{"paper_id":"22c8b682-a23b-4600-aaa0-db6d24392be9","body_text":"The Alleviating Effect of Gallic Acid on Chemotherapy-Induced Myelosuppression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The Alleviating Effect of Gallic Acid on Chemotherapy-Induced Myelosuppression Junyi Luo, Zhaoxia Zhang, Liming Jin, Zhaoying Wang, Qiuyue Sun, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4498216/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background This study aims to investigate the alleviating effects of Gallic Acid (GA) on chemotherapy-induced bone marrow suppression. Methods A mouse model of bone marrow suppression was established in BALB/c mice using intraperitoneal injections of cyclophosphamide (CTX). Mice were treated with low (100 mg/kg/d), medium (200 mg/kg/d), and high (400 mg/kg/d) doses of GA to mitigate the CTX-induced bone marrow suppression. The efficacy of GA in alleviating chemotherapy-induced bone marrow suppression was evaluated through blood cell counts, immune organ (thymus and spleen) indices, bone marrow nucleated cell (BMNC) counts, cell cycle, apoptosis, histopathology of bone marrow and spleen, and analysis of splenic hematopoietic factors. Results CTX induced a decrease in peripheral blood and BMNC counts, reduced spleen and thymus indices, and abnormal pathology of bone marrow and spleen, as well as disturbances in hematopoietic factors. GA was able to alleviate these abnormalities in the bone marrow. It modulated cell proliferation and apoptosis, adjusted the proportion of cells in the G0/G1 phase, and reduced apoptosis in femoral bone marrow. Conclusion GA can alleviate the atrophy of immune organs, relieve the proliferation blockade of bone marrow cells, inhibit bone marrow cell apoptosis, and promote the recovery of the spleen and hematopoietic factors, thereby mitigating CTX-induced bone marrow suppression. The study confirms the potential of the natural compound GA as an effective adjunct in alleviating CTX-induced bone marrow suppression, offering significant clinical application potential. These findings provide a theoretical basis and experimental evidence for developing new adjunct chemotherapy treatment strategies. Natural compounds Bone marrow suppression Chemotherapy Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction Cancer ranks as the second leading cause of death globally, trailing only ischemic heart disease. By 2060, it is likely to become the leading cause of death, with an overall cancer risk of 20.2% for individuals aged 0–74[ 1 ]. Chemotherapy is a common cancer treatment approach, employing various drugs such as anthracyclines (e.g., doxorubicin), alkylating agents (e.g., cyclophosphamide, ifosfamide), antimetabolites (e.g., methotrexate), topoisomerase inhibitors (e.g., etoposide), alkaloids (e.g., vincristine), and cytotoxic antibiotics (e.g., dactinomycin), these drugs are used in combinations to achieve therapeutic effects but also cause various side effects[ 2 – 7 ]. Common adverse reactions induced by chemotherapy drugs include suppression of the hematopoietic system, ototoxicity, pulmonary toxicity, hepatorenal toxicity, and cardiotoxicity[ 8 ]. Among these, bone marrow suppression is the most common and has a significant impact on prognosis[ 9 ]. Cyclophosphamide (CTX), a widely used alkylating antineoplastic agent, is primarily utilized for treating hematological malignancies and various epithelial tumors[ 10 ]. However, while inhibiting cancer cells, the active intermediates of CTX cannot effectively differentiate between normal and tumor cells, leading to bone marrow suppression and immunosuppression[ 11 ]. Chemotherapy-induced bone marrow suppression primarily manifests as reductions in red blood cells (RBCs), white blood cells (WBCs), and platelets (PLTs), increasing the risk of infections, bleeding, and fatigue, thereby affecting the treatment progress and quality of life of patients[ 12 ]. Therefore, alleviating bone marrow suppression is crucial for enhancing the efficacy of cancer chemotherapy and improving patient survival quality. Current methods for treating bone marrow suppression include the administration of recombinant human granulocyte colony-stimulating factor (RhG-CSF), erythropoiesis-stimulating agents, and blood transfusions. However, each of these approaches has its drawbacks: RhG-CSF can induce bone pain, erythropoiesis-stimulating agents may lead to thrombosis, and blood transfusions can trigger transfusion reactions[ 13 ]. Consequently, there is an urgent need to develop new therapeutic strategies. Research indicates that certain natural compounds, known for their anti-inflammatory, antioxidant, and immunomodulatory properties, show potential in alleviating bone marrow suppression. Ginsenosides, for instance, have demonstrated effectiveness against liver cancers[ 14 ], gastric cancers[ 15 ], and prostate cancers[ 16 ], along with their immunomodulatory[ 17 ] and antioxidant activities[ 18 ]. Jiahong Han et al., suggest that ginsenoside Rg3 can mitigate the reduction in peripheral blood bone marrow nucleated cell counts, thymic index, and spleen index caused by cyclophosphamide[ 19 ]. Curcumin has demonstrated anti-colorectal cancer effects[ 20 ], anti-lung cancer effects[ 21 ], anti-liver cancer effects[ 22 ], as well as anti-inflammatory[ 23 ] and antioxidant properties[ 24 ]. According to Monika A. Papież, curcumin helps alleviate etoposide-induced myelodysplasia by increasing the proportion of granulocyte precursors and lymphocytes [ 25 ].Further research by Kartick Patra et al. points to cinnamic acid's ability to lessen the reduction in bone marrow and splenic cells induced by cyclophosphamide, linking it to oxidative stress in the bone marrow and liver[ 26 ]. Gallic acid (3,4,5-trihydroxybenzoic acid, GA), a biologically active natural phenolic compound, has been proven to possess antioxidant properties [ 27 ]and efficacy against lung cancers 28 , breast cancers[ 29 ], and prostate cancers[ 30 ], in addition to its anti-inflammatory [ 31 ]and immunomodulatory functions[ 32 ]. Based on these findings, it is reasonable to hypothesize that gallic acid could play a significant role in alleviating bone marrow suppression. To study the effects of gallic acid (GA) on chemotherapy-induced bone marrow suppression, we utilized a mouse model developed using cyclophosphamide (CTX)[ 11 ]. By establishing this bone marrow suppression model in mice with CTX and administering gallic acid, we monitored several parameters, including peripheral blood cell counts, spleen and thymus organ indices, femur tissue histopathology, cell cycle dynamics, apoptosis, and hematopoietic factors. This approach allowed us to assess whether GA could alleviate the suppression of the hematopoietic system induced by CTX. Our findings aim to provide new therapeutic insights for managing bone marrow suppression resulting from chemotherapy. 2. Materials and Methods 2.1 Experimental Drugs Gallic acid (GA) was procured from Shanghai Aladdin Biochemical Technology Co., Ltd. (Shanghai, China) (Catalog No.: G131992), with a purity exceeding 99% as confirmed by HPLC analysis. Cyclophosphamide (CTX) was also obtained from Shanghai Aladdin Biochemical Technology Co., Ltd. (Shanghai, China) (Catalog No.: C126044), with a purity greater than 98%, as determined by HPLC. Diyu Shengbai tablets(DYSB) were sourced from Sichuan Chengdu Di Ao Group Tianfu Pharmaceutical Co., Ltd. (Sichuan, China) (License No.: Z20026497). Recombinant human granulocyte colony-stimulating factor was acquired from Xiamen Amoytop Biotech Co., Ltd. (Xiamen, China) (Catalog No.: S20033047). 2.2 Major Instruments and Reagents Lymphocyte separation medium for mice was obtained from Solarbio Science & Technology Co., Ltd. (Beijing, China) (Catalog No.: P6040). EDTA decalcifying solution was purchased from Servicebio Technology Co., Ltd. (Wuhan, China) (Catalog No.: G1105-500ML). The Cell Cycle Analysis Kit was acquired from BD Pharmingen (USA, 550825); the cycle reagent was added according to the manual, and the cell cycle was analyzed using flow cytometry and ModFit LT software (Version 3.2). The Annexin V-FITC Apoptosis Detection Kit was also sourced from BD Pharmingen (USA, 556547). Apoptotic cells were quantified using a flow cytometer (BD Pharmingen, USA) and analyzed with FlowJo software (Version 10.8.1). Primers for real-time quantitative PCR (RT-qPCR) were designed and synthesized by Shanghai Qingke Biotechnology Co., Ltd. (Shanghai, China). All chemical reagents used were of at least analytical grade. 2.3 Experimental Animals All procedures in this study were approved by the Ethics Committee of the Children's Hospital affiliated with Chongqing Medical University (Chongqing, China), under approval number CHCMU-IACUC20220323001. Female Balb-c mice, weighing 12–16 grams and aged 4 weeks, were sourced from the Experimental Animal Center of Chongqing Medical University. All mice were housed in a specific pathogen-free environment at the Animal Experimentation Center of Chongqing Medical University's Children's Hospital. Prior to the initiation of the experiments, the mice were provided with autoclaved standard rodent chow and water. They were acclimated to their cages for 3 days under a 12:12 hour light-dark cycle, with lights on at 7 AM. 2.4 Methods 2.4.1 Model Establishment Thirty-six 4-week-old Balb-c mice were randomly divided into two groups: the model group (receiving cyclophosphamide (CTX) at a dosage of 100 mg/kg/day via intraperitoneal injection) and the control group (receiving an equivalent volume of saline via intraperitoneal injection). On days 3, 5, and 7, six mice from each group were randomly selected for sampling. Assessment parameters included general condition, peripheral blood counts, and spleen and thymus indices. 2.4.2 Intervention Experimental Grouping and Administration An additional forty-two 4-week-old Balb-c mice were randomly divided into seven groups of six each: control, model, low-dose gallic acid (L-GA), medium-dose gallic acid (M-GA), high-dose gallic acid(H-GA), Diyu Shengbai tablet(DYSB), and recombinant human granulocyte colony-stimulating factor (RhG-CSF). The GA groups received varying concentrations of GA solution orally for 10 consecutive days: low-dose (100 mg/kg/day), medium-dose (200 mg/kg/day), and high-dose (400 mg/kg/day). The Diyu Shengbai tablet group was administered Di yu sheng bai tablets at 100 mg/kg/day orally for the same duration. Both the model and control groups received saline orally once daily for 10 days. On day 7, all groups except the control received CTX intraperitoneally at 100 mg/kg/day for three consecutive days. On day 10, the RhG-CSF group received an intravenous injection of RhG-CSF at 125 mg/kg/day for two consecutive days. All indices were measured on day 12. 2.4.3 Sample Collection Twenty-four hours after the last administration, the body weight of the mice was measured. At the conclusion of the experiment, blood samples were collected into clean tubes containing ethylenediaminetetraacetic acid (EDTA), and the mice were briefly disinfected by immersion in 75% ethanol. Subsequently, both femurs were rapidly and completely isolated, and cleaned with gauze. One femur from each mouse was fixed in formaldehyde and decalcified with EDTA-sodium solution for 30 days to prepare histological sections. The other femur was cut at both ends under sterile conditions and washed three times with phosphate-buffered saline (PBS) containing antibiotics (penicillin-streptomycin). The epiphyses were removed with tweezers, and the bone shaft was flushed multiple times with PBS using a syringe. Bone marrow nucleated cells were extracted following the lymphocyte separation medium manual for subsequent bone marrow nucleated cell counting and flow cytometry analysis. The thymus and spleen were immediately excised post-experiment and collected for further analysis. 2.4.4 Peripheral Blood Analysis A 100 µL blood sample containing EDTA was analyzed by the Laboratory Department of the Children's Hospital affiliated with Chongqing Medical University. The analysis included measurements of white blood cells (WBC), red blood cells (RBC), hemoglobin (Hb), and platelets (Plt). Quantitative data were expressed as mean ± standard deviation. Differences between two groups were determined using the t-test, while comparisons involving three or more groups utilized one-way analysis of variance (one-way ANOVA). A P-value of less than 0.05 was considered statistically significant. 2.4.5 Thymus and Spleen Indices Immediately after euthanasia, the thymus and spleen were excised from the mice and weighed to calculate the organ indices. The organ index is expressed as the ratio of the organ weight to the body weight, denoted in milligrams per gram (mg/g)[ 33 ]. 2.4.6 Femur and Spleen Staining For each group, three femur samples are fixed in 4% formaldehyde. Parts of the spleen from each group are also fixed using 4% formaldehyde. After dehydration, the spleen and femur are embedded in paraffin to produce sections 5µm thick for histological analysis. The sections are stained with Hematoxylin and Eosin (H&E) and all images are captured and observed under an ECLIPSE Ci microscope (Nikon, Tokyo, Japan). 2.4.7 Bone Marrow Nucleated Cell (BMNC) Cycle Analysis Bone marrow nucleated cells (BMNCs) are washed with cold PBS and then fixed with 75% cold ethanol. The cells are stained using propidium iodide (PI)/RNase staining buffer (BD Pharmingen, 550825, USA) for cell cycle analysis via flow cytometry, and the phases G0/G1, S, and G2/M are determined using ModFit LT software (Version 3.2). 2.4.8 Bone Marrow Nucleated Cell (BMNC) Apoptosis Analysis BMNCs are washed with cold PBS. Apoptosis is analyzed using the Annexin V Apoptosis Detection Kit (BD Pharmingen, 556547, Franklin Lakes, NJ, USA). Annexin V reagent is added according to the manufacturer’s instructions, and apoptotic cells are detected using a flow cytometer (BD Pharmingen, USA). Data analysis is performed using FlowJo software (Version 10.8.1). 