{"paper_id":"212df365-0fe4-4dd7-9331-af74214d6330","body_text":"PPIH, a component of U4/U6 snRNP, regulates spermiogenesis by alternative splicing | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article PPIH, a component of U4/U6 snRNP, regulates spermiogenesis by alternative splicing Qun Zhao, Ziqi Wang, Kang Shangguan, Biyun Liu, Xinyue Wu, Shiyu Wang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9239117/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 10 You are reading this latest preprint version Abstract Male infertility has become an increasingly critical global issue, with abnormal spermiogenesis being a major contributor. The structural integrity of sperm is closely linked to male fertility. Alternative splicing (AS) is one of the key post-transcriptional regulation mechanisms that plays an essential role in spermatogenesis. However, the function of AS during spermiogenesis remains poorly understood. In this study, we demonstrated that peptidylprolyl isomerase H (PPIH), a component of the U4/U6 snRNP, acts as a critical AS regulator that participates in mouse spermiogenesis. Germ-cell-specific knock-out of Ppih in mice results in abnormal sperm morphology and male infertility. Mechanistically, PPIH affects the expression of spliceosome components and the assembly of the spliceosome, especially the organization of the U4/U6. U5 tri-snRNP complex. By doing so, PPIH mediates the expression of genes associated with sperm flagellum formation and motility (e.g., Tssk4 , Sept4 , Ift88 ) via AS. Additionally, PPIH can directly bind to the genes of Odf2 , Catsperg1, 2 , and U2af1 , regulating their transcription through AS. Taken together, our research identified PPIH as a pivotal regulator of AS during sperm maturation and an essential factor for male fertility. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Infertility has become an increasingly pressing global issue with profound social and psychological impacts[ 1 ]. Reproductive capacity is critical for the survival of the animal species, and male factors are estimated to contribute to 30–50% of cases of infertility[ 2 ]. Among the various causes, genetic variation and defective spermiogenesis are major contributors to asthenozoospermia, particularly those associated with sperm flagellar structure.[ 3 ]. Spermatogenesis is a highly organized process, comprising sequential mitotic, meiotic, and spermiogenic phases [ 4 ]. Spermatogonia undergo mitotic divisions and generate a pool of spermatocytes; Haploid spermatids are generated after the meiotic phase[ 5 ]. Spermiogenesis is the terminal process by which round spermatids complete an extraordinary series of events to become spermatozoa capable of motility[ 6 ]. Completing spermiogenesis is critical for male fertility[ 7 ]. Since DNA condenses in the nucleus, the global transcription rates of spermiogenesis decline. However, de novo protein synthesis is necessary for the development of the specific sperm cell morphology[ 8 ]. Although the stages of spermiogenesis are well characterized at the cellular level, the precise biological mechanisms that regulate this process are not entirely understood [ 9 ]. Multiple regulatory mechanisms, including transcriptional and post-transcriptional regulation, are reported to be involved in this complex process to ensure successful spermiogenesis[ 10 , 11 ]. While global transcriptional activity decreases with chromatin condensation during spermiogenesis, the expression of specific genes appears to be regulated by alternative splicing (AS) of transcripts [ 12 ]. AS is a universal post-transcriptional regulatory mechanism that increases the diversity of transcripts and proteins generated from a limited number of genes, representing a critical step in gene expression[ 13 , 14 ]. mRNA splicing is accomplished by the macromolecular machinery called the spliceosome[ 15 ]. The spliceosome is composed of five uridine-rich small nuclear RNAs (snRNAs) that interact with essential protein chaperones to form snRNP (small nuclear RNA–protein complex) subcomplexes. The stepwise assembly of spliceosomes is initiated with the association of U1 snRNP with the 5’ splice site (ss) and U2 snRNP with the branch point to form the pre-spliceosome. This is followed by the binding of the U4/U6. U5 tri-snRNP. After a major remodeling, the fully assembled spliceosome changes into a catalytically active machine[ 16 – 18 ]. Testicular tissue is one of the richest tissues with respect to the number of alternative splicing events and mRNA isoforms[ 19 ]. By using mouse knockout models, several newly defined AS regulators like BCAS2[ 20 ], CWF19L2[ 21 ], PTBP1/2[ 22 ], and SRSF10[ 23 ] proved that AS is critical for the mitotic division of spermatogonia and meiotic stages[ 24 ]. What’s more, previous studies also demonstrated that mutations of spliceosome components and/or malformation of spliceosome frequently lead to aberrant splicing variants and male infertility, for example, suppressing PRPF4, the key component of U4/U6 snRNP, results in a decrease in pluripotency of mouse embryonic stem cells[ 25 ]; Research in drosophila found that the spliceosome component U2A, the homolog of hSNRPA1, is required for spermatogonia differentiation and associated with NOA[ 26 ]; LARP7-mediated U6 modification is functionally required for the fidelity of pre-mRNA splicing in male germ cells[ 27 ]. However, the regulatory mechanisms of specific spliceosome members in spermiogenesis are still largely underestimated. Peptidylprolyl isomerase H (PPIH), a peptidyl-prolyl cis-trans isomerase, was first defined in the matrix of Neurospora crassa mitochondria and plays a role in importing and folding of proteins[ 28 ]. Later studies proved that PPIH interacted with the U4/U6 snRNP components (PRPF3, PRPF4) and function in the assembly of U4/U6. U5 tri-snRNPs and/or in conformational changes occurring during the splicing process in hela cell[ 29 , 30 ]. In this study, by using a germ cell-specific Ppih knock-out mouse model, we found that PPIH took part in the regulation of spermiogenesis by participating in the alternative splicing of sperm cilium or motile-related mRNA. Losing Ppih lead to the structure of spermatozoa disrupted, decreasing sperm motility, and male infertility. Mechanically, PPIH influences the organization of U4/U6. U5 tri-snRNP mediates the expression of U4/U6. U5 snRNP components. AS of cilium formation-related genes were disrupted after Ppih loss, resulting in decreased expression of these genes. Besides, LACE-Seq analysis indicated that PPIH binds to the mRNA of flagella formation and Ca 2+ ion channel genes and directly regulates their expression by AS. Taken together, our study presents compelling evidence for proving that PPIH is a critical regulator of mRNA alternative splicing during spermiogenesis and essential for male fertility. Result PPIH is greatly expressed during spermiogenesis During male germ cell development, stage-specific genes are expressed in the meiotic prophase and early round spermatid stage. Germ cell-specific isoforms of several genes are generated through alternative splicing[31, 32]. To date, the known functions of splicing regulators are dominantly working at mitotic or meiotic stages[33, 34]; however, the splicing effectors that work in spermiogenesis remain to be elucidated. To investigate the role of mRNA alternative splicing during the transition from round to elongated spermatids, we focused our attention on spliceosome components, as the spliceosome is the main splicing machinery[35]. To begin with, we reanalyzed the published single-cell sequencing data[36] and characterized the expression patterns of several spliceosome components, such as Sf3b1 (belonging to U2 snRNP), the core proteins of U4/U6 snRNP ( Prpf3, Prpf4, Prpf31, and Ppih ), and U5 snRNP-specific components ( Prpf6, Prpf8 )[36-38]. We found that the expression levels of these proteins are dynamic during spermatogenesis, with the highest expression at the leptotene stage and a subsequent decrease. However, Ppih exhibited a different expression pattern, being abundantly expressed at the zygotene stage (Fig. S1a) . To validate the sequencing result, we measured the transcription levels of the aforementioned genes during the first wave of spermatogenesis by qPCR and found that the expression of these genes was lowest at the leptotene stages (12 days after birth, PD12), after which their expression increased and remained at a high level (Fig. 1a) . Similar to the mRNA expression profile, the protein levels of these genes decreased at postnatal day 12 (PD12, Leptotene) and recovered at PD14 (Zygotene), remained at high levels thereafter (Fig. 1b) . Together, these data suggest that the spliceosome may play a unique role in spermatogenesis. To further define the subcellular localization of these proteins in testes, we performed immunofluorescence (IF) staining using testicular paraffin sections. Our results showed that almost all of these proteins were highly expressed in pachytene or diplotene spermatocytes, reduced in round spermatids, and almost undetectable in elongated spermatids. Furthermore, these proteins were largely localized in the nucleus (Fig. 1c) . However, unlike the measured proteins, PPIH exhibited a unique expression and localization pattern: PPIH was localized both in the nucleus and cytoplasm. Additionally, PPIH was highly expressed in round spermatids and elongated spermatids, but lower in pachytene and diplotene spermatocytes (Fig. 1d) . Isolation of testicular nuclei and cytosol further confirmed the localization pattern of PPIH and other snRNP proteins (Fig. 1e) . To further confirm the unique expression of PPIH, we performed similar experiments in HEK 293 T cells transfected with PPIH-Flag plasmid; Nuclear/cytosol isolation indicated that PPIH existed in both the nucleus and cytosol both in vivo and in vitro (Fig. S1b) . We also carried out IF to observe the PPIH localization in HEK 293 cells and found that PPIH was expressed in the nucleus and cytosol (Fig. S1c) . The distinct distribution and expression pattern of PPIH may indicate an exceptional function in spermiogenesis. PPIH co-participated with multiple spliceosome components in the testes In human cells, PPIH was assembled to the U4/U6 snRNP and was indispensable for its splicing activity[39]. Amino acid sequence alignment analysis of PPIH orthologs from prokaryotes to eukaryotes demonstrated its evolutionary conservation ( Fig. S1d ), indicating that PPIH may have conserved characteristics in mice. Given this potential conservation, and since the detailed function of mouse PPIH has not been reported, we first elucidated the tissue expression profile of PPIH by Western blot (WB) using multiple adult mouse tissues. Our results showed that PPIH was predominantly expressed in mouse genital organs, with weak expression in the brain and other tissues. (Fig. 1f) . We then investigated whether PPIH is associated with components of the U4/U6 snRNP complex in mouse testes as well as in human cells. Immunoprecipitation (IP) was performed using anti-PPIH antibodies, and proteins were analyzed by WB. Consistent with the previous studies where PPIH tightly binds to PRPF3, PRPF4, and PRPF18, PPIH also stably interacted with PRPF3, PRPF4, and PRPF18 in the testes (Fig. 1g) . We also constructed PPIH-Flag and PRPF18-HA plasmids and verified their interaction by co-transfecting the plasmids into the HEK 293T cell line. Co-immunoprecipitation experiments further confirmed the interaction between PPIH and PRPF18 (Fig. 1h) . Collectively, these findings indicate that PPIH is also integrated into the U4/U6 snRNP in mice testes. To explore the interactors of PPIH during spermatogenesis, we performed IP followed by mass spectrometry (IP-MS) experiments using total protein extracts from mouse testes with an anti-PPIH antibody, aiming to identify other potential proteins interacting with PPIH besides the verified spliceosome components. A total of 1867 proteins were specifically identified by IP-MS. In addition to the tested proteins associated with U4/U6 snRNP, U2 snRNP (SF3B1), U5 snRNP-specific members (PRPF8, DDX23[40]), RNA-binding proteins (e.g hnRNP[41]) and molecular chaperones (e.g., Hspa5[42]) were also discovered (Fig. 1i) . Using in vivo IP, we further validated and confirmed that U2, U4/U6, and U5 snRNP proteins (PRPF31, PRPF8, and DDX23) identified by IP-MS indeed interacted with PPIH in the testes (Fig. 1j) . IF analysis further demonstrated that PPIH co-localized with PRPF31 and SF3B1 in diplotene spermatocytes and round spermatids (Fig. 1k) . Taken together, these data suggest that PPIH is indeed associated with the spliceosome in mouse testes. Considering the high, unique expression pattern of PPIH in mouse testes and its stable association with the spliceosome, PPIH may be indispensable for controlling AS during spermiogenesis. Ppih deletion causes complete male infertility and disrupted spermiogenesis. To uncover the function of PPIH during spermiogenesis and fertilization, we engineered a germline-specific conditional Ppih knock out mice using the Cre -loxP system. Firstly, we generated mice with a floxed Ppih allele by inserting two loxP cassettes—one before exon 4 and the other after exon 5—using the CRISPR-Cas9 system[43] (Fig. 2a) . After mating with a Stra8-GFPCre line, germ cell-specific conditional knockout Ppih ( Ppih fl/fl Stra8-GFPCre , here after Ppih cKO) mice could be generated[44]. The genotypes of wild-type ( Ppih f Ppih fl/fl , WT) and Ppih cKO mice for the targeted mutation of Ppih were identified by PCR analysis of genomic DNA (Fig. S2a) . Successful deletion of Ppih was determined by qPCR and immunoblot analysis of testicular mRNA or protein extracts, which showed that the transcription and translation of Ppih were markedly reduced in Ppih cKO mice (Fig. 2b&c) . Consistently, IF analysis of the testis sections revealed the loss of PPIH in germ cells (Fig. 2d) . The WT and Ppih cKO mice had identical body size (Fig. S2b), and there was no alteration in their body weight (Fig. 2e) . However, male Ppih cKO were infertile, and no offspring were delivered. Whereas female reproduction capacity was not disturbed by missing Ppih (Fig. 2f) . To elucidate the details that Ppih knock out result in male infertility, we first observe the morphology of the testes and the cauda epididymis. Differing from the WT litter-matched control, the testes of adult Ppih cKO mice were smaller, and the ratio of testes to body weight in Ppih cKO mice was significantly lower than that of WT (Fig. 2g&h) . Furthermore, the caput and cauda epididymides of Ppih cKO mice were irregular compared with WT (Fig. 2g) . These observations suggest that PPIH is essential for male fertility. To explore the role of PPIH in spermatogenesis following the observed male infertility in Ppih CKO mice, histological analyses were performed. Using Hematoxylin and Eosin (H&E) to stain the testes and epididymis paraffin section, we observed no differences in the number of empty seminiferous tubules. However, the decreasing quantity of round and elongated spermatids was found in Ppih cKO mice, and elongated spermatids of Ppih cKO mice had impaired flagellum as well (Fig. 2i) . When the cauda epididymal section was inspected, Ppih cKO epididymis showed a reduced number of spermatozoa and an increased cell debris (Fig. 2j& k & Fig. S2c) . To identify the developmental defects underlying spermiogenesis malformation, we performed stage-specific investigations using IF analysis of lectin peanut agglutinin (PNA), which marks the acrosome[45]. As shown in the Fig 2l , germ cell development proceeded normally between WT and Ppih cKO mice, as all cell-type proportions were maintained. However, although the hook-shaped acrosome in WT spermatids was also observed in Ppih cKO spermatids, Ppih cKO spermatids exhibited continuous variation in acrosome and nucleus shapes (Fig. 2l) . Additionally, by counting the number of cells per tubule, we found that the number of round and elongated spermatids was significantly decreased in Ppih cKO mice (Fig. S2d&e) . To exclude artificial influences, we used flow cytometry-based cell counting to assess the number of cells at different stages (Fig. 2m) . Consistent with the counting results, there was a clear reduction in haploid cells in Ppih cKO mice, while a slight increase in meiotic cells was observed in Ppih cKO mice (Fig. 2n) . IF analysis of Sertoli cells (SOX9)[46] and undifferentiated spermatogonia (PLZF) [47]showed no differences between WT and Ppih cKO mice (Fig. S2f&g) . Taken together, these data demonstrated that PPIH specifically functions in the spermiogenesis phase and is dispensable for the development of spermatogonia and spermatocytes. PPIH is required for spermatozoa biogenesis Our results revealed that PPIH deletion leads to a reduction in the number of round and elongated spermatids. To further characterize whether PPIH plays a role in spermatozoa morphology development, we observed spermatozoa from the cauda epididymis. Results showed that PPIH deletion led to abnormal spermatozoa morphology, including shorter or bent tails and abnormal heads (Fig. 3a) . The proportion of deformed sperm in Ppih cKO mice was significantly higher than that in WT mice (Fig. 3b) . Computer-assisted semen analysis (CASA) of epididymal sperm revealed that the rates of total motility and progressive motility in Ppih cKO mice were significantly lower than those in WT mice (Fig. 3c) . Sperm flagellum is essential for sperm motility, which is a fundamental requirement for male fertility [48, 49]. Considering the facts that Ppih cKO mice had irregular sperm flagella and reduced motility, we hypothesized that the structure of the sperm cilium might be disrupted. To test this hypothesis, we stained testes with β-tubulin (a marker of cilia)[50] to confirm defects in Ppih cKO mice. We found a clear loss of β-tubulin expression in the lumen of Ppih cKO mice, where signals are abundant in WT mice (Fig. 3d&f) . WB analysis further confirmed the reduction of β-tubulin in Ppih cKO mice (Fig. 3e) . To gain deeper insight into sperm cilium and head defects, we visualized cauda sperm by IF analysis of β-tubulin and PNA. IF showed that β-tubulin expression was significantly decreased in Ppih cKO sperm. Furthermore, PNA staining revealed that the acrosome of Ppih cKO sperm was also malformed (Fig. 3f) . Together, these results suggest that PPIH is required for spermatozoa development. To deeply reveal the significant spermatozoa morphology defects, we then applied transmission electron microscopy (TEM) on the cauda epididymis to observe the ultrastructure. As shown in Fig 3g , the spermatozoa head of Ppih cKO mice was disrupted with degenerating acrosomes and the nucleus shrunken compared with WT. Furthermore, abnormal structure and mitochondria lost were found in the head-neck connecting piece in Ppih cKO mice (Fig. 3h) . To further explore the specific role of PPIH in motile cilium development, we also examined the 9+2 cilium structure by TEM. Consistent with the reduced motility of Ppih cKO sperm, the flagellum structure was disrupted, and the 9+2 microtubule structure of Ppih cKO mice was disorganized, along with disarrangements of the outer dense fibers, mitochondrial sheath, and axonemes (Fig. 3i) . Taken together, these results provide strong evidence that PPIH is essential for modulating sperm tail organization as well as sperm head development. Ppih knockout leads to alterations of the transcriptome in round spermatids. To gain further insight into the molecular basis for the spermatogenesis defects observed in Ppih cKO mice, we performed RNA-seq analyses of sorted round spermatids from adult mice. Compared with WT controls, RNA-Seq analysis detected 420 upregulated and 208 downregulated genes in Ppih cKO mice (Fig. 4a) . For the downregulated genes, Gene Ontology (GO) enrichment analysis revealed that their functions mainly involved in cilium development and lipid transport (Fig. 4b) . Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis further highlighted that genes relating to cell death regulation (apoptosis, necroptosis, and the Notch signaling pathway) were obviously increased in Ppih cKO mice (Fig. 4c) . To validate the RNA-Seq results, one or two of the genes relating to the aforementioned pathways or functions were checked by qPCR. Consistent with the RNA-Seq results (Fig. 4d) , qPCR confirmed that genes related to cell death and the Notch signaling pathway were significantly upregulated in Ppih cKO mice (Fig. 4e) , while genes associated with cilium organization and lipid transport were significantly downregulated in Ppih cKO mice (Fig. 4i) . To uncover the impact of these up/downregulated genes on cellular processes, we examined cell death and lipid content changes in the testes. TUNEL staining of testis paraffin sections showed that, compared with WT controls, more TUNEL-positive cells and seminiferous tubules were observed in Ppih cKO mice (Fig. 4f&g) . Moreover, TUNEL staining revealed that the positive signals mainly localized in elongated spermatids (Fig. 4f) , which may account for the reduced sperm count observed in Ppih cKO mice. Fluorescence-activated cell sorting (FACS) analysis further confirmed that a significant increased proportion of apoptotic cells were detected in the testes of Ppih cKO mice (Fig. 4h) . In addition to the downregulated genes, WB result concluded that the expression of lipid transport-related proteins (ACSL5 and DOCK5[51]) was reduced in Ppih cKO mice (Fig. 4j) . Staining of testicular cryosections with Oil Red O proved that lipid accumulation was reduced in elongated spermatids of Ppih cKO mice (Fig. 4k) . Taken together, these results indicated that PPIH plays an important role in regulating cilium organization and lipid transport. Deformed spermatids in Ppih cKO mice may be eliminated by apoptosis through the regulation of cell death-related processes. Loss of PPIH induces splicing defects in round spermatids. Given the truth that PPIH is a component of the U4/U6 snRNP and alternative splicing is one of the main mechanisms regulating gene expression, we then investigated whether RNA alternative splicing contributes to the gene expression disturbances observed in Ppih cKO mice. By analyzing aberrant alternative splicing events in Ppih cKO mice, a total of 321 alternative splicing events were identified in 286 genes. Five categories of alternative splicing (AS) events were affected, with exon skipping being the most frequent splicing alteration (61.37%) (Fig. 5a) . GO enrichment analysis revealed that the biological processes of genes with abnormal alternative splicing are involved in RNA splicing, spermatid development, and sperm motility (Fig. 5b) . Based on cellular component analysis, most of these genes are involved in cilium organization and sperm development, which is consistent with the downregulated genes observed in RNA-Seq (Fig. 5b) . To further confirm the existence of abnormal alternative splicing, we used RT-qPCR to verify the splicing of Ift88 [52] (skipped exon, SE), Tssk4 [53] (retained intron, RI), Sept4 [54] (alternative 5’ splice site, A5SS), and Rsrp1 [55] (alternative 3’ splice site, A3SS), which are known elements critical for motile cilium formation and RNA splicing. The results revealed that loss of Ppih leads to aberrant splicing events in the aforementioned genes (Fig. 5c& S3a) . Abnormal splicing may result in unusual transcripts, which are eliminated by nonsense-mediated mRNA decay (NMD) in eukaryotes[56, 57]. qPCR analysis confirmed that the mRNA levels of genes with abnormal alternative splicing were significantly reduced compared with those in WT mice (Fig. S3b) , and their protein abundances were also decreased in Ppih cKO mice (Fig. 5d) . IF analysis of WT and Ppih cKO testis sections with anti-TSSK4, anti-SEPT4, and anti-IFT88 antibodies further confirmed that their expression was downregulated in germ cells and spermatids (Fig. 5e&f) . Collectively, these data reveal that PPIH is required for regulating the alternative splicing of sperm motility genes, which, in turn, mediates their transcription and translation. PPIH participates in AS regulation by affecting spliceosome assembly To reveal the mechanism by which PPIH functions in alternative splicing regulation, we first examined whether PPIH affects the expression of other spliceosome components. WB analysis of protein expression in sorted germ cells from WT and Ppih cKO mice showed that PPIH deletion led to reduced expression of PRPF3, PRPF4, PRPF18, and DDX23 (all of which belong to the U4/U6/U5 tri-snRNP), whereas loss of PPIH had little effect on the expression of U5 snRNP-specific proteins (PRPF6 and PRPF8) or the U2 snRNP component SF3B1 (Fig. 5g) . These results are consistent with previous reports that loss of a spliceosome protein only affects the expression of limited part of snRNPs members[58]. It has been known that U1, U2, U4, and U5 snRNAs are exported to the cytoplasm after transcription and interact with Sm proteins to form the core U snRNP complexes[59, 60]. Considering the unique localization of PPIH, which both existed in nuclear and the cytoplasm, we then assessed whether PPIH also influences the assembly of the spliceosome. snRNP complexes were immunopurified using anti-DDX23 antibodies in the presence or absence of PPIH. Ppih knockdown substantially decreased the association of DDX23-associated U4/U6 snRNA particles with PRPF3 and PRPF4, and to a lesser extent with PRPF31. Interestingly, PPIH knockdown also impacted the interaction between DDX23 and the U5 snRNP-specific protein PRPF6, while the association with SF3B1 was not detectably affected (Fig. 5h) . Co-staining of DDX23 with these snRNP proteins and evaluating the overlap coefficient confirmed the decreased expression and colocalization of DDX23 and snRNP proteins in Ppih cKO mice compared with WT control (Fig. 5i&j) . Collectively, these results suggest that PPIH plays an integral role in regulating the expression of both U4/U6 di-snRNP and U5 snRNP particles, as well as the assembly of the U4/U6.U5 tri-snRNP. Based on the results obtained, we concluded that PPIH regulate the translation and structural rearrangement of the U4/U6.U5 tri-snRNP and alter the formation and/or stability of spliceosome intermediates, thereby impacting the dynamics and assembly of the spliceosome machinery. PPIH directly binds to the cilium development and the Ca 2+ ion channel-related mRNA To further study the target mRNA of PPIH, we performed linear amplification of complementary DNA ends and sequencing (LACE-seq)[61], a low-input method for global profiling of RNA-binding protein (RBP) target sites, to profile PPIH binding events in enriched spermatogonia. Annotation of LACE-Seq data identified a total of 2,192 transcripts that were significantly enriched in PPIH immunoprecipitants, with approximately 21% of targets located in intron regions (Fig. 6a) . PPIH-binding peaks in mouse spermatogonia were significantly enriched for UC/UG-rich consensus motifs, which are bound by the known RNA splicing factors PTBP1 or RBMXL12 [62-64] (Fig. 6b) . Concomitantly, GO enrichment analysis revealed that the functions of PPIH targets are mostly involved in cilium assembly, actin filament-based processes, and cell growth, which is concordant with the predominant phenotype observed in Ppih cKO mice (Fig. 6c) . The LACE-Seq results were furtherly validated by RIP-qPCR. We selected eight PPIH target mRNAs and confirmed that they were predominantly present in PPIH immunoprecipitants from WT testes (Fig. 6d) . To determine the effect of PPIH on the expression of the genes it binds, we measured the expression of target genes by qPCR and found that knocking out Ppih reduces their transcription (Fig. S3c) . Furthermore, we selected the newly identified cilium-related genes, Odf2 , and validated their downregulated expression by WB (Fig. 6e) . Outer dense fibre 2 (Odf2 or ODF2) is a cytoskeletal protein required for flagella-beating and transporting sperm cells from testes to the eggs[65, 66]. IF staining of testis sections with an ODF2 antibody demonstrated that PPIH participates in mediating ODF2 expression during sperm flagellum assembly (Fig. 6f) . To explore the relationship between the abnormal alternative splicing mRNA and PPIH target mRNA, we cross-analyzed LACE-Seq and AS data and found that 81 genes, which occurred aberrant alternative splicing, were directly bound by PPIH (Fig. 6g) . GO enrichment analysis showed that the overlapping genes are mainly related to the 9+2 motile cilium, nuclear speckles, and the CatSper complex (Fig. 6h) . CatSper is a sperm-specific ion channel that serves as the principal calcium channel in sperm, mediating calcium influx into the sperm flagellum and acting as an essential modulator of downstream fertilization-related mechanisms[67, 68]. Deeply analyzing the RNA-Seq we had, we found that Ppih and Ddx23 (a U5 snRNP component) are the only two significantly downregulated genes involved in alternative splicing (Fig. 4d) . As supporting evidence, we also performed LACE-Seq with anti-DDX23. There were 1,094 common mRNAs targeted by both PPIH and DDX23 (Fig. 6i) . GO enrichment analysis of these common target genes revealed that their main functions are indulged in cilium assembly/organization, motility, and GTPase-regulated activity (Fig. 6j) . There were 51 common genes shared among PPIH LACE-Seq data, DDX23 LACE-Seq data, and genes with abnormal AS (Fig. 6k) . We selected 4 of these genes for verification by RIP-qPCR, and all were highly enriched in PPIH precipitants; U2af1 , which was specifically bound by PPIH, was not enriched in DDX23 precipitants (Fig. 6l) . RT-PCR additionally confirm that these genes exhibited aberrant alternative splicing (Fig. 6m) , which leading to decreased gene transcription (Fig. 6n) . All together, these data suggest that PPIH participates in spermiogenesis by directly binding to mRNAs of cilium motility/ organization and Ca 2+ ion channel mRNA, influencing their expression by AS. Discussion In this study, by using a germ cell-specific Ppih knockout ( Ppih cKO) mouse model and integrating multi-omics analysis with cell biology experiments, we systematically elucidate the pivotal roles of peptidyl-prolyl cis-trans isomerase H (PPIH) in mouse spermatogenesis: 1) PPIH is indispensable for male mouse fertility; 2) PPIH is a member of spliceosome in mouse and essential for spliceosome assembly; 3) PPIH regulates spermiogenesis by mediating alternative splicing and participates in sperm flagellum formation by directly bind to the sperm motile cilium or cilium assembly related mRNA. As a member of the U4/U6 snRNP complex, the unique expression and localization patterns of PPIH in testicular tissues suggest its exceptional function. Unlike other spliceosome components that are dominantly localized in the nucleus in pachytene/diplotene spermatocytes, PPIH accumulates both in the nucleus and cytoplasm, maintaining high expression levels in metaphase II (MII) spermatocytes, round, and elongated spermatids. Considering the truth that the core U snRNPs are organized in the cytoplasm and reimport into nuclear to function[ 69 ], this differential characteristic of PPIH implies that it might perform specialized roles in spermiogenesis. IP-MS and co-immunoprecipitation experiments confirm that PPIH not only stably interacts with U4/U6 snRNP components (PRPF3, PRPF4, PRPF18)[ 39 ] but also binds to U2, U5 snRNP members, and molecular chaperones (Hspa5)[ 42 , 70 ], further indicating its multiple roles in spliceosome assembly and sperm structure formation. These findings are highly consistent with those observed in human cells that PPIH is indispensable for the splicing activity of U4/U6 snRNP complex[ 29 , 71 ], highlighting the evolutionarily conserved function of PPIH. Conditional knockout of Ppih in germ cells results in complete male mice infertility, and histological analyses reveal a significant reduction in the number of round and elongated spermatids within seminiferous tubules of Ppih cKO mice, decreased sperm concentration, and increased fragmentation in the epididymis, along with a markedly higher rate of sperm morphological abnormalities. Transmission electron microscopy and immunofluorescence staining further demonstrate that the absence of PPIH disrupts the ultrastructure of sperm heads and tails, causing disarray in the 9 + 2 microtubule doublets, dispersion of peripheral dense fibers, and mitochondrial reduction, all of which are critical for sperm motility[ 72 , 73 ]. Computer-assisted semen analysis (CASA) confirms a significant decrease in total sperm motility and progressive movement in Ppih cKO mice, directly confirming the causal relationship between sperm tail dysfunction and loss of fertility. Notably, the quantity and morphology of Sertoli cells (marked by SOX9)[ 46 ] and undifferentiated spermatogonia (marked by PLZF)[ 47 ] remain unaffected, indicating that the role of PPIH is specifically confined to spermiogenesis without apparent regulation on spermatogonia proliferation or meiotic progression, distinguishing it from the known splice factors like MRG15[ 74 ], DDX5[ 75 ] and PTBP2[ 22 ] that regulate mitosis-to-meiosis transition. The core mechanism by which PPIH regulates spermiogenesis lies in its control over snRNP components expression, spliceosome assembly, and alternative splicing. RNA-seq analysis shows that Ppih deficiency leads to 321 aberrant splicing events in 286 genes, with exon skipping (61.37%) being the predominant type. These differentially spliced genes are enriched in pathways related to cilia development, sperm motility, and RNA splicing. RT-qPCR validation confirms abnormal splicing of key sperm tail formation and RNA splicing genes ( Ift88, Tssk4, Sept4, Rsrp1 ), with significantly reduced mRNA and protein expression levels, suggesting that aberrant splicing products may be cleared through nonsense-mediated mRNA decay (NMD)[ 76 ]. Further mechanical investigations proved that PPIH deficiency selectively reduces the expression of U4/U6. U5 tri-snRNP components (PRPF3, PRPF4, PRPF18, DDX23) and disrupts the interaction between DDX23 and U4/U6 and U5 snRNPs, impeding spliceosome assembly. This selective regulatory feature aligns with previous observations where Prpf31 deficiency affects only certain snRNP components, suggesting that the stability of the spliceosome depends on specific component regulation[ 77 ]. PPIH ensures the integrity of the spliceosome and maintains its catalytic activity, thus regulating normal splicing of spermiogenesis-related genes. LACE-seq technology provides crucial evidence for PPIH’s direct regulatory role by identifying its target mRNAs. The study reveals that PPIH binds to 2192 transcripts, with 21% of binding sites located in intronic regions. The targets of mRNA of PPIH are significantly enriched in pathways related to flagellum assembly and actin filament processing. Cross-analysis of LACE-seq and aberrant splicing data identifies 81 genes directly regulated by PPIH, including sperm tail structural genes ( Odf2 ) and calcium channel genes ( Catsperg1, Catsperg2 )[ 78 , 79 ]. As sperm-specific calcium channels, the Catsper family mediates calcium influx essential for sperm capacitation and flagellar movement[ 80 ]. The abnormal alternative splicing of these mRNA likely impacts channel function, potentially exacerbating sperm motility defects in Ppih cKO mice. Additionally, PPIH shares 1094 target mRNAs with U5 snRNP component DDX23[ 81 ], which are concentrated in pathways related to cilium organization and GTPase regulation, suggesting a possible functional complex that cooperatively regulates sperm tail development, providing new clues about the collaborative roles of spliceosome subcomplexes in spermatogenesis. Beyond splicing regulation, PPIH also participates in lipid transport pathway regulation, expanding its functional dimensions. RNA-seq and Western blot experiments show significantly reduced expression of lipid transport-related proteins such as ACSL5 and DOCK5[ 51 ] in Ppih cKO mice, with Oil Red O staining confirming decreased lipid accumulation in elongated spermatids. Previous studies indicate that deficiencies in ACSL family members (e.g., ACSL3, ACSL6) lead to sperm morphological abnormalities and male infertility[ 82 , 83 ]. What’s more, the sperm phenotype of Ppih cKO mice closely resemble to ACSL6 knockout mice. This suggests that lipid metabolism disorders might be another critical cause of sperm defects due to PPIH deficiency. Moreover, the number of apoptotic cells in Ppih cKO mouse testes is significantly increased, primarily localized in elongated spermatids, suggesting that abnormal splicing and lipid metabolism defects collectively lead to malformed sperm being cleared via apoptosis, explaining the observed reduction in sperm numbers. In summary, our study reveals a critical and evolutionarily conserved role for PPIH in mediating RNA alternative splicing and underscores its essential function in maintaining sperm flagellum structural and functional integrity. However, there are some limitations in this research as well. Firstly, the mechanisms for why the deletion of PPIH only affects some components of snRNP are not known. Secondly, our study dominantly concentrated on the function of PPIH in alternative splicing; other potential functions of PPIH, like involving protein folding, which may also participate in spermiogenesis remained to be elucidated. Thirdly, considering the critical role of PPIH in controlling sperm flagellum assembly and male fertility, the pathological relationships between PPIH mutation and asthenozoospermia patients are not included in this study. Future study will focus on the detailed interaction between PPIH and spliceosome components, explore the role of its isomerase activity in spermatogenesis, and conduct clinical cohort studies to provide a theoretical basis for the diagnosis and treatment of male infertility. Materials and Methods Mice All mice were maintained under specific-pathogen-free conditions and approved by the Animal Care and Use Committee at Shandong University. The Ppih Floxed/Floxed ( Ppih fl/f l ) mice were purchased from Cyagen. Inc. The Ppih fl/f l mice were mated with Stra8-CreGFP transgenic mice [ 44 ] to obtain the mouse model with Ppih-specific deletion in the germ cell lines. The genotype of Ppih fl/fl Stra8-CreGFP was used as mutants and was referred to as Ppih cKO. The genotypes of Ppih fl/fl were used as the WT control. Genotyping of Ppih was performed by PCR of mouse tail genomic DNA with forward primer: 5-TGTATTGCAGAAACGATGCCAAG − 3, and reverse primer: 5- CTAGCAACGGTAACTAGCAAAGC − 3 were used to detect the wild-type allele (615 bp) and the floxed allele (467 bp). The Stra8-Cre was genotyped with forward primer (5- ACTCCAAGCACTGGGCAGAA-3) and reverse primer1 (5- GCCACCATAGCAGCATCAAA − 3) and 2(5- CGTTTACGTCGCCGTCCAG − 3), with the wild type allele being 240 bp and the insert allele being. The annealing temperature of all primers was 60℃. Fertility test For the Ppih cKO mouse lines (8–12 weeks), the fertility (pups/plugs) of three males and four females was tested. For male mice, each was housed with three WT females (8-week-old), and two Ppih cKO females were caged with a WT male mouse for 2 months. The presence of vaginal plugs and the number of offspring were counted every weekday. Histological analysis Testis and epididymis specimens were immersed in Bouin’s Fixative (HT10132, Sigma-Aldrich) overnight at room temperature. After gradual dehydration, specimens were embedded in a paraffin block and sliced into sections with a thickness of 5µm. Sections were dewaxed, stained with hematoxylin for 10 minutes and 1% eosin for 30 seconds, with a brief wash by tap water after each step. The sections were imaged with an Olympus BX53 microscope. Immunohistochemistry (IHC) and immunocytochemistry (ICC) For immunostaining, testes from control and Ppih cKO mice were isolated and fixed in 4% PFA overnight at 4℃. Dehydration and section were done as previous describe. After dewaxing and hydration, the sections were boiled in citrate antigen retrieval solution (0.01 M citric acid/sodium citrate, pH 6.0) for 15 mins in the boiling water. After free cooling to RT, the sections were washed with PBS (pH 7.4) three times and blocked with 3% BSA in PBS for 1 hr at RT. Then, the sections were incubated with the primary antibody diluted with 3% BSA overnight at 4℃. On the second day, the sections were washed with PBS three times and incubated with the secondary antibody diluted with 3% BSA for 1 hr at RT. After washing in PBS three times, the sections were mounted with Antifade Mounting Medium with DAPI (P0131, Eeyotime). The immunofluorescence staining was imaged with a laser scanning confocal microscope LSM880 (Leica, Germany). For ICC, spermatozoa and spermatids were spread onto slides and were air-dried before fixation with 4% PFA for 15min at room temperature. The slides were washed with PBS, blocked, probed with antibodies, and mounted as described in IHC. The antibodies used in IHC and ICC are listed in Supplementary List 1. RNA extraction and qRT-PCR Total RNA was extracted from whole testes or enriched cells using TRIzol™ Reagent (Cat: 15596018, Invitrogen) following the manufacturer’s instructions. 