACTCGGGTCGTAAT 3′ Ras (kras) Forward: 5′ CTCCCTGTGTCAGACTGCTCTTT 3′ Reverse: 5′ GGCCTTGCAACCTTGGTCTCTTC 3′ RAF 1 Forward: 5′ TTTCCTGGATCATGTTCCCCT 3′ Reverse: 5′ ACTTTGGTGCTACAGTGCTCA 3′ LINC00162 Forward: 5′ GCTCTAACTCAGGGCTCCA 3′ Reverse: 5′ TGCTCCCCACCTAAGCAATG 3′ GAPDH Forward: 5′ CAAGATCATCAGCAATGCCT 3′ Reverse: 5′ GCCATCACGCCACAGTTTCC 3′ 2.5 MTT assay The half maximal inhibitory concentration (IC50) of Sorafenib was determined by MTT assay. In this regard, BC-PAP cells were seeded at a density of 7 × 10 3 cells per well. 24 hours following the cultivation, seeded cells were treated with various concentrations of Sorafenib ranging from 0.1 to 100 µg/ml. The next day, 50 µL of MTT solution (5 mg/mL, Sigma-Aldrich, Germany) was added to each well, and the plate was incubated for 4 hours. In order to dissolve formazan crystals, dimethyl sulfoxide was appended into each well, and the plate was incubated for 30 minutes. The absorbance (OD) at 570–620 nm was measured by an ELISA microplate reader (Tecan, Switzerland). MTT assay was also performed to investigate the LINC00162 silencing effect on the BC-PAP cells' sensitivity to Sorafenib. Thus, first, cells were transfected with LINC00162 siRNA and then treated with Sorafenib. IC50 of the individual groups treated with Sorafenib and the combination group were measured. The viability of the cells following LINC00162 siRNA transfection was also determined with an MTT assay. 2.6 Annexin/PI apoptosis assays To investigate the effect of the LINC00162 siRNA, both individually and in combination with Sorafenib, on apoptosis induction in BC-PAP cell lines, an apoptosis assay was conducted. First, BC-PAP cells were seeded at a density of 1.5 × 10 5 cells per well and incubated for 24 hours. LINC00162 siRNA was transfected into the cells, and 24 hours later, the relevant groups were treated with Sorafenib and incubated for an additional 24 hours. Afterward, the cells were harvested from each well and washed with PBS. Cells of each group were resuspended in binding buffer and stained with a V-FITC/PI staining kit (Immunostep, Spain), according to provided protocols. Apoptosis induction in each group was assessed with flow cytometry (Auto-analyzer 10 Miltenyi Biotec, Germany). All experiments were conducted in triplicate. 2.7 DAPI staining Apoptosis induction based on chromatin fragmentation was investigated with 4′,6-diamidino‐2 phenylindole (DAPI) staining. Firstly, BC-PAP cells were seeded in a 96-well plate with a density of 7 × 10 3 cells per well. The relevant groups transfected with LINC00162 siRNA and subsequently, treated with Sorafenib. Then, the cells were fixed with 100 µL of 4% paraformaldehyde and incubated for 1.5 hours. Fixed cells were washed with PBS multiple times, permeated with 0.1% Triton-X-100, and incubated for 15 minutes. After a wash step with PBS, the cells of each group were stained with 100 µl of DAPI (0.1%, Sigma-Aldrich, USA) and incubated for an additional 10 minutes in dark condition. Morphological changes observed with the DAPI channel of Cytation 5 fluorescence imaging system (BioTK). 2.8 Cell cycle assay The impact of the LINC00162 siRNA, both individually and combined with Sorafenib on the cell cycle progression of BC-PAP cells was examined by flow cytometry. First, cells were seeded in a 6-well plate at a density of 1.5 × 10 5 cells per well. LINC00162 siRNA was transfected to cells, and after 24 hours, transfected groups were treated with Sorafenib, and the plate was incubated for an additional 24 hours. After incubation time, the cells were harvested and fixed with cold 80% ethanol at -20 ̊C overnight. Then, fixed cells were centrifuged, resuspended in 500 µl of cold PBS containing 5 µL of RNase A, and incubated for 30 minutes. Incubated cells were centrifuged and resuspended at DAPI and triton containing PBS. After 10 minutes of incubation, stained cells were centrifuged and washed with PBS. Cell cycle arrest in each group was analyzed using flow cytometry (Auto-analyzer 10 Miltenyi Biotec, Germany). 2.9 Colony formation assay The inhibitory effect of siRNA-mediated LINC00162 lncRNA inhibition and treatment with Sorafenib on the colony formation ability of BC-PAP thyroid cancer cells was investigated with the clonogenic assay. Firstly, 2.5 × 10 4 cells were seeded in a 6-well plate, transfected with LINC00162 siRNA, treated with Sorafenib, and the plate was incubated for 10 days. Afterward, each group was washed with PBS, and paraformaldehyde (5%) was used to fix each group. Each group was stained with crystal violet for 20 min, and the colonies were photographed. 2.10 Wound healing assay Cellular migration of the BC-PAP thyroid cancer cells following LINC00162 inhibition and treatment with Sorafenib was assessed with the wound healing assay (scratch). BC-PAP cells were seeded in a 24-well plate with a density of 7.5 × 104 cells per well for this purpose. LINC00162 siRNA was transfected into the seeded cells, and 24 hours later, the relevant groups were treated with Sorafenib. A yellow pipet tip was employed to scratch the cellular monolayers, and the migration distance of the BC-PAP cells to the wound area was captured at 0, 24, and 48 hours. The rate of the open wound area was calculated with Imaje j software. 2.11 Statistical analysis All data are expressed as mean ± standard deviation and P < 0.05 was considered statistically significant. Statistical analysis was conducted using GraphPad Prism 8.0. Flow cytometry data were analyzed by Flowjo, and wound healing assay images were analyzed with image J. The differences between two groups and multiple groups were analyzed using Student’s t-tests and one-way analysis of variance (ANOVA), respectively. 3. Results 3.1 Efficient transfection of siRNA Flow cytometry data showed that FITC-labeled siRNA transfected into BC-PAP cells with 87.7% efficiency compared to the untransfected control group and demonstrated the effectiveness of Lipofectamine in delivering siRNA to BC-PAP cancer cells (Fig. 1 ). 3.2 PICSAR siRNA reduced expression of the LINC00162 lncRNA In order to determine the optimum dose of the LINC00162 siRNA, BC-PAP cells were transfected with various doses of the siRNA (60, 80, 100 pmol) for 24, 48, and 72 hours. qRT-PCR results showed that the transfection of the 80 pmol of the siRNA significantly reduced LINC00162 expression (Fig. 2 A). Also, the transfection of the siRNA following 48 hours, significantly decreased the expression of the LINC00162 compared to the untransfected and NC groups (Fig. 2 B). Thus, 80 pmol was selected as the optimum dose, while 48 hours was chosen as the optimum time of the transfection for the subsequent experiments. 3.3 Silencing of the LINC00162 lncRNA reduced the viability of the cells The MTT assay was used to determine the viability of the BC-PAP cells following siRNA-mediated silencing of the LINC00162 lncRNA. BC-PAP cells were transfected with the optimum dose of 80 pmol for 48 hours The results showed no significant differences in the viability of the cells transfected with scramble siRNA compared to the untransfected control cells. In addition, the MTT assay results showed a significant decrease in the viability of the cells transfected with LINC00162 siRNA compared to the control and NC groups (Fig. 3 ). 3.3 Inhibition of LINC00162 lncRNAs increased sensitivity of BC-PAP cells to Sorafenib MTT assay was performed to determine IC50 of the Sorafenib individually and following LINC00162 inhibition. BC-PAP cells were treated with various concentrations of sorafenib ranging from 0.1 µg/ml to 100 µg/ml. The results showed that 11.48 µg/ml of sorafenib reduced the viability of the cells by 50% compared to the untreated control group. However, the IC50 of the sorafenib following LINC00162 siRNA transfection was determined as 7.760 µg/ml (Fig. 4 ). This reduced IC50 of the Sorafenib in the combination group indicates that LINC00162 silencing decreased the efficient dose of sorafenib by increasing the sensitivity of the BC-PAP cells to the chemotherapy drug. 3.4 siRNA-mediated inhibition of LINC00162 lncRNAs combined with Sorafenib induced apoptosis AnnexinV/PI assays were performed to assess the effect of LINC00162 inhibition and its combination with Sorafenib on the apoptosis of BC-PAP cells. Flow cytometry results showed that the rate of apoptosis induced by LIN00162 siRNA and Sorafenib treatment individually were 23% and 25.88%, respectively. This rate increased to 35.6% in the combination treatment group (Fig. 5 A). These findings suggested that while individual treatments of LINC00162 inhibition and treatment with Sorafenib significantly induced apoptosis compared to the control group (***p < 0.001 and ****p < 0.0001, respectively), apoptosis rate in the combination group with LINC00162 inhibition and Sorafenib treatment was significantly higher than individual treatments and control group (***p < 0.0001) (Fig. 5 B). A chromatin fragmentation assay with DAPI staining also confirmed apoptosis assay results and showed higher number of apoptotic cells in the combination therapy group compared to individual treatments (Fig. 5 C). To confirm flow cytometry and DAPI staining assay results, relative mRNA expression of the genes involved in the apoptosis pathway, including Bax, Bcl2, Caspase 3, and Caspase 9, were evaluated by qRT-PCR. The results indicated that while siRNA-mediated silencing of the LINC00162 lncRNA had no significant effect on the expression of the pro-apoptotic Bax gene, Sorafenib treatment significantly increased the expression of the Bax (***p < 0.001) compared to the control group. Also, LINC00162 siRNA transfection followed by Sorafenib treatment increased relative Bax mRNA expression more than individual treatments (****p < 0.0001). Furthermore, the qRT-PCR results indicated that LINC00162 silencing and sole treatment with Sorafenib significantly elevated mRNA levels of the proapoptotic caspase 3 and caspase 9 genes while suppressing the expression of the anti-apoptotic gene Bcl-2. Furthermore, siRNA transfection combined with Sorafenib treatment significantly upregulated pro-apoptotic Caspase 3 (****p < 0.0001) and Caspase 9 (****p < 0.0001) genes expression while downregulating the expression of the anti-apoptotic Bcl-2 compared to the individual treatments (Fig. 6 ). 3.5 siRNA-mediated inhibition of LINC00162 lncRNAs combined with Sorafenib induced cell cycle arrest In this study, flow cytometry analysis was performed to determine how LINC00162 silencing and combination of Sorafenib affected BC-PAP thyroid cancer cell cycle progression and to evaluate cell cycle distribution. In the siRNA transfected group, LINC00162 silencing in BC-PAP cells increased the percentage of cells in the Sub-G1 phase from 4.28% in the control group to 6.38%. Sorafenib treatment increased the rate of cells arrested in the Sub-G1 (12.8%) and G2/M (30.5%) phases. The LINC00162 silencing and Sorafenib treatment combination increased the Sub-G1 arrested cell rate to 21.6%. Also, combination treatment increased cell distribution in the G2-M phase (26%) compared to the control group (16.9%). However, the rate of G2-M arrested cells that had been increased by Sorafenib (30.5%) was slightly reduced in the combination group (26%) (Fig. 7 A, B). To further confirm cell cycle assay findings, we evaluated the expression of the genes involved in the cell cycle progression. The qRT-PCR results showed that the expression levels of P53 significantly increased (***p < 0.001) following LINC00162 silencing. In addition, sorafenib treatment significantly upregulated P53 expression (****p < 0.0001) compared to the control group. With the combination of LINC00162 inhibition and Sorafenib treatment, relative mRNA expression of the P53 increased significantly compared to the control group (****p < 0.0001) and individual treatments (Fig. 7 C). These findings confirm the results of cell cycle assay. To further investigate the role of LINC00162 lncRNA in cell cycle progression, we evaluated the expression of the c-myc and cyclin-D genes, which are crucial in regulating cell cycle progression. qRT-PCR results showed that while LINC00162 inhibition (****p < 0.0001) and treatment with Sorafenib (****p < 0.0001) reduced c-myc expression in BC-PAP thyroid cancer cells, combination of these therapeutic methods significantly reduced of c-myc expression compared to control (****p < 0.0001) and individual groups (****p < 0.0001). (Fig. 7 C). 3.6 siRNA-mediated inhibition of LINC00162 lncRNAs combined with Sorafenib inhibited stemness ability of the BC-PAP cells Colony formation and stemness of BC-PAP cells examined by colony formation assay. The results showed that while transfection of the LINC00162 siRNA slightly reduced the number of the formed colonies, Sorafenib treatment decreased the number and size of the colonies. Furthermore, the size and the number of colonies in the group transfected with siRNA and treated with Sorafenib significantly decreased compared to control and individual treatment groups (Fig. 8 A). To evaluate the impact of combination treatment on stemness of the BC-PAP cells, mRNA fold changes of the Nanog, Sox2, CD44, and CD133 genes ,key players in the stemness and self-renewal of cancer cells—were investigated using qRT-PCR. The results indicated that in cells whereLINC00162 was silenced by siRNA transfection, the expression of Nanog (****p < 0.0001), Sox2 (****p < 0.0001), and CD44 (**p < 0.01) significantly decreased compared to the control group. However, no significant downregulation was observed in the expression of the CD133 following LINC00162 silencing. Sorafenib treatment also significantly downregulated expression of the Nanog (****p < 0.0001), Sox2 (****p < 0.0001), CD44 (****p < 0.0001, and CD133 (***p < 0.001). Furthermore, the qRT-PCR results demonstrated that combining the LINC00162 siRNA and Sorafenib treatment led to a greater decrease (****p < 0.0001) in the expression of the Nanog, Sox2, CD 44, and CD 133 genes than either treatment alone. These findings confirm the role of LINC00162 lncRNA in the stemness of the BC-PAP cancer cells (Fig. 8 B). 3.7 siRNA-mediated inhibition of LINC00162 lncRNAs combined with Sorafenib inhibited migration of the BC-PAP cells The effect of the LINC00162 siRNA and Sorafenib, both individually and in combination, on the migration of the BC-PAP cells was investigated by wound healing assay. While siRNA-mediated silencing of the LINC00162 lncRNA slightly reduced the migration ability of the BC-PAP cancer cells, Sorafenib treatment led to a more significant reduction in migration compared to the control group. Furthermore, LINC00162 siRNA and Sorafenib combination significantly decreased the migration of the BC-PAP cells, with a higher open wound area rate in this group compared to control (****p < 0.0001) and individually treated groups with LINC00162 siRNA (****p < 0.0001) and Sorafenib (****p < 0.0001) (Fig. 9 A). To further confirm the findings from the wound healing assay, we evaluated the expression of the genes involved in cell migration and invasion. The qRT-PCR results showed that the expression levels of MMP-3 (*p < 0.05) and MMP-9 (***p < 0.001) significantly decreased following LINC00162 silencing. Compared to the control group, sorafenib treatment significantly downregulated MMP-3 (**p < 0.01) and MMP-9 (****p < 0.0001) expression. With LINC00162 inhibition combined with Sorafenib treatment, the relative mRNA expression of the MMP-9 and MMP-3 decreased significantly compared to the control group (****p < 0.0001) and individual treatments. This confirms the findings from the wound healing assay (Fig. 9 B). 3.8 siRNA-mediated inhibition of LINC00162 lncRNAs combined with Sorafenib inhibited MAPK pathway genes Increased activation of the MAPK pathway is observed in thyroid cancer. Additionally, point mutations of the RAS and BRAF genes, which activate the MAPK pathway, were found in two-thirds of PTC. Kinase cascades pathway with RAS – RAF – MEK, and ERK elevates following MAPK activation. In this context,, we evaluated the MAPK, RAF, and RAS genes expression. qRT-PCR results showed that siRNA-mediated silencing of the LINC00162 lncRNA significantly decreased expression of the MAPK (*p < 0.05) and RAS (**p < 0.01) genes while the RAF levels did not change significantly. Sorafenib treatment also significantly decreased the expression of the MAPK, RAS, and RAF genes (**p < 0.01, ***p < 0.001, and ***p < 0.001, respectively) compared to the control group (Fig. 10 ). Furthermore, treating transfected cells with Sorafenib further enhanced the suppression of MAPK, RAS, and RAF expression. These findings underscore the potential role of LINC00162 inhibition in downregulating the MAPK signaling pathway. 