2.4.9 Analysis of Hematopoietic Factor mRNA Expression in the Spleen Spleen tissue is homogenized using a ribolyzer and then centrifuged twice. Total RNA is extracted from the supernatant and its purity is measured using spectrophotometry. Then, 1 µg of total RNA from each sample is reverse-transcribed into cDNA using the SuperRT cDNA Kit. The synthesized cDNA is amplified using SYBR Green Realtime PCR Master Mix. The nucleotide sequences of the forward and reverse primers used for PCR are listed in Table 1 . The PCR cycles consist of 1 minute at 95°C, followed by 40 cycles of 5 seconds at 95°C, 15 seconds at 56°C, and 20 seconds at 72°C. RT-qPCR analysis is conducted using the LightCycler 480 RT-qPCR System (Roche, Basel, Switzerland). Relative mRNA expression results for each group are calculated using the comparative Ct method (Livak and Schmittgen, 2001), setting the normal control as 100%. Tabel 1 .Primers used for quantitative RT-PCR. Genes Forward(5'–3') Reverse(5'–3') GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA IL-1β GCTACCTGTGTCTTTCCCGT CGTCACACACCAGCAGGTTA IL-3 GGTTCTTGCCAGCTCTACCA GGTATCCCGGCCACTGATTG IL-6 GTGGCTAAGGACCAAGACCA TAACGCACTAGGTTTGCCGA GM-CSF GGCCATCAAAGAAGCCCTGA TGGTGAAATTGCCCCGTAGA EPO AGGTACATCTTAGAGGCCAAGGA AACTTCTATGGCCTGTTCTTCCA TPO GTGACCGAAGATGACCAGTACTC AGGAGTTTGAGGGAAGCTGTATG SCF ATGTTCCCCGCTCTCTTTGG GTGTGGCATAAGGGCTCACT TNF-α GACCCTCACACTCAGATCATCTT CCTTGAAGAGAACCTGGGAGTAG 2.4.9 Statistical Analysis The results are analyzed using GraphPad Prism 9.0 software. Quantitative data are expressed as mean ± standard deviation. Differences between two groups are assessed using the t-test, while comparisons involving three or more groups are analyzed using one-way analysis of variance (one-way ANOVA). A P-value of less than 0.05 is considered statistically significant. All experiments are conducted in triplicate or more. 3. Results 3.1 Gallic Acid Mitigates the Decline in Peripheral Blood Cells Due to Bone Marrow Suppression in Mice Table 1 illustrates that compared to the normal group, cyclophosphamide (CTX) treatment on days 3, 5, and 7 significantly reduced the counts of white blood cells (WBCs), platelets, and hemoglobin concentration in mice, as well as significantly lowered the spleen and thymus indices, with statistical significance. Following 3 days of CTX injection, the model mice exhibited symptoms such as reduced hair, lethargy, sluggish response, hunched posture, reduced food and water intake; these symptoms were more pronounced after 5 days, accompanied by continuous weight loss; after 7 days, further significant weight reduction was observed, along with weak breathing, sparse hair, reduced body temperature, and significant thymus atrophy and fragility. These results indicate that the bone marrow suppression model established with 3 days of CTX treatment is ideal due to its stability, milder suppression, better general condition of the mice, easier recovery, and its ability to avoid complications related to bone marrow suppression. Table 2 Effects of cyclophosphamide injection time on peripheral blood, spleen index and thymus index of myelosuppressed mice(mean ± sd) Group WBC(x10 9 /L) PLT(x10 9 /L) RBC(x10 12 /L) Hb(g/dL) Weight(g) Spleen index(mg/g) Thymus index(mg/g) n 3d-Normal 4.79 ± 0.73 1181.67 ± 143 9.53 ± 0.47 150.67 ± 2.08 13.12 ± 1.55 9.34 ± 1.24 2.01 ± 0.34 6 3d-model 2.44 ± 0.9** 939.5 ± 211.65** 8.91 ± 0.15 140 ± 5.42** 11.62 ± 1.23 4.23 ± 1.33** 0.84 ± 0.21** 6 5d-Normal 5.49 ± 1.01 1055.71 ± 92.91 9.57 ± 0.12 146.86 ± 7.22 11.6 ± 1.33 6.54 ± 1.02 2.7 ± 3.17 6 5d-model 0.42 ± 0.33** 603 ± 110.48** 8.57 ± 0.9* 132.13 ± 15.29** 10.25 ± 2.45 7.98 ± 0.87** 5.96 ± 1.79** 6 7d-Normal 5.66 ± 0.73 1068.54 ± 89.2 9.53 ± 0.47 140.63 ± 2.08 12.12 ± 1.75 8.34 ± 1.24 1.96 ± 0.54 5 7d-model 0.12 ± 0.24** 220.54 ± 111.3** 8.32 ± 0.11* 128 ± 5.43** 9.32 ± 1.65 3.23 ± 2.33* 0.44 ± 0.21* 5 Note:n, number of mice.*p < 0.05, **p < 0.05,compared with Normal. Peripheral blood cell counts indirectly reflect hematopoietic function[ 34 ]. Compared to the normal group, the WBC count in the model group was significantly reduced, consistent with the modeling results, suggesting that the CTX-induced bone marrow suppression model closely mirrors the clinical manifestations of bone marrow suppression (Fig. 1 A, B, C). Compared to the model group, low, medium, and high doses of gallic acid (L-GA, M-GA, H-GA) significantly increased the WBC counts in mice with bone marrow suppression. There were significant differences between the low and medium dose groups compared to the high dose group, indicating a dose-dependent effect of gallic acid. The effect of high-dose gallic acid on increasing WBC counts was superior to that of recombinant human granulocyte colony-stimulating factor (rhG-CSF) (Fig. 1 A). Compared to the model group, medium and high doses of gallic acid significantly increased the hemoglobin count, with statistical significance. The hemoglobin counts in the low and medium dose groups were significantly different, further confirming the dose-dependent effect of gallic acid. The effect of low-dose gallic acid on increasing peripheral blood hemoglobin count was superior to rhG-CSF (Fig. 1 B). Compared to the model group, high-dose gallic acid significantly increased the platelet count, with significant differences between the low and medium dose groups compared to the high dose group, indicating a dose-dependent effect of gallic acid in this regard as well. The effect of high-dose gallic acid on increasing platelet counts was superior to rhG-CSF (Fig. 1 C). These results indicate that different concentrations of gallic acid significantly increase peripheral blood cell counts, demonstrating a dose-response relationship, with high concentrations of gallic acid being more effective in alleviating CTX-induced bone marrow suppression than rhG-CSF. 3.2 Gallic Acid Mitigates Cyclophosphamide-Induced Pathological Changes in the Spleen and Thymus Cyclophosphamide (CTX) causes immune and bone marrow suppression, and the primary immune organs in mice are the thymus and spleen. Therefore, we assessed the immunomodulatory effects of gallic acid (GA) on CTX-treated mice using organ indices. Compared to the normal group, the spleen and thymus indices in the model group were significantly reduced, indicating the successful establishment of the bone marrow suppression model (Fig. 2 A/B). Compared to the normal group, other groups also showed significant differences in spleen and thymus indices, suggesting that different treatments post-modeling could not fully restore these indices. However, compared to the model group, low, medium, and high doses of GA significantly alleviated the reduction in spleen indices, and high-dose GA significantly alleviated the reduction in thymus indices, with statistical significance. These results indicate that GA can mitigate the atrophy of immune organs induced by CTX in mice with bone marrow suppression. Histopathological examinations were conducted to explore the pathological changes in the spleen and bone marrow during GA treatment. Spleen sections stained with Hematoxylin and Eosin (H&E) showed normal tissue structure in the normal group (Fig. 2 C). In the model group, multiple multinucleated giant cells with atypical nuclei were visible in the spleen. With increasing concentrations of GA, the number of multinucleated giant cells in the spleen decreased. Bone marrow H&E staining showed normal bone marrow tissue structure in the normal group. In contrast, the model group showed a reduction in bone marrow cellularity, along with the appearance of vacuoles and an increase in multinucleated giant cells and fat cells (Fig. 2 D). In GA-treated groups, as the concentration increased, the number of multinucleated giant cells, vacuoles, and fat cells in the bone marrow decreased, while the number of bone marrow cells increased and the distribution became more uniform and orderly. 3.3 GA Alleviates the Decline in BMNCs, Reduces Cell Cycle Arrest, and Mitigates Apoptosis in Mice with Bone Marrow Suppression BMNC (Bone Marrow Nucleated Cell) count is a direct indicator of hematopoietic function. Compared to the normal group, the model group showed a significant reduction in BMNC count, consistent with the characteristics of the cyclophosphamide-induced bone marrow suppression model (Fig. 3 C). Compared to the model group, medium and high doses of gallic acid (GA) significantly alleviated the decline in BMNC count, with statistical significance. There was a significant difference between the low and high-dose GA groups, indicating a dose-dependent relationship of GA. Compared to the Diyu Shengbai (DYSB) group, medium and high doses of GA significantly alleviated the decline in BMNCs, performing better than DYSB. Changes in the cell cycle distribution of bone marrow cells across the groups are shown in Fig. 3 A. Compared to the normal group, the proportion of G0/G1 phase cells in the BMNCs of the model control group significantly increased, while the proportions of G2/M and S phase cells significantly decreased, all statistically significant, due to chemotherapy-induced proliferation blockade. Compared to the model control group, the high-dose GA group showed a significant reduction in the proportion of G0/G1 phase BMNCs and a significant increase in the proportion of G2/M phase cells and the proliferation index, indicating that high-dose GA can reduce the proportion of bone marrow cells in G0/G1 phase and increase those in G2/M phase. This suggests that GA can enhance the proliferative capacity of bone marrow cells to some extent, alleviate chemotherapy-induced bone marrow suppression, improve the function of the impaired hematopoietic system, and promote the recovery of hematopoietic function. Changes in BMNC apoptosis across the groups are shown in Fig. 3 B. Compared to the normal group, the model group showed a significant increase in the proportion of early apoptotic and total apoptotic cells, statistically significant. Compared to the model control group, the low-dose GA group showed a significant decrease in the proportion of early apoptotic BMNCs, and the medium-dose GA group showed a significant decrease in both early apoptotic and total apoptotic BMNCs, statistically significant, indicating that GA can inhibit apoptosis in mice with bone marrow suppression. These results suggest that the significant reduction in BMNCs post-radiotherapy/chemotherapy could be due to both inhibited cell proliferation and increased apoptosis. The role of GA in promoting the recovery of BMNCs might be associated with its ability to promote entry of bone marrow cells into the G2/M proliferation cycle and prevent apoptosis. 3.4 GA Alleviates Abnormalities in Hematopoietic Factors in the Spleens of Mice with Bone Marrow Suppression As depicted in Fig. 4 , compared to the normal control group, the model control group exhibited significantly decreased mRNA levels of hematopoietic promoting factors such as IL-1β, IL-3, IL-6, TPO, EPO, GM-CSF, and SCF, while the mRNA level of the hematopoietic inhibitory factor TNF-α was significantly increased, indicating that cyclophosphamide-induced bone marrow suppression in mice decreases hematopoietic promoters and increases inhibitors. Compared to the model control group, low, medium, and high doses of gallic acid (GA) significantly increased the mRNA levels of IL-1β, IL-3, IL-6, EPO, GM-CSF, and SCF in mice. The low-dose GA group also showed a significant increase in TPO mRNA level. These findings suggest that different concentrations of GA can promote the expression of hematopoietic growth factors such as IL-1β, IL-3, IL-6, GM-CSF, TPO, EPO, and SCF in model mice, positively regulating hematopoiesis. Additionally, the TNF-α mRNA levels significantly decreased in the low, medium, and high-dose GA groups compared to the model group, indicating that GA can suppress TNF-α mRNA expression, thus negatively regulating hematopoiesis. Compared to the Diyu Shengbai (DYSB) group, the high-dose GA group showed a significant increase in IL-3 mRNA levels, while the medium and high-dose GA groups had significantly higher GM-CSF mRNA levels, and the low-dose GA group had significantly higher TPO mRNA levels. The medium-dose GA group also showed a significant increase in SCF mRNA levels. Compared to the recombinant human granulocyte-stimulating factor (Rh-GSF) group, the high-dose GA group had significantly higher IL-3 mRNA levels, and all GA dose groups exhibited significantly higher GM-CSF mRNA levels. The high-dose GA group also showed a significant increase in IL-6 mRNA levels. These results demonstrate that GA's effect in alleviating cyclophosphamide-induced suppression of spleen hematopoietic factor expression is superior to that of DYSB and Rh-GSF. 4. Discussion Bone marrow suppression remains the principal dose-limiting toxicity of cancer chemotherapy, leading to high morbidity and mortality rates[ 35 ]. Reducing chemotherapy dosage may compromise disease control and patient survival. Therefore, identifying natural compounds that can mitigate chemotherapy-induced bone marrow suppression without necessitating a reduction in chemotherapy dosage is of significant clinical importance. Cyclophosphamide (CTX), a commonly used alkylating broad-spectrum antitumor drug, is typically employed to establish chemotherapy-induced bone marrow suppression models. CTX primarily inhibits DNA replication and transcription or causes DNA strand breaks by undergoing alkylation reactions, resulting in damage to DNA structure and function[ 36 ]. Furthermore, the metabolites of CTX can disrupt the antioxidant system, leading to increased reactive oxygen species and subsequent DNA strand breaks[ 37 ]. Therefore, antioxidants are recommended to counteract the side effects of CTX. Gallic acid (GA) has been proven to protect against CTX-induced genotoxicity, liver damage[ 38 ], and nephrotoxicity[ 39 ], suggesting that it might also alleviate CTX-induced bone marrow suppression. The lifespan of circulating peripheral blood cells is limited, and their continuous replenishment is managed by the bone marrow. Thus, the quantity of peripheral blood cells indirectly reflects the hematopoietic function of the bone marrow, and the count of BMNCs directly indicates hematopoietic activity[ 40 ]. Our study results show that the model group mice exhibited a significant reduction in peripheral blood cell counts and BMNCs, consistent with results from using CTX to establish a bone marrow suppression model[ 