1 ug of total RNA was reverse-transcribed into cDNA using FastKing gDNA Dispelling RT SuperMix (Cat: KR118, Tiangen) according to the manufacturer’s protocol. qRT-PCR was performed using an 2× qPCR MasterMix (Cat: GKT211-03, Tiangen) on a LightCycler 480 instrument (Q7). Relative gene expression was analyzed based on the 2 − ΔΔCt method with Gapdh as an internal control. At least three independent experiments were analyzed. Primers were listed in Supplementary Table 2. Western blot (WB) WB was performed as previously described with a little modification[ 21 ]. The protein from testes, epidermal, or enriched cells was extracted by RIPK lysis buffer [1% Triton X-100, 50mM NaCl, 20mM Tris-HCl, 1× protease inhibitor cocktail (Cat:12352204, Rocher), 1mM PMSF (Cat: 10837091001, Merck), 1 mM DTT (Cat: R0861, Thermofisher)]. After incubating on ice for 15 min, the solution was centrifuged at 4°C, 12,000 rpm for 10 min. The supernatant was boiled at 95 for 10 min before used for immunoblotting analysis. The primary antibodies used in this study are indicated in Supplementary Table 1. Immunoprecipitation (IP) Magnetic bead-based IP was performed. Testes protein was extracted using NP40 lysis buffer (Cat: P0013F, Beyotime). Supernatant was equally used to IP using the Magnetic beads (Cat: HY-K0202, MEC). IP was carried out under the recommended protocol of the manufacturer. The IP product was subjected to immunoblotting or MS analyses. RNA sequencing FACE-sorted round and elongated spermatids were collected from control and Ppih cKO mice. The RNA-seq experiment was performed in three biological replications. Total RNA was isolated using the TRIzol™ Reagent (Cat: 15596018, Invitrogen) according to the manufacturer’s protocol and treated with DNase I (Cat: M0303S, NEB) to remove residual genomic DNA. A total amount of 1 µg of RNA per sample was used to prepare cDNA libraries generated using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) following the manufacturer’s instructions. 6 G base pairs (raw data) were generated by Illumina Novaseq 6000 for each cDNA library. The adaptor sequence and sequences with a high content of unknown bases or low-quality reads were removed to produce the clean reads used for bioinformatic analysis. Testes digestion and generation of cell suspensions Testes from adult mice were used to generate single-cell suspensions following enzymatic digestion as described previously[ 84 ]. In brief, testes were collected from WT control and Ppih cKO mice and the tunica albuginea. Then, the testes were digested with 5 ml collagenase I (Cat: 17100017, Thermofisher) for 6 min at 37°C. Gently passing the supernatant to a 40 µm pore size cell strainer, with about 1 ml solution remaining. Then, adding 4 ml PBS and 5 ml 0.25% trypsin/EDTA (Cat: 25200056, Thermofisher) for 8 min at 37°C, followed by the addition of 0.5 ml 10% FBS (Cat: 16000044, Thermofisher). Single-cell suspensions were made by gently repeated pipetting and passed through a 40-µm pore size cell strainer. The cells are centrifuged at 500 g for 5 min at 4°C and resuspended with 2 ml DMEM (Cat: 10-017-CM, Corning) for FACS selection. Linear amplification of complementary DNA ends and sequencing PPIH and DDX23 LACE-seq were performed based on a previously described protocol with some modifications[ 61 ]. Briefly, testes cells were collected into 1.5 ml microcentrifuge tubes with 5 µl of 1×PBS (pH 7.4). The cells were irradiated twice with 0.40 J cm − 2 UV light (254 nm) in a CL-1000 ultraviolet crosslinker (UVP). 10 µl of protein A/G magnetic beads were washed twice with BSA/PBS solution. and incubated with 200 µl blocking buffer at RT for 1 hr. After washing the blocked beads, 5 µg PPIH, DDX23 antibody, or IgG were added and incubated at RT for 1 h. The antibody-coupled beads were washed twice, and cross-linked samples were added after lysed on ice. After removal of genomic DNA, 10 µl of antibody-coupled beads were added to the lysate and incubated at 4°C overnight. Bead-bound antibody-RNA complexes were then washed twice, and the immunoprecipitated RNAs were fragmented with micrococcal nuclease for 3 min at 37°C. The RNA 3’ ends were dephosphorylated on beads with FastAP alkaline phosphatase. After washing, the 3’ linker was ligated with T4 RNA ligase 2 for 2.5 hr at RT. RNA was reverse transcribed with Superscript II reverse transcriptase. First-strand cDNA was released from Protein A/G beads by treatment with RNase H and captured by streptavidin C1 beads. The cDNA 3’ linker was ligated with T4 RNA ligase 1 overnight at RT. Then, cDNA was pre-amplified using KAPA HiFi HotStart ReadyMix, and PCR products were purified with Ampure XP beads. After in vitro transcription, RNA was purified with Agencourt RNA Clean beads. After reverse transcription and indexed PCR, the PCR products were size-selected on a 2% agarose gel, and regions corresponding to 250–500 bp were purified using the Gel Extraction Kit. The LACE-seq library was paired-end sequenced using Illumina NovaSeq 6000 at Novogene. Differential splicing analysis and validation Differential splicing events of RNA-seq data were analyzed using rMATS software with the standard protocol[ 85 ]. The rMATS software can identify the five common modes of AS events and obtain accurate splicing change quantification between WT and Ppih cKO samples. We used p < 0.05 and |ΔPSI |>0.1 as the threshold to filter for significantly differential splicing events. For differential splicing events validation, we first imported the differentially spliced sites of interesting functional genes analyzed by rMATS into the integrative genomics viewer tool to efficiently and flexibly visualize and explore spliced sites between WTand Ppih cKO samples. The primers for differentially spliced exons were designed using Primer5. Primers were designed within constitutive exons flanking the differentially spliced exons. Standard PCR for analysis by gel electrophoresis was performed according to the manufacturer’s instructions and visualized by running on a 2% agarose gel. All primers were listed in Supplementary Table 2 . Statistical analysis All experiments were performed at least three times. At least three independent biological samples were collected for the quantitative experiments. Quantification of positively stained cells was performed from at least three independent fields of view. Paired two-tailed Student’s t-test was used for statistical analysis, and data were presented as mean ± SEM. * Represent p < 0.05, ** represent p < 0.01 and *** represent p < 0.001. p < 0.05 was considered a significant difference level. Equal variances were not formally tested. No statistical method was used to predetermine sample sizes. Declarations Availability of data and materials All data generated or analysed during this study are included in this published article, its supplementary information files and publicly available repositories. The RNA-seq and LACE-seq data were deposited in GEO (https:// www. ncbi. nlm.nih. gov/ geo/). The individual data values for Figs.1, 4, 5, and 6 are provided in Additional Excels. Acknowledgements We thank Tao Yan and Xiao Luo for doing some FACE and Cryostat Sectioning experiments. We appreciate the experimental discussion with Wencheng Zhu. Additionally, we appreciate the support provided by the Translational Medicine Core Facility of Shandong University for consultation and instrument use. Funding This work was supported by the Science Foundation for Young Scholars of Shandong (ZR2024QH543 ); the National Natural Science Foundation of China (82495190, 82371618); the National Key Research and Development Program of China (2024YFC2706804); the Taishan Scholars Program of Shandong Province（tsqn202408397）. Author contributions Conceptualization, Q. Z and T.H; Experimental Q.Z., Z.Q.W., K.S.G and B.Y.L; Formal analysis, Q. Z., X.Y.W and S.Y. W, C.Q.H; IP-MS was done by Q.Z., S.H.J; Supervision, T.H, and H.B.L; Funding acquisition, Q.Z and T.H; Manuscript preparation, Q. Z and T.H., with the assistance of the other authors. All authors reviewed and approved the final manuscript. Competing interests The authors declare no competing interests References Lohan, M., et al., Global research priority-setting exercise on the sexual and reproductive health and rights of young adolescents. Lancet Child & Adolescent Health, 2025. 9 (10): p. 724-734. Eisenberg, M.L., et al., Male infertility. Nature Reviews Disease Primers, 2023. 9 (1). Jiao, S.Y., Y.H. Yang, and S.R. Chen, Molecular genetics of infertility: loss-of-function mutations in humans and corresponding knockout/mutated mice. Human Reproduction Update, 2021. 27 (1): p. 154-189. SassoneCorsi, P., Transcriptional checkpoints determining the fate of male germ cells. Cell, 1997. 88 (2): p. 163-166. Salicioni, A.M., et al., Testis-specific serine kinase protein family in male fertility and as targets for non-hormonal male contraception. Biology of Reproduction, 2020. 103 (2): p. 264-274. Struijk, R.B., et al., Simultaneous Purification of Round and Elongated Spermatids from Testis Tissue Using a FACS-Based DNA Ploidy Assay. Cytometry Part A, 2019. 95a (3): p. 309-313. Zhang, X.G., et al., CEP112 coordinates translational regulation of essential fertility genes during spermiogenesis through phase separation in humans and mice. Nature Communications, 2024. 15 (1). Bettegowda, A. and M.F. Wilkinson, Transcription and post-transcriptional regulation of spermatogenesis. Philosophical Transactions of the Royal Society B-Biological Sciences, 2010. 365 (1546): p. 1637-1651. Zhu, T.Y., et al., Stage-Resolved Phosphoproteomic Landscape of Mouse Spermiogenesis Reveals Key Kinase Signaling in Sperm Morphogenesis. Advanced Science, 2025. 12 (44). MacLean, J.I.I. and M.F. Wilkinson, Gene regulation in spermatogenesis. Current Topics in Developmental Biology, Vol 71, 2005. 71 : p. 131-+. Zhao, Y.Q., et al., Dynamic transcription and expression patterns of KIF3A and KIF3B genes during spermiogenesis in the shrimp, Palaemon carincauda. Animal Reproduction Science, 2017. 184 : p. 59-77. Tanaka, H. and T. Baba, Gene expression in spermiogenesis. Cellular and Molecular Life Sciences, 2005. 62 (3): p. 344-354. Marasco, L.E. and A.R. Kornblihtt, The physiology of alternative splicing. Nature Reviews Molecular Cell Biology, 2023. 24 (4): p. 242-254. Shi, Y.G., Mechanistic insights into precursor messenger RNA splicing by the spliceosome. Nature Reviews Molecular Cell Biology, 2017. 18 (11): p. 655-670. Adams, B.M., et al., Nuclear cyclophilins affect spliceosome assembly and function. Biochemical Journal, 2015. 469 : p. 223-233. Shi, Y.G., The Spliceosome: A Protein-Directed Metalloribozyme. Journal of Molecular Biology, 2017. 429 (17): p. 2640-2653. Lerner, M.R., et al., Are Snrnps Involved in Splicing. Nature, 1980. 283 (5743): p. 220-224. Hinterberger, M., I. Pettersson, and J.A. Steitz, Isolation of Small Nuclear Ribonucleoproteins Containing U1, U2, U4, U5, and U6 Rnas. Journal of Biological Chemistry, 1983. 258 (4): p. 2604-2613. Wang, E.T., et al., Alternative isoform regulation in human tissue transcriptomes. Nature, 2008. 456 (7221): p. 470-476. Liu, W.B., et al., BCAS2 is involved in alternative mRNA splicing in spermatogonia and the transition to meiosis. Nature Communications, 2017. 8 . Wang, S.Y., et al., CWF19L2 is Essential for Male Fertility and Spermatogenesis by Regulating Alternative Splicing. Journal of Urology, 2025. 213 (4). Hannigan, M.M., L.L. Zagore, and D.D. Licatalosi, Ptbp2 Controls an Alternative Splicing Network Required for Cell Communication during Spermatogenesis. Cell Reports, 2017. 19 (12): p. 2598-2612. Liu, W.B., et al., SRSF10 is essential for progenitor spermatogonia expansion by regulating alternative splicing. Elife, 2022. 11 . Wang, Y.X., et al., PTBP1 mediates Sertoli cell actin cytoskeleton organization by regulating alternative splicing of actin regulators. Nucleic Acids Research, 2024. 52 (20): p. 12244-12261. Park, S., et al., Suppression of regulates pluripotency, proliferation, and differentiation in mouse embryonic stem cells. Cell Biochemistry and Function, 2019. 37 (8): p. 608-617. Wu, H., et al., Major spliceosome defects cause male infertility and are associated with nonobstructive azoospermia in humans. Proceedings of the National Academy of Sciences of the United States of America, 2016. 113 (15): p. 4134-4139. Ma, S.S., et al., Molecular Basis for Hormone Recognition and Activation of Corticotropin-Releasing Factor Receptors. Molecular Cell, 2020. 77 (3): p. 669-+. Rassow, J., et al., Cyclophilin-20 Is Involved in Mitochondrial Protein-Folding in Cooperation with Molecular Chaperones Hsp7o and Hsp60. Molecular and Cellular Biology, 1995. 15 (5): p. 2654-2662. Teigelkamp, S., et al., The 20kD protein of human [U4/U6.U5] tri-snRNPs is a novel cyclophilin that forms a complex with the U4/UG-specific 60kD and 90kD proteins. Rna, 1998. 4 (2): p. 127-141. Ingelfinger, D., et al., Two protein-protein interaction sites on the spliceosome-associated human cyclophilin CypH. Nucleic Acids Research, 2003. 31 (16): p. 4791-4796. Soumillon, M., et al., Cellular Source and Mechanisms of High Transcriptome Complexity in the Mammalian Testis. Cell Reports, 2013. 3 (6): p. 2179-2190. Zuo, H.Y., et al., Transcriptomic Variation during Spermiogenesis in Mouse Germ Cells. Plos One, 2016. 11 (11). Song, H.B., et al., The Function of Pre-mRNA Alternative Splicing in Mammal Spermatogenesis. International Journal of Biological Sciences, 2020. 16 (1): p. 38-48. Jiang, N., et al., The Intricate Functional Networks of Pre-mRNA Alternative Splicing in Mammalian Spermatogenesis. International Journal of Molecular Sciences, 2024. 25 (22). Beusch, I. and H.D. Madhani, Understanding the dynamic design of the spliceosome. Trends in Biochemical Sciences, 2024. 49 (7): p. 583-595. Chen, Y., et al., Single-cell RNA-seq uncovers dynamic processes and critical regulators in mouse spermatogenesis. Cell Research, 2018. 28 (9): p. 879-896. Wan, R.X., et al., The 3.8 Å structure of the U4/U6.U5 tri-snRNP: Insights into spliceosome assembly and catalysis. Science, 2016. 351 (6272): p. 466-475. Chen, Z., et al., Identification of a 35S U4/U6.U5 tri-small nuclear ribonucleoprotein (tri-snRNP) complex intermediate in spliceosome assembly. Journal of Biological Chemistry, 2017. 292 (44): p. 18113-18128. Reidt, U., et al., Crystal structure of a complex between human spliceosomal cyclophilin H and a U4/U6 snRNP-60K peptide. Journal of Molecular Biology, 2003. 331 (1): p. 45-56. Burns, W., et al., Syndromic neurodevelopmental disorder associated with de novo variants in. American Journal of Medical Genetics Part A, 2021. 185 (10): p. 2863-2872. Xiong, X.X., et al., hnRNPC Functions with HuR to Regulate Alternative Splicing in an m6A-Dependent Manner and is Essential for Meiosis. Advanced Science, 2025. 12 (13). Wang, J., et al., Gene encoding Hsp70 chaperone BiP in the endoplasmic reticulum. Gene, 2017. 618 : p. 14-23. Skarnes, W.C., et al., A conditional knockout resource for the genome-wide study of mouse gene function. Nature, 2011. 474 (7351): p. 337-U361. Lin, Z., et al., Mettl3-/Mettl14-mediated mRNA-methyladenosine modulates murine spermatogenesis. Cell Research, 2017. 27 (10): p. 1216-1230. Cheng, F.P., et al., Use of peanut agglutinin to assess the acrosomal status and the zona pellucida-induced acrosome reaction in stallion spermatozoa. Journal of Andrology, 1996. 17 (6): p. 674-682. Fröjdman, K., V.R. Harley, and L.J. Pelliniemi, Sox9 protein in rat Sertoli cells is age and stage dependent. Histochemistry and Cell Biology, 2000. 113 (1): p. 31-36. Buaas, F.W., et al., Plzf is required in adult male germ cells for stem cell self-renewal. Nature Genetics, 2004. 36 (6): p. 647-652. Turner, R.M., Moving to the beat: a review of mammalian sperm motility regulation. Reproduction Fertility and Development, 2006. 18 (1-2): p. 25-38. Freitas, M.J., S. Vijayaraghavan, and M. Fardilha, Signaling mechanisms in mammalian sperm motility. Biology of Reproduction, 2017. 96 (1): p. 2-12. Janke, C. and M.M. Magiera, The tubulin code and its role in controlling microtubule properties and functions. Nature Reviews Molecular Cell Biology, 2020. 21 (6): p. 307-326. Shinoda, T., et al., Conformational alteration of DOCK5•ELMO1 signalosome on lipid membrane. Communications Biology, 2025. 8 (1). San Agustin, J.T., G.J. Pazour, and G.B. Witman, Intraflagellar transport is essential for mammalian spermiogenesis but is absent in mature sperm. Molecular Biology of the Cell, 2015. 26 (24): p. 4358-4372. Wang, X.L., et al., Tssk4 is essential for maintaining the structural integrity of sperm flagellum. Molecular Human Reproduction, 2015. 21 (2): p. 136-145. Jannatifar, R., et al., The correlation of Septin4 gene expression with sperm quality, DNA damage, and oxidative stress level in infertile patients. Anatomy & Cell Biology, 2023. 56 (4): p. 518-525. Li, Y.M., et al., Spliceosome-regulated RSRP1-dependent NF-κB activation promotes the glioblastoma mesenchymal phenotype. Neuro-Oncology, 2021. 23 (10): p. 1693-1708. Kamps-Hughes, N., et al., A Systematic Method for Detecting Abnormal mRNA Splicing and Assessing Its Clinical Impact in Individuals Undergoing Genetic Testing for Hereditary Cancer Syndromes. Journal of Molecular Diagnostics, 2023. 25 (3): p. 156-167. Frischmeyer, P.A., et al., An mRNA surveillance mechanism that eliminates transcripts lacking termination codons. Science, 2002. 295 (5563): p. 2258-2261. Mathew, R., et al., Phosphorylation of human PRP28 by SRPK2 is required for integration of the U4/U6-U5 tri-snRNP into the spliceosome. Nature Structural & Molecular Biology, 2008. 15 (5): p. 435-443. Duchemin, A., et al., DHX15-independent roles for TFIP11 in U6 snRNA modification, U4/U6.U5 tri-snRNP assembly and pre-mRNA splicing fidelity. Nature Communications, 2021. 12 (1). Morris, G.E., The Cajal body. Biochimica Et Biophysica Acta-Molecular Cell Research, 2008. 