3.9 siRNA-mediated inhibition of LINC00162 lncRNAs combined with Sorafenib increased expression of the autophagic genes To better understand the role of LINC00162 in thyroid cancer progression, we evaluated the expression of the autophagy-related genes ATG5, ATG7, and LC3B. Obtained results indicated that in the cells that LINC00162 silenced by siRNA transfection, expression of ATG5 (**p < 0.01) and LC3B (****p < 0.0001) significantly upregulated compared to the control group. However, no significant upregulation was observed in the expression of the ATG7 in the LINC00162 siRNA transfected group. Sorafenib treatment also significantly increased mRNA expression of the ATG5 (****p < 0.0001), ATG7 (***p < 0.001), and LC3B (****p < 0.0001). Furthermore, the qRT-PCR results showed that combining the LINC00162 siRNA and Sorafenib treatment significantly upregulated ATG5, TG7, and LC3B more than sole treatments (Fig. 11 ). 4. Discussion Thyroid cancer, which has seen a notable rise in its incidence in recent years, is the most common malignancy of the endocrine system [ 25 ]. Despite advancements in the diagnosis of thyroid cancer, approximately 6–20% of cases present regional or distant metastasis [ 26 ]. PTC is the most prevalent histological type of thyroid cancer. Surgery, chemotherapy, radioactive iodine, and adjuvant radiation are the most common treatments for PTC [ 27 , 28 ]. Despite the favorable prognosis of PTC, some patients experience local recurrence or distant metastasis following surgery and radioactive iodine therapy [ 29 ]. PTC includes various tumor types that share mutations in genes responsible for encoding effectors that signal through the MAPK pathway; BRAFV600E, which has the highest mutation rate, is one of these genes [ 30 ]. However, the molecular mechanisms underlying PTC progression remain unclear, necessitating further research to identify novel pathways and therapeutic targets. In recent years, tyrosine-kinase inhibitors (TKIs), including Sorafenib, which is a multikinase inhibitor, have been used in thyroid cancer treatment [ 31 ]. However, Sorafenib does not significantly increase the survival rate due to side effects that lead to dose limitation [ 12 ]. Studies have shown that combining Sorafenib with other molecular agents can enhance the treatment efficiency through synergistic effects [ 32 ]. lncRNAs, as biological players, play roles in various stages of malignancy, and their oncogenic or tumor-suppressive functions demonstrated across different cancers [ 13 ]. Multiple studies have also reported the role of lncRNAs in thyroid cancer progression and metastasis. In a recent study, Shi et al. established that lncRNA GLTC promotes radioiodine resistance and progression of PTC by targeting LDHA [ 33 ]. Li and coworkers also indicated that lncRNA SOCS2-AS1 increased PTC cell proliferation by promoting p53 degradation [ 34 ]. Considering the importance of lncRNAs, in this study, we investigated the effect of LINC00162 on the BC-PAP thyroid cancer cell line for the first time. Our earlier study demonstrated that LINC00162 is overexpressed in thyroid cancer tissue. In this study, we transfected LINC00162 siRNA and observed downregulation in the expression of LINC00162. We aimed to investigate the effect of the LINC00162 silencing on the chemosensitivity of BC-PAP thyroid cancer cells. MTT assay results indicated that LINC00162 silencing decreased the viability of the BC-PAP cells and increased the chemosensitivity of the BC-PAP cells to Sorafenib by decreasing the IC50 from 11.48 µg/ml in Sorafenib alone treated cells to 7.760 µg/ml in cells transfected with LINC00162 and co-treated with Sorafenib. Wang et al. investigated the effect of the PICSAR lncRNA on the sensitivity of the cutaneous squamous cell carcinoma cells to cisplatin. Their study revealed that PICSAR lncRNA sponges miR-485-5p in cisplatin resistance cutaneous squamous cell carcinoma cells, which leads to REV3L overexpression and resistance of the cancerous cells to cisplatin. lncRNA PICSAR silencing reversed this pathway [ 35 ]. In another study conducted by Fei et al. Overexpression of downregulated LncRNA-IQCH-AS1 sensitized thyroid cancer cells to doxorubicin. They reported that LncRNA contributed to the chemosensitivity of thyroid cancer cells by modulating the miR-196a-5p/PPP2R1B signaling pathway [ 36 ]. In addition to increasing the sensitivity of BC-PAP cancerous cells to Sorafenib, flow cytometry analysis revealed that Linc00162 downregulation and Sorafenib treatment induced apoptosis compared to the control group. Furthermore, a combination of Linc00162 siRNA and Sorafenib remarkably evaluated the apoptosis rate. In order to reveal underlying molecular pathways, we assessed the expression of the Bax and Bcl-2 genes. Anti-apoptotic Bcl-2, which is an inner mitochondrial membrane protein, and its pro-apoptotic homolog, Bax, plays an essential role in apoptosis [ 37 ]. Also, Bcl-2 expression confers protection to thyroid carcinomas by inhibiting apoptosis triggered by chemotherapy [ 38 ]. While siRNA-mediated silencing of LINC00162 and Sorafenib treatment alone upregulated expression of Bax and downregulated Bcl-2 expression, qRT-PCR results showed the lower ratio of the Bcl-2/Bax in cells that received combination therapy compared to individual treatments and control group. Caspase3 and Caspase9, which are cysteine proteases, play a key role in apoptosis induction in various cancers. Functioning as an initiator caspase, Caspase9 cleaves and activates Caspase3 [ 39 ]. However, caspase3 role in thyroid cancer is not well defined. Therefore, we evaluated Caspase3 and Caspase9 expression in order to understand better the effect of the LINC00162 silencing on apoptosis induction in BC-PAP cells. Our results showed that expression of Caspase3 and Caspase9 noticeably increased following the siRNA-mediated downregulation of LINC00162. Also, combining the LINC00162 siRNA and Sorafenib significantly upregulated these genes' mRNA levels compared to individual treatments and control groups. Lee et al. demonstrated that silencing of LINC00162 induced apoptotic cell death. They reported that LINC00162 regulates apoptosis through sponging of miR-485-5p, and overexpression of the miR-485-5p downregulates LINC00162 [ 40 ]. Zhang et al. revealed the role of FOXD2-AS1/miR‐485‐5p/KLK7 in regulating apoptosis and cell proliferation in PTC cells. miR-485-5p increases apoptosis rate, however, FOXD2-AS1 lncRNA decreases apoptosis by sponging miR-485-5p [ 41 ]. Furthermore, a study showed that silencing of FOXD2-AS1 lncRNA in BC-PAP cancer cells inhibited the survival of the cancer cells by increasing expression of the Caspase3 and Caspase9 [ 42 ]. In addition to apoptosis, we also investigated the effect of the LINC00162 silencing and sorafenib treatment on the cell cycle progression of BC-PAP thyroid cancer cells. Flow cytometry evaluation of the arrested cells in various phases of the cell cycle revealed that LINC00162 lncRNA silencing induced Sub-G1 cell cycle arrest while Sorafenib treatment induced arrest in both Sub-g1 and G2-M. The combination of LINC00162 silencing and treatment with Sorafenib increased the percentage of arrested cells in the Sub-G1 and G2-M phases, suggesting the inhibitory role of the LINC00162 silencing and combination therapy on BC-PAP cell progression. To investigate the mechanism responsible for the anti-proliferation effects of LINC00162 silencing, we evaluated the mRNA levels of c-Myc and P53. qRT-PCR results showed that siRNA-mediated silencing of LINC00162 and Sorafenib significantly downregulated c‐Myc expression while upregulated P53 expression in BC-PAP cells. Furthermore, in comparison to individual treatment groups, the combination therapy resulted in the lowest c-Myc expression levels while markedly enhancing the expression of P53. c-Myc is an oncogenic transcription factor which promotes G1 to S-phase transition during cell cycle [ 43 ]. One of the main ways that c-myc regulates the cell cycle is through inducing cyclin D1 and D2, which sequestrate p27 and activate cyclin E-Cdk2 [ 44 ]. Cyclin D facilitates the initiation of the cell cycle by promoting the transition from the G0 or G1 phase to the S phase [ 45 ]. The molecular effects of LINC00162 on Cyclin D were also evaluated qRT-PCR. Obtain results revealed that LINC00162 silencing reduced expression of Cyclin D while it’s combination with Sorafenib significantly increased inhibition of Cyclin D1. These results confirm anti prolative effect of Linc00162 in BC-PAP PTC cells. Furthermore, we evaluated the effect of the LINC00162 silencing and its combination effect with Sorafenib on BC-PAP cell invasion and colony formation ability. Results of wound healing assay and colony formation assay indicated that while LINC00162 silencing slightly reduces migration and colony formation ability of cancerous cells, its combination with Sorafenib synergistically and significantly decreases migration, colony number, and the size of colonies. Align with our findings, in a study conducted on hepatocellular carcinoma cells, lncRNA PICSAR overexpression promoted colony formation while its knockdown inhibited the colony formation of the Hep3B cells [ 46 ]. Metastasis is a major reason for death in various cancers. Epithelial-mesenchymal transition (EMT) plays an important role in metastasis and contributes to drug resistance [ 47 ]. Matrix metalloproteinase (MMPs) contributes significantly to the EMT process and degrades ECM [ 48 ]. Considering the importance of MMPs in metastasis and invasion, we evaluated the expression of the MMP-3 and MMP-9. Previous studies demonstrated increased expression of the MMP-9 in thyroid cancer tissue and various thyroid cancer cell lines [ 49 , 50 ]. Our results demonstrated that expression of MMP-3 and MMP-9 decreased following siRNA-mediated silencing of LINC00162, independently from Sorafenib. Also, treatment with Sorafenib following LINC00162 silencing inhibited the expression of MMP-3 and MMP-9 more significantly compared to individual treatments and the control group. Cancer stem cells (CSCs), which consist of a small population of cells, generate heterogeneous cells and retain cancer cells' self-renewal ability. They are also resistant to chemotherapy drugs and regulate metastasis [ 51 ]. Increased expression of stemness markers, including Sox2, Nanog, CD133, and CD44, was reported in various thyroid cancer cell lines compared to normal thyroid [ 51 ]. In order to reveal the role of the LINC00162 and sorafenib treatment on the stemness of thyroid cancer cells, we evaluated the expression of the Sox2, Nanog, CD133, and CD44 in BC-PAP cancer cells. qRT-PCR results showed that CD44, Sox2, and Nanog expression was significantly downregulated in BC-PAP after LINC00162 silencing, while siRNA transfection did not have a significant impact on the expression of the CD133. While sorafenib remarkably reduced the expression of these genes, the combined treatment was most potent and inhibited the expression of CD44 and CD133 more than the sole treatment. In a similar study, Li et al. demonstrated that in PTC, SOX2 induces LINC01510 transcription by binding to its promoter and increases its expression [ 52 ]. In summary, we proposed that LINC00162 silencing, either alone or combined with Sorafenib, may impede thyroid cancer cell migration and metastasis by targeting the EMT process and related metastatic pathways. MAPK signaling pathways regulate proliferation, survival, metabolism, migration, invasion, and differentiation. Alteration in MAPK signaling pathway components, including Ras, a molecular switch, is involved in PTC and activates MAPK [ 53 ]. Guanine-nucleotide exchange factors facilitate activation by Ras [ 54 ]. In our unpublished study, we demonstrated increased expression of the guanine nucleotide exchange factor, RAPGEFL1, in BC-PAP cells. siRNA-mediated silencing of the LINC00162 reduced the expression of the RAPGEFL1. In order to understand the underlying mechanisms involved in thyroid cancer progression, in this study, we evaluated the expression of the MAP, RAS, and RAF genes. The data displayed that lncRNA LINC00162 silencing drastically decreased MAPK and RAS expression while had not any significant impact on RAF expression. Also, sorafenib treatment significantly reduced the expression of the MAPK, RAS, and RAF genes. Combination of LINC00162 silencing with multikinase inhibitor, Sorafenib remarkably increased inhibition of all three genes compared to individual treatments and control group. Piipponen et al. demonstrated that p38 MAPK negatively regulates the expression of PICSAR in cutaneous squamous cell carcinoma [ 55 ]. These results indicate that the knockdown of LINC00162 decreased RAPGEFL1 expression, leading to the deactivation of RAS and downregulation of MAPK pathway. Conclusively, LINC00162 downregulates the MAPK pathway, and sorafenib promotes this inhibition effect. Autophagy, as a cellular mechanism that destroys organelles and proteins, can both promote or inhibit cancer progression and regulate metastasis [ 56 , 57 ]. ATG family genes including ATG5, and LC3B (ATG8F), regulate autophagy by involving in autophagosome formation [ 58 ]. ATG7, an E1 enzyme, plays a key role in initiating autophagy by guiding ATG12 and ATG8 to their respective E2 enzymes [ 59 ]. To investigate the impact of LINC00162 knockdown and sorafenib treatment on autophagy in thyroid cancer cells, we analyzed the expression levels of ATG5, ATG7, and LC3B genes in BC-PAP cancer cells. qRT-PCR results showed that ATG5 and LC3B expression was significantly upregulated in BC-PAP after LINC00162 silencing, while siRNA transfection did not have a significant impact on the expression of the ATG7. Although sorafenib significantly elevated the expression of these genes, the combined treatment proved to be the most effective, further enhancing the expression of ATG5, ATG7, and LC3B compared to sole treatments and control groups. Consistent with our findings, another study demonstrated that RBM47 upregulation regulates FOXO3, thereby promoting the transcription of ATG3 and ATG5 and activation of autophagy in PTC. They also observed a reduction in PTC progression following RBM47 upregulation [ 60 ]. Qin et al. demonstrated that LncRNA, which is downregulated in PTC cells, has a tumor-suppressive role in PTC and activates autophagy by increasing the expression of the ATG5 and leading to autophagic cell death [ 61 ]. 5. Conclusion For the first time, we investigated the effect of the siRNA-mediated downregulation of the LINC00162 and its combination with sorafenib on BC-PAP thyroid cancer cells. Taken together, our results revealed that LINC00162 has an oncogene role, and its knockdown increased the sensitivity of the BC-PAP cells to sorafenib. Also, apoptosis and Sub-G1 cell cycle arrest were induced following LINC00162 silencing. In addition to inhibiting migration and colony formation ability of the cancerous cells, LINC00162 silencing also downregulated the expression of the genes involved in migration and stemness. Furthermore, our study revealed the role of the LINC00162 in thyroid cancer progression through deactivating and decreasing expression of the MAPK, RAS, and RAF genes. Furthermore, LINC00162 silencing, combined with sorafenib, significantly reduced the viability, progression, and stemness ability of the BC-PAP cells. In conclusion, Silencing LINC00162 and also its combination with sorafenib could play a potential role in thyroid cancer treatment and increase the survival of the patients. Declarations Ethics approval and consent to participate Not applicable Consent for publication Not applicable Availability of data and materials All data generated or analyzed during this study are included in this published article Competing interests: The authors declare that they have no competing interests Funding: The authors are thankful for the support of the Immunology Research Center, Tabriz University of Medical Science (grant number: 71287) and Endocrinology and Metabolism Research Institute, Tehran University of Medical Sciences (grant number: 62540) Authors' contributions: Conceptualization: Amir Ali Mokhtarzadeh, Seyed Mohammad Tavangar Data curation: Maryam Hejazi, Seyedeh Zahra Bahojb Mahdavi, Saba Abedimanesh Formal analysis: Amir Ali Mokhtarzadeh, Seyed Mohammad Tavangar Investigation: Maryam Hejazi, Seyedeh Zahra Bahojb Mahdavi, Saba Abedimanesh Methodology: Amir Ali Mokhtarzadeh, Gita Shafiee, Seyed Mohammad Tavangar, Ramin Heshmat, Bagher Larijani Project administration: Amir Ali Mokhtarzadeh, Software: Maryam Hejazi, Seyedeh Zahra Bahojb Mahdavi, Saba Abedimanesh Supervision: Amir Ali Mokhtarzadeh, Gita Shafiee, Seyed Mohammad Tavangar, Ramin Heshmat, Bagher Larijani Validation: Amir Ali Mokhtarzadeh, Ramin Heshmat, Bagher Larijani Visualization: Maryam Hejazi, Seyedeh Zahra Bahojb Mahdavi, Saba Abedimanesh Writing–original draft: Maryam Hejazi, Seyedeh Zahra Bahojb Mahdavi, Saba Abedimanesh Writing–review & editing: Amir Ali Mokhtarzadeh, Gita Shafiee, Seyed Mohammad Tavangar Acknowledgments The authors are thankful for the support of the Immunology Research Center, Tabriz University of Medical Science and Endocrinology and Metabolism Research Institute, Tehran University of Medical Sciences References Sung, H. et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA: A Cancer Journal for Clinicians, 71(3): pp. 209–249. (2021). Li, M., Dal Maso, L. & Vaccarella, S. Global trends in thyroid cancer incidence and the impact of overdiagnosis 8p. 468–470 (The lancet Diabetes & endocrinology, 2020). 