41 ]. After intervention with various concentrations of GA, the study confirmed that GA could restore the numbers of BMNCs, WBCs, PLTs, and Hb in the bone marrow suppression mouse model, although changes in RBC numbers were not significant. This phenomenon has not yet been explained in this study and requires further research to reveal its mechanism. Additionally, changes in BMNC numbers correspond with histological findings in bone marrow sections. After CTX use, bone marrow structure was disrupted, with reduced cell counts and increased vacuolation and multinucleated giant cells and fat cells. However, GA intervention mitigated these structural damages and facilitated some recovery in structure and function. The spleen and thymus are critical immune and hematopoietic organs. CTX can damage these organs, leading to atrophy and reduced organ indices[ 42 ]. Our results also confirmed that cyclophosphamide causes atrophy of the thymus and spleen, with reduced spleen and thymus indices. H&E staining showed that CTX disrupted spleen structure. However, after GA intervention, atrophy in the spleen and thymus was alleviated, and the normal structure and function of the spleen were somewhat restored. These changes indicate that GA plays a positive role in the differentiation of the hematopoietic system and the functional recovery of immune organs. Previous studies have shown that CTX induces apoptosis and cell cycle arrest in bone marrow suppression mice, with proliferating bone marrow cells being most sensitive to chemotherapy damage[ 19 ]. After chemotherapy, CTX causes DNA damage in hematopoietic cells, activating cell cycle checkpoint mechanisms, causing cell cycle arrest at the G1 phase to repair the damaged DNA. Our findings are consistent with this, showing an increase in the proportion of cells in the G1/M phase and a decrease in G2 and S phase cells, characteristic of damaged cells arrested at the G1 phase. GA intervention significantly increased the proportion of cells in the G1 phase, indicating that GA can promote the repair of DNA-damaged cells and facilitate entry into the proliferation phase. However, the specific mechanisms by which GA repairs cell DNA require further investigation. Additionally, GA not only alleviates CTX-induced apoptosis but also relieves cell cycle arrest. Our study has not yet definitively determined whether GA reduces apoptosis rates by relieving the cell cycle arrest of bone marrow nucleated cells or has dual activity in relieving cell cycle arrest and reducing apoptosis rates. In future research, we will further explore the specific mechanisms by which GA alleviates CTX-induced bone marrow suppression. The hematopoietic system is regulated by various factors, including both promoting and inhibitory cytokines[ 43 ]. Promoting cytokines such as IL-1β, IL-3, IL-6, TPO, EPO, GM-CSF, and SCF play vital roles, while TNF-α serves as an inhibitory factor. IL-1 protects and restores bone marrow from chemotherapy or radiation damage[ 44 ], and it affects all cells of the innate immune system[ 45 ]. IL-3, known as multi-colony stimulating factor, is extensively studied for treating bone marrow failure and hematologic malignancies, mobilizing and expanding hematopoietic progenitor cells for transplantation, and supporting post-transplant engraftment[ 46 ]. IL-6 is crucial in immune responses with context-dependent pro-inflammatory and anti-inflammatory properties, making it a key target for clinical intervention[ 47 ]. Erythropoietin (EPO) regulates erythropoiesis in mammals by driving the maturation of erythroid cells through its homodimeric receptor (EPO-R), resulting in the production of billions of mature red blood cells[ 48 ]. Thrombopoietin (TPO), produced by the liver and kidneys, regulates platelet production[ 49 ]. Granulocyte-macrophage colony-stimulating factor (GM-CSF) induces the production of myeloid cells, including neutrophils, monocytes, macrophages, and dendritic cells, in response to stress, infection, and cancer[ 50 ]. Stem cell factor (SCF) collaborates with other factors in hematopoietic regulation, modulating hematopoietic stem and progenitor cells[ 51 ]. In contrast, tumor necrosis factor-α (TNF-α) inhibits the proliferation and differentiation of hematopoietic cells[ 52 ].The study results indicate that after GA intervention, hematopoietic promoting factors increased while inhibitory factors were suppressed in chemotherapy-induced myelosuppressed mice, positively regulating hematopoiesis. These increased promoting factors may collectively enhance the differentiation of hematopoietic stem cells, ultimately influencing megakaryocyte and erythrocyte formation. However, the specific effects of GA on hematopoietic stem cell differentiation require further investigation. In conclusion, this study confirms that the natural compound GA can serve as an adjunctive treatment option to alleviate cyclophosphamide-induced bone marrow suppression. However, the specific mechanisms by which GA mitigates the side effects of CTX require further investigation. Given its widespread availability and low cost, GA's potential therapeutic role in alleviating chemotherapy-induced side effects lays the foundation for clinical trials exploring GA treatment in patients with bone myelosuppression. Abbreviations GA Gallic acid L-GA Low-dose gallic acid M-GA Medium-dose gallic acid H-GA High-dose gallic acid CTX Cyclophosphamide DYSB Di yu sheng bai tablet RhG-CSF Recombinant human granulocyte colony-stimulating factor WBC White blood cell RBC Red blood cell PLT Platelet Hb Hemoglobin Declarations Availability of data and materials All data generated or analysed during this study are included in this published article. Conflict of interest All the authors declare that there are no conflicts of interest. Ethics statement The animal study was reviewed and approved by the Ethics Committee of the Chongqing Medical University. Data availability The data that has been used is confidential. Funding This work was supported by “Chongqing graduate research innovation project”(CYS23343) and The Chongqing Traditional Chinese Medicine Innovation Team: \"Innovative Team for the Development of New Targeted Delivery Traditional Chinese Medicine Formulations.\" Author Contributions Conceptualization, Junyi Luo, Zhaoxia Zhang, Liming Jin; Data curation, Junyi Luo, Zhaoying Wang; Formal analysis, Junyi Luo; Funding acquisition, Dawei He; Investigation, Junyi Luo, Zhaoxia Zhang , Liming Jin, Zhaoying Wang and Qiuyue Sun; Methodology, Junyi Luo, Zhaoxia Zhang, Junyi Luo, Zhaoying, Qiuyue Sun and Dawei He; Project administration, Dawei He; Supervision, Dawei He; Validation, Junyi Luo; Visualization, Junyi Luo and Liming Jin; Writing–original draft, Liming Jin; Writing–review & editing, Junyi Luo, Zhaoxia Zhang , Liming Jin and Dawei He. Acknowledgements Not applicable. References C M, G L. Current Cancer Epidemiology. Journal of epidemiology and global health. 2019;9. Turner N, Biganzoli L, Di Leo A. Continued value of adjuvant anthracyclines as treatment for early breast cancer. Lancet Oncol. 2015;16:e362-369. A E, Rj J, Ra B. Cyclophosphamide and cancer: golden anniversary. Nature reviews Clinical oncology. 2009;6. Wagenaar HC, Colombo N, Vergote I, Hoctin-Boes G, Zanetta G, Pecorelli S, et al. Bleomycin, methotrexate, and CCNU in locally advanced or recurrent, inoperable, squamous-cell carcinoma of the vulva: an EORTC Gynaecological Cancer Cooperative Group Study. European Organization for Research and Treatment of Cancer. Gynecol Oncol. 2001;81:348–54. Paz-Ares L, Dvorkin M, Chen Y, Reinmuth N, Hotta K, Trukhin D, et al. Durvalumab plus platinum-etoposide versus platinum-etoposide in first-line treatment of extensive-stage small-cell lung cancer (CASPIAN): a randomised, controlled, open-label, phase 3 trial. Lancet. 2019;394:1929–39. K S, M Y, Y A, K M, K S, S K, et al. Rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisolone combined with high-dose methotrexate plus intrathecal chemotherapy for newly diagnosed intravascular large B-cell lymphoma (PRIMEUR-IVL): a multicentre, single-arm, phase 2 trial. The Lancet Oncology. 2020;21. Combination of TRAIL and actinomycin D liposomes enhances antitumor effect in non-small cell lung cancer - PubMed. https://pubmed.ncbi.nlm.nih.gov/22619505/. Accessed 13 May 2024. Im Z, Y H-B. [Management of chemotherapy side effects and their long-term sequelae]. Der Urologe Ausg A. 2021;60. S Y, H C, L X, B Z, S L. Traditional Chinese medicine on treating myelosuppression after chemotherapy: A protocol for systematic review and meta-analysis. Medicine. 2021;100. Ahlmann M, Hempel G. The effect of cyclophosphamide on the immune system: implications for clinical cancer therapy. Cancer Chemother Pharmacol. 2016;78:661–71. Xh H, Yp L, T G, Ry C, Ym F. Immunosuppressive effect of cyclophosphamide on white blood cells and lymphocyte subpopulations from peripheral blood of Balb/c mice. International immunopharmacology. 2011;11. Rs E, Ms A, Uk BR, T S, J K, Ml L-P, et al. Patient Burden and Real-World Management of Chemotherapy-Induced Myelosuppression: Results from an Online Survey of Patients with Solid Tumors. Advances in therapy. 2020;37. J C, D H, K G, J W. The impact of myelosuppression on quality of life of patients treated with chemotherapy. Future oncology (London, England). 2024. https://doi.org/10.2217/fon-2023-0513. Ginsenoside Compound K Regulates HIF-1α-Mediated Glycolysis Through Bclaf1 to Inhibit the Proliferation of Human Liver Cancer Cells - PubMed. https://pubmed.ilibs.cn/33363466/. Accessed 21 May 2024. Ginsenoside Rh4 Suppresses Metastasis of Gastric Cancer via SIX1-Dependent TGF-β/Smad2/3 Signaling Pathway - PubMed. https://pubmed.ilibs.cn/35458126/. Accessed 21 May 2024. X L, S C, M L, Y G, Y L, S Y, et al. Anticancer property of ginsenoside Rh2 from ginseng. European journal of medicinal chemistry. 2020;203. X L, Z Z, J L, Y W, Q Z, S W, et al. Ginsenoside Rg3 improves cyclophosphamide-induced immunocompetence in Balb/c mice. International immunopharmacology. 2019;72. F Y, Q X, K L, X C, L S, Y L. Phenolic Compounds and Ginsenosides in Ginseng Shoots and Their Antioxidant and Anti-Inflammatory Capacities in LPS-Induced RAW264.7 Mouse Macrophages. International journal of molecular sciences. 2019;20. Han J, Xia J, Zhang L, Cai E, Zhao Y, Fei X, et al. Studies of the effects and mechanisms of ginsenoside Re and Rk3 on myelosuppression induced by cyclophosphamide. Journal of Ginseng Research. 2019;43:618–24. M P, B G, F G, G L, E I, A DL. Curcumin and Colorectal Cancer: From Basic to Clinical Evidences. International journal of molecular sciences. 2020;21. Wnb WMT, Nh L, F A, I O, R N. Mechanistic Understanding of Curcumin’s Therapeutic Effects in Lung Cancer. Nutrients. 2019;11. Si SA-H, S AJ, M MK, S JS, I A, Rm RP, et al. Curcumin in the treatment of liver cancer: From mechanisms of action to nanoformulations. Phytotherapy research : PTR. 2023;37. Y P, M A, B D, Y J, L Y, Z C, et al. Anti-Inflammatory Effects of Curcumin in the Inflammatory Diseases: Status, Limitations and Countermeasures. Drug design, development and therapy. 2021;15. Antioxidant and anti-inflammatory effects of curcumin/turmeric supplementation in adults: A GRADE-assessed systematic review and dose-response meta-analysis of randomized controlled trials - PubMed. https://pubmed.ilibs.cn/36804260/. Accessed 22 May 2024. Ma P. The influence of curcumin and (-)-epicatechin on the genotoxicity and myelosuppression induced by etoposide in bone marrow cells of male rats. Drug and chemical toxicology. 2013;36. Patra K, Bose S, Sarkar S, Rakshit J, Jana S, Mukherjee A, et al. Amelioration of cyclophosphamide induced myelosuppression and oxidative stress by cinnamic acid. Chemico-Biological Interactions. 2012;195:231–9. Dietary gallic acid as an antioxidant: A review of its food industry applications, health benefits, bioavailability, nano-delivery systems, and drug interactions - PubMed. https://pubmed.ilibs.cn/38395544/. Accessed 22 May 2024. Gallic Acid Impedes Non-Small Cell Lung Cancer Progression via Suppression of EGFR-Dependent CARM1-PELP1 Complex - PubMed. https://pubmed.ilibs.cn/32425504/. Accessed 22 May 2024. Anticancer Effect of Gallic Acid on Acidity-Induced Invasion of MCF7 Breast Cancer Cells - PubMed. https://pubmed.ilibs.cn/37630786/. Accessed 22 May 2024. Yg J, Eb K, Kc C. Gallic acid, a phenolic acid, hinders the progression of prostate cancer by inhibition of histone deacetylase 1 and 2 expression. The Journal of nutritional biochemistry. 2020;84. Gallic acid: Pharmacological activities and molecular mechanisms involved in inflammation-related diseases - PubMed. https://pubmed.ilibs.cn/33212373/. Accessed 22 May 2024. Gallic acid induces T-helper-1-like Treg cells and strengthens immune checkpoint blockade efficacy - PubMed. https://pubmed.ilibs.cn/35817479/. Accessed 22 May 2024. Guo M-Z, Meng M, Feng C-C, Wang X, Wang C-L. A novel polysaccharide obtained from Craterellus cornucopioides enhances immunomodulatory activity in immunosuppressive mice models via regulation of the TLR4-NF-κB pathway. Food Funct. 2019;10:4792–801. M Z, Y Z, X Z, W Z, Q Y, W Z, et al. Two birds with one stone: YQSSF regulates both proliferation and apoptosis of bone marrow cells to relieve chemotherapy-induced myelosuppression. Journal of ethnopharmacology. 2022;289. J C, Dc D, Gh L. Chemotherapy-induced neutropenia: risks, consequences, and new directions for its management. Cancer. 2004;100. Wang C, Gao H, Cai E, Zhang L, Zheng X, Zhang S, et al. Protective effects of Acanthopanax senticosus - Ligustrum lucidum combination on bone marrow suppression induced by chemotherapy in mice. Biomedicine & Pharmacotherapy. 2019;109:2062–9. Deng J, Zhong Y-F, Wu Y-P, Luo Z, Sun Y-M, Wang G-E, et al. Carnosine attenuates cyclophosphamide-induced bone marrow suppression by reducing oxidative DNA damage. Redox Biology. 2018;14:1–6. S S, Kb S. Gallic acid: A promising genoprotective and hepatoprotective bioactive compound against cyclophosphamide induced toxicity in mice. Environmental toxicology. 2021;36. S B, H K, M K, M G, E M, H K. Pretreatment with Gallic Acid Mitigates Cyclophosphamide Induced Inflammation and Oxidative Stress in Mice. Current molecular pharmacology. 