1783 (11): p. 2108-2115. Su, R.B., et al., Global profiling of RNA-binding protein target sites by LACE-seq. Nature Cell Biology, 2021. 23 (6): p. 664-+. Han, A., et al., Prediction of PTBP1 Binding and Splicing Targets Reveals Unexpected Features of Its RNA Recognition and Function. Plos Computational Biology, 2014. 10 (1). Peart, N.J., et al., The germ cell-specific RNA binding protein RBM46 is essential for spermatogonial differentiation in mice. Plos Genetics, 2022. 18 (9). Ehrmann, I., et al., An ancient germ cell-specific RNA-binding protein protects the germline from cryptic splice site poisoning. Elife, 2019. 8 . Ito, C., et al., haploinsufficiency causes a new type of decapitated and decaudated spermatozoa, Odf2-DDS, in mice. Scientific Reports, 2019. 9 . Wang, X.L., et al., Testis-specific serine/threonine protein kinase 4 (Tssk4) phosphorylates Odf2 at Ser-76. Scientific Reports, 2016. 6 . Rahban, R. and S. Nef, CatSper: The complex main gate of calcium entry in mammalian spermatozoa. Molecular and Cellular Endocrinology, 2020. 518 . Swain, D.K., et al., The essential calcium channel of sperm CatSper is temperature-gated. Nature Communications, 2025. 16 (1). Paushkin, S., et al., The SMN complex, an assemblyosome of ribonucleoproteins. Current Opinion in Cell Biology, 2002. 14 (3): p. 305-312. Hu, C., et al., Heat shock proteins: Biological functions, pathological roles, and therapeutic opportunities. Medcomm, 2022. 3 (3). Davis, T.L., et al., Structural and Biochemical Characterization of the Human Cyclophilin Family of Peptidyl-Prolyl Isomerases. Plos Biology, 2010. 8 (7). Breitbart, H. and M. Finkelstein, Actin cytoskeleton and sperm function. Biochemical and Biophysical Research Communications, 2018. 506 (2): p. 372-377. Yogo, K., Molecular basis of the morphogenesis of sperm head and tail in mice. Reproductive Medicine and Biology, 2022. 21 (1). Iwamori, N., et al., MRG15 is required for pre-mRNA splicing and spermatogenesis. Proceedings of the National Academy of Sciences of the United States of America, 2016. 113 (37): p. E5408-E5415. Legrand, J.M.D., et al., DDX5 plays essential transcriptional and post-transcriptional roles in the maintenance and function of spermatogonia. Nature Communications, 2019. 10 . Brogna, S. and J.K. Wen, Nonsense-mediated mRNA decay (NMD) mechanisms. Nature Structural & Molecular Biology, 2009. 16 (2): p. 107-113. Makarova, O.V., et al., Protein 61K, encoded by a gene () linked to autosomal dominant retinitis pigmentosa, is required for U4/U6•U5 tri-snRNP formation and pre-mRNA splicing. Embo Journal, 2002. 21 (5): p. 1148-1157. Wang, H.K., et al., A Novel, Single, Transmembrane Protein CATSPERG Is Associated with CATSPER1 Channel Protein. Biology of Reproduction, 2009. 81 (3): p. 539-544. Luo, T., et al., A novel copy number variation in CATSPER2 causes idiopathic male infertility with normal semen parameters. Human Reproduction, 2019. 34 (3): p. 414-+. Hwang, J.Y., Analysis of Ca-mediated sperm motility to evaluate the functional normality of the sperm-specific Ca channel, CatSper. Frontiers in Cell and Developmental Biology, 2024. 12 . Zhao, C., et al., Splicing Factor DDX23, Transcriptionally Activated by E2F1, Promotes Ovarian Cancer Progression by Regulating FOXM1. Frontiers in Oncology, 2021. 11 . Hale, B.J., et al., Acyl-CoA synthetase 6 enriches seminiferous tubules with the ?-3 fatty acid docosahexaenoic acid and is required for male fertility in the mouse. Journal of Biological Chemistry, 2019. 294 (39): p. 14394-14405. Collodel, G., et al., Relevance of Fatty Acids to Sperm Maturation and Quality. Oxidative Medicine and Cellular Longevity, 2020. 2020 . Gaysinskaya, V., et al., Optimized flow cytometry isolation of murine spermatocytes. Cytometry Part A, 2014. 85a (6): p. 556-565. Wang, Y.Y., et al., rMATS-turbo: an efficient and flexible computational tool for alternative splicing analysis of large-scale RNA-seq data. Nature Protocols, 2024. 19 (4). Additional Declarations No competing interests reported. Supplementary Files Additonalfile1.zip Supplementary.docx Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 05 May, 2026 Reviews received at journal 30 Apr, 2026 Reviews received at journal 23 Apr, 2026 Reviewers agreed at journal 23 Apr, 2026 Reviewers agreed at journal 20 Apr, 2026 Reviewers agreed at journal 19 Apr, 2026 Reviewers invited by journal 18 Apr, 2026 Editor assigned by journal 27 Mar, 2026 Submission checks completed at journal 27 Mar, 2026 First submitted to journal 26 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-9239117\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":628431322,\"identity\":\"596b5b93-343e-4e6a-b144-0920ca1319a4\",\"order_by\":0,\"name\":\"Qun Zhao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Women, Children and Reproductive Health, Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Qun\",\"middleName\":\"\",\"lastName\":\"Zhao\",\"suffix\":\"\"},{\"id\":628431323,\"identity\":\"d81ef03b-d255-40fa-9e3c-557791924e5d\",\"order_by\":1,\"name\":\"Ziqi Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Ultrasound, Qilu Hospital of Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ziqi\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":628431325,\"identity\":\"4d0c6525-4d56-45c2-90ac-8c1c44633122\",\"order_by\":2,\"name\":\"Kang Shangguan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Women, Children and Reproductive Health, Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Kang\",\"middleName\":\"\",\"lastName\":\"Shangguan\",\"suffix\":\"\"},{\"id\":628431326,\"identity\":\"a1e2566f-57a1-4a88-9266-a1f640103fc0\",\"order_by\":3,\"name\":\"Biyun Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Women, Children and Reproductive Health, Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Biyun\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":628431328,\"identity\":\"fbf2751e-cae7-4f92-96a8-dbcb122597ef\",\"order_by\":4,\"name\":\"Xinyue Wu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Department of Reproductive Endocrinology, Women's Hospital, School of Medicine, Zhejiang University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xinyue\",\"middleName\":\"\",\"lastName\":\"Wu\",\"suffix\":\"\"},{\"id\":628431331,\"identity\":\"ff016944-2235-4588-9233-5e74260f3ef9\",\"order_by\":5,\"name\":\"Shiyu Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Center for Reproductive Medicine, The First Affiliated Hospital of Zhengzhou University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shiyu\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":628431332,\"identity\":\"fe0f49e3-33d6-4a3a-ba56-c6a048f8649c\",\"order_by\":6,\"name\":\"Chengqi Huang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Women, Children and Reproductive Health, Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chengqi\",\"middleName\":\"\",\"lastName\":\"Huang\",\"suffix\":\"\"},{\"id\":628431333,\"identity\":\"a509d885-ac81-4899-a088-f35b2913436e\",\"order_by\":7,\"name\":\"Shuhui Ji\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"State Key Laboratory of Medical Proteomics, Beijing Proteome Research Center, National Center for Protein Sciences (Beijing), Beijing Institute of Lifeomics\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Shuhui\",\"middleName\":\"\",\"lastName\":\"Ji\",\"suffix\":\"\"},{\"id\":628431334,\"identity\":\"12895b3f-5044-4c21-8247-d7fc5a37d7b0\",\"order_by\":8,\"name\":\"Tao Huang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Institute of Women, Children and Reproductive Health, Shandong University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tao\",\"middleName\":\"\",\"lastName\":\"Huang\",\"suffix\":\"\"},{\"id\":628431337,\"identity\":\"f787ab81-0ada-43c0-945c-38a84c017076\",\"order_by\":9,\"name\":\"Hongbin Liu\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYBACAyBmBpMMCQwHGGxsGPiYSdOSlsbARpwWBogWBoa0wwxshBxmzt57+HVBwR0G+fYcw8M8Cefl2dh5zKQLGOzkdBuwa7HsOZdmPcPgGYPBmTcGQC23DduYgVpmMCQbmx3A4bAbOWbGPAaHGQwkcgwOzvxxmxGshYfhQOI2QlrkZwC1zEg4Z0+MFuPHIC0MN3IMDnxIOJBIWMuZM2bMM0AOO/OsAKglObmNma3YmscAj1+O9xh/LvgDdFh78uYPCQl2tv38hzfe5qmwk8OlBQjYJIBEfQNCgMMAEl+4AfMHNAH2B3jVj4JRMApGwYgDAIayWCQ5wdKSAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Institute of Women, Children and Reproductive Health, Shandong University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Hongbin\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2026-03-27 02:23:26\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-9239117/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-9239117/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":107927123,\"identity\":\"0c6ee968-27bf-4005-bffd-72a5ea0802b0\",\"added_by\":\"auto\",\"created_at\":\"2026-04-27 15:55:50\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":817346,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ePPIH is greatly expressed during spermiogenesis and interplays with multiple spliceosome components\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFigure 1. PPIH is associated with multiple components of the spliceosome. \\u003c/strong\\u003ea. The expression of spliceosome components at different aged mice. b. The protein levels of different spliceosome members are dynamic change during spermatogenesis. c. Localization of different snRNP proteins in adult mouse testes. d. Immunohistochemistry presentation of PPIH and γH2A.X in adult testes. e. Nuclear and cytosolic dissociation of the testis indicated that PPIH was localized in both in nuclear and the cytosol. f. The expression of PPIH in multiple tissues of adult mice. g. Immunoprecipitation indicated that PPIH interacted with the U4/U6 snRNP subunits in mouse testes. i. PPIH immunoprecipitation plus mass spectrum observed some candidates associated with PPIH; the red box highlights the proteins belonging to the spliceosome. j. PPIH immunoprecipitation further validated the IP-MS results. k. PPIH colocalized with PRPF31, and SF3B1 further proved the IP-MS result as well as the fact that PPIH is a component of the spliceosome in mouse testes. The qPCR and WB experiments are repeated three times.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9239117/v1/df055e62b0de2134dc1c88f9.png\"},{\"id\":108006681,\"identity\":\"5200c6f7-facd-4acf-9346-13719ad5fc2a\",\"added_by\":\"auto\",\"created_at\":\"2026-04-28 12:56:26\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":991320,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ePPIH is required for mouse spermiogenesis. \\u003c/strong\\u003ea. Schematic representation of the\\u003cem\\u003e Ppih \\u003c/em\\u003egene deletion strategy. Exons 5 and 6 of \\u003cem\\u003ePpih\\u003c/em\\u003e were removed using a \\u003cem\\u003eCre-LoxP\\u003c/em\\u003e-based gene knockout method. b. \\u003cem\\u003ePpih\\u003c/em\\u003e levels in \\u003cem\\u003ePpih \\u003c/em\\u003e\\u003csup\\u003e\\u003cem\\u003efl/fl\\u003c/em\\u003e\\u003c/sup\\u003e\\u003cem\\u003e \\u003c/em\\u003e(WT) and\\u003cem\\u003e Ppih \\u003c/em\\u003e\\u003csup\\u003e\\u003cem\\u003efl/fl\\u003c/em\\u003e\\u003c/sup\\u003e\\u003cem\\u003e Stra8 -CreGFP \\u003c/em\\u003e(\\u003cem\\u003ePpih \\u003c/em\\u003ecKO) mouse testes. c. WB proved that PPIH was sharply reduced in \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice testes. GAPDH served as a loading control. d. IF suggests that full PPIH deletion in germ cells. e. The body weight of littermate WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice (5 mice were included). f. Quantification of fertility from WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO male and female mice (n = 4 independent experiments). g. The morphology of mouse testes and epididymis from WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice. h. Ratio of body and testes weight of WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice (n = 6 independent experiments). i. Hematoxylin and eosin (H\\u0026amp;E) staining of the testes and caudal epididymis in WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice\\u003cem\\u003e. \\u003c/em\\u003eArrows indicate abnormalities in round spermatids and sperm flagella. k. Counting of motile spermatozoa in WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice (n = 4 independent experiments); l. Immunofluorescence staining of peanut agglutinin (PNA, green) and DAPI (blue) in testis sections of WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice to categorize the 12 stages of seminiferous tubules. m. Flow cytometric analysis of Hoechst testicular single-cell suspension to isolate meiotic prophase I substage. n. Quantification of the Leptotene (L) and Zygotene (Z) substages, Pachytene(P) and Diplotene (D) substages, and haploid spermatids (n = 5 independent experiments).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9239117/v1/48307eb6dda0a4b887b6dbe0.png\"},{\"id\":108006888,\"identity\":\"a3cfd7f1-6c31-4420-86e4-3316e1440257\",\"added_by\":\"auto\",\"created_at\":\"2026-04-28 12:57:49\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":756726,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ePPIH is required for spermatozoa biogenesis.\\u003c/strong\\u003ea. Morphological presentation of sperm obtained from WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mouse caudal epididymides. b. Percentage of abnormal sperm (as shown in A). More than 100 sperm from 3 males were examined. c\\u0026amp;d. Quantification of motile and progressively motile spermatozoa in WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice (n = 5 independent experiments). e. Immunofluorescence staining of β-tubulin (Green) and DAPI (blue) in testis sections of WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice. f. The whole protein extracts of WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO testes were subjected to a western blot to examine β-tubulin(marker of sperm tail), and GAPDH served as a loading control. g. IF presentation of β-tubulin(Green), PNA (red), and DAPI (blue) in sperm. Arrows position of the sperm head. h. SEM images of WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO spermatozoa heads. i. Longitudinal sections in the sperm head and neck region ultrastructure. The arrows show the loss of mitochondria in the mid-piece and the structural defects in the head-neck connecting region. j. Cross sections of the middle piece, principal piece, and end piece of WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO sperm tail showed that abnormal mitochondria, loss of outer dense fibers, and disorganized 9+2 structure existed in \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice (white arrows).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9239117/v1/94f7e20a280c2c9262669b03.png\"},{\"id\":107927041,\"identity\":\"c1d6beca-1b82-4b28-aadc-df217f46177d\",\"added_by\":\"auto\",\"created_at\":\"2026-04-27 15:55:28\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":678396,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cem\\u003e\\u003cstrong\\u003ePpih\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003eknockout leads to alterations of the transcriptome in round spermatids. \\u003c/strong\\u003ea. Volcano plot of differentially expressed genes (DEGs) identified by RNA-seq in round spermatids from WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice. b. Gene Ontology (GO) enrichment analysis of down-regulated DEGs highlights significant involvement in biological processes and cellular components. c. KEGG pathway enrichment analysis of DEGs highlights the up regulated related to apoptosis, PI3K-AKT, and Notch pathway. d. Heatmaps depicting expression patterns of key proteins in the DEGs. Color intensity represents relative expression levels. e. The transcription of upregulated genes was measured by qPCR using the cDNA from the round spermatids of WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice. f. TUNEL stain of the testes section from WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice indicated that losing \\u003cem\\u003ePpih \\u003c/em\\u003eleads to cell go to apoptosis. The red circle indicated the elongated spermatids. g. Counting the number of apoptotic cells in each TUNEL-positive seminiferous tubule and the percentage of TUNEL-positive tubules. A total of 30 seminiferous tubules from 3 mice were included. k. FACE analysis of the PI and TUNEL-stained single cell of WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO testes revealed that missing \\u003cem\\u003ePpih\\u003c/em\\u003eleads to increased apoptosis. i. The transcription of downregulated genes was measured by qPCR. j. Representative western blots showing decreased lipid transport protein expression in \\u003cem\\u003ePpih \\u003c/em\\u003ecKO round spermatids compared with WT; GAPDH served as a loading control. k. Oil red O stain on the sections of seminiferous tubules and quantitative data indicated that lipid abundance was decreased in \\u003cem\\u003ePpih \\u003c/em\\u003ecKO testes. Representative of 20 seminiferous tubules for each group and the mean was estimated.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9239117/v1/7ad9636bd51646fe2b6a3873.png\"},{\"id\":107927164,\"identity\":\"6bc67b44-0481-46a5-9806-dc33bb09f68f\",\"added_by\":\"auto\",\"created_at\":\"2026-04-27 15:56:06\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":907878,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eLoss of PPIH induces splicing defects and alters spliceosome assembly. \\u003c/strong\\u003ea. Five alternative splicing (AS) events significantly affected by \\u003cem\\u003ePpih\\u003c/em\\u003edepletion in the round spermatids. Pie charts showing the distribution of regulated splicing events among different splicing types in \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice versus WT control. The number of predicted AS events and genes in each category is indicated. b. GO enrichment analysis for genes with the abnormal splicing shows significant involvement in biological processes and cellular components related to RNA splicing, cilium movement, 9+2 motile cilium, and sperm flagellum, respectively. c. RT-PCR analyses alternative splicing for sperm motility, sperm flagellum, and 9+2 motile cilium (\\u003cem\\u003eRsrp1, Sept4, Ift88, Tssk4\\u003c/em\\u003e) genes between WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO round spermatids. Visualization of the differentially spliced genes is shown using the Integrative Genomics Viewer (IGV). d. Western blots showing decreased protein expression of the abnormal splicing genes in \\u003cem\\u003ePpih \\u003c/em\\u003ecKO round spermatids compared with WT; GAPDH served as a loading control. e. Immunofluorescence on testes obtained from WT and\\u003cem\\u003e Ppih \\u003c/em\\u003ecKO mice with an anti-TSSK4, SEPT4, IFT88, and γH2A.X antibody. f. IF further confirm the down expression of TSSK4 in \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mature sperm. g. WB analysis of the spliceosome components and GAPDH protein levels in adult testes from WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice; GAPDH served as a loading control. h. Immunoprecipitation (IP) with anti-DDX23 antibody and control IgG using adult WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mouse testes. Immunoprecipitations were blotted with the indicated antibodies. i\\u0026amp;j. Immunofluorescence of WT and\\u003cem\\u003e Ppih \\u003c/em\\u003ecKO testicular sections. PRPF3 and DDX23, PRPF4 and DDX23 were colocalized in WT, while this colocalization was significantly reduced in \\u003cem\\u003ePpih \\u003c/em\\u003ecKO testicular sections. What’s more, the expression of PRPF3 and PRPF4 was decreased in \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice. The colocalization of DDX23 and PRPF3/PRPF4 was analyzed by ImageJ. Three different repeats were included for each sample.