6. Schlumberger, M. & Leboulleux, S. Current practice in patients with differentiated thyroid cancer. Nat. Reviews Endocrinol. 17 (3), 176–188 (2021). Zhang, L. et al. Molecular basis and targeted therapy in thyroid cancer: Progress and opportunities. Biochimica et Biophysica Acta (BBA)-Reviews on Cancer, 1878 (4): p. 188928. (2023). Miranda-Filho, A. et al. Thyroid cancer incidence trends by histology in 25 countries: a population-based study. lancet Diabetes Endocrinol. 9 (4), 225–234 (2021). Chen, D. W. et al. Thyroid cancer. Lancet 401 (10387), 1531–1544 (2023). Zhang, J. & Xu, S. High aggressiveness of papillary thyroid cancer: from clinical evidence to regulatory cellular networks. Cell. Death Discovery . 10 (1), 378 (2024). Xing, M., Haugen, B. R. & Schlumberger, M. Progress in molecular-based management of differentiated thyroid cancer. Lancet 381 (9871), 1058–1069 (2013). Gupta-Abramson, V. et al. Phase II trial of sorafenib in advanced thyroid cancer. J. Clin. Oncol. 26 (29), 4714–4719 (2008). Kloos, R. T. et al. Phase II trial of sorafenib in metastatic thyroid cancer. J. Clin. Oncol. 27 (10), 1675–1684 (2009). Zygulska, A. L., Krzemieniecki, K. & Sowa-Staszczak, A. The use of sorafenib in the thyroid cancer. Eur. Endocrinol. 9 (1), 28 (2013). Brose, M. S. et al. Sorafenib in locally advanced or metastatic, radioactive iodine-refractory, differentiated thyroid cancer: a randomized, double-blind, phase 3 trial. Lancet 384 (9940), 319 (2014). Nandwani, A., Rathore, S. & Datta, M. LncRNAs in cancer: regulatory and therapeutic implications. Cancer Lett. 501 , 162–171 (2021). Lu, W. et al. LncRNAs: the regulator of glucose and lipid metabolism in tumor cells. Front. Oncol. 9 , 1099 (2019). Zhang, Y. et al. Roles of long noncoding RNAs in human inflammatory diseases. Cell. Death Discovery . 10 (1), 235 (2024). Moran, V. A., Perera, R. J. & Khalil, A. M. Emerging functional and mechanistic paradigms of mammalian long non-coding RNAs. Nucleic Acids Res. 40 (14), 6391–6400 (2012). Cao, J. et al. Non-coding RNA in thyroid cancer - Functions and mechanisms. Cancer Lett. 496 , 117–126 (2021). Guo, K. et al. LncRNA-MIAT promotes thyroid cancer progression and function as ceRNA to target EZH2 by sponging miR-150-5p. Cell Death Dis, 12(12): p. 1097. (2021). Fan, M. et al. A long non-coding RNA, PTCSC3, as a tumor suppressor and a target of miRNAs in thyroid cancer cells. Exp. Ther. Med. 5 (4), 1143–1146 (2013). Fei, Y., Li, Y. & Chen, F. LncRNA-IQCH-AS1 sensitizes thyroid cancer cells to doxorubicin via modulating the miR-196a-5p/PPP2R1B signalling pathway. J. Chemother. 35 (3), 250–258 (2023). Piipponen, M. et al. Long Noncoding RNA PICSAR Promotes Growth of Cutaneous Squamous Cell Carcinoma by Regulating ERK1/2 Activity. J. Invest. Dermatol. 136 (8), 1701–1710 (2016). Liu, Z. et al. Long noncoding RNA PICSAR/miR-588/EIF6 axis regulates tumorigenesis of hepatocellular carcinoma by activating PI3K/AKT/mTOR signaling pathway. Cancer Sci. 111 (11), 4118–4128 (2020). Chen, M. et al. Long Intergenic Non-Coding 00162 as Diagnostic Biomarker for Early-Stage Pancreatic Cancer. Ann. Clin. Lab. Sci. 52 (4), 533–543 (2022). Wang, X. et al. Super-Enhancer LncRNA LINC00162 Promotes Progression of Bladder Cancer. iScience 23 (12), 101857 (2020). Siegel, R. L. et al. Cancer statistics, 2021. Cancer J. Clin. 71 (1), 7–33 (2021). Shobab, L., Burman, K. D. & Wartofsky, L. Sex differences in differentiated thyroid cancer. Thyroid 32 (3), 224–235 (2022). Perri, F. et al. Targeted therapy: a new hope for thyroid carcinomas. Crit. Rev. Oncol. Hematol. 94 (1), 55–63 (2015). Liu, F. et al. Over-expression of miR-206 decreases the Euthyrox-resistance by targeting MAP4K3 in papillary thyroid carcinoma 114p. 108605 (Biomedicine & Pharmacotherapy, 2019). Gao, Y. et al. BRAFV600E mutation-responsive miRNA-222-3p promotes metastasis of papillary thyroid cancer cells via snail-induced EMT. Front. Endocrinol. 13 , 843334 (2022). Kimura, E. T. et al. High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res. 63 (7), 1454–1457 (2003). Wilhelm, S. M. et al. Preclinical overview of sorafenib, a multikinase inhibitor that targets both Raf and VEGF and PDGF receptor tyrosine kinase signaling. Mol. Cancer Ther. 7 (10), 3129–3140 (2008). Mortensen, A. C. L. et al. Combination therapy of tyrosine kinase inhibitor sorafenib with the HSP90 inhibitor onalespib as a novel treatment regimen for thyroid cancer. Sci. Rep. 13 (1), 16844 (2023). Shi, L. et al. LncRNA GLTC targets LDHA for succinylation and enzymatic activity to promote progression and radioiodine resistance in papillary thyroid cancer. Cell. Death Differ. 30 (6), 1517–1532 (2023). Zhang, X. et al. LncRNA SOCS2-AS1 promotes the progression of papillary thyroid cancer by destabilizing p53 protein. Biochem. Biophys. Res. Commun. 669 , 95–102 (2023). Wang, D. et al. Lnc-PICSAR contributes to cisplatin resistance by miR-485-5p/REV3L axis in cutaneous squamous cell carcinoma. Open. life Sci. 15 (1), 488–500 (2020). Fei, Y., Li, Y. & Chen, F. LncRNA-IQCH-AS1 sensitizes thyroid cancer cells to doxorubicin via modulating the miR-196a-5p/PPP2R1B signalling pathway. J. Chemother. 35 (3), 250–258 (2023). Cvejic, D. et al. Apoptosis and proliferation related molecules (Bcl-2, Bax, p53, PCNA) in papillary microcarcinoma versus papillary carcinoma of the thyroid. Pathology, 40(5): pp. 475–480. (2008). Mitsiades, C. S. et al. Bcl-2 overexpression in thyroid carcinoma cells increases sensitivity to Bcl-2 homology 3 domain inhibition. J. Clin. Endocrinol. Metabolism . 92 (12), 4845–4852 (2007). Liu, P. F. et al. Expression levels of cleaved caspase-3 and caspase-3 in tumorigenesis and prognosis of oral tongue squamous cell carcinoma. PloS one . 12 (7), e0180620 (2017). Lee, W. J. et al. LINC00162 regulates cell proliferation and apoptosis by sponging PAQR4-targeting miR-485-5p. J Cell Physiol, 237(7): pp. 2943–2960. (2022). Zhang, Y. et al. LncRNA FOXD2-AS1 accelerates the papillary thyroid cancer progression through regulating the miR‐485‐5p/KLK7 axis. J. Cell. Biochem. 120 (5), 7952–7961 (2019). Liu, X. et al. LncRNA FOXD2-AS1 Functions as a Competing Endogenous RNA to Regulate TERT Expression by Sponging miR-7-5p in Thyroid Cancer. Front. Endocrinol. (Lausanne) . 10 , 207 (2019). García-Gutiérrez, L. et al. Myc stimulates cell cycle progression through the activation of Cdk1 and phosphorylation of p27. Scientific reports, 9(1): p. 18693. (2019). Bouchard, C. et al. Direct induction of cyclin D2 by Myc contributes to cell cycle progression and sequestration of p27 (The EMBO journal, 1999). Caudron-Herger, M. & Diederichs, S. Insights from the degradation mechanism of cyclin D into targeted therapy of the cancer cell cycle. Signal. Transduct. Target. Therapy . 6 (1), 311 (2021). Liu, Z. et al. Long noncoding RNA PICSAR/miR-588/EIF6 axis regulates tumorigenesis of hepatocellular carcinoma by activating PI3K/AKT/mTOR signaling pathway. Cancer Sci. 111 (11), 4118–4128 (2020). Singh, A. & Settleman, J. EMT, cancer stem cells and drug resistance: an emerging axis of evil in the war on cancer. Oncogene 29 (34), 4741–4751 (2010). Mustafa, S., Koran, S. & AlOmair, L. Insights into the role of matrix metalloproteinases in cancer and its various therapeutic aspects: a review. Front. Mol. Biosci. 9 , 896099 (2022). Wang, T. et al. Pathologic study of expression and significance of matrix metalloproteinases-9, tissue inhibitor of metalloproteinase-1, vascular endothelial growth factor and transforming growth factor beta-1 in papillary carcinoma and follicular carcinoma of thyroid. Zhonghua Bing li xue za zhi = Chinese. J. Pathol. 38 (12), 824–828 (2009). Li, Y. et al. Role of MMP-9 in epithelial-mesenchymal transition of thyroid cancer. World J. Surg. Oncol. 18 (1), 181 (2020). Ma, R. et al. Stemness in human thyroid cancers and derived cell lines: the role of asymmetrically dividing cancer stem cells resistant to chemotherapy. J. Clin. Endocrinol. Metab. 99 (3), E400 (2014). Li, Q., Wang, X. & Jin, J. SOX2-induced upregulation of lncRNA LINC01510 promotes papillary thyroid carcinoma progression by modulating miR-335/SHH and activating Hedgehog pathway. Biochem. Biophys. Res. Commun. 520 (2), 277–283 (2019). Namba, H., Rubin, S. A. & Fagin, J. A. Point mutations of ras oncogenes are an early event in thyroid tumorigenesis. Mol. Endocrinol. 4 (10), 1474–1479 (1990). Zaballos, M. A. et al. Regulators of the RAS-ERK pathway as therapeutic targets in thyroid cancer. Endocr. Relat. Cancer . 26 (6), R319–R344 (2019). Piipponen, M. et al. Long noncoding RNA PICSAR promotes growth of cutaneous squamous cell carcinoma by regulating ERK1/2 activity. J. Invest. Dermatology . 136 (8), 1701–1710 (2016). Liu, K. et al. BIRC7 promotes epithelial-mesenchymal transition and metastasis in papillary thyroid carcinoma through restraining autophagy. Am. J. cancer Res. 10 (1), 78 (2020). Gugnoni, M. et al. Cadherin-6 promotes EMT and cancer metastasis by restraining autophagy. Oncogene 36 (5), 667–677 (2017). Mai, S. et al. Autophagy proteins LC3B, ATG5 and ATG12 participate in quality control after mitochondrial damage and influence lifespan. Autophagy 8 (1), 47–62 (2012). Kaiser, S. E. et al. Noncanonical E2 recruitment by the autophagy E1 revealed by Atg7–Atg3 and Atg7–Atg10 structures. Nature structural & molecular biology, 19(12): pp. 1242–1249. (2012). Qin, Y. et al. RBM47/SNHG5/FOXO3 axis activates autophagy and inhibits cell proliferation in papillary thyroid carcinoma. Cell Death Dis. 13 (3), 270 (2022). Qin, Y. et al. LncRNA GAS8-AS1 inhibits cell proliferation through ATG5-mediated autophagy in papillary thyroid cancer. Endocrine 59 , 555–564 (2018). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 13 Aug, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 27 Apr, 2025 Reviews received at journal 26 Apr, 2025 Reviews received at journal 05 Apr, 2025 Reviewers agreed at journal 05 Apr, 2025 Reviewers agreed at journal 03 Apr, 2025 Reviewers invited by journal 31 Mar, 2025 Editor assigned by journal 31 Mar, 2025 Editor invited by journal 19 Mar, 2025 Submission checks completed at journal 17 Mar, 2025 First submitted to journal 05 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6159534\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":438075529,\"identity\":\"61e0d976-c099-42c0-8b30-86b80f83d7df\",\"order_by\":0,\"name\":\"Maryam Hejazi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tehran University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Maryam\",\"middleName\":\"\",\"lastName\":\"Hejazi\",\"suffix\":\"\"},{\"id\":438075530,\"identity\":\"96b667db-8020-4ca7-9622-89711bdf1acd\",\"order_by\":1,\"name\":\"Seyedeh Zahra\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tabriz University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Seyedeh\",\"middleName\":\"\",\"lastName\":\"Zahra\",\"suffix\":\"\"},{\"id\":438075531,\"identity\":\"02cd3ac2-1fce-4194-9d71-08b9ee71a925\",\"order_by\":2,\"name\":\"Saba Abedimanesh\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tabriz University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Saba\",\"middleName\":\"\",\"lastName\":\"Abedimanesh\",\"suffix\":\"\"},{\"id\":438075532,\"identity\":\"b08273ce-ceee-4dbf-ba5a-b654a8970f31\",\"order_by\":3,\"name\":\"Ramin Heshmat\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tehran University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ramin\",\"middleName\":\"\",\"lastName\":\"Heshmat\",\"suffix\":\"\"},{\"id\":438075533,\"identity\":\"36bd0e6e-c4a3-487d-a28d-8208e9fb4e1d\",\"order_by\":4,\"name\":\"Bagher Larijani\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tehran University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Bagher\",\"middleName\":\"\",\"lastName\":\"Larijani\",\"suffix\":\"\"},{\"id\":438075534,\"identity\":\"d539e014-5133-4240-9af6-bfaafd27a9c9\",\"order_by\":5,\"name\":\"Amir Ali Mokhtarzadeh\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABHElEQVRIiWNgGAWjYDACCTBiMDCAcJkZDNgbQHwLIrSwwbTwHADxJUjRIpEAFccB+Gc3P7zBmGNjbC7f/OzjjxprOXPJ51c3/CiQYOBv707AasmdY8YWjNvSzCzb2IxnSBxLN7acnVN2swfoMIkzZzdgteZGgpkE47bDNgbHGIwZDNgOJ264nZN2gweoxUAiF6sW+Rvp36Ba2D8zJPw7XL/h5pm0m3/waDG4kQO2xczgGI8xw8G2wwkGN9iP3cZni+GNnGKLxG1pxgbHcooZG/vSDTecyWG7LWMgwYPLL3I30jfe+LjNxnDD4eObGX98s5Y3OH782c03f2zk+Nt7sXsfBBJQuTzglMCDUzkWwP6AFNWjYBSMglEw/AEAzadkd70Epe0AAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Tabriz University of Medical Sciences\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Amir\",\"middleName\":\"Ali\",\"lastName\":\"Mokhtarzadeh\",\"suffix\":\"\"},{\"id\":438075535,\"identity\":\"2a7921bb-6fcc-4920-9033-7b761f5454eb\",\"order_by\":6,\"name\":\"Gita Shafiee\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tehran University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Gita\",\"middleName\":\"\",\"lastName\":\"Shafiee\",\"suffix\":\"\"},{\"id\":438075536,\"identity\":\"a6b493db-0b0a-430c-b39d-4283f106b34d\",\"order_by\":7,\"name\":\"Seyed Mohammad Tavangar\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tehran University of Medical Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Seyed\",\"middleName\":\"Mohammad\",\"lastName\":\"Tavangar\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-03-05 06:38:40\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6159534/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6159534/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1038/s41598-025-12805-x\",\"type\":\"published\",\"date\":\"2025-08-13T15:58:06+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":79936779,\"identity\":\"9fede028-16b6-4108-a3b3-d269d66cd00f\",\"added_by\":\"auto\",\"created_at\":\"2025-04-04 18:16:03\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":122247,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eLINC00162 siRNA transfection. The FITC-labeled siRNA was successfully transfected into BC-PAP cells with an 87.7% transfection rate.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6159534/v1/6d9724baf45bf57feb10e59d.png\"},{\"id\":79936780,\"identity\":\"215dcf0f-cdf6-4049-b761-beaebe14f38d\",\"added_by\":\"auto\",\"created_at\":\"2025-04-04 18:16:03\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":80427,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eDetermining (A)optimum dose and (B) time of the transfection.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6159534/v1/e6888a18a3b9bef0d3a389d9.png\"},{\"id\":79936781,\"identity\":\"3665e5c3-c0ba-4e08-b2b8-a92e102137f1\",\"added_by\":\"auto\",\"created_at\":\"2025-04-04 18:16:03\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":48525,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003esiRNA transfection significantly reduced the viability of BC-PAP cells compared to control and NC groups (**p \\u0026lt; 0.01 and ns=not significant)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6159534/v1/2795b4992b5f6173bad3c519.png\"},{\"id\":79937131,\"identity\":\"3e7eb919-a956-4bdb-9c11-c03243e929d8\",\"added_by\":\"auto\",\"created_at\":\"2025-04-04 18:24:03\",\"extension\":\"jpeg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":86613,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eIC50 of the Sorafenib individually and combined with LINC00162 siRNA transfection. siRNA-mediated silencing of the LINC00162 sensitized BC-PAP cells to sorafenib and reduced the IC50 value from 11.48 µg/ml to 7.760 µg/ml.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6159534/v1/bcdf8ddf3b0b491f0456d24c.jpeg\"},{\"id\":79936787,\"identity\":\"a6a8a85c-839f-4ee1-9cff-461a481cbae5\",\"added_by\":\"auto\",\"created_at\":\"2025-04-04 18:16:03\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":577378,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffect of the LINC00162 silencing combined with Sorafenib on apoptosis induction in BC-PAP thyroid cancer cells. A) Apoptosis rate in various groups evaluated by AnnexinV/PI assay. B) While LINC00162 siRNA transfection and treatment with Sorafenib significantly increased apoptosis rate, the combination of these treatments induced apoptosis more than individual treatments (****p\\u0026lt; 0.0001 and ***p \\u0026lt; 0.001). C) DAPI staining to determine chromatin fragmentation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6159534/v1/c57739a88197d31139e5da22.png\"},{\"id\":79937129,\"identity\":\"c3ccbf4a-e50a-4a60-89c5-9186ff0a8a6a\",\"added_by\":\"auto\",\"created_at\":\"2025-04-04 18:24:03\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":250565,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eComparing the combination group to the control group, qRT-PCR showed significant upregulations of Bax, caspase 3, and caspase 9 and downregulation of Bcl-2 (****p\\u0026lt; 0.0001, ***p \\u0026lt; 0.001, **p \\u0026lt; 0.01, *p\\u0026lt; 0.05; ns=not significant).