2022;15. Pj C. Drug-induced myelosuppression : diagnosis and management. Drug safety. 2003;26. Zhang W-N, Gong L-L, Liu Y, Zhou Z-B, Wan C-X, Xu J-J, et al. Immunoenhancement effect of crude polysaccharides ofHelvella leucopuson cyclophosphamide-induced immunosuppressive mice. Journal of Functional Foods. 2020;69:103942. Han J, Dai M, Zhao Y, Cai E, Zhang L, Jia X, et al. Compatibility effects of ginseng and Ligustrum lucidum Ait herb pair on hematopoietic recovery in mice with cyclophosphamide-induced myelosuppression and its material basis. Journal of Ginseng Research. 2020;44:291–9. Op V, Aa M, Hr S. Growth factors and hematopoietic stem cells. Hematology/oncology clinics of North America. 1997;11. Modulation of Myelopoiesis Progenitors Is an Integral Component of Trained Immunity - PubMed. https://pubmed.ilibs.cn/29328910/. Accessed 22 May 2024. C G, Ca D, A M. The interleukin-1 family: back to the future. Immunity. 2013;39. M E, G G, A G. IL-3 in the clinic. Stem cells (Dayton, Ohio). 1997;15. Ca H, Sa J. IL-6 as a keystone cytokine in health and disease. Nature immunology. 2015;16. As T. Erythropoietin (EPO) as a Key Regulator of Erythropoiesis, Bone Remodeling and Endothelial Transdifferentiation of Multipotent Mesenchymal Stem Cells (MSCs): Implications in Regenerative Medicine. Cells. 2021;10. Jw A. Thrombopoietin and platelet function. Seminars in thrombosis and hemostasis. 2006;32. A K, A TK, A SO, S S. GM-CSF: A Double-Edged Sword in Cancer Immunotherapy. Frontiers in immunology. 2022;13. C W. Spatiotemporal Resolution of SCF Supply in Early Hematopoiesis. Cell stem cell. 2019;24. Se J, Fw J, C F, Ls R. TNF-alpha, the great imitator: role of p55 and p75 TNF receptors in hematopoiesis. Stem cells (Dayton, Ohio). 1994;12 Suppl 1. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4498216\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":310341020,\"identity\":\"3aac6b20-9c2c-4ae2-883a-d3dc9492fea7\",\"order_by\":0,\"name\":\"Junyi Luo\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Chongqing Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Junyi\",\"middleName\":\"\",\"lastName\":\"Luo\",\"suffix\":\"\"},{\"id\":310341021,\"identity\":\"3e46f241-2198-4123-90e2-009049bcc275\",\"order_by\":1,\"name\":\"Zhaoxia Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Chongqing Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zhaoxia\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":310341022,\"identity\":\"196f81fe-4f0b-411e-ba68-dc280b9291cc\",\"order_by\":2,\"name\":\"Liming Jin\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Chongqing Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Liming\",\"middleName\":\"\",\"lastName\":\"Jin\",\"suffix\":\"\"},{\"id\":310341023,\"identity\":\"5a8662bf-222d-4856-b690-669b940e0db9\",\"order_by\":3,\"name\":\"Zhaoying Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Chongqing Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zhaoying\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":310341024,\"identity\":\"d82ab6d5-8582-4c05-babc-cbc98600bc01\",\"order_by\":4,\"name\":\"Qiuyue Sun\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Chongqing Medical University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qiuyue\",\"middleName\":\"\",\"lastName\":\"Sun\",\"suffix\":\"\"},{\"id\":310341025,\"identity\":\"e74de295-22d4-4b6d-861f-fa4a9710e833\",\"order_by\":5,\"name\":\"Dawei He\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABHklEQVRIie3RsUoDMRjA8U8OcssHroGz9RUiB3eKpc+SUrhbepNQCooWCnYpzgo+RKSouB0Eess9QIqD7ZKpm0tBUa+2Jw4p5+iQPyFL8iMJAbDZ/mHsewCtr2bgAHvlyk6/gvhrwgH/SqAlYH1MNQndwd0r9g7jR3eoZ/NlE8GV92OERk2kjp4ZyNFocuJhTpOnUR4yztsIGHWfESJfpCRkpoupDvOSS5oI1SGUcweBYlAQ2RIpEmoiLwv/LfmgMVOxLshFST63E4WBl/QpZ4oHBZElSbeTPOoev0/ogchXb4kyJMVbpres7d9IEhhJJsfT67PzfZYN9XzZOK3vuvJBLXrN2lU20CbyO1LOm89yKvb/ENh8rs1ms9nKvgDFA2BDkQGwjAAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Chongqing Medical University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Dawei\",\"middleName\":\"\",\"lastName\":\"He\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-05-29 15:49:09\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4498216/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4498216/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":58289435,\"identity\":\"94c6fa15-6bc5-4532-9109-53d3bb50e99b\",\"added_by\":\"auto\",\"created_at\":\"2024-06-13 13:15:05\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":400577,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe effect of GA on the peripheral blood counts of white blood cells (WBC), red blood cells (RBC), platelets (PLT), and hemoglobin (Hb) levels in myelosuppressed mice. Data are presented as mean ± SD (n = 6). (A) White blood cell count (WBC), (B) Red blood cell count (RBC), (C) Hemoglobin level (Hb), (D) Platelet count (PLT). Values are presented as mean ± SD (n = 3). *P\\u0026lt;0.05; **P\\u0026lt;0.01 compared with the Normal group. \\u003csup\\u003e#\\u003c/sup\\u003eP\\u0026lt;0.05; \\u003csup\\u003e##\\u003c/sup\\u003eP\\u0026lt;0.01 compared with the Model group. \\u003csup\\u003e\\u0026amp;\\u003c/sup\\u003eP\\u0026lt;0.05; \\u003csup\\u003e\\u0026amp;\\u0026amp;\\u003c/sup\\u003eP\\u0026lt;0.01 compared with Diyu Shengbai tablets (DYSB). \\u003csup\\u003e△\\u003c/sup\\u003eP\\u0026lt;0.05; \\u003csup\\u003e△△\\u003c/sup\\u003eP\\u0026lt;0.01 compared with rhG-CSF.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4498216/v1/06a7ea06b119e435373c835a.png\"},{\"id\":58290113,\"identity\":\"ce0b2456-4b21-47cc-93d2-c5af8f46e638\",\"added_by\":\"auto\",\"created_at\":\"2024-06-13 13:23:05\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":6909126,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e(A) The effect of GA on the spleen index of myelosuppressed mice. (B) The effect of GA on the thymus index of myelosuppressed mice. (C) The effect of GA on the histomorphology of femoral bone marrow tissue in myelosuppressed mice (H\\u0026amp;E staining, x200). (D) The effect of GA on the histomorphology of femoral bone marrow tissue in myelosuppressed mice (H\\u0026amp;E staining, x200).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4498216/v1/9b0bc49ce431ee5e7fe77b08.png\"},{\"id\":58289437,\"identity\":\"77be7d2f-bee3-4e66-aa08-1380eb2a1ba5\",\"added_by\":\"auto\",\"created_at\":\"2024-06-13 13:15:05\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1904742,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e(A) The effect of Gallic acid (GA) on the cell cycle of BMNCs. (B) Flow cytometry of myelosuppressed mice. (C) The effect of Gallic acid (GA) on the number of BMNCs. Values are presented as mean ± SD (n = 3).P\\u0026lt;0.05;**P\\u0026lt;0.01 compared with Normal.\\u003csup\\u003e#\\u003c/sup\\u003eP\\u0026lt;0.05;\\u003csup\\u003e##\\u003c/sup\\u003eP\\u0026lt;0.01 compared with Model.\\u003csup\\u003e\\u0026amp;\\u003c/sup\\u003eP\\u0026lt;0.05;\\u003csup\\u003e\\u0026amp;\\u0026amp;\\u003c/sup\\u003eP\\u0026lt;0.01compared with Diyu Shengbai tablets（DYSB）.\\u003csup\\u003e△\\u003c/sup\\u003eP\\u0026lt;0.05;\\u003csup\\u003e△△\\u003c/sup\\u003eP\\u0026lt;0.01compared with rhG-CSF .\\u003c/p\\u003e\\n\\u003cp\\u003e3.4 GA Alleviates Abnormalities in Hematopoietic Factors in the Spleens of Mice with Bone Marrow Suppression\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4498216/v1/02883a73f321e729dd7a3744.png\"},{\"id\":58289438,\"identity\":\"89be3cd6-7d67-41b4-ac41-7e557222a9e6\",\"added_by\":\"auto\",\"created_at\":\"2024-06-13 13:15:05\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1377697,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eGallic acid(GA )on the mRNA levels of IL-1β, IL-3, IL-6, EPO, TPO, GM-CSF, SCF, and TNF-α in the spleens of cyclophosphamide-induced myelosuppressed mice. Total RNA was extracted from spleen tissues and analyzed using qRT-PCR with specific forward and reverse primers to assess the mRNA levels of GAPDH, IL-1β, IL-3, IL-6, EPO, TPO, GM-CSF, SCF, and TNF-α.Values were obtained by comparing to that of normal group and normalized to GAPDH (mean± SD, n=3). *P\\u0026lt;0.05;**P\\u0026lt;0.01 compared with Normal.\\u003csup\\u003e#\\u003c/sup\\u003eP\\u0026lt;0.05;\\u003csup\\u003e##\\u003c/sup\\u003eP\\u0026lt;0.01 compared with Model.\\u003csup\\u003e\\u0026amp;\\u003c/sup\\u003eP\\u0026lt;0.05;\\u003csup\\u003e\\u0026amp;\\u0026amp;\\u003c/sup\\u003eP\\u0026lt;0.01compared with Diyu Shengbai tablets（DYSB）.\\u003csup\\u003e△\\u003c/sup\\u003eP\\u0026lt;0.05;\\u003csup\\u003e△△\\u003c/sup\\u003eP\\u0026lt;0.01compared with rhG-CSF .\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4498216/v1/234a048ca13ae9b40a64a953.png\"},{\"id\":63237690,\"identity\":\"6c01a8db-b564-4050-b844-f7963b0ccb2f\",\"added_by\":\"auto\",\"created_at\":\"2024-08-26 03:35:04\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":6823156,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4498216/v1/4e758ac3-2afd-4ea1-abec-69e71bbd52f7.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"The Alleviating Effect of Gallic Acid on Chemotherapy-Induced Myelosuppression\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eCancer ranks as the second leading cause of death globally, trailing only ischemic heart disease. By 2060, it is likely to become the leading cause of death, with an overall cancer risk of 20.2% for individuals aged 0\\u0026ndash;74[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. Chemotherapy is a common cancer treatment approach, employing various drugs such as anthracyclines (e.g., doxorubicin), alkylating agents (e.g., cyclophosphamide, ifosfamide), antimetabolites (e.g., methotrexate), topoisomerase inhibitors (e.g., etoposide), alkaloids (e.g., vincristine), and cytotoxic antibiotics (e.g., dactinomycin), these drugs are used in combinations to achieve therapeutic effects but also cause various side effects[\\u003cspan additionalcitationids=\\\"CR3 CR4 CR5 CR6\\\" citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. Common adverse reactions induced by chemotherapy drugs include suppression of the hematopoietic system, ototoxicity, pulmonary toxicity, hepatorenal toxicity, and cardiotoxicity[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. Among these, bone marrow suppression is the most common and has a significant impact on prognosis[\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. Cyclophosphamide (CTX), a widely used alkylating antineoplastic agent, is primarily utilized for treating hematological malignancies and various epithelial tumors[\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. However, while inhibiting cancer cells, the active intermediates of CTX cannot effectively differentiate between normal and tumor cells, leading to bone marrow suppression and immunosuppression[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. Chemotherapy-induced bone marrow suppression primarily manifests as reductions in red blood cells (RBCs), white blood cells (WBCs), and platelets (PLTs), increasing the risk of infections, bleeding, and fatigue, thereby affecting the treatment progress and quality of life of patients[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. Therefore, alleviating bone marrow suppression is crucial for enhancing the efficacy of cancer chemotherapy and improving patient survival quality.\\u003c/p\\u003e \\u003cp\\u003eCurrent methods for treating bone marrow suppression include the administration of recombinant human granulocyte colony-stimulating factor (RhG-CSF), erythropoiesis-stimulating agents, and blood transfusions. However, each of these approaches has its drawbacks: RhG-CSF can induce bone pain, erythropoiesis-stimulating agents may lead to thrombosis, and blood transfusions can trigger transfusion reactions[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. Consequently, there is an urgent need to develop new therapeutic strategies. Research indicates that certain natural compounds, known for their anti-inflammatory, antioxidant, and immunomodulatory properties, show potential in alleviating bone marrow suppression. Ginsenosides, for instance, have demonstrated effectiveness against liver cancers[\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e], gastric cancers[\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e], and prostate cancers[\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e], along with their immunomodulatory[\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e] and antioxidant activities[\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]. Jiahong Han et al., suggest that ginsenoside Rg3 can mitigate the reduction in peripheral blood bone marrow nucleated cell counts, thymic index, and spleen index caused by cyclophosphamide[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. Curcumin has demonstrated anti-colorectal cancer effects[\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e], anti-lung cancer effects[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e], anti-liver cancer effects[\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e], as well as anti-inflammatory[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e] and antioxidant properties[\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. According to Monika A. Papież, curcumin helps alleviate etoposide-induced myelodysplasia by increasing the proportion of granulocyte precursors and lymphocytes [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e].Further research by Kartick Patra et al. points to cinnamic acid's ability to lessen the reduction in bone marrow and splenic cells induced by cyclophosphamide, linking it to oxidative stress in the bone marrow and liver[\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]. Gallic acid (3,4,5-trihydroxybenzoic acid, GA), a biologically active natural phenolic compound, has been proven to possess antioxidant properties [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]and efficacy against lung cancers\\u003csup\\u003e28\\u003c/sup\\u003e, breast cancers[\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e], and prostate cancers[\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e], in addition to its anti-inflammatory [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]and immunomodulatory functions[\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. Based on these findings, it is reasonable to hypothesize that gallic acid could play a significant role in alleviating bone marrow suppression.