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9239117/v1/2fd07f290192d5b932e0411a.png\"},{\"id\":107927059,\"identity\":\"501ab36a-2e15-44c4-b96e-fbda36432877\",\"added_by\":\"auto\",\"created_at\":\"2026-04-27 15:55:34\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":705527,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ePPIH directly binds to the cilium development and Ca\\u003c/strong\\u003e\\u003csup\\u003e\\u003cstrong\\u003e2+ \\u003c/strong\\u003e\\u003c/sup\\u003e\\u003cstrong\\u003eion channel-related mRNA. \\u003c/strong\\u003ea. Pie chart showing the genomic distribution of PPIH-binding peaks identified by LACE-seq in transcripts of round spermatids of adult mouse testes. b. Top three enriched sequence motifs within PPIH-binding peaks, identified by de novo motif analysis using the HOMER algorithm; corresponding p-values and target percentages are indicated. c. Gene Ontology (GO) enrichment analysis of PPIH-bound transcripts, highlighting significant associations with sperm cilium organization and motility. d. RIP-qPCR indicated that PPIH could bind to the target genes defined by LACE-Seq. IgG was used as a negative control. e. Western blot analysis of PPIH protein level in the testes of the WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice; GAPDH served as a loading control. f. Immunofluorescence on testes sections obtained from WT and\\u003cem\\u003e Ppih \\u003c/em\\u003ecKO males with ODF2 (Green), γH2A.X (red), and DAPI (blue). Arrows show the elongated spermatid flagellum. g. Venn diagram showing overlap of genes bound by PPIH and genes with abnormal AS in \\u003cem\\u003ePpih \\u003c/em\\u003ecKO testes. h. GO term analysis of PPIH binding genes with abnormal AS in \\u003cem\\u003ePpih \\u003c/em\\u003ecKO mice indicated that PPIH directly binds to the genes related to CatSper complex, 9+2 motile cilium, and nuclear speck. i. Venn diagram showing overlap of genes bound by PPIH and DDX23 in WT testes. j. GO term analysis of PPIH binding genes with DDX23 targeting genes in WT mice. k. Venn diagram showing the overlapped gene bound by PPIH, DDX23, and genes with abnormal AS in \\u003cem\\u003ePpih \\u003c/em\\u003ecKO testes. l. Bar graph showing results of qPCR analyses for indicated mRNAs co-precipitated by PPIH, DDX23 antigens, and control IgG antibody in RIP experiments, normalized to the amount of precipitated PPIH and DDX23. m. Validation of abnormal AS of \\u003cem\\u003eCatsperg1 2, Dync2h1, \\u003c/em\\u003eand \\u003cem\\u003eU2af1\\u003c/em\\u003e in \\u003cem\\u003ePpih \\u003c/em\\u003ecKO round spermatids by RT-PCR. n = 3. n. Quantitative expressions of \\u003cem\\u003eCatsperg1 2, Dync2h1, \\u003c/em\\u003eand \\u003cem\\u003eU2af1\\u003c/em\\u003e were examined by quantitative RT-PCR in WT and \\u003cem\\u003ePpih \\u003c/em\\u003ecKO round spermatids. qPCR data in this figure are expressed as mean ± SD of at least three independent experiments.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9239117/v1/3bad4bbf1d0d893e7eaee2e2.png\"},{\"id\":108008698,\"identity\":\"f7e8ca26-a269-4b37-8535-891fa6a261ea\",\"added_by\":\"auto\",\"created_at\":\"2026-04-28 13:08:00\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":5257736,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9239117/v1/ff4d5708-a75a-450f-bd49-6ef4973a902e.pdf\"},{\"id\":107927014,\"identity\":\"5b277dc5-abe0-4f5b-86d3-a89fce6f3370\",\"added_by\":\"auto\",\"created_at\":\"2026-04-27 15:55:22\",\"extension\":\"zip\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":140336,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Additonalfile1.zip\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9239117/v1/728516c67a2dcbc0bb282baa.zip\"},{\"id\":107927015,\"identity\":\"b859f844-37cf-47f3-8e92-e981e07f858d\",\"added_by\":\"auto\",\"created_at\":\"2026-04-27 15:55:22\",\"extension\":\"docx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":1930160,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplementary.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-9239117/v1/af98f0d684a99835a47968db.docx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"PPIH, a component of U4/U6 snRNP, regulates spermiogenesis by alternative splicing\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eInfertility has become an increasingly pressing global issue with profound social and psychological impacts[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. Reproductive capacity is critical for the survival of the animal species, and male factors are estimated to contribute to 30\\u0026ndash;50% of cases of infertility[\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Among the various causes, genetic variation and defective spermiogenesis are major contributors to asthenozoospermia, particularly those associated with sperm flagellar structure.[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. Spermatogenesis is a highly organized process, comprising sequential mitotic, meiotic, and spermiogenic phases [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Spermatogonia undergo mitotic divisions and generate a pool of spermatocytes; Haploid spermatids are generated after the meiotic phase[\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. Spermiogenesis is the terminal process by which round spermatids complete an extraordinary series of events to become spermatozoa capable of motility[\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eCompleting spermiogenesis is critical for male fertility[\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. Since DNA condenses in the nucleus, the global transcription rates of spermiogenesis decline. However, de novo protein synthesis is necessary for the development of the specific sperm cell morphology[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. Although the stages of spermiogenesis are well characterized at the cellular level, the precise biological mechanisms that regulate this process are not entirely understood [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. Multiple regulatory mechanisms, including transcriptional and post-transcriptional regulation, are reported to be involved in this complex process to ensure successful spermiogenesis[\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. While global transcriptional activity decreases with chromatin condensation during spermiogenesis, the expression of specific genes appears to be regulated by alternative splicing (AS) of transcripts [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eAS is a universal post-transcriptional regulatory mechanism that increases the diversity of transcripts and proteins generated from a limited number of genes, representing a critical step in gene expression[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. mRNA splicing is accomplished by the macromolecular machinery called the spliceosome[\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. The spliceosome is composed of five uridine-rich small nuclear RNAs (snRNAs) that interact with essential protein chaperones to form snRNP (small nuclear RNA\\u0026ndash;protein complex) subcomplexes. The stepwise assembly of spliceosomes is initiated with the association of U1 snRNP with the 5\\u0026rsquo; splice site (ss) and U2 snRNP with the branch point to form the pre-spliceosome. This is followed by the binding of the U4/U6. U5 tri-snRNP. After a major remodeling, the fully assembled spliceosome changes into a catalytically active machine[\\u003cspan additionalcitationids=\\\"CR17\\\" citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eTesticular tissue is one of the richest tissues with respect to the number of alternative splicing events and mRNA isoforms[\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e]. By using mouse knockout models, several newly defined AS regulators like BCAS2[\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e], CWF19L2[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e], PTBP1/2[\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e], and SRSF10[\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e] proved that AS is critical for the mitotic division of spermatogonia and meiotic stages[\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. What\\u0026rsquo;s more, previous studies also demonstrated that mutations of spliceosome components and/or malformation of spliceosome frequently lead to aberrant splicing variants and male infertility, for example, suppressing PRPF4, the key component of U4/U6 snRNP, results in a decrease in pluripotency of mouse embryonic stem cells[\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]; Research in drosophila found that the spliceosome component U2A, the homolog of hSNRPA1, is required for spermatogonia differentiation and associated with NOA[\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e]; LARP7-mediated U6 modification is functionally required for the fidelity of pre-mRNA splicing in male germ cells[\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. However, the regulatory mechanisms of specific spliceosome members in spermiogenesis are still largely underestimated.\\u003c/p\\u003e \\u003cp\\u003ePeptidylprolyl isomerase H (PPIH), a peptidyl-prolyl cis-trans isomerase, was first defined in the matrix of \\u003cem\\u003eNeurospora crassa\\u003c/em\\u003e mitochondria and plays a role in importing and folding of proteins[\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. Later studies proved that PPIH interacted with the U4/U6 snRNP components (PRPF3, PRPF4) and function in the assembly of U4/U6. U5 tri-snRNPs and/or in conformational changes occurring during the splicing process in hela cell[\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. In this study, by using a germ cell-specific \\u003cem\\u003ePpih\\u003c/em\\u003e knock-out mouse model, we found that PPIH took part in the regulation of spermiogenesis by participating in the alternative splicing of sperm cilium or motile-related mRNA. Losing \\u003cem\\u003ePpih\\u003c/em\\u003e lead to the structure of spermatozoa disrupted, decreasing sperm motility, and male infertility. Mechanically, PPIH influences the organization of U4/U6. U5 tri-snRNP mediates the expression of U4/U6. U5 snRNP components. AS of cilium formation-related genes were disrupted after \\u003cem\\u003ePpih\\u003c/em\\u003e loss, resulting in decreased expression of these genes. Besides, LACE-Seq analysis indicated that PPIH binds to the mRNA of flagella formation and Ca\\u003csup\\u003e2+\\u003c/sup\\u003e ion channel genes and directly regulates their expression by AS. Taken together, our study presents compelling evidence for proving that PPIH is a critical regulator of mRNA alternative splicing during spermiogenesis and essential for male fertility.\\u003c/p\\u003e\"},{\"header\":\"Result\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003ePPIH is greatly expressed during spermiogenesis\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eDuring male germ cell development, stage-specific genes are expressed in the meiotic prophase and early round spermatid stage. Germ cell-specific isoforms of several genes are generated through alternative splicing[31, 32]. To date, the known functions of splicing regulators are dominantly working at mitotic or meiotic stages[33, 34]; however, the splicing effectors that work in spermiogenesis remain to be elucidated. To investigate the role of mRNA alternative splicing during the transition from round to elongated spermatids, we focused our attention on spliceosome components, as the spliceosome is the main splicing machinery[35]. To begin with, we reanalyzed the published single-cell sequencing data[36] and characterized the expression patterns of several spliceosome components, such as \\u003cem\\u003eSf3b1\\u0026nbsp;\\u003c/em\\u003e(belonging to U2 snRNP), the core proteins of U4/U6 snRNP (\\u003cem\\u003ePrpf3, Prpf4, Prpf31,\\u003c/em\\u003e and \\u003cem\\u003ePpih\\u003c/em\\u003e), and U5 snRNP-specific components (\\u003cem\\u003ePrpf6, Prpf8\\u003c/em\\u003e)[36-38]. We found that the expression levels of these proteins are dynamic during spermatogenesis, with the highest expression at the leptotene stage and a subsequent decrease. However, \\u003cem\\u003ePpih\\u003c/em\\u003e exhibited a different expression pattern, being abundantly expressed at the zygotene stage \\u003cstrong\\u003e(Fig. S1a)\\u003c/strong\\u003e. To validate the sequencing result, we measured the transcription levels of the aforementioned genes during the first wave of spermatogenesis by qPCR and found that the expression of these genes was lowest at the leptotene stages (12 days after birth, PD12), after which their expression increased and remained at a high level \\u003cstrong\\u003e(Fig. 1a)\\u003c/strong\\u003e. Similar to the mRNA expression profile, the protein levels of these genes decreased at postnatal day 12 (PD12, Leptotene) and recovered at PD14 (Zygotene), remained at high levels thereafter \\u003cstrong\\u003e(Fig. 1b)\\u003c/strong\\u003e. Together, these data suggest that the spliceosome may play a unique role in spermatogenesis.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTo further define the subcellular localization of these proteins in testes, we performed immunofluorescence (IF) staining using testicular paraffin sections. Our results showed that almost all of these proteins were highly expressed in pachytene or diplotene spermatocytes, reduced in round spermatids, and almost undetectable in elongated spermatids. Furthermore, these proteins were largely localized in the nucleus \\u003cstrong\\u003e(Fig. 1c)\\u003c/strong\\u003e. However, unlike the measured proteins, PPIH exhibited a unique expression and localization pattern: PPIH was localized both in the nucleus and cytoplasm. Additionally, PPIH was highly expressed in round spermatids and elongated spermatids, but lower in pachytene and diplotene spermatocytes \\u003cstrong\\u003e(Fig. 1d)\\u003c/strong\\u003e. Isolation of testicular nuclei and cytosol further confirmed the localization pattern of PPIH\\u0026nbsp;and other snRNP proteins \\u003cstrong\\u003e(Fig. 1e)\\u003c/strong\\u003e. To further confirm the unique expression of PPIH, we performed similar experiments in HEK 293 T cells transfected with PPIH-Flag plasmid; Nuclear/cytosol isolation indicated that PPIH existed in both the nucleus and cytosol both in vivo and in vitro \\u003cstrong\\u003e(Fig. S1b)\\u003c/strong\\u003e. We also carried out IF to observe the PPIH localization in HEK 293 cells and found that PPIH was expressed in the nucleus and cytosol \\u003cstrong\\u003e(Fig. S1c)\\u003c/strong\\u003e. The distinct distribution and expression pattern of PPIH may indicate an exceptional function in spermiogenesis. \\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ePPIH co-participated with multiple spliceosome components in the testes\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eIn human cells, PPIH was assembled to the U4/U6 snRNP and was indispensable for its splicing activity[39]. Amino acid sequence alignment analysis of PPIH orthologs from prokaryotes to eukaryotes demonstrated its evolutionary conservation (\\u003cstrong\\u003eFig. S1d\\u003c/strong\\u003e), indicating that PPIH may have conserved characteristics in mice. Given this potential conservation, and since the detailed function of mouse PPIH has not been reported, we first elucidated the tissue expression profile of PPIH by Western blot (WB) using multiple adult mouse tissues. Our results showed that PPIH was predominantly expressed in mouse genital organs, with weak expression in the brain and other tissues. \\u003cstrong\\u003e(Fig. 1f)\\u003c/strong\\u003e. We then investigated whether PPIH is associated with components of the U4/U6 snRNP complex in mouse testes as well as in human cells. Immunoprecipitation (IP) was performed using anti-PPIH antibodies, and proteins were analyzed by WB. Consistent with the previous studies where PPIH tightly binds to PRPF3, PRPF4, and PRPF18, PPIH also stably interacted with PRPF3, PRPF4, and PRPF18 in the testes \\u003cstrong\\u003e(Fig. 1g)\\u003c/strong\\u003e. We also constructed PPIH-Flag and PRPF18-HA plasmids and verified their interaction by co-transfecting the plasmids into the HEK 293T cell line. Co-immunoprecipitation experiments further confirmed the interaction between PPIH and PRPF18 \\u003cstrong\\u003e(Fig. 1h)\\u003c/strong\\u003e. Collectively, these findings indicate that PPIH is also integrated into the U4/U6 snRNP in mice testes.\\u003c/p\\u003e\\n\\u003cp\\u003eTo explore the interactors of PPIH during spermatogenesis, we performed IP followed by mass spectrometry (IP-MS) experiments using total protein extracts from mouse testes with an anti-PPIH antibody, aiming to identify other potential proteins interacting with PPIH besides the verified spliceosome components. A total of 1867 proteins were specifically identified by IP-MS. In addition to the tested proteins associated with U4/U6 snRNP, U2 snRNP (SF3B1), U5 snRNP-specific members (PRPF8, DDX23[40]), RNA-binding proteins (e.g hnRNP[41]) and molecular chaperones (e.g., Hspa5[42]) were also discovered \\u003cstrong\\u003e(Fig. 1i)\\u003c/strong\\u003e. Using in vivo IP, we further validated and confirmed that U2, U4/U6, and U5 snRNP proteins (PRPF31, PRPF8, and DDX23) identified by IP-MS indeed interacted with PPIH in the testes \\u003cstrong\\u003e(Fig. 1j)\\u003c/strong\\u003e. IF analysis further demonstrated that PPIH co-localized with PRPF31 and SF3B1 in diplotene spermatocytes and round spermatids \\u003cstrong\\u003e(Fig. 1k)\\u003c/strong\\u003e. Taken together, these data suggest that PPIH is indeed associated with the spliceosome in mouse testes. Considering the high, unique expression pattern of PPIH in mouse testes and its stable association with the spliceosome, PPIH may be indispensable for controlling AS during spermiogenesis.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003ePpih\\u003c/em\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;deletion causes complete male infertility and disrupted spermiogenesis.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo uncover the function of PPIH during spermiogenesis and fertilization, we engineered a germline-specific conditional \\u003cem\\u003ePpih\\u003c/em\\u003e knock out mice using the \\u003cem\\u003eCre\\u003c/em\\u003e-loxP system. Firstly, we generated mice with a floxed \\u003cem\\u003ePpih\\u003c/em\\u003e allele by inserting two loxP cassettes\\u0026mdash;one before exon 4 and the other after exon 5\\u0026mdash;using the CRISPR-Cas9 system[43] \\u003cstrong\\u003e(Fig. 2a)\\u003c/strong\\u003e. After mating with a \\u003cem\\u003eStra8-GFPCre\\u0026nbsp;\\u003c/em\\u003eline, germ cell-specific conditional knockout \\u003cem\\u003ePpih\\u003c/em\\u003e (\\u003cem\\u003ePpih\\u003c/em\\u003e\\u003csup\\u003e\\u0026nbsp;fl/fl\\u003c/sup\\u003e\\u003cem\\u003e\\u0026nbsp;Stra8-GFPCre\\u003c/em\\u003e, here after \\u003cem\\u003ePpih\\u003c/em\\u003e cKO) mice could be generated[44]. The genotypes of wild-type (\\u003cem\\u003ePpih\\u003c/em\\u003e\\u003csup\\u003e\\u0026nbsp;f\\u003c/sup\\u003e\\u003cem\\u003e\\u0026nbsp;Ppih\\u003c/em\\u003e\\u003csup\\u003e\\u0026nbsp;fl/fl\\u003c/sup\\u003e, WT) and\\u003cem\\u003e\\u0026nbsp;Ppih\\u003c/em\\u003e cKO mice for the targeted mutation of \\u003cem\\u003ePpih\\u003c/em\\u003e were identified by PCR analysis of genomic DNA \\u003cstrong\\u003e(Fig. S2a)\\u003c/strong\\u003e. Successful deletion of \\u003cem\\u003ePpih\\u003c/em\\u003e was determined by qPCR and immunoblot analysis of testicular mRNA or protein extracts, which showed that the transcription and translation of \\u003cem\\u003ePpih\\u0026nbsp;\\u003c/em\\u003ewere markedly reduced in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. 