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6159534/v1/b2c35bfa7476b049fb0aebec.png\"},{\"id\":79936790,\"identity\":\"c83e7ef3-5a58-438e-8273-406a872fe027\",\"added_by\":\"auto\",\"created_at\":\"2025-04-04 18:16:03\",\"extension\":\"jpeg\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":525687,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAnalysis of the impact of siRNA-mediated silencing of LINC00162 and Sorafenib on cell cycle progression in BC-PAP cells\\u003cstrong\\u003e. A) \\u003c/strong\\u003eLINC00162 siRNA transfection increased Sub-G1 arrested cells while Sorafenib increased Sub-G1 and G2-M arrested cells rate. The combination of these treatments increased both Sub-G1 and G2-M arrested cell rates. \\u003cstrong\\u003eB) \\u003c/strong\\u003eThe graph illustrates the distribution of cells across different phases within the treatment groups. \\u003cstrong\\u003eC) \\u003c/strong\\u003eAnalysis of P53 and c-myc expression by qRT-PCR (****p\\u0026lt; 0.0001 and ***p \\u0026lt; 0.001).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage7.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6159534/v1/7a388b3a07e37109bb0e0da7.jpeg\"},{\"id\":79936802,\"identity\":\"d8042859-6691-4ed0-ad77-357703538a80\",\"added_by\":\"auto\",\"created_at\":\"2025-04-04 18:16:03\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":492709,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eA) Analysis of LINC00162 siRNA and Sorafenib combination effect on colony formation of BC-PAP cells. B) Analysis of Nanog, Sox2, CD44, and CD133 expression by qRT-PCR (****p\\u0026lt; 0.0001 and ***p \\u0026lt; 0.001).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6159534/v1/48bcc9e580036412f0b349c7.png\"},{\"id\":79937135,\"identity\":\"a0818d9e-60ed-4bba-b63e-1cd0bb7a6073\",\"added_by\":\"auto\",\"created_at\":\"2025-04-04 18:24:03\",\"extension\":\"jpeg\",\"order_by\":9,\"title\":\"Figure 9\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1768017,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eA) Analysis of LINC00162 siRNA and Sorafenib combination effect on migration of BC-PAP cells. B) Analysis of MMP-3 and MMP-9 expression by qRT-PCR (****p\\u0026lt; 0.0001, ***p \\u0026lt; 0.001, **p \\u0026lt; 0.01, *p\\u0026lt; 0.05; ns=not significant).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage9.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6159534/v1/abd279bd05b1d1d5d300db92.jpeg\"},{\"id\":79936794,\"identity\":\"63fc57db-2357-4e73-b7f2-c88cbe7b9321\",\"added_by\":\"auto\",\"created_at\":\"2025-04-04 18:16:03\",\"extension\":\"png\",\"order_by\":10,\"title\":\"Figure 10\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":179255,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAnalysis of the effect of LINC00162 siRNA transfection combined with Sorafenib on the expression of MAPK, RAS, and RAF by qRT-PCR (****p\\u0026lt; 0.0001, ***p \\u0026lt; 0.001, **p \\u0026lt; 0.01, *p\\u0026lt; 0.05; ns=not significant).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage10.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6159534/v1/17902169e6928717624d258b.png\"},{\"id\":79936800,\"identity\":\"99ae8c54-0d82-42fa-82cb-38863d7c5c6f\",\"added_by\":\"auto\",\"created_at\":\"2025-04-04 18:16:03\",\"extension\":\"png\",\"order_by\":11,\"title\":\"Figure 11\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":173585,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eqRT-PCR analysis of the effect of siRNA-mediated silencing of the LINC00162 combined with Sorafenib on the expression of ATG5, TG7, and LC3B (****p\\u0026lt; 0.0001, ***p \\u0026lt; 0.001, **p \\u0026lt; 0.01, *p\\u0026lt; 0.05; ns=not significant).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage11.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6159534/v1/02cbcbf6e7e115a86442d76c.png\"},{\"id\":89310739,\"identity\":\"54807291-db2e-4976-8a90-78dbd5b2140a\",\"added_by\":\"auto\",\"created_at\":\"2025-08-18 16:10:04\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":5594496,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6159534/v1/efebbc6e-c6b4-4c61-9552-48f096289b8c.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"LINC00162 Silencing Enhances Sorafenib Sensitivity and Inhibits Thyroid Cancer Cells Progression through Modulation of MAPK Signaling and Apoptosis\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eThyroid cancer, ranked as the 9th most prevalent cancer, accounted for 586,000 cases globally in 2020 [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. The incident rate of thyroid cancer in affluent and medium-income countries has steadily increased from 1998 to 2012 [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Differentiated thyroid cancer (DTC) as a subtype of thyroid cancer consists of papillary thyroid cancer (PTC) and follicular thyroid cancer (FTC) [\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. Common tumor treatments such as radiotherapy, surgery, and also radioactive iodine (RAI) are being used in DTC patients [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Among various histological subtypes of thyroid cancer, PTC, which accounts for 80% of cases, has the highest incidents compared to other subtypes. [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. Despite the low mortality rates associated with PTC, its aggressive nature leads to recurrence and metastasis, potentially resulting in death [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. Therefore, investigating the underlying mechanisms and developing novel therapies are essential for thyroid cancer treatment. .\\u003c/p\\u003e \\u003cp\\u003eIncreased activation of the mitogen-activated protein kinase (MAPK) pathway is observed in various cancers, including PTC. Point mutations of the RAS and BRAF genes, which activate the MAPK pathway, have been identified in two-thirds of PTC. The kinase cascades involving RAS \\u0026ndash; RAF \\u0026ndash; MEK, and ERK are elevates following MAPK activation [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. In this regard, novel therapies targeting the MAPK pathway could enhance the survival of patients. Sorafenib (Nexavar, BAY 43-9006), is a new molecular targeted therapy currently used for treatment of thyroid cancer. The efficiency of Sorafenib in thyroid cancer patients was demonstrated by two phase II clinical trials [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. Sorafenib functions as a multikinase inhibitor, targeting serine/threonine kinases RAF1, as well as targets VEGF receptors (VEGF-R) 1 to 3, platelet-derived growth factor receptor (PDGFR), RET, and c-KIT [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. However, Sorafenib only improves the progression-free survival rate for 5 months compared to the placebo in patients with radioactive iodine refractory locally advanced or metastatic differentiated thyroid cancer. Also, adverse effects, particularly hand-foot skin reaction, led to decreasing the drug dose, interruptions, and discontinuation of clinical trials. Other side effects of Sorafenib include diarrhea, fatigue, alopecia, and weight loss [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. In this context, combining Sorafenib with other molecular agents and targeted therapies may enhance efficiency and reduce the required dose of chemotherapy drugs, potentially improving treatment outcomes.\\u003c/p\\u003e \\u003cp\\u003eNoncoding RNAs (ncRNAs), which constitute 90% of the genome, cannot encode proteins. Based on their sizes, ncRNAs are categorized into two subunits: short ncRNAs (including small interfering RNA, PIWI-interacting RNAs, and miRNAs) and long ncRNAs (LncRNAs). ncRNAs are involved in various biological processes, including cell differentiation, inflammation, glucose metabolism and different types of cancers [\\u003cspan additionalcitationids=\\\"CR14\\\" citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. LncRNAs, which are 200 nucleotides in length, can regulate the activity and binding of transcription factors. They also modulate the stability of mRNA directly or through interacting with miRNAs and preventing their binding to mRNA [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. Dysregulated expression of lncRNA\\u0026rsquo;s has been observed in various cancers. Their altered expression can act as an oncogene role or contribute to tumorigenesis and the development of malignancies [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. Various studies investigated the role of different lncRNAs in thyroid cancer, reporting their involvement in oncogenesis, metastasis, apoptosis, and invasion of thyroid cancer [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. For instance, a study demonstrated the prognostic role of MIAT lncRNA in PTC, revealing that MIAT lncRNA enhances PTC cell invasion through the miR-150/EZH2 signaling pathway [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. Also, overexpression of IQCH-AS1 lncRNA, which is downregulated in doxorubicin-resistant thyroid cancer cells, sensitized these cancerous cells to doxorubicin [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. In 2016, Piipponen et al. introduced lincRNA PICSAR (P38 Inhibited Cutaneous Squamous cell carcinoma-associated lincRNA), also known as LINC00162. They found that this previously uncharacterized lncRNA is overexpressed in Keratinocyte-derived cutaneous squamous cell carcinoma. They reported that lncRNA PICSAR promotes cSCC progression through the ERK1/2 pathway, and knockdown of this lncRNA inhibited migration and invasion of the cSCC cells [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. Furthermore, it was reported that PICSAR enhances the expression of the PI3K/AKT/mTOR by targeting miR-588, promoting hepatocellular carcinoma [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. Moreover, the role of the lncRNA LINC00162 in various malignancies, including pancreatic cancer, hepatocellular carcinoma, and bladder cancer, has been demonstrated [\\u003cspan additionalcitationids=\\\"CR23\\\" citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. In our previous study, bioinformatic analysis and tissue data revealed increased expression of LINC00162 in thyroid cancer tissue. These findings are currently under review for publication and will be available in the near future. However, there is no study on the role of the lncRNA LINC00162 in thyroid cancer and its role in the chemosensitivity of chemotherapy drugs.\\u003c/p\\u003e \\u003cp\\u003eThus, in the present study, we first investigated the effect of the lncRNA PICSAR silencing on thyroid cancer cell viability. Next, we examined its role in the sensitivity of the thyroid cancer cells to Sorafenib. Finally, we investigated the effect of the LINC00162 silencing, Sorafenib treatment, and combination therapy on the progression, apoptosis, cell cycle, and invasion of the BC-PAP thyroid cancer cells, while also evaluating the expression of the genes involved in these pathways. Furthermore, we analyzed the expression of the stemness-related genes and genes involved in the MAPK pathway. Results obtained from our study revealed that lncRNA LINC00162 silencing increases the sensitivity of BC-PAP cancer cells to Sorafenib. Also, the combination of the LINC00162 siRNA and Sorafenib reduces viability, progression, and invasion of cancerous cells. Taken together, lncRNA PICSAR silencing can be utilized individually in treating thyroid cancer; also, by enhancing the chemosensitivity of thyroid cancer cells, combination therapy can be considered as a new therapeutic intervention in thyroid cancer treatment.\\u003c/p\\u003e\"},{\"header\":\"2. Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1 Cell culture\\u003c/h2\\u003e \\u003cp\\u003eThe BC-PAP cancer cell line of human papillary thyroid cancer was purchased from the National Cell Bank of Iran (Pasteur Institute, Tehran, Iran). The cell line was cultivated in the RPMI 1640 (Gibco, USA) enriched with 10% FBS (Gibco, USA) and penicillin/streptomycin (100 \\u0026micro;g/ml and 100 IU/ml, respectively). The cells were kept in an incubator (37 ̊C, 5% CO2, 95% humidity). After reaching 70% confluency, the cells were subcultured using 0.25% trypsin-EDTA (Gibco, USA).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2 Transfection efficiency\\u003c/h2\\u003e \\u003cp\\u003eThe cells were seeded in a 6-well plate at a density of 2.5*10\\u003csup\\u003e5\\u003c/sup\\u003e cells per well. Following the manufacturer's protocol, siRNA labeled with the FITC was transfected into the seeded BC-PAP cells using the Lipofectamine 3000 (Thermo Fisher Scientific). The efficiency of the transfection was evaluated by flow cytometry (Auto-analyzer 10 Miltenyi Biotec, Germany).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 Dose and time optimization of the siRNA\\u003c/h2\\u003e \\u003cp\\u003eThe cells were seeded in a 6-well plate at a density of 2.5\\u0026times;10\\u003csup\\u003e5\\u003c/sup\\u003e cells per well. 24 hours later, the various doses of 60, 80, and 100 pmol of LINC00162 siRNA targeting the lncRNA, which was synthesized by BIONEER company (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e), and negative control siRNA (Negative control, 5' UUCUCCGAACGUGUCACGUUU 3'), siRNA guide strand as scramble without any target) transfected into cultured cells using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 6 hours, following the manufacturer\\u0026rsquo;s protocol. Complete media containing 10% FBS were added to each well six hours later. In order to determine the optimum dose and time of the transfection, the levels of the LINC00162 were evaluated after 24, 48, and 72 hours of transfection by quantitative reverse transcription polymerase chain reaction (qRT-PCR).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003esiRNA LINC00162 sequence\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLIINC00162\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eSense\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCUCAGACAUCUGCAGUCACUUCACA\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAntisense\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eUGUGAAGUGACUGCAGAUGUCUGAGGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4 RNA extraction and qRT-PCR\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA of the BC-PAP cells isolated by Trizol RNA extraction kit (GeneAll, Korea). The purity and concentration of the isolated RNAs were determined with a NanoDrop spectrophotometer (Thermo Fisher Scientific Life Sciences, USA) by measuring 260 and 280 nm absorbance. A reverse transcription kit (AddScript cDNA Synthesis Kit) was used in order to synthesize Complementary DNA (cDNA) from 1 microgram of the isolated RNA. Isolated RNAs reverse transcribed into cDNA using a Thermal cycler (Bio Rad, USA).