\\u003c/p\\u003e \\u003cp\\u003eTo study the effects of gallic acid (GA) on chemotherapy-induced bone marrow suppression, we utilized a mouse model developed using cyclophosphamide (CTX)[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. By establishing this bone marrow suppression model in mice with CTX and administering gallic acid, we monitored several parameters, including peripheral blood cell counts, spleen and thymus organ indices, femur tissue histopathology, cell cycle dynamics, apoptosis, and hematopoietic factors. This approach allowed us to assess whether GA could alleviate the suppression of the hematopoietic system induced by CTX. Our findings aim to provide new therapeutic insights for managing bone marrow suppression resulting from chemotherapy.\\u003c/p\\u003e\"},{\"header\":\"2. Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1 Experimental Drugs\\u003c/h2\\u003e \\u003cp\\u003eGallic acid (GA) was procured from Shanghai Aladdin Biochemical Technology Co., Ltd. (Shanghai, China) (Catalog No.: G131992), with a purity exceeding 99% as confirmed by HPLC analysis. Cyclophosphamide (CTX) was also obtained from Shanghai Aladdin Biochemical Technology Co., Ltd. (Shanghai, China) (Catalog No.: C126044), with a purity greater than 98%, as determined by HPLC. Diyu Shengbai tablets(DYSB) were sourced from Sichuan Chengdu Di Ao Group Tianfu Pharmaceutical Co., Ltd. (Sichuan, China) (License No.: Z20026497). Recombinant human granulocyte colony-stimulating factor was acquired from Xiamen Amoytop Biotech Co., Ltd. (Xiamen, China) (Catalog No.: S20033047).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2 Major Instruments and Reagents\\u003c/h2\\u003e \\u003cp\\u003eLymphocyte separation medium for mice was obtained from Solarbio Science \\u0026amp; Technology Co., Ltd. (Beijing, China) (Catalog No.: P6040). EDTA decalcifying solution was purchased from Servicebio Technology Co., Ltd. (Wuhan, China) (Catalog No.: G1105-500ML). The Cell Cycle Analysis Kit was acquired from BD Pharmingen (USA, 550825); the cycle reagent was added according to the manual, and the cell cycle was analyzed using flow cytometry and ModFit LT software (Version 3.2). The Annexin V-FITC Apoptosis Detection Kit was also sourced from BD Pharmingen (USA, 556547). Apoptotic cells were quantified using a flow cytometer (BD Pharmingen, USA) and analyzed with FlowJo software (Version 10.8.1). Primers for real-time quantitative PCR (RT-qPCR) were designed and synthesized by Shanghai Qingke Biotechnology Co., Ltd. (Shanghai, China). All chemical reagents used were of at least analytical grade.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 Experimental Animals\\u003c/h2\\u003e \\u003cp\\u003e All procedures in this study were approved by the Ethics Committee of the Children's Hospital affiliated with Chongqing Medical University (Chongqing, China), under approval number CHCMU-IACUC20220323001. Female Balb-c mice, weighing 12\\u0026ndash;16 grams and aged 4 weeks, were sourced from the Experimental Animal Center of Chongqing Medical University. All mice were housed in a specific pathogen-free environment at the Animal Experimentation Center of Chongqing Medical University's Children's Hospital. Prior to the initiation of the experiments, the mice were provided with autoclaved standard rodent chow and water. They were acclimated to their cages for 3 days under a 12:12 hour light-dark cycle, with lights on at 7 AM.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4 Methods\\u003c/h2\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.1 Model Establishment\\u003c/h2\\u003e \\u003cp\\u003eThirty-six 4-week-old Balb-c mice were randomly divided into two groups: the model group (receiving cyclophosphamide (CTX) at a dosage of 100 mg/kg/day via intraperitoneal injection) and the control group (receiving an equivalent volume of saline via intraperitoneal injection). On days 3, 5, and 7, six mice from each group were randomly selected for sampling. Assessment parameters included general condition, peripheral blood counts, and spleen and thymus indices.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.2 Intervention Experimental Grouping and Administration\\u003c/h2\\u003e \\u003cp\\u003eAn additional forty-two 4-week-old Balb-c mice were randomly divided into seven groups of six each: control, model, low-dose gallic acid (L-GA), medium-dose gallic acid (M-GA), high-dose gallic acid(H-GA), Diyu Shengbai tablet(DYSB), and recombinant human granulocyte colony-stimulating factor (RhG-CSF). The GA groups received varying concentrations of GA solution orally for 10 consecutive days: low-dose (100 mg/kg/day), medium-dose (200 mg/kg/day), and high-dose (400 mg/kg/day). The Diyu Shengbai tablet group was administered Di yu sheng bai tablets at 100 mg/kg/day orally for the same duration. Both the model and control groups received saline orally once daily for 10 days. On day 7, all groups except the control received CTX intraperitoneally at 100 mg/kg/day for three consecutive days. On day 10, the RhG-CSF group received an intravenous injection of RhG-CSF at 125 mg/kg/day for two consecutive days. All indices were measured on day 12.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.3 Sample Collection\\u003c/h2\\u003e \\u003cp\\u003eTwenty-four hours after the last administration, the body weight of the mice was measured. At the conclusion of the experiment, blood samples were collected into clean tubes containing ethylenediaminetetraacetic acid (EDTA), and the mice were briefly disinfected by immersion in 75% ethanol. Subsequently, both femurs were rapidly and completely isolated, and cleaned with gauze. One femur from each mouse was fixed in formaldehyde and decalcified with EDTA-sodium solution for 30 days to prepare histological sections. The other femur was cut at both ends under sterile conditions and washed three times with phosphate-buffered saline (PBS) containing antibiotics (penicillin-streptomycin). The epiphyses were removed with tweezers, and the bone shaft was flushed multiple times with PBS using a syringe. Bone marrow nucleated cells were extracted following the lymphocyte separation medium manual for subsequent bone marrow nucleated cell counting and flow cytometry analysis. The thymus and spleen were immediately excised post-experiment and collected for further analysis.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.4 Peripheral Blood Analysis\\u003c/h2\\u003e \\u003cp\\u003eA 100 \\u0026micro;L blood sample containing EDTA was analyzed by the Laboratory Department of the Children's Hospital affiliated with Chongqing Medical University. The analysis included measurements of white blood cells (WBC), red blood cells (RBC), hemoglobin (Hb), and platelets (Plt). Quantitative data were expressed as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation. Differences between two groups were determined using the t-test, while comparisons involving three or more groups utilized one-way analysis of variance (one-way ANOVA). A P-value of less than 0.05 was considered statistically significant.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.5 Thymus and Spleen Indices\\u003c/h2\\u003e \\u003cp\\u003eImmediately after euthanasia, the thymus and spleen were excised from the mice and weighed to calculate the organ indices. The organ index is expressed as the ratio of the organ weight to the body weight, denoted in milligrams per gram (mg/g)[\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e].\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.6 Femur and Spleen Staining\\u003c/h2\\u003e \\u003cp\\u003eFor each group, three femur samples are fixed in 4% formaldehyde. Parts of the spleen from each group are also fixed using 4% formaldehyde. After dehydration, the spleen and femur are embedded in paraffin to produce sections 5\\u0026micro;m thick for histological analysis. The sections are stained with Hematoxylin and Eosin (H\\u0026amp;E) and all images are captured and observed under an ECLIPSE Ci microscope (Nikon, Tokyo, Japan).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.7 Bone Marrow Nucleated Cell (BMNC) Cycle Analysis\\u003c/h2\\u003e \\u003cp\\u003eBone marrow nucleated cells (BMNCs) are washed with cold PBS and then fixed with 75% cold ethanol. The cells are stained using propidium iodide (PI)/RNase staining buffer (BD Pharmingen, 550825, USA) for cell cycle analysis via flow cytometry, and the phases G0/G1, S, and G2/M are determined using ModFit LT software (Version 3.2).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.8 Bone Marrow Nucleated Cell (BMNC) Apoptosis Analysis\\u003c/h2\\u003e \\u003cp\\u003eBMNCs are washed with cold PBS. Apoptosis is analyzed using the Annexin V Apoptosis Detection Kit (BD Pharmingen, 556547, Franklin Lakes, NJ, USA). Annexin V reagent is added according to the manufacturer\\u0026rsquo;s instructions, and apoptotic cells are detected using a flow cytometer (BD Pharmingen, USA). Data analysis is performed using FlowJo software (Version 10.8.1).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.9 Analysis of Hematopoietic Factor mRNA Expression in the Spleen\\u003c/h2\\u003e \\u003cp\\u003eSpleen tissue is homogenized using a ribolyzer and then centrifuged twice. Total RNA is extracted from the supernatant and its purity is measured using spectrophotometry. Then, 1 \\u0026micro;g of total RNA from each sample is reverse-transcribed into cDNA using the SuperRT cDNA Kit. The synthesized cDNA is amplified using SYBR Green Realtime PCR Master Mix. The nucleotide sequences of the forward and reverse primers used for PCR are listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e. The PCR cycles consist of 1 minute at 95\\u0026deg;C, followed by 40 cycles of 5 seconds at 95\\u0026deg;C, 15 seconds at 56\\u0026deg;C, and 20 seconds at 72\\u0026deg;C. RT-qPCR analysis is conducted using the LightCycler 480 RT-qPCR System (Roche, Basel, Switzerland). Relative mRNA expression results for each group are calculated using the comparative Ct method (Livak and Schmittgen, 2001), setting the normal control as 100%.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eTabel 1\\u003c/b\\u003e.Primers used for quantitative RT-PCR.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"No\\\" id=\\\"Taba\\\" border=\\\"1\\\"\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGenes\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward(5'\\u0026ndash;3')\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eReverse(5'\\u0026ndash;3')\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGAPDH\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAGGTCGGTGTGAACGGATTTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTGTAGACCATGTAGTTGAGGTCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIL-1β\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGCTACCTGTGTCTTTCCCGT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCGTCACACACCAGCAGGTTA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIL-3\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGTTCTTGCCAGCTCTACCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGGTATCCCGGCCACTGATTG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eIL-6\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGTGGCTAAGGACCAAGACCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTAACGCACTAGGTTTGCCGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eGM-CSF\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGGCCATCAAAGAAGCCCTGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTGGTGAAATTGCCCCGTAGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eEPO\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eAGGTACATCTTAGAGGCCAAGGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAACTTCTATGGCCTGTTCTTCCA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTPO\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGTGACCGAAGATGACCAGTACTC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAGGAGTTTGAGGGAAGCTGTATG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eSCF\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eATGTTCCCCGCTCTCTTTGG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGTGTGGCATAAGGGCTCACT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTNF-α\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eGACCCTCACACTCAGATCATCTT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCCTTGAAGAGAACCTGGGAGTAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section3\\\"\\u003e \\u003ch2\\u003e2.4.9 Statistical Analysis\\u003c/h2\\u003e \\u003cp\\u003eThe results are analyzed using GraphPad Prism 9.0 software. Quantitative data are expressed as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation. Differences between two groups are assessed using the t-test, while comparisons involving three or more groups are analyzed using one-way analysis of variance (one-way ANOVA). A P-value of less than 0.05 is considered statistically significant. All experiments are conducted in triplicate or more.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003ch2\\u003e3.1 Gallic Acid Mitigates the Decline in Peripheral Blood Cells Due to Bone Marrow Suppression in Mice\\u003c/h2\\u003e\\n\\u003cp\\u003eTable 1 illustrates that compared to the normal group, cyclophosphamide (CTX) treatment on days 3, 5, and 7 significantly reduced the counts of white blood cells (WBCs), platelets, and hemoglobin concentration in mice, as well as significantly lowered the spleen and thymus indices, with statistical significance. Following 3 days of CTX injection, the model mice exhibited symptoms such as reduced hair, lethargy, sluggish response, hunched posture, reduced food and water intake; these symptoms were more pronounced after 5 days, accompanied by continuous weight loss; after 7 days, further significant weight reduction was observed, along with weak breathing, sparse hair, reduced body temperature, and significant thymus atrophy and fragility. These results indicate that the bone marrow suppression model established with 3 days of CTX treatment is ideal due to its stability, milder suppression, better general condition of the mice, easier recovery, and its ability to avoid complications related to bone marrow suppression.