2b\\u0026amp;c)\\u003c/strong\\u003e. Consistently, IF analysis of the testis sections revealed the loss of PPIH in germ cells \\u003cstrong\\u003e(Fig. 2d)\\u003c/strong\\u003e. The WT and \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice had identical body size \\u003cstrong\\u003e(Fig. S2b),\\u003c/strong\\u003e and there was no alteration in their body weight \\u003cstrong\\u003e(Fig. 2e)\\u003c/strong\\u003e. However, male \\u003cem\\u003ePpih\\u003c/em\\u003e cKO were infertile, and no offspring were delivered. Whereas female reproduction capacity was not disturbed by missing \\u003cem\\u003ePpih\\u003c/em\\u003e \\u003cstrong\\u003e(Fig. 2f)\\u003c/strong\\u003e.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTo elucidate the details that \\u003cem\\u003ePpih\\u003c/em\\u003e knock out result in male infertility, we first observe the morphology of the testes and the cauda epididymis. Differing from the WT litter-matched control, the testes of adult \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice were smaller, and the ratio of testes to body weight in\\u003cem\\u003e\\u0026nbsp;Ppih\\u003c/em\\u003e cKO mice was significantly lower than that of WT \\u003cstrong\\u003e(Fig. 2g\\u0026amp;h)\\u003c/strong\\u003e. Furthermore, the caput and cauda epididymides of \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice were irregular compared with WT \\u003cstrong\\u003e(Fig. 2g)\\u003c/strong\\u003e. These observations suggest that PPIH is essential for male fertility. To explore the role of PPIH in spermatogenesis following the observed male infertility in \\u003cem\\u003ePpih\\u003c/em\\u003e CKO mice, histological analyses were performed. Using Hematoxylin and Eosin (H\\u0026amp;E) to stain the testes and epididymis paraffin section, we observed no differences in the number of empty seminiferous tubules. However, the decreasing quantity of round and elongated spermatids was found in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice, and elongated spermatids of \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice had impaired flagellum as well \\u003cstrong\\u003e(Fig. 2i)\\u003c/strong\\u003e. When the cauda epididymal section was inspected, \\u003cem\\u003ePpih\\u003c/em\\u003e cKO epididymis showed a reduced number of spermatozoa and an increased cell debris \\u003cstrong\\u003e(Fig. 2j\\u0026amp; k \\u0026amp; Fig. S2c)\\u003c/strong\\u003e.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTo identify the developmental defects underlying spermiogenesis malformation, we performed stage-specific investigations using IF analysis of lectin peanut agglutinin (PNA), which marks the acrosome[45].\\u0026nbsp;As shown in the \\u003cstrong\\u003eFig 2l\\u003c/strong\\u003e, germ cell development proceeded normally between WT and \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice, as all cell-type proportions were maintained. However, although the hook-shaped acrosome in WT spermatids was also observed in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO spermatids, \\u003cem\\u003ePpih\\u003c/em\\u003e cKO spermatids exhibited continuous variation in acrosome and nucleus shapes \\u003cstrong\\u003e(Fig. 2l)\\u003c/strong\\u003e. Additionally, by counting the number of cells per tubule, we found that the number of round and elongated spermatids was significantly decreased in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. S2d\\u0026amp;e)\\u003c/strong\\u003e. To exclude artificial influences, we used flow cytometry-based cell counting to assess the number of cells at different stages \\u003cstrong\\u003e(Fig. 2m)\\u003c/strong\\u003e. Consistent with the counting results, there was a clear reduction in haploid cells in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice, while a slight increase in meiotic cells was observed in\\u003cem\\u003e\\u0026nbsp;Ppih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. 2n)\\u003c/strong\\u003e. IF analysis of Sertoli cells (SOX9)[46] and undifferentiated spermatogonia (PLZF) [47]showed no differences between WT and \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. S2f\\u0026amp;g)\\u003c/strong\\u003e. Taken together, these data demonstrated that PPIH specifically functions in the spermiogenesis phase and is dispensable for the development of spermatogonia and spermatocytes.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ePPIH is required for spermatozoa biogenesis\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003eOur results revealed that PPIH deletion leads to a reduction in the number of round and elongated spermatids. To further characterize whether PPIH plays a role in spermatozoa morphology development, we observed spermatozoa from the cauda epididymis. Results showed that PPIH deletion led to abnormal spermatozoa morphology, including shorter or bent tails and abnormal heads \\u003cstrong\\u003e(Fig. 3a)\\u003c/strong\\u003e. The proportion of deformed sperm in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice was significantly higher than that in WT mice \\u003cstrong\\u003e(Fig. 3b)\\u003c/strong\\u003e. Computer-assisted semen analysis (CASA) of epididymal sperm revealed that the rates of total motility and progressive motility in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice were significantly lower than those in WT mice \\u003cstrong\\u003e(Fig. 3c)\\u003c/strong\\u003e. Sperm flagellum is essential for sperm motility, which is a fundamental requirement for male fertility [48, 49]. Considering the facts that \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice had irregular sperm flagella and reduced motility, we hypothesized that the structure of the sperm cilium might be disrupted. To test this hypothesis, we stained testes with \\u0026beta;-tubulin (a marker of cilia)[50] to confirm defects in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice. We found a clear loss of \\u0026beta;-tubulin expression in the lumen of \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice, where signals are abundant in WT mice \\u003cstrong\\u003e(Fig. 3d\\u0026amp;f)\\u003c/strong\\u003e. WB analysis further confirmed the reduction of \\u0026beta;-tubulin in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. 3e)\\u003c/strong\\u003e. To gain deeper insight into sperm cilium and head defects, we visualized cauda sperm by IF analysis of \\u0026beta;-tubulin and PNA. IF showed that \\u0026beta;-tubulin expression was significantly decreased in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO sperm. Furthermore, PNA staining revealed that the acrosome of \\u003cem\\u003ePpih\\u003c/em\\u003e cKO sperm was also malformed \\u003cstrong\\u003e(Fig. 3f)\\u003c/strong\\u003e. Together, these results suggest that PPIH is required for spermatozoa development. \\u0026nbsp; \\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTo deeply reveal the significant spermatozoa morphology defects, we then applied transmission electron microscopy (TEM) on the cauda epididymis to observe the ultrastructure. As shown in \\u003cstrong\\u003eFig 3g\\u003c/strong\\u003e, the spermatozoa head of \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice was disrupted with degenerating acrosomes and the nucleus shrunken compared with WT. Furthermore,\\u0026nbsp;abnormal structure and mitochondria lost were found in the head-neck connecting piece in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. 3h)\\u003c/strong\\u003e. To further explore the specific role of PPIH in motile cilium development, we also examined the 9+2 cilium structure by TEM. Consistent with the reduced motility of \\u003cem\\u003ePpih\\u003c/em\\u003e cKO sperm, the flagellum structure was disrupted, and the 9+2 microtubule structure of \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice was disorganized, along with disarrangements of the outer dense fibers, mitochondrial sheath, and axonemes \\u003cstrong\\u003e(Fig. 3i)\\u003c/strong\\u003e. Taken together, these results provide strong evidence that PPIH is essential for modulating sperm tail organization as well as sperm head development.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003ePpih\\u003c/em\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;knockout leads to alterations of the transcriptome in round spermatids.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo gain further insight into the molecular basis for the spermatogenesis defects observed in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice, we performed RNA-seq analyses of sorted round spermatids from adult mice. Compared with WT controls, RNA-Seq analysis detected 420 upregulated and 208 downregulated genes in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. 4a)\\u003c/strong\\u003e. For the downregulated genes, Gene Ontology (GO) enrichment analysis revealed that their functions mainly involved in cilium development and lipid transport \\u003cstrong\\u003e(Fig. 4b)\\u003c/strong\\u003e. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis further highlighted that genes relating to cell death regulation (apoptosis, necroptosis, and the Notch signaling pathway) were obviously increased in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. 4c)\\u003c/strong\\u003e. To validate the RNA-Seq results, one or two of the genes relating to the aforementioned pathways or functions were checked by qPCR. Consistent with the RNA-Seq results \\u003cstrong\\u003e(Fig. 4d)\\u003c/strong\\u003e, qPCR confirmed that genes related to cell death and the Notch signaling pathway were significantly upregulated in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. 4e)\\u003c/strong\\u003e, while genes associated with cilium organization and lipid transport were significantly downregulated in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. 4i)\\u003c/strong\\u003e.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTo uncover the impact of these up/downregulated genes on cellular processes, we examined cell death and lipid content changes in the testes. TUNEL staining of testis paraffin sections showed that, compared with WT controls, more TUNEL-positive cells and seminiferous tubules were observed in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. 4f\\u0026amp;g)\\u003c/strong\\u003e. Moreover, TUNEL staining revealed that the positive signals mainly localized in elongated spermatids \\u003cstrong\\u003e(Fig. 4f)\\u003c/strong\\u003e, which may account for the reduced sperm count observed in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice. Fluorescence-activated cell sorting (FACS) analysis further confirmed that a significant increased proportion of apoptotic cells were detected in the testes of \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. 4h)\\u003c/strong\\u003e. In addition to the downregulated genes, WB result concluded that the expression of lipid transport-related proteins (ACSL5 and DOCK5[51]) was reduced in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. 4j)\\u003c/strong\\u003e. Staining of testicular cryosections with Oil Red O proved that lipid accumulation was reduced in elongated spermatids of \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. 4k)\\u003c/strong\\u003e. Taken together, these results indicated that PPIH plays an important role in regulating cilium organization and lipid transport. Deformed spermatids in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice may be eliminated by apoptosis through the regulation of cell death-related processes.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eLoss of PPIH induces splicing defects in round spermatids.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eGiven the truth that PPIH is a component of the U4/U6 snRNP and alternative splicing is one of the main mechanisms regulating gene expression, we then investigated whether RNA alternative splicing contributes to the gene expression disturbances observed in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice. By analyzing aberrant alternative splicing events in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice, a total of 321 alternative splicing events were identified in 286 genes. Five categories of alternative splicing (AS) events were affected, with exon skipping being the most frequent splicing alteration (61.37%) \\u003cstrong\\u003e(Fig. 5a)\\u003c/strong\\u003e. GO enrichment analysis revealed that the biological processes of genes with abnormal alternative splicing are involved in RNA splicing, spermatid development, and sperm motility \\u003cstrong\\u003e(Fig. 5b)\\u003c/strong\\u003e. Based on cellular component analysis, most of these genes are involved in cilium organization and sperm development, which is consistent with the downregulated genes observed in RNA-Seq \\u003cstrong\\u003e(Fig. 5b)\\u003c/strong\\u003e. To further confirm the existence of abnormal alternative splicing, we used RT-qPCR to verify the splicing of \\u003cem\\u003eIft88\\u003c/em\\u003e[52] (skipped exon, SE), \\u003cem\\u003eTssk4\\u003c/em\\u003e[53] (retained intron, RI), \\u003cem\\u003eSept4\\u003c/em\\u003e[54] (alternative 5\\u0026rsquo; splice site, A5SS), and \\u003cem\\u003eRsrp1\\u003c/em\\u003e[55] (alternative 3\\u0026rsquo; splice site, A3SS), which are known elements critical for motile cilium formation and RNA splicing. The results revealed that loss of \\u003cem\\u003ePpih\\u003c/em\\u003e leads to aberrant splicing events in the aforementioned genes \\u003cstrong\\u003e(Fig. 5c\\u0026amp; S3a)\\u003c/strong\\u003e. Abnormal splicing may result in unusual transcripts, which are eliminated by nonsense-mediated mRNA decay (NMD) in eukaryotes[56, 57]. qPCR analysis confirmed that the mRNA levels of genes with abnormal alternative splicing were significantly reduced compared with those in WT mice \\u003cstrong\\u003e(Fig. S3b)\\u003c/strong\\u003e, and their protein abundances were also decreased in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. 5d)\\u003c/strong\\u003e. IF analysis of WT and \\u003cem\\u003ePpih\\u003c/em\\u003e cKO testis sections with anti-TSSK4, anti-SEPT4, and anti-IFT88 antibodies further confirmed that their expression was downregulated in germ cells and spermatids \\u003cstrong\\u003e(Fig. 5e\\u0026amp;f)\\u003c/strong\\u003e. Collectively, these data reveal that PPIH is required for regulating the alternative splicing of sperm motility genes, which, in turn, mediates their transcription and translation.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ePPIH participates in AS regulation by affecting spliceosome assembly\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo reveal the mechanism by which PPIH functions in alternative splicing regulation, we first examined whether PPIH affects the expression of other spliceosome components. WB analysis of protein expression in sorted germ cells from WT and\\u003cem\\u003e\\u0026nbsp;Ppih\\u003c/em\\u003e cKO mice showed that PPIH deletion led to reduced expression of PRPF3, PRPF4, PRPF18, and DDX23 (all of which belong to the U4/U6/U5 tri-snRNP), whereas loss of PPIH had little effect on the expression of U5 snRNP-specific proteins (PRPF6 and PRPF8) or the U2 snRNP component SF3B1 \\u003cstrong\\u003e(Fig. 5g)\\u003c/strong\\u003e. These results are consistent with previous reports that loss of a spliceosome protein only affects the expression of limited part of snRNPs members[58].\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eIt has been known that U1, U2, U4, and U5 snRNAs are exported to the cytoplasm after transcription and interact with Sm proteins to form the core U snRNP complexes[59, 60]. Considering the unique localization of PPIH, which both existed in nuclear and the cytoplasm, we then assessed whether PPIH also influences the assembly of the spliceosome. snRNP complexes were immunopurified using anti-DDX23 antibodies in the presence or absence of PPIH. \\u003cem\\u003ePpih\\u003c/em\\u003e knockdown substantially decreased the association of DDX23-associated U4/U6 snRNA particles with PRPF3 and PRPF4, and to a lesser extent with PRPF31. Interestingly, PPIH knockdown also impacted the interaction between DDX23 and the U5 snRNP-specific protein PRPF6, while the association with SF3B1 was not detectably affected \\u003cstrong\\u003e(Fig. 5h)\\u003c/strong\\u003e. Co-staining of DDX23 with these snRNP proteins and evaluating the overlap coefficient confirmed the decreased expression and colocalization of DDX23 and snRNP proteins in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice compared with WT control \\u003cstrong\\u003e(Fig. 5i\\u0026amp;j)\\u003c/strong\\u003e. Collectively, these results suggest that PPIH plays an integral role in regulating the expression of both U4/U6 di-snRNP and U5 snRNP particles, as well as the assembly of the U4/U6.U5 tri-snRNP. Based on the results obtained, we concluded that PPIH regulate the translation and structural rearrangement of the U4/U6.U5 tri-snRNP and alter the formation and/or stability of spliceosome intermediates, thereby impacting the dynamics and assembly of the spliceosome machinery.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ePPIH directly binds to the cilium development and the Ca\\u003csup\\u003e2+\\u0026nbsp;\\u003c/sup\\u003eion channel-related mRNA\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo further study the target mRNA of PPIH, we performed linear amplification of complementary DNA ends and sequencing (LACE-seq)[61], a low-input method for global profiling of RNA-binding protein (RBP) target sites, to profile PPIH binding events in enriched spermatogonia. Annotation of LACE-Seq data identified a total of 2,192 transcripts that were significantly enriched in PPIH immunoprecipitants, with approximately 21% of targets located in intron regions \\u003cstrong\\u003e(Fig. 6a)\\u003c/strong\\u003e. PPIH-binding peaks in mouse spermatogonia were significantly enriched for UC/UG-rich consensus motifs, which are bound by the known RNA splicing factors PTBP1 or RBMXL12 [62-64] \\u003cstrong\\u003e(Fig. 6b)\\u003c/strong\\u003e. Concomitantly, GO enrichment analysis revealed that the functions of PPIH targets are mostly involved in cilium assembly, actin filament-based processes, and cell growth, which is concordant with the predominant phenotype observed in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice \\u003cstrong\\u003e(Fig. 6c)\\u003c/strong\\u003e. The LACE-Seq results were furtherly validated by RIP-qPCR. We selected eight PPIH target mRNAs and confirmed that they were predominantly present in PPIH immunoprecipitants from WT testes \\u003cstrong\\u003e(Fig. 6d)\\u003c/strong\\u003e. To determine the effect of PPIH on the expression of the genes it binds, we measured the expression of target genes by qPCR and found that knocking out \\u003cem\\u003ePpih\\u003c/em\\u003e reduces their transcription \\u003cstrong\\u003e(Fig. S3c)\\u003c/strong\\u003e. Furthermore, we selected the newly identified cilium-related genes, \\u003cem\\u003eOdf2\\u003c/em\\u003e, and validated their downregulated expression by WB \\u003cstrong\\u003e(Fig. 6e)\\u003c/strong\\u003e. Outer dense fibre 2 (Odf2 or ODF2) is a cytoskeletal protein required for flagella-beating and transporting sperm cells from testes to the eggs[65, 66]. IF staining of testis sections with an ODF2 antibody demonstrated that PPIH participates in mediating ODF2 expression during sperm flagellum assembly \\u003cstrong\\u003e(Fig. 6f)\\u003c/strong\\u003e.