\\u003c/p\\u003e \\u003cp\\u003eqRT-PCR conducted by qRT-PCR (Roche, Switzerland) and the relative mRNA expression of the lncRNA LINC00162, Bax, Bcl2, Caspase3, Caspase9, P53, c-myc, MAPK, RAS, RAF, Nanog, Sox2, CD44, and CD133. were evaluated (Ampliqon\\u0026trade; RealQ plus 2X Real-Time PCR Master Mix, Denmark) and calculated using the 2\\u003csup\\u003e\\u0026minus;ΔΔCt\\u003c/sup\\u003e method. The expression of the LINC00162 lncRNA and genes were normalized with GAPDH. The sequence of primers used in this experiment was blasted using the NCBI\\u0026rsquo;s Primer-BLAST (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003ePrimer Sequences\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"2\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimers\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eSequences\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBax\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; GACTCCCCCCGAGAGGTCTT 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; ACAGGGCCTTGAGCACCAGTT 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eBcl-2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; CTGTGGATGACTGAGTACCTG 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; GAGACAGCCAGGAGAAATCA 3\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCaspase3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; GGAAGCGAATCAATGGACTCTGG 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; GCATCGACATCTGTACCAGACC 3\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCaspase9\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; CCAGAGATTCGCAAACCAGAGG 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; GAGCACCGACATCACCAAATCC 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eP53\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; CCTCAGCATCTTATCCGAGTGG 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; TGGATGGTGGTACAGTCAGAGC 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCDK1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; GGAAACCAGGAAGCCTAGCATC 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; GGATGATTCAGTGCCATTTTGCC 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSTAT1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; ATCAGGCTCAGTCGGGGAATA 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; TGGTCTCGTGTTCTCTGTTCT 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ec-myc\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; AGGCTCTCCTTGCAGCTGCTC 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; AAGTTCTCCTCCTCGTCGCAGT 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eNanog\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; CTAAGAGGTGGCAGAAAAACA 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; CTGGTGGTAGGAAGAGTAAAGG 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSox2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; ACATGTGAGGGCCGGACAGC 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; TTGCGTGAGTGTGGATGGGATTGG 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCD44\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; CAAGCCACTCCAGGACAAGG 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; ATCCAAGTGAGGGACTACAACAG 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eCD133\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; GACCGACTGAGACCCAACATC 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; GGCTAGTTTTCACGCTGGTCA 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eMAPK1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; CCCAAATGCTGACTCCAAAGC 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; GCTCGTCACTCGGGTCGTAAT 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRas (kras)\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; CTCCCTGTGTCAGACTGCTCTTT 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; GGCCTTGCAACCTTGGTCTCTTC 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eRAF 1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; TTTCCTGGATCATGTTCCCCT 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; ACTTTGGTGCTACAGTGCTCA 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eLINC00162\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; GCTCTAACTCAGGGCTCCA 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; TGCTCCCCACCTAAGCAATG 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGAPDH\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: 5\\u0026prime; CAAGATCATCAGCAATGCCT 3\\u0026prime;\\u003c/p\\u003e \\u003cp\\u003eReverse: 5\\u0026prime; GCCATCACGCCACAGTTTCC 3\\u0026prime;\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5 MTT assay\\u003c/h2\\u003e \\u003cp\\u003eThe half maximal inhibitory concentration (IC50) of Sorafenib was determined by MTT assay. In this regard, BC-PAP cells were seeded at a density of 7 \\u0026times; 10\\u003csup\\u003e3\\u003c/sup\\u003e cells per well. 24 hours following the cultivation, seeded cells were treated with various concentrations of Sorafenib ranging from 0.1 to 100 \\u0026micro;g/ml. The next day, 50 \\u0026micro;L of MTT solution (5 mg/mL, Sigma-Aldrich, Germany) was added to each well, and the plate was incubated for 4 hours. In order to dissolve formazan crystals, dimethyl sulfoxide was appended into each well, and the plate was incubated for 30 minutes. The absorbance (OD) at 570\\u0026ndash;620 nm was measured by an ELISA microplate reader (Tecan, Switzerland). MTT assay was also performed to investigate the LINC00162 silencing effect on the BC-PAP cells' sensitivity to Sorafenib. Thus, first, cells were transfected with LINC00162 siRNA and then treated with Sorafenib. IC50 of the individual groups treated with Sorafenib and the combination group were measured. The viability of the cells following LINC00162 siRNA transfection was also determined with an MTT assay.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.6 Annexin/PI apoptosis assays\\u003c/h2\\u003e \\u003cp\\u003eTo investigate the effect of the LINC00162 siRNA, both individually and in combination with Sorafenib, on apoptosis induction in BC-PAP cell lines, an apoptosis assay was conducted. First, BC-PAP cells were seeded at a density of 1.5 \\u0026times; 10\\u003csup\\u003e5\\u003c/sup\\u003e cells per well and incubated for 24 hours. LINC00162 siRNA was transfected into the cells, and 24 hours later, the relevant groups were treated with Sorafenib and incubated for an additional 24 hours. Afterward, the cells were harvested from each well and washed with PBS. Cells of each group were resuspended in binding buffer and stained with a V-FITC/PI staining kit (Immunostep, Spain), according to provided protocols. Apoptosis induction in each group was assessed with flow cytometry (Auto-analyzer 10 Miltenyi Biotec, Germany). All experiments were conducted in triplicate.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.7 DAPI staining\\u003c/h2\\u003e \\u003cp\\u003eApoptosis induction based on chromatin fragmentation was investigated with 4\\u0026prime;,6-diamidino‐2 phenylindole (DAPI) staining. Firstly, BC-PAP cells were seeded in a 96-well plate with a density of 7 \\u0026times; 10\\u003csup\\u003e3\\u003c/sup\\u003e cells per well. The relevant groups transfected with LINC00162 siRNA and subsequently, treated with Sorafenib. Then, the cells were fixed with 100 \\u0026micro;L of 4% paraformaldehyde and incubated for 1.5 hours. Fixed cells were washed with PBS multiple times, permeated with 0.1% Triton-X-100, and incubated for 15 minutes. After a wash step with PBS, the cells of each group were stained with 100 \\u0026micro;l of DAPI (0.1%, Sigma-Aldrich, USA) and incubated for an additional 10 minutes in dark condition. Morphological changes observed with the DAPI channel of Cytation 5 fluorescence imaging system (BioTK).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.8 Cell cycle assay\\u003c/h2\\u003e \\u003cp\\u003eThe impact of the LINC00162 siRNA, both individually and combined with Sorafenib on the cell cycle progression of BC-PAP cells was examined by flow cytometry. First, cells were seeded in a 6-well plate at a density of 1.5 \\u0026times; 10\\u003csup\\u003e5\\u003c/sup\\u003e cells per well. LINC00162 siRNA was transfected to cells, and after 24 hours, transfected groups were treated with Sorafenib, and the plate was incubated for an additional 24 hours. After incubation time, the cells were harvested and fixed with cold 80% ethanol at -20 ̊C overnight. Then, fixed cells were centrifuged, resuspended in 500 \\u0026micro;l of cold PBS containing 5 \\u0026micro;L of RNase A, and incubated for 30 minutes. Incubated cells were centrifuged and resuspended at DAPI and triton containing PBS. After 10 minutes of incubation, stained cells were centrifuged and washed with PBS. Cell cycle arrest in each group was analyzed using flow cytometry (Auto-analyzer 10 Miltenyi Biotec, Germany).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.9 Colony formation assay\\u003c/h2\\u003e \\u003cp\\u003eThe inhibitory effect of siRNA-mediated LINC00162 lncRNA inhibition and treatment with Sorafenib on the colony formation ability of BC-PAP thyroid cancer cells was investigated with the clonogenic assay. Firstly, 2.5 \\u0026times; 10\\u003csup\\u003e4\\u003c/sup\\u003e cells were seeded in a 6-well plate, transfected with LINC00162 siRNA, treated with Sorafenib, and the plate was incubated for 10 days. Afterward, each group was washed with PBS, and paraformaldehyde (5%) was used to fix each group. Each group was stained with crystal violet for 20 min, and the colonies were photographed.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.10 Wound healing assay\\u003c/h2\\u003e \\u003cp\\u003eCellular migration of the BC-PAP thyroid cancer cells following LINC00162 inhibition and treatment with Sorafenib was assessed with the wound healing assay (scratch). BC-PAP cells were seeded in a 24-well plate with a density of 7.5 \\u0026times; 104 cells per well for this purpose. LINC00162 siRNA was transfected into the seeded cells, and 24 hours later, the relevant groups were treated with Sorafenib. A yellow pipet tip was employed to scratch the cellular monolayers, and the migration distance of the BC-PAP cells to the wound area was captured at 0, 24, and 48 hours. The rate of the open wound area was calculated with Imaje j software.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.11 Statistical analysis\\u003c/h2\\u003e \\u003cp\\u003eAll data are expressed as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation and P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered statistically significant. Statistical analysis was conducted using GraphPad Prism 8.0. Flow cytometry data were analyzed by Flowjo, and wound healing assay images were analyzed with image J. The differences between two groups and multiple groups were analyzed using Student\\u0026rsquo;s t-tests and one-way analysis of variance (ANOVA), respectively.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.1 Efficient transfection of siRNA\\u003c/h2\\u003e \\u003cp\\u003eFlow cytometry data showed that FITC-labeled siRNA transfected into BC-PAP cells with 87.7% efficiency compared to the untransfected control group and demonstrated the effectiveness of Lipofectamine in delivering siRNA to BC-PAP cancer cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.2 PICSAR siRNA reduced expression of the LINC00162 lncRNA\\u003c/h2\\u003e \\u003cp\\u003eIn order to determine the optimum dose of the LINC00162 siRNA, BC-PAP cells were transfected with various doses of the siRNA (60, 80, 100 pmol) for 24, 48, and 72 hours. qRT-PCR results showed that the transfection of the 80 pmol of the siRNA significantly reduced LINC00162 expression (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA). Also, the transfection of the siRNA following 48 hours, significantly decreased the expression of the LINC00162 compared to the untransfected and NC groups (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB). Thus, 80 pmol was selected as the optimum dose, while 48 hours was chosen as the optimum time of the transfection for the subsequent experiments.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.3 Silencing of the LINC00162 lncRNA reduced the viability of the cells\\u003c/h2\\u003e \\u003cp\\u003eThe MTT assay was used to determine the viability of the BC-PAP cells following siRNA-mediated silencing of the LINC00162 lncRNA. BC-PAP cells were transfected with the optimum dose of 80 pmol for 48 hours The results showed no significant differences in the viability of the cells transfected with scramble siRNA compared to the untransfected control cells. In addition, the MTT assay results showed a significant decrease in the viability of the cells transfected with LINC00162 siRNA compared to the control and NC groups (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.3 Inhibition of LINC00162 lncRNAs increased sensitivity of BC-PAP cells to Sorafenib\\u003c/h2\\u003e \\u003cp\\u003eMTT assay was performed to determine IC50 of the Sorafenib individually and following LINC00162 inhibition. BC-PAP cells were treated with various concentrations of sorafenib ranging from 0.1 \\u0026micro;g/ml to 100 \\u0026micro;g/ml. The results showed that 11.48 \\u0026micro;g/ml of sorafenib reduced the viability of the cells by 50% compared to the untreated control group. However, the IC50 of the sorafenib following LINC00162 siRNA transfection was determined as 7.760 \\u0026micro;g/ml (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). This reduced IC50 of the Sorafenib in the combination group indicates that LINC00162 silencing decreased the efficient dose of sorafenib by increasing the sensitivity of the BC-PAP cells to the chemotherapy drug.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.4 siRNA-mediated inhibition of LINC00162 lncRNAs combined with Sorafenib induced apoptosis\\u003c/h2\\u003e \\u003cp\\u003eAnnexinV/PI assays were performed to assess the effect of LINC00162 inhibition and its combination with Sorafenib on the apoptosis of BC-PAP cells. Flow cytometry results showed that the rate of apoptosis induced by LIN00162 siRNA and Sorafenib treatment individually were 23% and 25.88%, respectively. This rate increased to 35.6% in the combination treatment group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA). These findings suggested that while individual treatments of LINC00162 inhibition and treatment with Sorafenib significantly induced apoptosis compared to the control group (***p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001 and ****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001, respectively), apoptosis rate in the combination group with LINC00162 inhibition and Sorafenib treatment was significantly higher than individual treatments and control group (***p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB). A chromatin fragmentation assay with DAPI staining also confirmed apoptosis assay results and showed higher number of apoptotic cells in the combination therapy group compared to individual treatments (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC).\\u003c/p\\u003e \\u003cp\\u003eTo confirm flow cytometry and DAPI staining assay results, relative mRNA expression of the genes involved in the apoptosis pathway, including Bax, Bcl2, Caspase 3, and Caspase 9, were evaluated by qRT-PCR. The results indicated that while siRNA-mediated silencing of the LINC00162 lncRNA had no significant effect on the expression of the pro-apoptotic Bax gene, Sorafenib treatment significantly increased the expression of the Bax (***p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) compared to the control group. Also, LINC00162 siRNA transfection followed by Sorafenib treatment increased relative Bax mRNA expression more than individual treatments (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001). Furthermore, the qRT-PCR results indicated that LINC00162 silencing and sole treatment with Sorafenib significantly elevated mRNA levels of the proapoptotic caspase 3 and caspase 9 genes while suppressing the expression of the anti-apoptotic gene Bcl-2. Furthermore, siRNA transfection combined with Sorafenib treatment significantly upregulated pro-apoptotic Caspase 3 (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) and Caspase 9 (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) genes expression while downregulating the expression of the anti-apoptotic Bcl-2 compared to the individual treatments (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.5 siRNA-mediated inhibition of LINC00162 lncRNAs combined with Sorafenib induced cell cycle arrest\\u003c/h2\\u003e \\u003cp\\u003eIn this study, flow cytometry analysis was performed to determine how LINC00162 silencing and combination of Sorafenib affected BC-PAP thyroid cancer cell cycle progression and to evaluate cell cycle distribution. In the siRNA transfected group, LINC00162 silencing in BC-PAP cells increased the percentage of cells in the Sub-G1 phase from 4.28% in the control group to 6.38%. Sorafenib treatment increased the rate of cells arrested in the Sub-G1 (12.8%) and G2/M (30.5%) phases. The LINC00162 silencing and Sorafenib treatment combination increased the Sub-G1 arrested cell rate to 21.6%. Also, combination treatment increased cell distribution in the G2-M phase (26%) compared to the control group (16.9%). However, the rate of G2-M arrested cells that had been increased by Sorafenib (30.5%) was slightly reduced in the combination group (26%) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eA, B).\\u003c/p\\u003e \\u003cp\\u003eTo further confirm cell cycle assay findings, we evaluated the expression of the genes involved in the cell cycle progression. The qRT-PCR results showed that the expression levels of P53 significantly increased (***p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) following LINC00162 silencing. In addition, sorafenib treatment significantly upregulated P53 expression (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) compared to the control group. With the combination of LINC00162 inhibition and Sorafenib treatment, relative mRNA expression of the P53 increased significantly compared to the control group (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) and individual treatments (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eC). These findings confirm the results of cell cycle assay.