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003ctable id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e\\n \\u003ccaption language=\\\"En\\\"\\u003e\\n \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e\\n \\u003cdiv class=\\\"CaptionContent\\\"\\u003e\\n \\u003cp\\u003eEffects of cyclophosphamide injection time on peripheral blood, spleen index and thymus index of myelosuppressed mice(mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;sd)\\u003c/p\\u003e\\n \\u003c/div\\u003e\\n \\u003c/caption\\u003e\\n \\u003cthead\\u003e\\n \\u003ctr\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eGroup\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eWBC(x10\\u003csup\\u003e9\\u003c/sup\\u003e /L)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003ePLT(x10\\u003csup\\u003e9\\u003c/sup\\u003e /L)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eRBC(x10\\u003csup\\u003e12\\u003c/sup\\u003e /L)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eHb(g/dL)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eWeight(g)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eSpleen index(mg/g)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003eThymus index(mg/g)\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003cth align=\\\"left\\\"\\u003e\\n \\u003cp\\u003en\\u003c/p\\u003e\\n \\u003c/th\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/thead\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e3d-Normal\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e4.79\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.73\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e1181.67\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;143\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e9.53\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.47\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e150.67\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.08\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e13.12\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.55\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e9.34\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.24\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e2.01\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.34\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e3d-model\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e2.44\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.9**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e939.5\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;211.65**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e8.91\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.15\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e140\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;5.42**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e11.62\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.23\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e4.23\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.33**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0.84\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.21**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e5d-Normal\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e5.49\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.01\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e1055.71\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;92.91\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e9.57\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.12\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e146.86\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;7.22\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e11.6\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.33\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e6.54\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.02\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e2.7\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3.17\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e5d-model\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0.42\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.33**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e603\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;110.48**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e8.57\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.9*\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e132.13\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;15.29**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e10.25\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.45\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e7.98\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.87**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e5.96\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.79**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e7d-Normal\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e5.66\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.73\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e1068.54\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;89.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e9.53\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.47\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e140.63\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.08\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e12.12\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.75\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e8.34\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.24\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e1.96\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.54\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd align=\\\"left\\\"\\u003e\\n \\u003cp\\u003e7d-model\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0.12\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.24**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e220.54\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;111.3**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e8.32\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.11*\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e128\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;5.43**\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e9.32\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;1.65\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e3.23\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2.33*\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e0.44\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;0.21*\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd align=\\\"char\\\"\\u003e\\n \\u003cp\\u003e5\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003eNote:n, number of mice.*p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, **p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05,compared with Normal.\\u003c/p\\u003e\\n\\u003cp\\u003ePeripheral blood cell counts indirectly reflect hematopoietic function[\\u003cspan class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. Compared to the normal group, the WBC count in the model group was significantly reduced, consistent with the modeling results, suggesting that the CTX-induced bone marrow suppression model closely mirrors the clinical manifestations of bone marrow suppression (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA, B, C).\\u003c/p\\u003e\\n\\u003cp\\u003eCompared to the model group, low, medium, and high doses of gallic acid (L-GA, M-GA, H-GA) significantly increased the WBC counts in mice with bone marrow suppression. There were significant differences between the low and medium dose groups compared to the high dose group, indicating a dose-dependent effect of gallic acid. The effect of high-dose gallic acid on increasing WBC counts was superior to that of recombinant human granulocyte colony-stimulating factor (rhG-CSF) (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA). Compared to the model group, medium and high doses of gallic acid significantly increased the hemoglobin count, with statistical significance. The hemoglobin counts in the low and medium dose groups were significantly different, further confirming the dose-dependent effect of gallic acid. The effect of low-dose gallic acid on increasing peripheral blood hemoglobin count was superior to rhG-CSF (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB). Compared to the model group, high-dose gallic acid significantly increased the platelet count, with significant differences between the low and medium dose groups compared to the high dose group, indicating a dose-dependent effect of gallic acid in this regard as well. The effect of high-dose gallic acid on increasing platelet counts was superior to rhG-CSF (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). These results indicate that different concentrations of gallic acid significantly increase peripheral blood cell counts, demonstrating a dose-response relationship, with high concentrations of gallic acid being more effective in alleviating CTX-induced bone marrow suppression than rhG-CSF.\\u003c/p\\u003e\\n\\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.2 Gallic Acid Mitigates Cyclophosphamide-Induced Pathological Changes in the Spleen and Thymus\\u003c/h2\\u003e\\n \\u003cp\\u003eCyclophosphamide (CTX) causes immune and bone marrow suppression, and the primary immune organs in mice are the thymus and spleen. Therefore, we assessed the immunomodulatory effects of gallic acid (GA) on CTX-treated mice using organ indices.\\u003c/p\\u003e\\n \\u003cp\\u003eCompared to the normal group, the spleen and thymus indices in the model group were significantly reduced, indicating the successful establishment of the bone marrow suppression model (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA/B). Compared to the normal group, other groups also showed significant differences in spleen and thymus indices, suggesting that different treatments post-modeling could not fully restore these indices. However, compared to the model group, low, medium, and high doses of GA significantly alleviated the reduction in spleen indices, and high-dose GA significantly alleviated the reduction in thymus indices, with statistical significance. These results indicate that GA can mitigate the atrophy of immune organs induced by CTX in mice with bone marrow suppression.\\u003c/p\\u003e\\n \\u003cp\\u003eHistopathological examinations were conducted to explore the pathological changes in the spleen and bone marrow during GA treatment. Spleen sections stained with Hematoxylin and Eosin (H\\u0026amp;E) showed normal tissue structure in the normal group (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC). In the model group, multiple multinucleated giant cells with atypical nuclei were visible in the spleen. With increasing concentrations of GA, the number of multinucleated giant cells in the spleen decreased. Bone marrow H\\u0026amp;E staining showed normal bone marrow tissue structure in the normal group. In contrast, the model group showed a reduction in bone marrow cellularity, along with the appearance of vacuoles and an increase in multinucleated giant cells and fat cells (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD). In GA-treated groups, as the concentration increased, the number of multinucleated giant cells, vacuoles, and fat cells in the bone marrow decreased, while the number of bone marrow cells increased and the distribution became more uniform and orderly.\\u003c/p\\u003e\\n \\u003ch2\\u003e3.3 GA Alleviates the Decline in BMNCs, Reduces Cell Cycle Arrest, and Mitigates Apoptosis in Mice with Bone Marrow Suppression\\u003c/h2\\u003e\\n \\u003cp\\u003eBMNC (Bone Marrow Nucleated Cell) count is a direct indicator of hematopoietic function. Compared to the normal group, the model group showed a significant reduction in BMNC count, consistent with the characteristics of the cyclophosphamide-induced bone marrow suppression model (Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC). Compared to the model group, medium and high doses of gallic acid (GA) significantly alleviated the decline in BMNC count, with statistical significance. There was a significant difference between the low and high-dose GA groups, indicating a dose-dependent relationship of GA. Compared to the Diyu Shengbai (DYSB) group, medium and high doses of GA significantly alleviated the decline in BMNCs, performing better than DYSB.\\u003c/p\\u003e\\n \\u003cp\\u003eChanges in the cell cycle distribution of bone marrow cells across the groups are shown in Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA. Compared to the normal group, the proportion of G0/G1 phase cells in the BMNCs of the model control group significantly increased, while the proportions of G2/M and S phase cells significantly decreased, all statistically significant, due to chemotherapy-induced proliferation blockade. Compared to the model control group, the high-dose GA group showed a significant reduction in the proportion of G0/G1 phase BMNCs and a significant increase in the proportion of G2/M phase cells and the proliferation index, indicating that high-dose GA can reduce the proportion of bone marrow cells in G0/G1 phase and increase those in G2/M phase. This suggests that GA can enhance the proliferative capacity of bone marrow cells to some extent, alleviate chemotherapy-induced bone marrow suppression, improve the function of the impaired hematopoietic system, and promote the recovery of hematopoietic function.\\u003c/p\\u003e\\n \\u003cp\\u003eChanges in BMNC apoptosis across the groups are shown in Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB. Compared to the normal group, the model group showed a significant increase in the proportion of early apoptotic and total apoptotic cells, statistically significant. Compared to the model control group, the low-dose GA group showed a significant decrease in the proportion of early apoptotic BMNCs, and the medium-dose GA group showed a significant decrease in both early apoptotic and total apoptotic BMNCs, statistically significant, indicating that GA can inhibit apoptosis in mice with bone marrow suppression. These results suggest that the significant reduction in BMNCs post-radiotherapy/chemotherapy could be due to both inhibited cell proliferation and increased apoptosis. The role of GA in promoting the recovery of BMNCs might be associated with its ability to promote entry of bone marrow cells into the G2/M proliferation cycle and prevent apoptosis.