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTo explore the relationship between the abnormal alternative splicing mRNA and PPIH target mRNA, we cross-analyzed LACE-Seq and AS data and found that 81 genes, which occurred aberrant alternative splicing, were directly bound by PPIH \\u003cstrong\\u003e(Fig. 6g)\\u003c/strong\\u003e. GO enrichment analysis showed that the overlapping genes are mainly related to the 9+2 motile cilium, nuclear speckles, and the CatSper complex \\u003cstrong\\u003e(Fig. 6h)\\u003c/strong\\u003e. CatSper is a sperm-specific ion channel that serves as the principal calcium channel in sperm, mediating calcium influx into the sperm flagellum and acting as an essential modulator of downstream fertilization-related mechanisms[67, 68]. Deeply analyzing the RNA-Seq we had, we found that \\u003cem\\u003ePpih\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eDdx23\\u003c/em\\u003e (a U5 snRNP component) are the only two significantly downregulated genes involved in alternative splicing \\u003cstrong\\u003e(Fig. 4d)\\u003c/strong\\u003e. As supporting evidence, we also performed LACE-Seq with anti-DDX23. There were 1,094 common mRNAs targeted by both PPIH and DDX23 \\u003cstrong\\u003e(Fig. 6i)\\u003c/strong\\u003e. GO enrichment analysis of these common target genes revealed that their main functions are indulged in cilium assembly/organization, motility, and GTPase-regulated activity \\u003cstrong\\u003e(Fig. 6j)\\u003c/strong\\u003e. There were 51 common genes shared among PPIH LACE-Seq data, DDX23 LACE-Seq data, and genes with abnormal AS \\u003cstrong\\u003e(Fig. 6k)\\u003c/strong\\u003e. We selected 4 of these genes for verification by RIP-qPCR, and all were highly enriched in PPIH precipitants; \\u003cem\\u003eU2af1\\u003c/em\\u003e, which was specifically bound by PPIH, was not enriched in DDX23 precipitants \\u003cstrong\\u003e(Fig. 6l)\\u003c/strong\\u003e. RT-PCR additionally confirm that these genes exhibited aberrant alternative splicing \\u003cstrong\\u003e(Fig. 6m)\\u003c/strong\\u003e, which leading to decreased gene transcription \\u003cstrong\\u003e(Fig. 6n)\\u003c/strong\\u003e. All together, these data suggest that PPIH participates in spermiogenesis by directly binding to mRNAs of cilium motility/ organization and Ca\\u003csup\\u003e2+\\u003c/sup\\u003e ion channel mRNA, influencing their expression by AS.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eIn this study, by using a germ cell-specific \\u003cem\\u003ePpih\\u003c/em\\u003e knockout (\\u003cem\\u003ePpih\\u003c/em\\u003e cKO) mouse model and integrating multi-omics analysis with cell biology experiments, we systematically elucidate the pivotal roles of peptidyl-prolyl cis-trans isomerase H (PPIH) in mouse spermatogenesis: 1) PPIH is indispensable for male mouse fertility; 2) PPIH is a member of spliceosome in mouse and essential for spliceosome assembly; 3) PPIH regulates spermiogenesis by mediating alternative splicing and participates in sperm flagellum formation by directly bind to the sperm motile cilium or cilium assembly related mRNA.\\u003c/p\\u003e \\u003cp\\u003eAs a member of the U4/U6 snRNP complex, the unique expression and localization patterns of PPIH in testicular tissues suggest its exceptional function. Unlike other spliceosome components that are dominantly localized in the nucleus in pachytene/diplotene spermatocytes, PPIH accumulates both in the nucleus and cytoplasm, maintaining high expression levels in metaphase II (MII) spermatocytes, round, and elongated spermatids. Considering the truth that the core U snRNPs are organized in the cytoplasm and reimport into nuclear to function[\\u003cspan citationid=\\\"CR69\\\" class=\\\"CitationRef\\\"\\u003e69\\u003c/span\\u003e], this differential characteristic of PPIH implies that it might perform specialized roles in spermiogenesis. IP-MS and co-immunoprecipitation experiments confirm that PPIH not only stably interacts with U4/U6 snRNP components (PRPF3, PRPF4, PRPF18)[\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e] but also binds to U2, U5 snRNP members, and molecular chaperones (Hspa5)[\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR70\\\" class=\\\"CitationRef\\\"\\u003e70\\u003c/span\\u003e], further indicating its multiple roles in spliceosome assembly and sperm structure formation. These findings are highly consistent with those observed in human cells that PPIH is indispensable for the splicing activity of U4/U6 snRNP complex[\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR71\\\" class=\\\"CitationRef\\\"\\u003e71\\u003c/span\\u003e], highlighting the evolutionarily conserved function of PPIH.\\u003c/p\\u003e \\u003cp\\u003eConditional knockout of \\u003cem\\u003ePpih\\u003c/em\\u003e in germ cells results in complete male mice infertility, and histological analyses reveal a significant reduction in the number of round and elongated spermatids within seminiferous tubules of \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice, decreased sperm concentration, and increased fragmentation in the epididymis, along with a markedly higher rate of sperm morphological abnormalities. Transmission electron microscopy and immunofluorescence staining further demonstrate that the absence of PPIH disrupts the ultrastructure of sperm heads and tails, causing disarray in the 9\\u0026thinsp;+\\u0026thinsp;2 microtubule doublets, dispersion of peripheral dense fibers, and mitochondrial reduction, all of which are critical for sperm motility[\\u003cspan citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e72\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR73\\\" class=\\\"CitationRef\\\"\\u003e73\\u003c/span\\u003e]. Computer-assisted semen analysis (CASA) confirms a significant decrease in total sperm motility and progressive movement in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice, directly confirming the causal relationship between sperm tail dysfunction and loss of fertility. Notably, the quantity and morphology of Sertoli cells (marked by SOX9)[\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e] and undifferentiated spermatogonia (marked by PLZF)[\\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e47\\u003c/span\\u003e] remain unaffected, indicating that the role of PPIH is specifically confined to spermiogenesis without apparent regulation on spermatogonia proliferation or meiotic progression, distinguishing it from the known splice factors like MRG15[\\u003cspan citationid=\\\"CR74\\\" class=\\\"CitationRef\\\"\\u003e74\\u003c/span\\u003e], DDX5[\\u003cspan citationid=\\\"CR75\\\" class=\\\"CitationRef\\\"\\u003e75\\u003c/span\\u003e] and PTBP2[\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e] that regulate mitosis-to-meiosis transition.\\u003c/p\\u003e \\u003cp\\u003eThe core mechanism by which PPIH regulates spermiogenesis lies in its control over snRNP components expression, spliceosome assembly, and alternative splicing. RNA-seq analysis shows that \\u003cem\\u003ePpih\\u003c/em\\u003e deficiency leads to 321 aberrant splicing events in 286 genes, with exon skipping (61.37%) being the predominant type. These differentially spliced genes are enriched in pathways related to cilia development, sperm motility, and RNA splicing. RT-qPCR validation confirms abnormal splicing of key sperm tail formation and RNA splicing genes (\\u003cem\\u003eIft88, Tssk4, Sept4, Rsrp1\\u003c/em\\u003e), with significantly reduced mRNA and protein expression levels, suggesting that aberrant splicing products may be cleared through nonsense-mediated mRNA decay (NMD)[\\u003cspan citationid=\\\"CR76\\\" class=\\\"CitationRef\\\"\\u003e76\\u003c/span\\u003e]. Further mechanical investigations proved that PPIH deficiency selectively reduces the expression of U4/U6. U5 tri-snRNP components (PRPF3, PRPF4, PRPF18, DDX23) and disrupts the interaction between DDX23 and U4/U6 and U5 snRNPs, impeding spliceosome assembly. This selective regulatory feature aligns with previous observations where \\u003cem\\u003ePrpf31\\u003c/em\\u003e deficiency affects only certain snRNP components, suggesting that the stability of the spliceosome depends on specific component regulation[\\u003cspan citationid=\\\"CR77\\\" class=\\\"CitationRef\\\"\\u003e77\\u003c/span\\u003e]. PPIH ensures the integrity of the spliceosome and maintains its catalytic activity, thus regulating normal splicing of spermiogenesis-related genes.\\u003c/p\\u003e \\u003cp\\u003eLACE-seq technology provides crucial evidence for PPIH\\u0026rsquo;s direct regulatory role by identifying its target mRNAs. The study reveals that PPIH binds to 2192 transcripts, with 21% of binding sites located in intronic regions. The targets of mRNA of PPIH are significantly enriched in pathways related to flagellum assembly and actin filament processing. Cross-analysis of LACE-seq and aberrant splicing data identifies 81 genes directly regulated by PPIH, including sperm tail structural genes (\\u003cem\\u003eOdf2\\u003c/em\\u003e) and calcium channel genes (\\u003cem\\u003eCatsperg1, Catsperg2\\u003c/em\\u003e)[\\u003cspan citationid=\\\"CR78\\\" class=\\\"CitationRef\\\"\\u003e78\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR79\\\" class=\\\"CitationRef\\\"\\u003e79\\u003c/span\\u003e]. As sperm-specific calcium channels, the Catsper family mediates calcium influx essential for sperm capacitation and flagellar movement[\\u003cspan citationid=\\\"CR80\\\" class=\\\"CitationRef\\\"\\u003e80\\u003c/span\\u003e]. The abnormal alternative splicing of these mRNA likely impacts channel function, potentially exacerbating sperm motility defects in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice. Additionally, PPIH shares 1094 target mRNAs with U5 snRNP component DDX23[\\u003cspan citationid=\\\"CR81\\\" class=\\\"CitationRef\\\"\\u003e81\\u003c/span\\u003e], which are concentrated in pathways related to cilium organization and GTPase regulation, suggesting a possible functional complex that cooperatively regulates sperm tail development, providing new clues about the collaborative roles of spliceosome subcomplexes in spermatogenesis.\\u003c/p\\u003e \\u003cp\\u003eBeyond splicing regulation, PPIH also participates in lipid transport pathway regulation, expanding its functional dimensions. RNA-seq and Western blot experiments show significantly reduced expression of lipid transport-related proteins such as ACSL5 and DOCK5[\\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e] in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice, with Oil Red O staining confirming decreased lipid accumulation in elongated spermatids. Previous studies indicate that deficiencies in ACSL family members (e.g., ACSL3, ACSL6) lead to sperm morphological abnormalities and male infertility[\\u003cspan citationid=\\\"CR82\\\" class=\\\"CitationRef\\\"\\u003e82\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR83\\\" class=\\\"CitationRef\\\"\\u003e83\\u003c/span\\u003e]. What\\u0026rsquo;s more, the sperm phenotype of \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice closely resemble to ACSL6 knockout mice. This suggests that lipid metabolism disorders might be another critical cause of sperm defects due to PPIH deficiency. Moreover, the number of apoptotic cells in \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mouse testes is significantly increased, primarily localized in elongated spermatids, suggesting that abnormal splicing and lipid metabolism defects collectively lead to malformed sperm being cleared via apoptosis, explaining the observed reduction in sperm numbers.\\u003c/p\\u003e \\u003cp\\u003eIn summary, our study reveals a critical and evolutionarily conserved role for PPIH in mediating RNA alternative splicing and underscores its essential function in maintaining sperm flagellum structural and functional integrity. However, there are some limitations in this research as well. Firstly, the mechanisms for why the deletion of PPIH only affects some components of snRNP are not known. Secondly, our study dominantly concentrated on the function of PPIH in alternative splicing; other potential functions of PPIH, like involving protein folding, which may also participate in spermiogenesis remained to be elucidated. Thirdly, considering the critical role of PPIH in controlling sperm flagellum assembly and male fertility, the pathological relationships between PPIH mutation and asthenozoospermia patients are not included in this study.\\u003c/p\\u003e \\u003cp\\u003eFuture study will focus on the detailed interaction between PPIH and spliceosome components, explore the role of its isomerase activity in spermatogenesis, and conduct clinical cohort studies to provide a theoretical basis for the diagnosis and treatment of male infertility.\\u003c/p\\u003e\"},{\"header\":\"Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMice\\u003c/h2\\u003e \\u003cp\\u003e All mice were maintained under specific-pathogen-free conditions and approved by the Animal Care and Use Committee at Shandong University. The \\u003cem\\u003ePpih\\u003c/em\\u003e Floxed/Floxed (\\u003cem\\u003ePpih\\u003c/em\\u003e\\u003csup\\u003e\\u003cem\\u003efl/f\\u003c/em\\u003el\\u003c/sup\\u003e) mice were purchased from Cyagen. Inc. The \\u003cem\\u003ePpih\\u003c/em\\u003e\\u003csup\\u003e\\u003cem\\u003efl/f l\\u003c/em\\u003e\\u003c/sup\\u003emice were mated with \\u003cem\\u003eStra8-CreGFP\\u003c/em\\u003e transgenic mice [\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e] to obtain the mouse model with \\u003cem\\u003ePpih-specific\\u003c/em\\u003e deletion in the germ cell lines. The genotype of \\u003cem\\u003ePpih\\u003c/em\\u003e\\u003csup\\u003e\\u003cem\\u003efl/fl\\u003c/em\\u003e\\u003c/sup\\u003e\\u003cem\\u003eStra8-CreGFP\\u003c/em\\u003e was used as mutants and was referred to as \\u003cem\\u003ePpih\\u003c/em\\u003e cKO. The genotypes of \\u003cem\\u003ePpih\\u003c/em\\u003e\\u003csup\\u003e\\u003cem\\u003efl/fl\\u003c/em\\u003e\\u003c/sup\\u003e were used as the WT control. Genotyping of \\u003cem\\u003ePpih\\u003c/em\\u003e was performed by PCR of mouse tail genomic DNA with forward primer: 5-TGTATTGCAGAAACGATGCCAAG\\u0026thinsp;\\u0026minus;\\u0026thinsp;3, and reverse primer: 5- CTAGCAACGGTAACTAGCAAAGC\\u0026thinsp;\\u0026minus;\\u0026thinsp;3 were used to detect the wild-type allele (615 bp) and the floxed allele (467 bp). The \\u003cem\\u003eStra8-Cre\\u003c/em\\u003e was genotyped with forward primer (5- ACTCCAAGCACTGGGCAGAA-3) and reverse primer1 (5- GCCACCATAGCAGCATCAAA\\u0026thinsp;\\u0026minus;\\u0026thinsp;3) and 2(5- CGTTTACGTCGCCGTCCAG\\u0026thinsp;\\u0026minus;\\u0026thinsp;3), with the wild type allele being 240 bp and the insert allele being. The annealing temperature of all primers was 60℃.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eFertility test\\u003c/h2\\u003e \\u003cp\\u003eFor the \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mouse lines (8\\u0026ndash;12 weeks), the fertility (pups/plugs) of three males and four females was tested. For male mice, each was housed with three WT females (8-week-old), and two \\u003cem\\u003ePpih\\u003c/em\\u003e cKO females were caged with a WT male mouse for 2 months. The presence of vaginal plugs and the number of offspring were counted every weekday.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eHistological analysis\\u003c/h2\\u003e \\u003cp\\u003eTestis and epididymis specimens were immersed in Bouin\\u0026rsquo;s Fixative (HT10132, Sigma-Aldrich) overnight at room temperature. After gradual dehydration, specimens were embedded in a paraffin block and sliced into sections with a thickness of 5\\u0026micro;m. Sections were dewaxed, stained with hematoxylin for 10 minutes and 1% eosin for 30 seconds, with a brief wash by tap water after each step. The sections were imaged with an Olympus BX53 microscope.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImmunohistochemistry (IHC) and immunocytochemistry (ICC)\\u003c/h2\\u003e \\u003cp\\u003eFor immunostaining, testes from control and \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice were isolated and fixed in 4% PFA overnight at 4℃. Dehydration and section were done as previous describe. After dewaxing and hydration, the sections were boiled in citrate antigen retrieval solution (0.01 M citric acid/sodium citrate, pH 6.0) for 15 mins in the boiling water. After free cooling to RT, the sections were washed with PBS (pH 7.4) three times and blocked with 3% BSA in PBS for 1 hr at RT. Then, the sections were incubated with the primary antibody diluted with 3% BSA overnight at 4℃. On the second day, the sections were washed with PBS three times and incubated with the secondary antibody diluted with 3% BSA for 1 hr at RT. After washing in PBS three times, the sections were mounted with Antifade Mounting Medium with DAPI (P0131, Eeyotime). The immunofluorescence staining was imaged with a laser scanning confocal microscope LSM880 (Leica, Germany). For ICC, spermatozoa and spermatids were spread onto slides and were air-dried before fixation with 4% PFA for 15min at room temperature. The slides were washed with PBS, blocked, probed with antibodies, and mounted as described in IHC. The antibodies used in IHC and ICC are listed in Supplementary List 1.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRNA extraction and qRT-PCR\\u003c/h2\\u003e \\u003cp\\u003eTotal RNA was extracted from whole testes or enriched cells using TRIzol\\u0026trade; Reagent (Cat: 15596018, Invitrogen) following the manufacturer\\u0026rsquo;s instructions. 1 ug of total RNA was reverse-transcribed into cDNA using FastKing gDNA Dispelling RT SuperMix (Cat: KR118, Tiangen) according to the manufacturer\\u0026rsquo;s protocol. qRT-PCR was performed using an 2\\u0026times; qPCR MasterMix (Cat: GKT211-03, Tiangen) on a LightCycler 480 instrument (Q7). Relative gene expression was analyzed based on the 2\\u0026thinsp;\\u0026minus;\\u0026thinsp;ΔΔCt method with \\u003cem\\u003eGapdh\\u003c/em\\u003e as an internal control. At least three independent experiments were analyzed. Primers were listed in \\u003cem\\u003eSupplementary Table\\u0026nbsp;2.\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eWestern blot (WB)\\u003c/h2\\u003e \\u003cp\\u003eWB was performed as previously described with a little modification[\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. The protein from testes, epidermal, or enriched cells was extracted by RIPK lysis buffer [1% Triton X-100, 50mM NaCl, 20mM Tris-HCl, 1\\u0026times; protease inhibitor cocktail (Cat:12352204, Rocher), 1mM PMSF (Cat: 10837091001, Merck), 1 mM DTT (Cat: R0861, Thermofisher)]. After incubating on ice for 15 min, the solution was centrifuged at 4\\u0026deg;C, 12,000 rpm for 10 min. The supernatant was boiled at 95 for 10 min before used for immunoblotting analysis. The primary antibodies used in this study are indicated in \\u003cem\\u003eSupplementary Table\\u0026nbsp;1.\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eImmunoprecipitation (IP)\\u003c/h2\\u003e \\u003cp\\u003eMagnetic bead-based IP was performed. Testes protein was extracted using NP40 lysis buffer (Cat: P0013F, Beyotime). Supernatant was equally used to IP using the Magnetic beads (Cat: HY-K0202, MEC). IP was carried out under the recommended protocol of the manufacturer. The IP product was subjected to immunoblotting or MS analyses.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eRNA sequencing\\u003c/h2\\u003e \\u003cp\\u003eFACE-sorted round and elongated spermatids were collected from control and \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice.\\u003c/p\\u003e \\u003cp\\u003eThe RNA-seq experiment was performed in three biological replications. Total RNA was isolated using the TRIzol\\u0026trade; Reagent (Cat: 15596018, Invitrogen) according to the manufacturer\\u0026rsquo;s protocol and treated with DNase I (Cat: M0303S, NEB) to remove residual genomic DNA. A total amount of 1 \\u0026micro;g of RNA per sample was used to prepare cDNA libraries generated using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) following the manufacturer\\u0026rsquo;s instructions. 