\\u003c/p\\u003e \\u003cp\\u003eTo further investigate the role of LINC00162 lncRNA in cell cycle progression, we evaluated the expression of the c-myc and cyclin-D genes, which are crucial in regulating cell cycle progression. qRT-PCR results showed that while LINC00162 inhibition (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) and treatment with Sorafenib (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) reduced c-myc expression in BC-PAP thyroid cancer cells, combination of these therapeutic methods significantly reduced of c-myc expression compared to control (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) and individual groups (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001). (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003eC).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.6 siRNA-mediated inhibition of LINC00162 lncRNAs combined with Sorafenib inhibited stemness ability of the BC-PAP cells\\u003c/h2\\u003e \\u003cp\\u003eColony formation and stemness of BC-PAP cells examined by colony formation assay. The results showed that while transfection of the LINC00162 siRNA slightly reduced the number of the formed colonies, Sorafenib treatment decreased the number and size of the colonies. Furthermore, the size and the number of colonies in the group transfected with siRNA and treated with Sorafenib significantly decreased compared to control and individual treatment groups (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eA).\\u003c/p\\u003e \\u003cp\\u003eTo evaluate the impact of combination treatment on stemness of the BC-PAP cells, mRNA fold changes of the Nanog, Sox2, CD44, and CD133 genes ,key players in the stemness and self-renewal of cancer cells\\u0026mdash;were investigated using qRT-PCR. The results indicated that in cells whereLINC00162 was silenced by siRNA transfection, the expression of Nanog (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001), Sox2 (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001), and CD44 (**p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01) significantly decreased compared to the control group. However, no significant downregulation was observed in the expression of the CD133 following LINC00162 silencing. Sorafenib treatment also significantly downregulated expression of the Nanog (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001), Sox2 (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001), CD44 (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001, and CD133 (***p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001). Furthermore, the qRT-PCR results demonstrated that combining the LINC00162 siRNA and Sorafenib treatment led to a greater decrease (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) in the expression of the Nanog, Sox2, CD 44, and CD 133 genes than either treatment alone. These findings confirm the role of LINC00162 lncRNA in the stemness of the BC-PAP cancer cells (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig8\\\" class=\\\"InternalRef\\\"\\u003e8\\u003c/span\\u003eB).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec22\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.7 siRNA-mediated inhibition of LINC00162 lncRNAs combined with Sorafenib inhibited migration of the BC-PAP cells\\u003c/h2\\u003e \\u003cp\\u003eThe effect of the LINC00162 siRNA and Sorafenib, both individually and in combination, on the migration of the BC-PAP cells was investigated by wound healing assay. While siRNA-mediated silencing of the LINC00162 lncRNA slightly reduced the migration ability of the BC-PAP cancer cells, Sorafenib treatment led to a more significant reduction in migration compared to the control group. Furthermore, LINC00162 siRNA and Sorafenib combination significantly decreased the migration of the BC-PAP cells, with a higher open wound area rate in this group compared to control (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) and individually treated groups with LINC00162 siRNA (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) and Sorafenib (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eA).\\u003c/p\\u003e \\u003cp\\u003eTo further confirm the findings from the wound healing assay, we evaluated the expression of the genes involved in cell migration and invasion. The qRT-PCR results showed that the expression levels of MMP-3 (*p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) and MMP-9 (***p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001) significantly decreased following LINC00162 silencing. Compared to the control group, sorafenib treatment significantly downregulated MMP-3 (**p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01) and MMP-9 (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) expression. With LINC00162 inhibition combined with Sorafenib treatment, the relative mRNA expression of the MMP-9 and MMP-3 decreased significantly compared to the control group (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) and individual treatments. This confirms the findings from the wound healing assay (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig9\\\" class=\\\"InternalRef\\\"\\u003e9\\u003c/span\\u003eB).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec23\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.8 siRNA-mediated inhibition of LINC00162 lncRNAs combined with Sorafenib inhibited MAPK pathway genes\\u003c/h2\\u003e \\u003cp\\u003eIncreased activation of the MAPK pathway is observed in thyroid cancer. Additionally, point mutations of the RAS and BRAF genes, which activate the MAPK pathway, were found in two-thirds of PTC. Kinase cascades pathway with RAS \\u0026ndash; RAF \\u0026ndash; MEK, and ERK elevates following MAPK activation. In this context,, we evaluated the MAPK, RAF, and RAS genes expression. qRT-PCR results showed that siRNA-mediated silencing of the LINC00162 lncRNA significantly decreased expression of the MAPK (*p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05) and RAS (**p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01) genes while the RAF levels did not change significantly. Sorafenib treatment also significantly decreased the expression of the MAPK, RAS, and RAF genes (**p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, ***p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, and ***p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, respectively) compared to the control group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig10\\\" class=\\\"InternalRef\\\"\\u003e10\\u003c/span\\u003e). Furthermore, treating transfected cells with Sorafenib further enhanced the suppression of MAPK, RAS, and RAF expression. These findings underscore the potential role of LINC00162 inhibition in downregulating the MAPK signaling pathway.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec24\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.9 siRNA-mediated inhibition of LINC00162 lncRNAs combined with Sorafenib increased expression of the autophagic genes\\u003c/h2\\u003e \\u003cp\\u003eTo better understand the role of LINC00162 in thyroid cancer progression, we evaluated the expression of the autophagy-related genes ATG5, ATG7, and LC3B. Obtained results indicated that in the cells that LINC00162 silenced by siRNA transfection, expression of ATG5 (**p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01) and LC3B (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001) significantly upregulated compared to the control group. However, no significant upregulation was observed in the expression of the ATG7 in the LINC00162 siRNA transfected group. Sorafenib treatment also significantly increased mRNA expression of the ATG5 (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001), ATG7 (***p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001), and LC3B (****p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001). Furthermore, the qRT-PCR results showed that combining the LINC00162 siRNA and Sorafenib treatment significantly upregulated ATG5, TG7, and LC3B more than sole treatments (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig11\\\" class=\\\"InternalRef\\\"\\u003e11\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eThyroid cancer, which has seen a notable rise in its incidence in recent years, is the most common malignancy of the endocrine system [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Despite advancements in the diagnosis of thyroid cancer, approximately 6\\u0026ndash;20% of cases present regional or distant metastasis [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. PTC is the most prevalent histological type of thyroid cancer. Surgery, chemotherapy, radioactive iodine, and adjuvant radiation are the most common treatments for PTC [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. Despite the favorable prognosis of PTC, some patients experience local recurrence or distant metastasis following surgery and radioactive iodine therapy [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. PTC includes various tumor types that share mutations in genes responsible for encoding effectors that signal through the MAPK pathway; BRAFV600E, which has the highest mutation rate, is one of these genes [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. However, the molecular mechanisms underlying PTC progression remain unclear, necessitating further research to identify novel pathways and therapeutic targets. In recent years, tyrosine-kinase inhibitors (TKIs), including Sorafenib, which is a multikinase inhibitor, have been used in thyroid cancer treatment [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. However, Sorafenib does not significantly increase the survival rate due to side effects that lead to dose limitation [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. Studies have shown that combining Sorafenib with other molecular agents can enhance the treatment efficiency through synergistic effects [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003elncRNAs, as biological players, play roles in various stages of malignancy, and their oncogenic or tumor-suppressive functions demonstrated across different cancers [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. Multiple studies have also reported the role of lncRNAs in thyroid cancer progression and metastasis. In a recent study, Shi et al. established that lncRNA GLTC promotes radioiodine resistance and progression of PTC by targeting LDHA [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]. Li and coworkers also indicated that lncRNA SOCS2-AS1 increased PTC cell proliferation by promoting p53 degradation [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. Considering the importance of lncRNAs, in this study, we investigated the effect of LINC00162 on the BC-PAP thyroid cancer cell line for the first time. Our earlier study demonstrated that LINC00162 is overexpressed in thyroid cancer tissue. In this study, we transfected LINC00162 siRNA and observed downregulation in the expression of LINC00162. We aimed to investigate the effect of the LINC00162 silencing on the chemosensitivity of BC-PAP thyroid cancer cells. MTT assay results indicated that LINC00162 silencing decreased the viability of the BC-PAP cells and increased the chemosensitivity of the BC-PAP cells to Sorafenib by decreasing the IC50 from 11.48 \\u0026micro;g/ml in Sorafenib alone treated cells to 7.760 \\u0026micro;g/ml in cells transfected with LINC00162 and co-treated with Sorafenib. Wang et al. investigated the effect of the PICSAR lncRNA on the sensitivity of the cutaneous squamous cell carcinoma cells to cisplatin. Their study revealed that PICSAR lncRNA sponges miR-485-5p in cisplatin resistance cutaneous squamous cell carcinoma cells, which leads to REV3L overexpression and resistance of the cancerous cells to cisplatin. lncRNA PICSAR silencing reversed this pathway [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. In another study conducted by Fei et al. Overexpression of downregulated LncRNA-IQCH-AS1 sensitized thyroid cancer cells to doxorubicin. They reported that LncRNA contributed to the chemosensitivity of thyroid cancer cells by modulating the miR-196a-5p/PPP2R1B signaling pathway [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. In addition to increasing the sensitivity of BC-PAP cancerous cells to Sorafenib, flow cytometry analysis revealed that Linc00162 downregulation and Sorafenib treatment induced apoptosis compared to the control group. Furthermore, a combination of Linc00162 siRNA and Sorafenib remarkably evaluated the apoptosis rate. In order to reveal underlying molecular pathways, we assessed the expression of the Bax and Bcl-2 genes. Anti-apoptotic Bcl-2, which is an inner mitochondrial membrane protein, and its pro-apoptotic homolog, Bax, plays an essential role in apoptosis [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. Also, Bcl-2 expression confers protection to thyroid carcinomas by inhibiting apoptosis triggered by chemotherapy [\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]. While siRNA-mediated silencing of LINC00162 and Sorafenib treatment alone upregulated expression of Bax and downregulated Bcl-2 expression, qRT-PCR results showed the lower ratio of the Bcl-2/Bax in cells that received combination therapy compared to individual treatments and control group. Caspase3 and Caspase9, which are cysteine proteases, play a key role in apoptosis induction in various cancers. Functioning as an initiator caspase, Caspase9 cleaves and activates Caspase3 [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e]. However, caspase3 role in thyroid cancer is not well defined. Therefore, we evaluated Caspase3 and Caspase9 expression in order to understand better the effect of the LINC00162 silencing on apoptosis induction in BC-PAP cells. Our results showed that expression of Caspase3 and Caspase9 noticeably increased following the siRNA-mediated downregulation of LINC00162. Also, combining the LINC00162 siRNA and Sorafenib significantly upregulated these genes' mRNA levels compared to individual treatments and control groups. Lee et al. demonstrated that silencing of LINC00162 induced apoptotic cell death. They reported that LINC00162 regulates apoptosis through sponging of miR-485-5p, and overexpression of the miR-485-5p downregulates LINC00162 [\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]. Zhang et al. revealed the role of FOXD2-AS1/miR‐485‐5p/KLK7 in regulating apoptosis and cell proliferation in PTC cells. miR-485-5p increases apoptosis rate, however, FOXD2-AS1 lncRNA decreases apoptosis by sponging miR-485-5p [\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]. Furthermore, a study showed that silencing of FOXD2-AS1 lncRNA in BC-PAP cancer cells inhibited the survival of the cancer cells by increasing expression of the Caspase3 and Caspase9 [\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eIn addition to apoptosis, we also investigated the effect of the LINC00162 silencing and sorafenib treatment on the cell cycle progression of BC-PAP thyroid cancer cells. Flow cytometry evaluation of the arrested cells in various phases of the cell cycle revealed that LINC00162 lncRNA silencing induced Sub-G1 cell cycle arrest while Sorafenib treatment induced arrest in both Sub-g1 and G2-M. The combination of LINC00162 silencing and treatment with Sorafenib increased the percentage of arrested cells in the Sub-G1 and G2-M phases, suggesting the inhibitory role of the LINC00162 silencing and combination therapy on BC-PAP cell progression. To investigate the mechanism responsible for the anti-proliferation effects of LINC00162 silencing, we evaluated the mRNA levels of c-Myc and P53. qRT-PCR results showed that siRNA-mediated silencing of LINC00162 and Sorafenib significantly downregulated c‐Myc expression while upregulated P53 expression in BC-PAP cells. Furthermore, in comparison to individual treatment groups, the combination therapy resulted in the lowest c-Myc expression levels while markedly enhancing the expression of P53. c-Myc is an oncogenic transcription factor which promotes G1 to S-phase transition during cell cycle [\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]. One of the main ways that c-myc regulates the cell cycle is through inducing cyclin D1 and D2, which sequestrate p27 and activate cyclin E-Cdk2 [\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e]. Cyclin D facilitates the initiation of the cell cycle by promoting the transition from the G0 or G1 phase to the S phase [\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e]. The molecular effects of LINC00162 on Cyclin D were also evaluated qRT-PCR. Obtain results revealed that LINC00162 silencing reduced expression of Cyclin D while it\\u0026rsquo;s combination with Sorafenib significantly increased inhibition of Cyclin D1. These results confirm anti prolative effect of Linc00162 in BC-PAP PTC cells.