\\u003c/p\\u003e\\n\\u003c/div\\u003e\\n\\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e\\n \\u003ch2\\u003e3.4 GA Alleviates Abnormalities in Hematopoietic Factors in the Spleens of Mice with Bone Marrow Suppression\\u003c/h2\\u003e\\n \\u003cp\\u003eAs depicted in Fig. \\u003cspan class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e, compared to the normal control group, the model control group exhibited significantly decreased mRNA levels of hematopoietic promoting factors such as IL-1\\u0026beta;, IL-3, IL-6, TPO, EPO, GM-CSF, and SCF, while the mRNA level of the hematopoietic inhibitory factor TNF-\\u0026alpha; was significantly increased, indicating that cyclophosphamide-induced bone marrow suppression in mice decreases hematopoietic promoters and increases inhibitors.\\u003c/p\\u003e\\n \\u003cp\\u003eCompared to the model control group, low, medium, and high doses of gallic acid (GA) significantly increased the mRNA levels of IL-1\\u0026beta;, IL-3, IL-6, EPO, GM-CSF, and SCF in mice. The low-dose GA group also showed a significant increase in TPO mRNA level. These findings suggest that different concentrations of GA can promote the expression of hematopoietic growth factors such as IL-1\\u0026beta;, IL-3, IL-6, GM-CSF, TPO, EPO, and SCF in model mice, positively regulating hematopoiesis. Additionally, the TNF-\\u0026alpha; mRNA levels significantly decreased in the low, medium, and high-dose GA groups compared to the model group, indicating that GA can suppress TNF-\\u0026alpha; mRNA expression, thus negatively regulating hematopoiesis.\\u003c/p\\u003e\\n \\u003cp\\u003eCompared to the Diyu Shengbai (DYSB) group, the high-dose GA group showed a significant increase in IL-3 mRNA levels, while the medium and high-dose GA groups had significantly higher GM-CSF mRNA levels, and the low-dose GA group had significantly higher TPO mRNA levels. The medium-dose GA group also showed a significant increase in SCF mRNA levels. Compared to the recombinant human granulocyte-stimulating factor (Rh-GSF) group, the high-dose GA group had significantly higher IL-3 mRNA levels, and all GA dose groups exhibited significantly higher GM-CSF mRNA levels. The high-dose GA group also showed a significant increase in IL-6 mRNA levels. These results demonstrate that GA\\u0026apos;s effect in alleviating cyclophosphamide-induced suppression of spleen hematopoietic factor expression is superior to that of DYSB and Rh-GSF.\\u003c/p\\u003e\\n\\u003c/div\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eBone marrow suppression remains the principal dose-limiting toxicity of cancer chemotherapy, leading to high morbidity and mortality rates[\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. Reducing chemotherapy dosage may compromise disease control and patient survival. Therefore, identifying natural compounds that can mitigate chemotherapy-induced bone marrow suppression without necessitating a reduction in chemotherapy dosage is of significant clinical importance. Cyclophosphamide (CTX), a commonly used alkylating broad-spectrum antitumor drug, is typically employed to establish chemotherapy-induced bone marrow suppression models. CTX primarily inhibits DNA replication and transcription or causes DNA strand breaks by undergoing alkylation reactions, resulting in damage to DNA structure and function[\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. Furthermore, the metabolites of CTX can disrupt the antioxidant system, leading to increased reactive oxygen species and subsequent DNA strand breaks[\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. Therefore, antioxidants are recommended to counteract the side effects of CTX. Gallic acid (GA) has been proven to protect against CTX-induced genotoxicity, liver damage[\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e], and nephrotoxicity[\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e], suggesting that it might also alleviate CTX-induced bone marrow suppression.\\u003c/p\\u003e \\u003cp\\u003eThe lifespan of circulating peripheral blood cells is limited, and their continuous replenishment is managed by the bone marrow. Thus, the quantity of peripheral blood cells indirectly reflects the hematopoietic function of the bone marrow, and the count of BMNCs directly indicates hematopoietic activity[\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]. Our study results show that the model group mice exhibited a significant reduction in peripheral blood cell counts and BMNCs, consistent with results from using CTX to establish a bone marrow suppression model[\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]. After intervention with various concentrations of GA, the study confirmed that GA could restore the numbers of BMNCs, WBCs, PLTs, and Hb in the bone marrow suppression mouse model, although changes in RBC numbers were not significant. This phenomenon has not yet been explained in this study and requires further research to reveal its mechanism. Additionally, changes in BMNC numbers correspond with histological findings in bone marrow sections. After CTX use, bone marrow structure was disrupted, with reduced cell counts and increased vacuolation and multinucleated giant cells and fat cells. However, GA intervention mitigated these structural damages and facilitated some recovery in structure and function.\\u003c/p\\u003e \\u003cp\\u003eThe spleen and thymus are critical immune and hematopoietic organs. CTX can damage these organs, leading to atrophy and reduced organ indices[\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]. Our results also confirmed that cyclophosphamide causes atrophy of the thymus and spleen, with reduced spleen and thymus indices. H\\u0026amp;E staining showed that CTX disrupted spleen structure. However, after GA intervention, atrophy in the spleen and thymus was alleviated, and the normal structure and function of the spleen were somewhat restored. These changes indicate that GA plays a positive role in the differentiation of the hematopoietic system and the functional recovery of immune organs.\\u003c/p\\u003e \\u003cp\\u003ePrevious studies have shown that CTX induces apoptosis and cell cycle arrest in bone marrow suppression mice, with proliferating bone marrow cells being most sensitive to chemotherapy damage[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. After chemotherapy, CTX causes DNA damage in hematopoietic cells, activating cell cycle checkpoint mechanisms, causing cell cycle arrest at the G1 phase to repair the damaged DNA. Our findings are consistent with this, showing an increase in the proportion of cells in the G1/M phase and a decrease in G2 and S phase cells, characteristic of damaged cells arrested at the G1 phase. GA intervention significantly increased the proportion of cells in the G1 phase, indicating that GA can promote the repair of DNA-damaged cells and facilitate entry into the proliferation phase. However, the specific mechanisms by which GA repairs cell DNA require further investigation. Additionally, GA not only alleviates CTX-induced apoptosis but also relieves cell cycle arrest. Our study has not yet definitively determined whether GA reduces apoptosis rates by relieving the cell cycle arrest of bone marrow nucleated cells or has dual activity in relieving cell cycle arrest and reducing apoptosis rates. In future research, we will further explore the specific mechanisms by which GA alleviates CTX-induced bone marrow suppression.\\u003c/p\\u003e \\u003cp\\u003eThe hematopoietic system is regulated by various factors, including both promoting and inhibitory cytokines[\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e]. Promoting cytokines such as IL-1β, IL-3, IL-6, TPO, EPO, GM-CSF, and SCF play vital roles, while TNF-α serves as an inhibitory factor. IL-1 protects and restores bone marrow from chemotherapy or radiation damage[\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e], and it affects all cells of the innate immune system[\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e]. IL-3, known as multi-colony stimulating factor, is extensively studied for treating bone marrow failure and hematologic malignancies, mobilizing and expanding hematopoietic progenitor cells for transplantation, and supporting post-transplant engraftment[\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e]. IL-6 is crucial in immune responses with context-dependent pro-inflammatory and anti-inflammatory properties, making it a key target for clinical intervention[\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e]. Erythropoietin (EPO) regulates erythropoiesis in mammals by driving the maturation of erythroid cells through its homodimeric receptor (EPO-R), resulting in the production of billions of mature red blood cells[\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e]. Thrombopoietin (TPO), produced by the liver and kidneys, regulates platelet production[\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e]. Granulocyte-macrophage colony-stimulating factor (GM-CSF) induces the production of myeloid cells, including neutrophils, monocytes, macrophages, and dendritic cells, in response to stress, infection, and cancer[\\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e]. Stem cell factor (SCF) collaborates with other factors in hematopoietic regulation, modulating hematopoietic stem and progenitor cells[\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e]. In contrast, tumor necrosis factor-α (TNF-α) inhibits the proliferation and differentiation of hematopoietic cells[\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e].The study results indicate that after GA intervention, hematopoietic promoting factors increased while inhibitory factors were suppressed in chemotherapy-induced myelosuppressed mice, positively regulating hematopoiesis. These increased promoting factors may collectively enhance the differentiation of hematopoietic stem cells, ultimately influencing megakaryocyte and erythrocyte formation. However, the specific effects of GA on hematopoietic stem cell differentiation require further investigation.\\u003c/p\\u003e \\u003cp\\u003eIn conclusion, this study confirms that the natural compound GA can serve as an adjunctive treatment option to alleviate cyclophosphamide-induced bone marrow suppression. However, the specific mechanisms by which GA mitigates the side effects of CTX require further investigation. Given its widespread availability and low cost, GA's potential therapeutic role in alleviating chemotherapy-induced side effects lays the foundation for clinical trials exploring GA treatment in patients with bone myelosuppression.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cdiv class=\\\"DefinitionList\\\"\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eGA\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eGallic acid\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eL-GA\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eLow-dose gallic acid\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eM-GA\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eMedium-dose gallic acid\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eH-GA\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eHigh-dose gallic acid\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eCTX\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eCyclophosphamide\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eDYSB\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eDi yu sheng bai tablet\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eRhG-CSF\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eRecombinant human granulocyte colony-stimulating factor\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eWBC\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eWhite blood cell\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eRBC\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eRed blood cell\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003ePLT\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003ePlatelet\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eHb\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eHemoglobin\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll data generated or analysed during this study are included in this published article.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll the authors declare that there are no conflicts of interest.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthics statement\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe animal study was reviewed and approved by the Ethics Committee of the Chongqing Medical University.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData availability\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe data that has been used is confidential.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by \\u0026ldquo;Chongqing graduate research innovation project\\u0026rdquo;(CYS23343) and The Chongqing Traditional Chinese Medicine Innovation Team: \\u0026quot;Innovative Team for the Development of New Targeted Delivery Traditional Chinese Medicine Formulations.\\u0026quot;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eConceptualization, Junyi Luo, Zhaoxia Zhang, Liming Jin; Data curation, Junyi Luo, Zhaoying Wang; Formal analysis, Junyi Luo; Funding acquisition, Dawei He; Investigation, Junyi Luo, Zhaoxia Zhang , Liming Jin, Zhaoying Wang and Qiuyue Sun; Methodology, Junyi Luo, Zhaoxia Zhang, Junyi Luo, Zhaoying, Qiuyue Sun and Dawei He; Project administration, Dawei He; Supervision, Dawei He; Validation, Junyi Luo; Visualization, Junyi Luo and Liming Jin; Writing\\u0026ndash;original draft, Liming Jin; Writing\\u0026ndash;review \\u0026amp; editing, Junyi Luo, Zhaoxia Zhang , Liming Jin and Dawei He.