\\u003c/p\\u003e \\u003cp\\u003eFurthermore, we evaluated the effect of the LINC00162 silencing and its combination effect with Sorafenib on BC-PAP cell invasion and colony formation ability. Results of wound healing assay and colony formation assay indicated that while LINC00162 silencing slightly reduces migration and colony formation ability of cancerous cells, its combination with Sorafenib synergistically and significantly decreases migration, colony number, and the size of colonies. Align with our findings, in a study conducted on hepatocellular carcinoma cells, lncRNA PICSAR overexpression promoted colony formation while its knockdown inhibited the colony formation of the Hep3B cells [\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e]. Metastasis is a major reason for death in various cancers. Epithelial-mesenchymal transition (EMT) plays an important role in metastasis and contributes to drug resistance [\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e]. Matrix metalloproteinase (MMPs) contributes significantly to the EMT process and degrades ECM [\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e]. Considering the importance of MMPs in metastasis and invasion, we evaluated the expression of the MMP-3 and MMP-9. Previous studies demonstrated increased expression of the MMP-9 in thyroid cancer tissue and various thyroid cancer cell lines [\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e]. Our results demonstrated that expression of MMP-3 and MMP-9 decreased following siRNA-mediated silencing of LINC00162, independently from Sorafenib. Also, treatment with Sorafenib following LINC00162 silencing inhibited the expression of MMP-3 and MMP-9 more significantly compared to individual treatments and the control group.\\u003c/p\\u003e \\u003cp\\u003eCancer stem cells (CSCs), which consist of a small population of cells, generate heterogeneous cells and retain cancer cells' self-renewal ability. They are also resistant to chemotherapy drugs and regulate metastasis [\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e]. Increased expression of stemness markers, including Sox2, Nanog, CD133, and CD44, was reported in various thyroid cancer cell lines compared to normal thyroid [\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e]. In order to reveal the role of the LINC00162 and sorafenib treatment on the stemness of thyroid cancer cells, we evaluated the expression of the Sox2, Nanog, CD133, and CD44 in BC-PAP cancer cells. qRT-PCR results showed that CD44, Sox2, and Nanog expression was significantly downregulated in BC-PAP after LINC00162 silencing, while siRNA transfection did not have a significant impact on the expression of the CD133. While sorafenib remarkably reduced the expression of these genes, the combined treatment was most potent and inhibited the expression of CD44 and CD133 more than the sole treatment. In a similar study, Li et al. demonstrated that in PTC, SOX2 induces LINC01510 transcription by binding to its promoter and increases its expression [\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e]. In summary, we proposed that LINC00162 silencing, either alone or combined with Sorafenib, may impede thyroid cancer cell migration and metastasis by targeting the EMT process and related metastatic pathways.\\u003c/p\\u003e \\u003cp\\u003eMAPK signaling pathways regulate proliferation, survival, metabolism, migration, invasion, and differentiation. Alteration in MAPK signaling pathway components, including Ras, a molecular switch, is involved in PTC and activates MAPK [\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e]. Guanine-nucleotide exchange factors facilitate activation by Ras [\\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e]. In our unpublished study, we demonstrated increased expression of the guanine nucleotide exchange factor, RAPGEFL1, in BC-PAP cells. siRNA-mediated silencing of the LINC00162 reduced the expression of the RAPGEFL1. In order to understand the underlying mechanisms involved in thyroid cancer progression, in this study, we evaluated the expression of the MAP, RAS, and RAF genes. The data displayed that lncRNA LINC00162 silencing drastically decreased MAPK and RAS expression while had not any significant impact on RAF expression. Also, sorafenib treatment significantly reduced the expression of the MAPK, RAS, and RAF genes. Combination of LINC00162 silencing with multikinase inhibitor, Sorafenib remarkably increased inhibition of all three genes compared to individual treatments and control group. Piipponen et al. demonstrated that p38 MAPK negatively regulates the expression of PICSAR in cutaneous squamous cell carcinoma [\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e]. These results indicate that the knockdown of LINC00162 decreased RAPGEFL1 expression, leading to the deactivation of RAS and downregulation of MAPK pathway. Conclusively, LINC00162 downregulates the MAPK pathway, and sorafenib promotes this inhibition effect.\\u003c/p\\u003e \\u003cp\\u003eAutophagy, as a cellular mechanism that destroys organelles and proteins, can both promote or inhibit cancer progression and regulate metastasis [\\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e57\\u003c/span\\u003e]. ATG family genes including ATG5, and LC3B (ATG8F), regulate autophagy by involving in autophagosome formation [\\u003cspan citationid=\\\"CR58\\\" class=\\\"CitationRef\\\"\\u003e58\\u003c/span\\u003e]. ATG7, an E1 enzyme, plays a key role in initiating autophagy by guiding ATG12 and ATG8 to their respective E2 enzymes [\\u003cspan citationid=\\\"CR59\\\" class=\\\"CitationRef\\\"\\u003e59\\u003c/span\\u003e]. To investigate the impact of LINC00162 knockdown and sorafenib treatment on autophagy in thyroid cancer cells, we analyzed the expression levels of ATG5, ATG7, and LC3B genes in BC-PAP cancer cells. qRT-PCR results showed that ATG5 and LC3B expression was significantly upregulated in BC-PAP after LINC00162 silencing, while siRNA transfection did not have a significant impact on the expression of the ATG7. Although sorafenib significantly elevated the expression of these genes, the combined treatment proved to be the most effective, further enhancing the expression of ATG5, ATG7, and LC3B compared to sole treatments and control groups. Consistent with our findings, another study demonstrated that RBM47 upregulation regulates FOXO3, thereby promoting the transcription of ATG3 and ATG5 and activation of autophagy in PTC. They also observed a reduction in PTC progression following RBM47 upregulation [\\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e60\\u003c/span\\u003e]. Qin et al. demonstrated that LncRNA, which is downregulated in PTC cells, has a tumor-suppressive role in PTC and activates autophagy by increasing the expression of the ATG5 and leading to autophagic cell death [\\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e61\\u003c/span\\u003e].\\u003c/p\\u003e\"},{\"header\":\"5. Conclusion\",\"content\":\"\\u003cp\\u003eFor the first time, we investigated the effect of the siRNA-mediated downregulation of the LINC00162 and its combination with sorafenib on BC-PAP thyroid cancer cells. Taken together, our results revealed that LINC00162 has an oncogene role, and its knockdown increased the sensitivity of the BC-PAP cells to sorafenib. Also, apoptosis and Sub-G1 cell cycle arrest were induced following LINC00162 silencing. In addition to inhibiting migration and colony formation ability of the cancerous cells, LINC00162 silencing also downregulated the expression of the genes involved in migration and stemness. Furthermore, our study revealed the role of the LINC00162 in thyroid cancer progression through deactivating and decreasing expression of the MAPK, RAS, and RAF genes. Furthermore, LINC00162 silencing, combined with sorafenib, significantly reduced the viability, progression, and stemness ability of the BC-PAP cells. In conclusion, Silencing LINC00162 and also its combination with sorafenib could play a potential role in thyroid cancer treatment and increase the survival of the patients.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthics approval and consent to participate\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent for publication\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll data generated or analyzed during this study are included in this published article\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests:\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding:\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors are thankful for the support of the Immunology Research Center, Tabriz University of Medical Science (grant number:\\u0026nbsp;71287) and Endocrinology and Metabolism Research Institute, Tehran University of Medical Sciences (grant number: 62540)\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthors' contributions:\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eConceptualization: Amir Ali Mokhtarzadeh, Seyed Mohammad Tavangar\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eData curation: Maryam Hejazi, Seyedeh Zahra Bahojb Mahdavi, Saba Abedimanesh\\u003c/p\\u003e\\n\\u003cp\\u003eFormal analysis: \\u0026nbsp;Amir Ali Mokhtarzadeh, Seyed Mohammad Tavangar\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eInvestigation: Maryam Hejazi, Seyedeh Zahra Bahojb Mahdavi, Saba Abedimanesh Methodology: Amir Ali Mokhtarzadeh, Gita Shafiee, Seyed Mohammad Tavangar, Ramin Heshmat, Bagher Larijani\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eProject administration: Amir Ali Mokhtarzadeh,\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eSoftware: Maryam Hejazi, Seyedeh Zahra Bahojb Mahdavi, Saba Abedimanesh\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eSupervision: Amir Ali Mokhtarzadeh, Gita Shafiee, Seyed Mohammad Tavangar, Ramin Heshmat, Bagher Larijani\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eValidation: Amir Ali Mokhtarzadeh, Ramin Heshmat, Bagher Larijani\\u003c/p\\u003e\\n\\u003cp\\u003eVisualization: Maryam Hejazi, Seyedeh Zahra Bahojb Mahdavi, Saba Abedimanesh\\u003c/p\\u003e\\n\\u003cp\\u003eWriting–original draft: Maryam Hejazi, Seyedeh Zahra Bahojb Mahdavi, Saba Abedimanesh\\u003c/p\\u003e\\n\\u003cp\\u003eWriting–review \\u0026amp; editing: Amir Ali Mokhtarzadeh, Gita Shafiee, Seyed Mohammad Tavangar\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors are thankful for the support of the Immunology Research Center, Tabriz University of Medical Science and Endocrinology and Metabolism Research Institute, Tehran University of Medical Sciences\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eSung, H. et al. \\u003cem\\u003eGlobal Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries.\\u003c/em\\u003e CA: A Cancer Journal for Clinicians, 71(3): pp. 209\\u0026ndash;249. (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, M., Dal Maso, L. \\u0026amp; Vaccarella, S. \\u003cem\\u003eGlobal trends in thyroid cancer incidence and the impact of overdiagnosis\\u003c/em\\u003e8p. 468\\u0026ndash;470 (The lancet Diabetes \\u0026amp; endocrinology, 2020). 6.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSchlumberger, M. \\u0026amp; Leboulleux, S. Current practice in patients with differentiated thyroid cancer. \\u003cem\\u003eNat. Reviews Endocrinol.\\u003c/em\\u003e \\u003cb\\u003e17\\u003c/b\\u003e (3), 176\\u0026ndash;188 (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang, L. et al. \\u003cem\\u003eMolecular basis and targeted therapy in thyroid cancer: Progress and opportunities.\\u003c/em\\u003e Biochimica et Biophysica Acta (BBA)-Reviews on Cancer, \\u003cb\\u003e1878\\u003c/b\\u003e(4): p. 188928. (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMiranda-Filho, A. et al. Thyroid cancer incidence trends by histology in 25 countries: a population-based study. \\u003cem\\u003elancet Diabetes Endocrinol.\\u003c/em\\u003e \\u003cb\\u003e9\\u003c/b\\u003e (4), 225\\u0026ndash;234 (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen, D. W. et al. Thyroid cancer. \\u003cem\\u003eLancet\\u003c/em\\u003e \\u003cb\\u003e401\\u003c/b\\u003e (10387), 1531\\u0026ndash;1544 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang, J. \\u0026amp; Xu, S. High aggressiveness of papillary thyroid cancer: from clinical evidence to regulatory cellular networks. \\u003cem\\u003eCell. Death Discovery\\u003c/em\\u003e. \\u003cb\\u003e10\\u003c/b\\u003e (1), 378 (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXing, M., Haugen, B. R. \\u0026amp; Schlumberger, M. Progress in molecular-based management of differentiated thyroid cancer. \\u003cem\\u003eLancet\\u003c/em\\u003e \\u003cb\\u003e381\\u003c/b\\u003e (9871), 1058\\u0026ndash;1069 (2013).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGupta-Abramson, V. et al. Phase II trial of sorafenib in advanced thyroid cancer. \\u003cem\\u003eJ. Clin. Oncol.\\u003c/em\\u003e \\u003cb\\u003e26\\u003c/b\\u003e (29), 4714\\u0026ndash;4719 (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKloos, R. T. et al. Phase II trial of sorafenib in metastatic thyroid cancer. \\u003cem\\u003eJ. Clin. Oncol.\\u003c/em\\u003e \\u003cb\\u003e27\\u003c/b\\u003e (10), 1675\\u0026ndash;1684 (2009).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZygulska, A. L., Krzemieniecki, K. \\u0026amp; Sowa-Staszczak, A. The use of sorafenib in the thyroid cancer. \\u003cem\\u003eEur. Endocrinol.\\u003c/em\\u003e \\u003cb\\u003e9\\u003c/b\\u003e (1), 28 (2013).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBrose, M. S. et al. Sorafenib in locally advanced or metastatic, radioactive iodine-refractory, differentiated thyroid cancer: a randomized, double-blind, phase 3 trial. \\u003cem\\u003eLancet\\u003c/em\\u003e \\u003cb\\u003e384\\u003c/b\\u003e (9940), 319 (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNandwani, A., Rathore, S. \\u0026amp; Datta, M. LncRNAs in cancer: regulatory and therapeutic implications. \\u003cem\\u003eCancer Lett.\\u003c/em\\u003e \\u003cb\\u003e501\\u003c/b\\u003e, 162\\u0026ndash;171 (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLu, W. et al. LncRNAs: the regulator of glucose and lipid metabolism in tumor cells. \\u003cem\\u003eFront. Oncol.\\u003c/em\\u003e \\u003cb\\u003e9\\u003c/b\\u003e, 1099 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang, Y. et al. Roles of long noncoding RNAs in human inflammatory diseases. \\u003cem\\u003eCell. Death Discovery\\u003c/em\\u003e. \\u003cb\\u003e10\\u003c/b\\u003e (1), 235 (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMoran, V. A., Perera, R. J. \\u0026amp; Khalil, A. M. Emerging functional and mechanistic paradigms of mammalian long non-coding RNAs. \\u003cem\\u003eNucleic Acids Res.\\u003c/em\\u003e \\u003cb\\u003e40\\u003c/b\\u003e (14), 6391\\u0026ndash;6400 (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCao, J. et al. Non-coding RNA in thyroid cancer - Functions and mechanisms. \\u003cem\\u003eCancer Lett.\\u003c/em\\u003e \\u003cb\\u003e496\\u003c/b\\u003e, 117\\u0026ndash;126 (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGuo, K. et al. \\u003cem\\u003eLncRNA-MIAT promotes thyroid cancer progression and function as ceRNA to target EZH2 by sponging miR-150-5p.\\u003c/em\\u003e Cell Death Dis, 12(12): p. 1097. (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFan, M. et al. A long non-coding RNA, PTCSC3, as a tumor suppressor and a target of miRNAs in thyroid cancer cells. \\u003cem\\u003eExp. Ther. Med.\\u003c/em\\u003e \\u003cb\\u003e5\\u003c/b\\u003e (4), 1143\\u0026ndash;1146 (2013).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFei, Y., Li, Y. \\u0026amp; Chen, F. LncRNA-IQCH-AS1 sensitizes thyroid cancer cells to doxorubicin via modulating the miR-196a-5p/PPP2R1B signalling pathway. \\u003cem\\u003eJ. Chemother.\\u003c/em\\u003e \\u003cb\\u003e35\\u003c/b\\u003e (3), 250\\u0026ndash;258 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePiipponen, M. et al. Long Noncoding RNA PICSAR Promotes Growth of Cutaneous Squamous Cell Carcinoma by Regulating ERK1/2 Activity. \\u003cem\\u003eJ. Invest. Dermatol.\\u003c/em\\u003e \\u003cb\\u003e136\\u003c/b\\u003e (8), 1701\\u0026ndash;1710 (2016).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, Z. et al. Long noncoding RNA PICSAR/miR-588/EIF6 axis regulates tumorigenesis of hepatocellular carcinoma by activating PI3K/AKT/mTOR signaling pathway. \\u003cem\\u003eCancer Sci.