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNot applicable.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eC M, G L. Current Cancer Epidemiology. Journal of epidemiology and global health. 2019;9.\\u003c/li\\u003e\\n\\u003cli\\u003eTurner N, Biganzoli L, Di Leo A. Continued value of adjuvant anthracyclines as treatment for early breast cancer. Lancet Oncol. 2015;16:e362-369.\\u003c/li\\u003e\\n\\u003cli\\u003eA E, Rj J, Ra B. Cyclophosphamide and cancer: golden anniversary. Nature reviews Clinical oncology. 2009;6.\\u003c/li\\u003e\\n\\u003cli\\u003eWagenaar HC, Colombo N, Vergote I, Hoctin-Boes G, Zanetta G, Pecorelli S, et al. Bleomycin, methotrexate, and CCNU in locally advanced or recurrent, inoperable, squamous-cell carcinoma of the vulva: an EORTC Gynaecological Cancer Cooperative Group Study. European Organization for Research and Treatment of Cancer. Gynecol Oncol. 2001;81:348\\u0026ndash;54.\\u003c/li\\u003e\\n\\u003cli\\u003ePaz-Ares L, Dvorkin M, Chen Y, Reinmuth N, Hotta K, Trukhin D, et al. Durvalumab plus platinum-etoposide versus platinum-etoposide in first-line treatment of extensive-stage small-cell lung cancer (CASPIAN): a randomised, controlled, open-label, phase 3 trial. Lancet. 2019;394:1929\\u0026ndash;39.\\u003c/li\\u003e\\n\\u003cli\\u003eK S, M Y, Y A, K M, K S, S K, et al. Rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisolone combined with high-dose methotrexate plus intrathecal chemotherapy for newly diagnosed intravascular large B-cell lymphoma (PRIMEUR-IVL): a multicentre, single-arm, phase 2 trial. The Lancet Oncology. 2020;21.\\u003c/li\\u003e\\n\\u003cli\\u003eCombination of TRAIL and actinomycin D liposomes enhances antitumor effect in non-small cell lung cancer - PubMed. https://pubmed.ncbi.nlm.nih.gov/22619505/. Accessed 13 May 2024.\\u003c/li\\u003e\\n\\u003cli\\u003eIm Z, Y H-B. [Management of chemotherapy side effects and their long-term sequelae]. Der Urologe Ausg A. 2021;60.\\u003c/li\\u003e\\n\\u003cli\\u003eS Y, H C, L X, B Z, S L. Traditional Chinese medicine on treating myelosuppression after chemotherapy: A protocol for systematic review and meta-analysis. Medicine. 2021;100.\\u003c/li\\u003e\\n\\u003cli\\u003eAhlmann M, Hempel G. The effect of cyclophosphamide on the immune system: implications for clinical cancer therapy. Cancer Chemother Pharmacol. 2016;78:661\\u0026ndash;71.\\u003c/li\\u003e\\n\\u003cli\\u003eXh H, Yp L, T G, Ry C, Ym F. Immunosuppressive effect of cyclophosphamide on white blood cells and lymphocyte subpopulations from peripheral blood of Balb/c mice. International immunopharmacology. 2011;11.\\u003c/li\\u003e\\n\\u003cli\\u003eRs E, Ms A, Uk BR, T S, J K, Ml L-P, et al. Patient Burden and Real-World Management of Chemotherapy-Induced Myelosuppression: Results from an Online Survey of Patients with Solid Tumors. Advances in therapy. 2020;37.\\u003c/li\\u003e\\n\\u003cli\\u003eJ C, D H, K G, J W. The impact of myelosuppression on quality of life of patients treated with chemotherapy. Future oncology (London, England). 2024. https://doi.org/10.2217/fon-2023-0513.\\u003c/li\\u003e\\n\\u003cli\\u003eGinsenoside Compound K Regulates HIF-1\\u0026alpha;-Mediated Glycolysis Through Bclaf1 to Inhibit the Proliferation of Human Liver Cancer Cells - PubMed. https://pubmed.ilibs.cn/33363466/. Accessed 21 May 2024.\\u003c/li\\u003e\\n\\u003cli\\u003eGinsenoside Rh4 Suppresses Metastasis of Gastric Cancer via SIX1-Dependent TGF-\\u0026beta;/Smad2/3 Signaling Pathway - PubMed. https://pubmed.ilibs.cn/35458126/. Accessed 21 May 2024.\\u003c/li\\u003e\\n\\u003cli\\u003eX L, S C, M L, Y G, Y L, S Y, et al. Anticancer property of ginsenoside Rh2 from ginseng. European journal of medicinal chemistry. 2020;203.\\u003c/li\\u003e\\n\\u003cli\\u003eX L, Z Z, J L, Y W, Q Z, S W, et al. Ginsenoside Rg3 improves cyclophosphamide-induced immunocompetence in Balb/c mice. International immunopharmacology. 2019;72.\\u003c/li\\u003e\\n\\u003cli\\u003eF Y, Q X, K L, X C, L S, Y L. Phenolic Compounds and Ginsenosides in Ginseng Shoots and Their Antioxidant and Anti-Inflammatory Capacities in LPS-Induced RAW264.7 Mouse Macrophages. International journal of molecular sciences. 2019;20.\\u003c/li\\u003e\\n\\u003cli\\u003eHan J, Xia J, Zhang L, Cai E, Zhao Y, Fei X, et al. Studies of the effects and mechanisms of ginsenoside Re and Rk3 on myelosuppression induced by cyclophosphamide. Journal of Ginseng Research. 2019;43:618\\u0026ndash;24.\\u003c/li\\u003e\\n\\u003cli\\u003eM P, B G, F G, G L, E I, A DL. Curcumin and Colorectal Cancer: From Basic to Clinical Evidences. International journal of molecular sciences. 2020;21.\\u003c/li\\u003e\\n\\u003cli\\u003eWnb WMT, Nh L, F A, I O, R N. Mechanistic Understanding of Curcumin\\u0026rsquo;s Therapeutic Effects in Lung Cancer. Nutrients. 2019;11.\\u003c/li\\u003e\\n\\u003cli\\u003eSi SA-H, S AJ, M MK, S JS, I A, Rm RP, et al. Curcumin in the treatment of liver cancer: From mechanisms of action to nanoformulations. Phytotherapy research : PTR. 2023;37.\\u003c/li\\u003e\\n\\u003cli\\u003eY P, M A, B D, Y J, L Y, Z C, et al. Anti-Inflammatory Effects of Curcumin in the Inflammatory Diseases: Status, Limitations and Countermeasures. Drug design, development and therapy. 2021;15.\\u003c/li\\u003e\\n\\u003cli\\u003eAntioxidant and anti-inflammatory effects of curcumin/turmeric supplementation in adults: A GRADE-assessed systematic review and dose-response meta-analysis of randomized controlled trials - PubMed. https://pubmed.ilibs.cn/36804260/. Accessed 22 May 2024.\\u003c/li\\u003e\\n\\u003cli\\u003eMa P. The influence of curcumin and (-)-epicatechin on the genotoxicity and myelosuppression induced by etoposide in bone marrow cells of male rats. Drug and chemical toxicology. 2013;36.\\u003c/li\\u003e\\n\\u003cli\\u003ePatra K, Bose S, Sarkar S, Rakshit J, Jana S, Mukherjee A, et al. Amelioration of cyclophosphamide induced myelosuppression and oxidative stress by cinnamic acid. Chemico-Biological Interactions. 2012;195:231\\u0026ndash;9.\\u003c/li\\u003e\\n\\u003cli\\u003eDietary gallic acid as an antioxidant: A review of its food industry applications, health benefits, bioavailability, nano-delivery systems, and drug interactions - PubMed. https://pubmed.ilibs.cn/38395544/. Accessed 22 May 2024.\\u003c/li\\u003e\\n\\u003cli\\u003eGallic Acid Impedes Non-Small Cell Lung Cancer Progression via Suppression of EGFR-Dependent CARM1-PELP1 Complex - PubMed. https://pubmed.ilibs.cn/32425504/. Accessed 22 May 2024.\\u003c/li\\u003e\\n\\u003cli\\u003eAnticancer Effect of Gallic Acid on Acidity-Induced Invasion of MCF7 Breast Cancer Cells - PubMed. https://pubmed.ilibs.cn/37630786/. Accessed 22 May 2024.\\u003c/li\\u003e\\n\\u003cli\\u003eYg J, Eb K, Kc C. Gallic acid, a phenolic acid, hinders the progression of prostate cancer by inhibition of histone deacetylase 1 and 2 expression. The Journal of nutritional biochemistry. 2020;84.\\u003c/li\\u003e\\n\\u003cli\\u003eGallic acid: Pharmacological activities and molecular mechanisms involved in inflammation-related diseases - PubMed. https://pubmed.ilibs.cn/33212373/. Accessed 22 May 2024.\\u003c/li\\u003e\\n\\u003cli\\u003eGallic acid induces T-helper-1-like Treg cells and strengthens immune checkpoint blockade efficacy - PubMed. https://pubmed.ilibs.cn/35817479/. Accessed 22 May 2024.\\u003c/li\\u003e\\n\\u003cli\\u003eGuo M-Z, Meng M, Feng C-C, Wang X, Wang C-L. A novel polysaccharide obtained from Craterellus cornucopioides enhances immunomodulatory activity in immunosuppressive mice models via regulation of the TLR4-NF-\\u0026kappa;B pathway. Food Funct. 2019;10:4792\\u0026ndash;801.\\u003c/li\\u003e\\n\\u003cli\\u003eM Z, Y Z, X Z, W Z, Q Y, W Z, et al. Two birds with one stone: YQSSF regulates both proliferation and apoptosis of bone marrow cells to relieve chemotherapy-induced myelosuppression. Journal of ethnopharmacology. 2022;289.\\u003c/li\\u003e\\n\\u003cli\\u003eJ C, Dc D, Gh L. Chemotherapy-induced neutropenia: risks, consequences, and new directions for its management. Cancer. 2004;100.\\u003c/li\\u003e\\n\\u003cli\\u003eWang C, Gao H, Cai E, Zhang L, Zheng X, Zhang S, et al. Protective effects of \\u003cem\\u003eAcanthopanax senticosus - Ligustrum lucidum\\u003c/em\\u003e combination on bone marrow suppression induced by chemotherapy in mice. Biomedicine \\u0026amp; Pharmacotherapy. 2019;109:2062\\u0026ndash;9.\\u003c/li\\u003e\\n\\u003cli\\u003eDeng J, Zhong Y-F, Wu Y-P, Luo Z, Sun Y-M, Wang G-E, et al. Carnosine attenuates cyclophosphamide-induced bone marrow suppression by reducing oxidative DNA damage. Redox Biology. 2018;14:1\\u0026ndash;6.\\u003c/li\\u003e\\n\\u003cli\\u003eS S, Kb S. Gallic acid: A promising genoprotective and hepatoprotective bioactive compound against cyclophosphamide induced toxicity in mice. Environmental toxicology. 2021;36.\\u003c/li\\u003e\\n\\u003cli\\u003eS B, H K, M K, M G, E M, H K. Pretreatment with Gallic Acid Mitigates Cyclophosphamide Induced Inflammation and Oxidative Stress in Mice. Current molecular pharmacology. 2022;15.\\u003c/li\\u003e\\n\\u003cli\\u003ePj C. Drug-induced myelosuppression : diagnosis and management. Drug safety. 2003;26.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang W-N, Gong L-L, Liu Y, Zhou Z-B, Wan C-X, Xu J-J, et al. Immunoenhancement effect of crude polysaccharides ofHelvella leucopuson cyclophosphamide-induced immunosuppressive mice. Journal of Functional Foods. 2020;69:103942.\\u003c/li\\u003e\\n\\u003cli\\u003eHan J, Dai M, Zhao Y, Cai E, Zhang L, Jia X, et al. Compatibility effects of ginseng and \\u003cem\\u003eLigustrum lucidum\\u003c/em\\u003e Ait herb pair on hematopoietic recovery in mice with cyclophosphamide-induced myelosuppression and its material basis. Journal of Ginseng Research. 2020;44:291\\u0026ndash;9.\\u003c/li\\u003e\\n\\u003cli\\u003eOp V, Aa M, Hr S. Growth factors and hematopoietic stem cells. Hematology/oncology clinics of North America. 1997;11.\\u003c/li\\u003e\\n\\u003cli\\u003eModulation of Myelopoiesis Progenitors Is an Integral Component of Trained Immunity - PubMed. https://pubmed.ilibs.cn/29328910/. Accessed 22 May 2024.\\u003c/li\\u003e\\n\\u003cli\\u003eC G, Ca D, A M. The interleukin-1 family: back to the future. Immunity. 2013;39.\\u003c/li\\u003e\\n\\u003cli\\u003eM E, G G, A G. IL-3 in the clinic. Stem cells (Dayton, Ohio). 1997;15.\\u003c/li\\u003e\\n\\u003cli\\u003eCa H, Sa J. IL-6 as a keystone cytokine in health and disease. Nature immunology. 2015;16.\\u003c/li\\u003e\\n\\u003cli\\u003eAs T. Erythropoietin (EPO) as a Key Regulator of Erythropoiesis, Bone Remodeling and Endothelial Transdifferentiation of Multipotent Mesenchymal Stem Cells (MSCs): Implications in Regenerative Medicine. Cells. 2021;10.\\u003c/li\\u003e\\n\\u003cli\\u003eJw A. Thrombopoietin and platelet function. Seminars in thrombosis and hemostasis. 2006;32.\\u003c/li\\u003e\\n\\u003cli\\u003eA K, A TK, A SO, S S. GM-CSF: A Double-Edged Sword in Cancer Immunotherapy. Frontiers in immunology. 2022;13.\\u003c/li\\u003e\\n\\u003cli\\u003eC W. Spatiotemporal Resolution of SCF Supply in Early Hematopoiesis. Cell stem cell. 2019;24.\\u003c/li\\u003e\\n\\u003cli\\u003eSe J, Fw J, C F, Ls R. TNF-alpha, the great imitator: role of p55 and p75 TNF receptors in hematopoiesis. Stem cells (Dayton, Ohio). 1994;12 Suppl 1.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Natural compounds, Bone marrow suppression, Chemotherapy\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4498216/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4498216/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003ch2\\u003eBackground\\u003c/h2\\u003e \\u003cp\\u003eThis study aims to investigate the alleviating effects of Gallic Acid (GA) on chemotherapy-induced bone marrow suppression.\\u003c/p\\u003e\\u003ch2\\u003eMethods\\u003c/h2\\u003e \\u003cp\\u003eA mouse model of bone marrow suppression was established in BALB/c mice using intraperitoneal injections of cyclophosphamide (CTX). Mice were treated with low (100 mg/kg/d), medium (200 mg/kg/d), and high (400 mg/kg/d) doses of GA to mitigate the CTX-induced bone marrow suppression. The efficacy of GA in alleviating chemotherapy-induced bone marrow suppression was evaluated through blood cell counts, immune organ (thymus and spleen) indices, bone marrow nucleated cell (BMNC) counts, cell cycle, apoptosis, histopathology of bone marrow and spleen, and analysis of splenic hematopoietic factors.\\u003c/p\\u003e\\u003ch2\\u003eResults\\u003c/h2\\u003e \\u003cp\\u003eCTX induced a decrease in peripheral blood and BMNC counts, reduced spleen and thymus indices, and abnormal pathology of bone marrow and spleen, as well as disturbances in hematopoietic factors. GA was able to alleviate these abnormalities in the bone marrow. It modulated cell proliferation and apoptosis, adjusted the proportion of cells in the G0/G1 phase, and reduced apoptosis in femoral bone marrow.\\u003c/p\\u003e\\u003ch2\\u003eConclusion\\u003c/h2\\u003e \\u003cp\\u003eGA can alleviate the atrophy of immune organs, relieve the proliferation blockade of bone marrow cells, inhibit bone marrow cell apoptosis, and promote the recovery of the spleen and hematopoietic factors, thereby mitigating CTX-induced bone marrow suppression. The study confirms the potential of the natural compound GA as an effective adjunct in alleviating CTX-induced bone marrow suppression, offering significant clinical application potential. These findings provide a theoretical basis and experimental evidence for developing new adjunct chemotherapy treatment strategies.\\u003c/p\\u003e\",\"manuscriptTitle\":\"The Alleviating Effect of Gallic Acid on Chemotherapy-Induced Myelosuppression\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-06-13 13:15:00\",\"doi\":\"10.21203/rs.3.rs-4498216/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"977c63e0-ccca-4a8b-8c60-958badfd0bb7\",\"owner\":[],\"postedDate\":\"June 13th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-08-26T03:26:52+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-06-13 13:15:00\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4498216\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4498216\",\"identity\":\"rs-4498216\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}