\\u003c/em\\u003e \\u003cb\\u003e111\\u003c/b\\u003e (11), 4118\\u0026ndash;4128 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen, M. et al. Long Intergenic Non-Coding 00162 as Diagnostic Biomarker for Early-Stage Pancreatic Cancer. \\u003cem\\u003eAnn. Clin. Lab. Sci.\\u003c/em\\u003e \\u003cb\\u003e52\\u003c/b\\u003e (4), 533\\u0026ndash;543 (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, X. et al. Super-Enhancer LncRNA LINC00162 Promotes Progression of Bladder Cancer. \\u003cem\\u003eiScience\\u003c/em\\u003e \\u003cb\\u003e23\\u003c/b\\u003e (12), 101857 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSiegel, R. L. et al. Cancer statistics, 2021. \\u003cem\\u003eCancer J. Clin.\\u003c/em\\u003e \\u003cb\\u003e71\\u003c/b\\u003e (1), 7\\u0026ndash;33 (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShobab, L., Burman, K. D. \\u0026amp; Wartofsky, L. Sex differences in differentiated thyroid cancer. \\u003cem\\u003eThyroid\\u003c/em\\u003e \\u003cb\\u003e32\\u003c/b\\u003e (3), 224\\u0026ndash;235 (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePerri, F. et al. Targeted therapy: a new hope for thyroid carcinomas. \\u003cem\\u003eCrit. Rev. Oncol. Hematol.\\u003c/em\\u003e \\u003cb\\u003e94\\u003c/b\\u003e (1), 55\\u0026ndash;63 (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, F. et al. \\u003cem\\u003eOver-expression of miR-206 decreases the Euthyrox-resistance by targeting MAP4K3 in papillary thyroid carcinoma\\u003c/em\\u003e114p. 108605 (Biomedicine \\u0026amp; Pharmacotherapy, 2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGao, Y. et al. BRAFV600E mutation-responsive miRNA-222-3p promotes metastasis of papillary thyroid cancer cells via snail-induced EMT. \\u003cem\\u003eFront. Endocrinol.\\u003c/em\\u003e \\u003cb\\u003e13\\u003c/b\\u003e, 843334 (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKimura, E. T. et al. High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. \\u003cem\\u003eCancer Res.\\u003c/em\\u003e \\u003cb\\u003e63\\u003c/b\\u003e (7), 1454\\u0026ndash;1457 (2003).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWilhelm, S. M. et al. Preclinical overview of sorafenib, a multikinase inhibitor that targets both Raf and VEGF and PDGF receptor tyrosine kinase signaling. \\u003cem\\u003eMol. Cancer Ther.\\u003c/em\\u003e \\u003cb\\u003e7\\u003c/b\\u003e (10), 3129\\u0026ndash;3140 (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMortensen, A. C. L. et al. Combination therapy of tyrosine kinase inhibitor sorafenib with the HSP90 inhibitor onalespib as a novel treatment regimen for thyroid cancer. \\u003cem\\u003eSci. Rep.\\u003c/em\\u003e \\u003cb\\u003e13\\u003c/b\\u003e (1), 16844 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShi, L. et al. LncRNA GLTC targets LDHA for succinylation and enzymatic activity to promote progression and radioiodine resistance in papillary thyroid cancer. \\u003cem\\u003eCell. Death Differ.\\u003c/em\\u003e \\u003cb\\u003e30\\u003c/b\\u003e (6), 1517\\u0026ndash;1532 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang, X. et al. LncRNA SOCS2-AS1 promotes the progression of papillary thyroid cancer by destabilizing p53 protein. \\u003cem\\u003eBiochem. Biophys. Res. Commun.\\u003c/em\\u003e \\u003cb\\u003e669\\u003c/b\\u003e, 95\\u0026ndash;102 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, D. et al. Lnc-PICSAR contributes to cisplatin resistance by miR-485-5p/REV3L axis in cutaneous squamous cell carcinoma. \\u003cem\\u003eOpen. life Sci.\\u003c/em\\u003e \\u003cb\\u003e15\\u003c/b\\u003e (1), 488\\u0026ndash;500 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFei, Y., Li, Y. \\u0026amp; Chen, F. LncRNA-IQCH-AS1 sensitizes thyroid cancer cells to doxorubicin via modulating the miR-196a-5p/PPP2R1B signalling pathway. \\u003cem\\u003eJ. Chemother.\\u003c/em\\u003e \\u003cb\\u003e35\\u003c/b\\u003e (3), 250\\u0026ndash;258 (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCvejic, D. et al. \\u003cem\\u003eApoptosis and proliferation related molecules (Bcl-2, Bax, p53, PCNA) in papillary microcarcinoma versus papillary carcinoma of the thyroid.\\u003c/em\\u003e Pathology, 40(5): pp. 475\\u0026ndash;480. (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMitsiades, C. S. et al. Bcl-2 overexpression in thyroid carcinoma cells increases sensitivity to Bcl-2 homology 3 domain inhibition. \\u003cem\\u003eJ. Clin. Endocrinol. Metabolism\\u003c/em\\u003e. \\u003cb\\u003e92\\u003c/b\\u003e (12), 4845\\u0026ndash;4852 (2007).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, P. F. et al. Expression levels of cleaved caspase-3 and caspase-3 in tumorigenesis and prognosis of oral tongue squamous cell carcinoma. \\u003cem\\u003ePloS one\\u003c/em\\u003e. \\u003cb\\u003e12\\u003c/b\\u003e (7), e0180620 (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLee, W. J. et al. \\u003cem\\u003eLINC00162 regulates cell proliferation and apoptosis by sponging PAQR4-targeting miR-485-5p.\\u003c/em\\u003e J Cell Physiol, 237(7): pp. 2943\\u0026ndash;2960. (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang, Y. et al. LncRNA FOXD2-AS1 accelerates the papillary thyroid cancer progression through regulating the miR‐485‐5p/KLK7 axis. \\u003cem\\u003eJ. Cell. Biochem.\\u003c/em\\u003e \\u003cb\\u003e120\\u003c/b\\u003e (5), 7952\\u0026ndash;7961 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, X. et al. LncRNA FOXD2-AS1 Functions as a Competing Endogenous RNA to Regulate TERT Expression by Sponging miR-7-5p in Thyroid Cancer. \\u003cem\\u003eFront. Endocrinol. (Lausanne)\\u003c/em\\u003e. \\u003cb\\u003e10\\u003c/b\\u003e, 207 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGarc\\u0026iacute;a-Guti\\u0026eacute;rrez, L. et al. \\u003cem\\u003eMyc stimulates cell cycle progression through the activation of Cdk1 and phosphorylation of p27.\\u003c/em\\u003e Scientific reports, 9(1): p. 18693. (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBouchard, C. et al. \\u003cem\\u003eDirect induction of cyclin D2 by Myc contributes to cell cycle progression and sequestration of p27\\u003c/em\\u003e (The EMBO journal, 1999).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCaudron-Herger, M. \\u0026amp; Diederichs, S. Insights from the degradation mechanism of cyclin D into targeted therapy of the cancer cell cycle. \\u003cem\\u003eSignal. Transduct. Target. Therapy\\u003c/em\\u003e. \\u003cb\\u003e6\\u003c/b\\u003e (1), 311 (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, Z. et al. Long noncoding RNA PICSAR/miR-588/EIF6 axis regulates tumorigenesis of hepatocellular carcinoma by activating PI3K/AKT/mTOR signaling pathway. \\u003cem\\u003eCancer Sci.\\u003c/em\\u003e \\u003cb\\u003e111\\u003c/b\\u003e (11), 4118\\u0026ndash;4128 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSingh, A. \\u0026amp; Settleman, J. EMT, cancer stem cells and drug resistance: an emerging axis of evil in the war on cancer. \\u003cem\\u003eOncogene\\u003c/em\\u003e \\u003cb\\u003e29\\u003c/b\\u003e (34), 4741\\u0026ndash;4751 (2010).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMustafa, S., Koran, S. \\u0026amp; AlOmair, L. Insights into the role of matrix metalloproteinases in cancer and its various therapeutic aspects: a review. \\u003cem\\u003eFront. Mol. Biosci.\\u003c/em\\u003e \\u003cb\\u003e9\\u003c/b\\u003e, 896099 (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, T. et al. \\u003cem\\u003ePathologic study of expression and significance of matrix metalloproteinases-9, tissue inhibitor of metalloproteinase-1, vascular endothelial growth factor and transforming growth factor beta-1 in papillary carcinoma and follicular carcinoma of thyroid.\\u003c/em\\u003e Zhonghua Bing li xue za zhi\\u0026thinsp;=\\u0026thinsp;Chinese. \\u003cem\\u003eJ. Pathol.\\u003c/em\\u003e \\u003cb\\u003e38\\u003c/b\\u003e (12), 824\\u0026ndash;828 (2009).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, Y. et al. Role of MMP-9 in epithelial-mesenchymal transition of thyroid cancer. \\u003cem\\u003eWorld J. Surg. Oncol.\\u003c/em\\u003e \\u003cb\\u003e18\\u003c/b\\u003e (1), 181 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMa, R. et al. Stemness in human thyroid cancers and derived cell lines: the role of asymmetrically dividing cancer stem cells resistant to chemotherapy. \\u003cem\\u003eJ. Clin. Endocrinol. Metab.\\u003c/em\\u003e \\u003cb\\u003e99\\u003c/b\\u003e (3), E400 (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, Q., Wang, X. \\u0026amp; Jin, J. SOX2-induced upregulation of lncRNA LINC01510 promotes papillary thyroid carcinoma progression by modulating miR-335/SHH and activating Hedgehog pathway. \\u003cem\\u003eBiochem. Biophys. Res. Commun.\\u003c/em\\u003e \\u003cb\\u003e520\\u003c/b\\u003e (2), 277\\u0026ndash;283 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNamba, H., Rubin, S. A. \\u0026amp; Fagin, J. A. Point mutations of ras oncogenes are an early event in thyroid tumorigenesis. \\u003cem\\u003eMol. Endocrinol.\\u003c/em\\u003e \\u003cb\\u003e4\\u003c/b\\u003e (10), 1474\\u0026ndash;1479 (1990).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZaballos, M. A. et al. Regulators of the RAS-ERK pathway as therapeutic targets in thyroid cancer. \\u003cem\\u003eEndocr. Relat. Cancer\\u003c/em\\u003e. \\u003cb\\u003e26\\u003c/b\\u003e (6), R319\\u0026ndash;R344 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePiipponen, M. et al. Long noncoding RNA PICSAR promotes growth of cutaneous squamous cell carcinoma by regulating ERK1/2 activity. \\u003cem\\u003eJ. Invest. Dermatology\\u003c/em\\u003e. \\u003cb\\u003e136\\u003c/b\\u003e (8), 1701\\u0026ndash;1710 (2016).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLiu, K. et al. BIRC7 promotes epithelial-mesenchymal transition and metastasis in papillary thyroid carcinoma through restraining autophagy. \\u003cem\\u003eAm. J. cancer Res.\\u003c/em\\u003e \\u003cb\\u003e10\\u003c/b\\u003e (1), 78 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGugnoni, M. et al. Cadherin-6 promotes EMT and cancer metastasis by restraining autophagy. \\u003cem\\u003eOncogene\\u003c/em\\u003e \\u003cb\\u003e36\\u003c/b\\u003e (5), 667\\u0026ndash;677 (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMai, S. et al. Autophagy proteins LC3B, ATG5 and ATG12 participate in quality control after mitochondrial damage and influence lifespan. \\u003cem\\u003eAutophagy\\u003c/em\\u003e \\u003cb\\u003e8\\u003c/b\\u003e (1), 47\\u0026ndash;62 (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKaiser, S. E. et al. \\u003cem\\u003eNoncanonical E2 recruitment by the autophagy E1 revealed by Atg7\\u0026ndash;Atg3 and Atg7\\u0026ndash;Atg10 structures.\\u003c/em\\u003e Nature structural \\u0026amp; molecular biology, 19(12): pp. 1242\\u0026ndash;1249. (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eQin, Y. et al. RBM47/SNHG5/FOXO3 axis activates autophagy and inhibits cell proliferation in papillary thyroid carcinoma. \\u003cem\\u003eCell Death Dis.\\u003c/em\\u003e \\u003cb\\u003e13\\u003c/b\\u003e (3), 270 (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eQin, Y. et al. LncRNA GAS8-AS1 inhibits cell proliferation through ATG5-mediated autophagy in papillary thyroid cancer. \\u003cem\\u003eEndocrine\\u003c/em\\u003e \\u003cb\\u003e59\\u003c/b\\u003e, 555\\u0026ndash;564 (2018).\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"scientific-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"scirep\",\"sideBox\":\"Learn more about [Scientific Reports](http://www.nature.com/srep/)\",\"snPcode\":\"\",\"submissionUrl\":\"\",\"title\":\"Scientific Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Scientific Reports\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"LINC00162, Thyroid Cancer, Sorafenib, Chemosensitivity, MAPK Pathway, Apoptosis, Autophagy, lncRNA\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6159534/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6159534/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eMany studies have reported aberrant expression of the lncRNAs and indicated their role in cancer progression and drug resistance across various cancers. In this study, we aimed to evaluate the effect of the LINC00162 lncRNA in the chemosensitivity of thyroid cancer cells, both individually and in combination with sorafenib on various biological processes. In this regard, we conducted our experiments in several groups: 1) LINC00162 siRNA transfected cells, 2) Sorafenib treated cells, 3) Cells that received siRNA transfection and sorafenib treatment combination 4) Control group. MTT assay results revealed that siRNA-mediated silencing of the LINC00162 reduced the viability of the BC-PAP thyroid cancer cells, and increased the sensitivity of the cancerous cells to sorafenib by reducing its IC50. Flow cytometry assessment of apoptosis and cell cycle progression indicated that LINC00162 silencing induced apoptosis and Sub-G1 cell cycle arrest while its combination with sorafenib significantly increased apoptosis rate and also arrested cells in the G2-M phase in addition to Sub-G1 phase. This combination treatment increased the expression of apoptosis-related genes Bax, Caspase3, and Caspase9 while decreasing Bcl-2 expression. Additionally, significant inhibition of cell-cycle related gene c-myc and upregulation of p53 were observed following combination treatment. Furthermore, the combination therapy reduced the migration of the BC-PAP cells through the downregulation of MMP-3 and MMP-9. Colony sizes and numbers also decreased following siRNA-mediated silencing of LINC00162 and sorafenib treatment. qRT-PCR analysis of stemness-involved genes, including Nanog, Sox2, Cd44, and CD133 confirmed colony formation assay\\u0026rsquo;s findings. To understand the underlying mechanisms of LINC0162 lncRNA in thyroid cancer progression, we evaluated the expression of the MAPK pathway genes. Our finding indicated that LINC00162 silencing, in combination with sorafenib, reduced the expression of the MAPK, RAS, and RAF genes. From our findings, we can be conclude that LINC00162 silencing individually and combined with sorafenib reduced the progression and viability of thyroid cancer cells through modulating genes involved in key pathways and could be considered a new therapeutic approach in papillary thyroid cancer (PTC) treatment.\\u003c/p\\u003e\",\"manuscriptTitle\":\"LINC00162 Silencing Enhances Sorafenib Sensitivity and Inhibits Thyroid Cancer Cells Progression through Modulation of MAPK Signaling and Apoptosis\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-04-04 18:15:58\",\"doi\":\"10.21203/rs.3.rs-6159534/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2025-04-28T02:16:04+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-04-26T12:38:31+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-04-05T12:12:07+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"49274934133447397110930156120316503819\",\"date\":\"2025-04-05T11:06:32+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"115320022069667928140230677000105954925\",\"date\":\"2025-04-03T16:32:40+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-03-31T12:43:03+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-03-31T12:39:19+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvited\",\"content\":\"\",\"date\":\"2025-03-19T06:05:25+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-03-17T10:06:22+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Scientific Reports\",\"date\":\"2025-03-05T06:32:32+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"scientific-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"scirep\",\"sideBox\":\"Learn more about [Scientific Reports](http://www.nature.com/srep/)\",\"snPcode\":\"\",\"submissionUrl\":\"\",\"title\":\"Scientific Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Scientific Reports\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"791783a2-2748-4138-8b18-f78231a4ca93\",\"owner\":[],\"postedDate\":\"April 4th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[{\"id\":46650911,\"name\":\"Biological sciences/Cancer\"},{\"id\":46650912,\"name\":\"Biological sciences/Cell biology\"}],\"tags\":[],\"updatedAt\":\"2025-08-18T16:06:26+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-6159534\",\"link\":\"https://doi.org/10.1038/s41598-025-12805-x\",\"journal\":{\"identity\":\"scientific-reports\",\"isVorOnly\":false,\"title\":\"Scientific Reports\"},\"publishedOn\":\"2025-08-13 15:58:06\",\"publishedOnDateReadable\":\"August 13th, 2025\"},\"versionCreatedAt\":\"2025-04-04 18:15:58\",\"video\":\"\",\"vorDoi\":\"10.1038/s41598-025-12805-x\",\"vorDoiUrl\":\"https://doi.org/10.1038/s41598-025-12805-x\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6159534\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6159534\",\"identity\":\"rs-6159534\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}