6 G base pairs (raw data) were generated by Illumina Novaseq 6000 for each cDNA library. The adaptor sequence and sequences with a high content of unknown bases or low-quality reads were removed to produce the clean reads used for bioinformatic analysis.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eTestes digestion and generation of cell suspensions\\u003c/h2\\u003e \\u003cp\\u003eTestes from adult mice were used to generate single-cell suspensions following enzymatic digestion as described previously[\\u003cspan citationid=\\\"CR84\\\" class=\\\"CitationRef\\\"\\u003e84\\u003c/span\\u003e]. In brief, testes were collected from WT control and \\u003cem\\u003ePpih\\u003c/em\\u003e cKO mice and the tunica albuginea. Then, the testes were digested with 5 ml collagenase I (Cat: 17100017, Thermofisher) for 6 min at 37\\u0026deg;C. Gently passing the supernatant to a 40 \\u0026micro;m pore size cell strainer, with about 1 ml solution remaining. Then, adding 4 ml PBS and 5 ml 0.25% trypsin/EDTA (Cat: 25200056, Thermofisher) for 8 min at 37\\u0026deg;C, followed by the addition of 0.5 ml 10% FBS (Cat: 16000044, Thermofisher). Single-cell suspensions were made by gently repeated pipetting and passed through a 40-\\u0026micro;m pore size cell strainer. The cells are centrifuged at 500 g for 5 min at 4\\u0026deg;C and resuspended with 2 ml DMEM (Cat: 10-017-CM, Corning) for FACS selection.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eLinear amplification of complementary DNA ends and sequencing\\u003c/h2\\u003e \\u003cp\\u003ePPIH and DDX23 LACE-seq were performed based on a previously described protocol with some modifications[\\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e61\\u003c/span\\u003e]. Briefly, testes cells were collected into 1.5 ml microcentrifuge tubes with 5 \\u0026micro;l of 1\\u0026times;PBS (pH 7.4). The cells were irradiated twice with 0.40 J cm\\u0026thinsp;\\u0026minus;\\u0026thinsp;2 UV light (254 nm) in a CL-1000 ultraviolet crosslinker (UVP). 10 \\u0026micro;l of protein A/G magnetic beads were washed twice with BSA/PBS solution. and incubated with 200 \\u0026micro;l blocking buffer at RT for 1 hr. After washing the blocked beads, 5 \\u0026micro;g PPIH, DDX23 antibody, or IgG were added and incubated at RT for 1 h. The antibody-coupled beads were washed twice, and cross-linked samples were added after lysed on ice. After removal of genomic DNA, 10 \\u0026micro;l of antibody-coupled beads were added to the lysate and incubated at 4\\u0026deg;C overnight. Bead-bound antibody-RNA complexes were then washed twice, and the immunoprecipitated RNAs were fragmented with micrococcal nuclease for 3 min at 37\\u0026deg;C. The RNA 3\\u0026rsquo; ends were dephosphorylated on beads with FastAP alkaline phosphatase. After washing, the 3\\u0026rsquo; linker was ligated with T4 RNA ligase 2 for 2.5 hr at RT. RNA was reverse transcribed with Superscript II reverse transcriptase. First-strand cDNA was released from Protein A/G beads by treatment with RNase H and captured by streptavidin C1 beads. The cDNA 3\\u0026rsquo; linker was ligated with T4 RNA ligase 1 overnight at RT. Then, cDNA was pre-amplified using KAPA HiFi HotStart ReadyMix, and PCR products were purified with Ampure XP beads. After in vitro transcription, RNA was purified with Agencourt RNA Clean beads. After reverse transcription and indexed PCR, the PCR products were size-selected on a 2% agarose gel, and regions corresponding to 250\\u0026ndash;500 bp were purified using the Gel Extraction Kit. The LACE-seq library was paired-end sequenced using Illumina NovaSeq 6000 at Novogene.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDifferential splicing analysis and validation\\u003c/h2\\u003e \\u003cp\\u003eDifferential splicing events of RNA-seq data were analyzed using rMATS software with the standard protocol[\\u003cspan citationid=\\\"CR85\\\" class=\\\"CitationRef\\\"\\u003e85\\u003c/span\\u003e]. The rMATS software can identify the five common modes of AS events and obtain accurate splicing change quantification between WT and \\u003cem\\u003ePpih\\u003c/em\\u003e cKO samples. We used p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 and |ΔPSI |\\u0026gt;0.1 as the threshold to filter for significantly differential splicing events. For differential splicing events validation, we first imported the differentially spliced sites of interesting functional genes analyzed by rMATS into the integrative genomics viewer tool to efficiently and flexibly visualize and explore spliced sites between WTand \\u003cem\\u003ePpih\\u003c/em\\u003e cKO samples. The primers for differentially spliced exons were designed using Primer5. Primers were designed within constitutive exons flanking the differentially spliced exons. Standard PCR for analysis by gel electrophoresis was performed according to the manufacturer\\u0026rsquo;s instructions and visualized by running on a 2% agarose gel. All primers were listed in \\u003cem\\u003eSupplementary Table\\u0026nbsp;2\\u003c/em\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eAll experiments were performed at least three times. At least three independent biological samples were collected for the quantitative experiments. Quantification of positively stained cells was performed from at least three independent fields of view. Paired two-tailed Student\\u0026rsquo;s t-test was used for statistical analysis, and data were presented as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;SEM. * Represent p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, ** represent p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01 and *** represent p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001. p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered a significant difference level. Equal variances were not formally tested. No statistical method was used to predetermine sample sizes.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAvailability of data and materials\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll data generated or analysed during this study are included in this published article, its supplementary information files and publicly available repositories. The RNA-seq and LACE-seq data were deposited in GEO (https:// www. ncbi. nlm.nih. gov/ geo/). The individual data values for Figs.1, 4, 5, and 6 are provided in Additional Excels.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank Tao Yan and Xiao Luo for doing some FACE and Cryostat Sectioning experiments. We appreciate the experimental discussion with Wencheng Zhu. Additionally, we appreciate the support provided by the Translational Medicine Core Facility of Shandong University for consultation and instrument use.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by the Science Foundation for Young Scholars of Shandong (ZR2024QH543\\u0026nbsp;);\\u0026nbsp;the National Natural Science Foundation of China (82495190, 82371618); the National Key Research and Development Program of China (2024YFC2706804); the Taishan Scholars Program of Shandong Province（tsqn202408397）.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eConceptualization, Q. Z and T.H; Experimental Q.Z., Z.Q.W., K.S.G and B.Y.L; Formal analysis, Q. Z., X.Y.W and S.Y. W, C.Q.H; IP-MS was done by Q.Z., S.H.J; Supervision, T.H, and H.B.L; Funding acquisition, Q.Z and T.H; Manuscript preparation, Q. Z and T.H., with the assistance of the other authors. All authors reviewed and approved the final manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no competing interests\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eLohan, M., et al., \\u003cem\\u003eGlobal research priority-setting exercise on the sexual and reproductive health and rights of young adolescents.\\u003c/em\\u003e Lancet Child \\u0026amp; Adolescent Health, 2025. \\u003cstrong\\u003e9\\u003c/strong\\u003e(10): p. 724-734.\\u003c/li\\u003e\\n\\u003cli\\u003eEisenberg, M.L., et al., \\u003cem\\u003eMale infertility.\\u003c/em\\u003e Nature Reviews Disease Primers, 2023. \\u003cstrong\\u003e9\\u003c/strong\\u003e(1).\\u003c/li\\u003e\\n\\u003cli\\u003eJiao, S.Y., Y.H. Yang, and S.R. Chen, \\u003cem\\u003eMolecular genetics of infertility: loss-of-function mutations in humans and corresponding knockout/mutated mice.\\u003c/em\\u003e Human Reproduction Update, 2021. \\u003cstrong\\u003e27\\u003c/strong\\u003e(1): p. 154-189.\\u003c/li\\u003e\\n\\u003cli\\u003eSassoneCorsi, P., \\u003cem\\u003eTranscriptional checkpoints determining the fate of male germ cells.\\u003c/em\\u003e Cell, 1997. \\u003cstrong\\u003e88\\u003c/strong\\u003e(2): p. 163-166.\\u003c/li\\u003e\\n\\u003cli\\u003eSalicioni, A.M., et al., \\u003cem\\u003eTestis-specific serine kinase protein family in male fertility and as targets for non-hormonal male contraception.\\u003c/em\\u003e Biology of Reproduction, 2020. \\u003cstrong\\u003e103\\u003c/strong\\u003e(2): p. 264-274.\\u003c/li\\u003e\\n\\u003cli\\u003eStruijk, R.B., et al., \\u003cem\\u003eSimultaneous Purification of Round and Elongated Spermatids from Testis Tissue Using a FACS-Based DNA Ploidy Assay.\\u003c/em\\u003e Cytometry Part A, 2019. \\u003cstrong\\u003e95a\\u003c/strong\\u003e(3): p. 309-313.\\u003c/li\\u003e\\n\\u003cli\\u003eZhang, X.G., et al., \\u003cem\\u003eCEP112 coordinates translational regulation of essential fertility genes during spermiogenesis through phase separation in humans and mice.\\u003c/em\\u003e Nature Communications, 2024. \\u003cstrong\\u003e15\\u003c/strong\\u003e(1).\\u003c/li\\u003e\\n\\u003cli\\u003eBettegowda, A. and M.F. Wilkinson, \\u003cem\\u003eTranscription and post-transcriptional regulation of spermatogenesis.\\u003c/em\\u003e Philosophical Transactions of the Royal Society B-Biological Sciences, 2010. \\u003cstrong\\u003e365\\u003c/strong\\u003e(1546): p. 1637-1651.\\u003c/li\\u003e\\n\\u003cli\\u003eZhu, T.Y., et al., \\u003cem\\u003eStage-Resolved Phosphoproteomic Landscape of Mouse Spermiogenesis Reveals Key Kinase Signaling in Sperm Morphogenesis.\\u003c/em\\u003e Advanced Science, 2025. \\u003cstrong\\u003e12\\u003c/strong\\u003e(44).\\u003c/li\\u003e\\n\\u003cli\\u003eMacLean, J.I.I. and M.F. Wilkinson, \\u003cem\\u003eGene regulation in spermatogenesis.\\u003c/em\\u003e Current Topics in Developmental Biology, Vol 71, 2005. \\u003cstrong\\u003e71\\u003c/strong\\u003e: p. 131-+.\\u003c/li\\u003e\\n\\u003cli\\u003eZhao, Y.Q., et al., \\u003cem\\u003eDynamic transcription and expression patterns of KIF3A and KIF3B genes during spermiogenesis in the shrimp, Palaemon carincauda.\\u003c/em\\u003e Animal Reproduction Science, 2017. \\u003cstrong\\u003e184\\u003c/strong\\u003e: p. 59-77.\\u003c/li\\u003e\\n\\u003cli\\u003eTanaka, H. and T. Baba, \\u003cem\\u003eGene expression in spermiogenesis.\\u003c/em\\u003e Cellular and Molecular Life Sciences, 2005. \\u003cstrong\\u003e62\\u003c/strong\\u003e(3): p. 344-354.\\u003c/li\\u003e\\n\\u003cli\\u003eMarasco, L.E. and A.R. Kornblihtt, \\u003cem\\u003eThe physiology of alternative splicing.\\u003c/em\\u003e Nature Reviews Molecular Cell Biology, 2023. \\u003cstrong\\u003e24\\u003c/strong\\u003e(4): p. 242-254.\\u003c/li\\u003e\\n\\u003cli\\u003eShi, Y.G., \\u003cem\\u003eMechanistic insights into precursor messenger RNA splicing by the spliceosome.\\u003c/em\\u003e Nature Reviews Molecular Cell Biology, 2017. \\u003cstrong\\u003e18\\u003c/strong\\u003e(11): p. 655-670.\\u003c/li\\u003e\\n\\u003cli\\u003eAdams, B.M., et al., \\u003cem\\u003eNuclear cyclophilins affect spliceosome assembly and function.\\u003c/em\\u003e Biochemical Journal, 2015. \\u003cstrong\\u003e469\\u003c/strong\\u003e: p. 223-233.\\u003c/li\\u003e\\n\\u003cli\\u003eShi, Y.G., \\u003cem\\u003eThe Spliceosome: A Protein-Directed Metalloribozyme.\\u003c/em\\u003e Journal of Molecular Biology, 2017. \\u003cstrong\\u003e429\\u003c/strong\\u003e(17): p. 2640-2653.\\u003c/li\\u003e\\n\\u003cli\\u003eLerner, M.R., et al., \\u003cem\\u003eAre Snrnps Involved in Splicing.\\u003c/em\\u003e Nature, 1980. \\u003cstrong\\u003e283\\u003c/strong\\u003e(5743): p. 220-224.\\u003c/li\\u003e\\n\\u003cli\\u003eHinterberger, M., I. Pettersson, and J.A. Steitz, \\u003cem\\u003eIsolation of Small Nuclear Ribonucleoproteins Containing U1, U2, U4, U5, and U6 Rnas.\\u003c/em\\u003e Journal of Biological Chemistry, 1983. \\u003cstrong\\u003e258\\u003c/strong\\u003e(4): p. 2604-2613.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, E.T., et al., \\u003cem\\u003eAlternative isoform regulation in human tissue transcriptomes.\\u003c/em\\u003e Nature, 2008. \\u003cstrong\\u003e456\\u003c/strong\\u003e(7221): p. 470-476.\\u003c/li\\u003e\\n\\u003cli\\u003eLiu, W.B., et al., \\u003cem\\u003eBCAS2 is involved in alternative mRNA splicing in spermatogonia and the transition to meiosis.\\u003c/em\\u003e Nature Communications, 2017. \\u003cstrong\\u003e8\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, S.Y., et al., \\u003cem\\u003eCWF19L2 is Essential for Male Fertility and Spermatogenesis by Regulating Alternative Splicing.\\u003c/em\\u003e Journal of Urology, 2025. \\u003cstrong\\u003e213\\u003c/strong\\u003e(4).\\u003c/li\\u003e\\n\\u003cli\\u003eHannigan, M.M., L.L. Zagore, and D.D. Licatalosi, \\u003cem\\u003ePtbp2 Controls an Alternative Splicing Network Required for Cell Communication during Spermatogenesis.\\u003c/em\\u003e Cell Reports, 2017. \\u003cstrong\\u003e19\\u003c/strong\\u003e(12): p. 2598-2612.\\u003c/li\\u003e\\n\\u003cli\\u003eLiu, W.B., et al., \\u003cem\\u003eSRSF10 is essential for progenitor spermatogonia expansion by regulating alternative splicing.\\u003c/em\\u003e Elife, 2022. \\u003cstrong\\u003e11\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, Y.X., et al., \\u003cem\\u003ePTBP1 mediates Sertoli cell actin cytoskeleton organization by regulating alternative splicing of actin regulators.\\u003c/em\\u003e Nucleic Acids Research, 2024. \\u003cstrong\\u003e52\\u003c/strong\\u003e(20): p. 12244-12261.\\u003c/li\\u003e\\n\\u003cli\\u003ePark, S., et al., \\u003cem\\u003eSuppression of regulates pluripotency, proliferation, and differentiation in mouse embryonic stem cells.\\u003c/em\\u003e Cell Biochemistry and Function, 2019. \\u003cstrong\\u003e37\\u003c/strong\\u003e(8): p. 608-617.\\u003c/li\\u003e\\n\\u003cli\\u003eWu, H., et al., \\u003cem\\u003eMajor spliceosome defects cause male infertility and are associated with nonobstructive azoospermia in humans.\\u003c/em\\u003e Proceedings of the National Academy of Sciences of the United States of America, 2016. \\u003cstrong\\u003e113\\u003c/strong\\u003e(15): p. 4134-4139.\\u003c/li\\u003e\\n\\u003cli\\u003eMa, S.S., et al., \\u003cem\\u003eMolecular Basis for Hormone Recognition and Activation of Corticotropin-Releasing Factor Receptors.\\u003c/em\\u003e Molecular Cell, 2020. \\u003cstrong\\u003e77\\u003c/strong\\u003e(3): p. 669-+.\\u003c/li\\u003e\\n\\u003cli\\u003eRassow, J., et al., \\u003cem\\u003eCyclophilin-20 Is Involved in Mitochondrial Protein-Folding in Cooperation with Molecular Chaperones Hsp7o and Hsp60.\\u003c/em\\u003e Molecular and Cellular Biology, 1995. \\u003cstrong\\u003e15\\u003c/strong\\u003e(5): p. 2654-2662.\\u003c/li\\u003e\\n\\u003cli\\u003eTeigelkamp, S., et al., \\u003cem\\u003eThe 20kD protein of human [U4/U6.U5] tri-snRNPs is a novel cyclophilin that forms a complex with the U4/UG-specific 60kD and 90kD proteins.\\u003c/em\\u003e Rna, 1998. \\u003cstrong\\u003e4\\u003c/strong\\u003e(2): p. 127-141.\\u003c/li\\u003e\\n\\u003cli\\u003eIngelfinger, D., et al., \\u003cem\\u003eTwo protein-protein interaction sites on the spliceosome-associated human cyclophilin CypH.\\u003c/em\\u003e Nucleic Acids Research, 2003. \\u003cstrong\\u003e31\\u003c/strong\\u003e(16): p. 4791-4796.\\u003c/li\\u003e\\n\\u003cli\\u003eSoumillon, M., et al., \\u003cem\\u003eCellular Source and Mechanisms of High Transcriptome Complexity in the Mammalian Testis.\\u003c/em\\u003e Cell Reports, 2013. \\u003cstrong\\u003e3\\u003c/strong\\u003e(6): p. 2179-2190.\\u003c/li\\u003e\\n\\u003cli\\u003eZuo, H.Y., et al., \\u003cem\\u003eTranscriptomic Variation during Spermiogenesis in Mouse Germ Cells.\\u003c/em\\u003e Plos One, 2016. \\u003cstrong\\u003e11\\u003c/strong\\u003e(11).\\u003c/li\\u003e\\n\\u003cli\\u003eSong, H.B., et al., \\u003cem\\u003eThe Function of Pre-mRNA Alternative Splicing in Mammal Spermatogenesis.\\u003c/em\\u003e International Journal of Biological Sciences, 2020. \\u003cstrong\\u003e16\\u003c/strong\\u003e(1): p. 38-48.\\u003c/li\\u003e\\n\\u003cli\\u003eJiang, N., et al., \\u003cem\\u003eThe Intricate Functional Networks of Pre-mRNA Alternative Splicing in Mammalian Spermatogenesis.\\u003c/em\\u003e International Journal of Molecular Sciences, 2024. \\u003cstrong\\u003e25\\u003c/strong\\u003e(22).\\u003c/li\\u003e\\n\\u003cli\\u003eBeusch, I. and H.D. Madhani, \\u003cem\\u003eUnderstanding the dynamic design of the spliceosome.\\u003c/em\\u003e Trends in Biochemical Sciences, 2024. \\u003cstrong\\u003e49\\u003c/strong\\u003e(7): p. 583-595.\\u003c/li\\u003e\\n\\u003cli\\u003eChen, Y., et al., \\u003cem\\u003eSingle-cell RNA-seq uncovers dynamic processes and critical regulators in mouse spermatogenesis.\\u003c/em\\u003e Cell Research, 2018. \\u003cstrong\\u003e28\\u003c/strong\\u003e(9): p. 879-896.\\u003c/li\\u003e\\n\\u003cli\\u003eWan, R.X., et al., \\u003cem\\u003eThe 3.8 \\u0026Aring; structure of the U4/U6.U5 tri-snRNP: Insights into spliceosome assembly and catalysis.\\u003c/em\\u003e Science, 2016. \\u003cstrong\\u003e351\\u003c/strong\\u003e(6272): p. 466-475.\\u003c/li\\u003e\\n\\u003cli\\u003eChen, Z., et al., \\u003cem\\u003eIdentification of a 35S U4/U6.U5 tri-small nuclear ribonucleoprotein (tri-snRNP) complex intermediate in spliceosome assembly.\\u003c/em\\u003e Journal of Biological Chemistry, 2017. \\u003cstrong\\u003e292\\u003c/strong\\u003e(44): p. 18113-18128.\\u003c/li\\u003e\\n\\u003cli\\u003eReidt, U., et al., \\u003cem\\u003eCrystal structure of a complex between human spliceosomal cyclophilin H and a U4/U6 snRNP-60K peptide.\\u003c/em\\u003e Journal of Molecular Biology, 2003. \\u003cstrong\\u003e331\\u003c/strong\\u003e(1): p. 45-56.\\u003c/li\\u003e\\n\\u003cli\\u003eBurns, W., et al., \\u003cem\\u003eSyndromic neurodevelopmental disorder associated with de novo variants in.\\u003c/em\\u003e American Journal of Medical Genetics Part A, 2021. \\u003cstrong\\u003e185\\u003c/strong\\u003e(10): p. 2863-2872.\\u003c/li\\u003e\\n\\u003cli\\u003eXiong, X.X., et al., \\u003cem\\u003ehnRNPC Functions with HuR to Regulate Alternative Splicing in an m6A-Dependent Manner and is Essential for Meiosis.\\u003c/em\\u003e Advanced Science, 2025. \\u003cstrong\\u003e12\\u003c/strong\\u003e(13).\\u003c/li\\u003e\\n\\u003cli\\u003eWang, J., et al., \\u003cem\\u003eGene encoding Hsp70 chaperone BiP in the endoplasmic reticulum.\\u003c/em\\u003e Gene, 2017. \\u003cstrong\\u003e618\\u003c/strong\\u003e: p. 14-23.\\u003c/li\\u003e\\n\\u003cli\\u003eSkarnes, W.C., et al., \\u003cem\\u003eA conditional knockout resource for the genome-wide study of mouse gene function.\\u003c/em\\u003e Nature, 2011. \\u003cstrong\\u003e474\\u003c/strong\\u003e(7351): p. 337-U361.\\u003c/li\\u003e\\n\\u003cli\\u003eLin, Z., et al., \\u003cem\\u003eMettl3-/Mettl14-mediated mRNA-methyladenosine modulates murine spermatogenesis.\\u003c/em\\u003e Cell Research, 2017. \\u003cstrong\\u003e27\\u003c/strong\\u003e(10): p. 1216-1230.\\u003c/li\\u003e\\n\\u003cli\\u003eCheng, F.P., et al., \\u003cem\\u003eUse of peanut agglutinin to assess the acrosomal status and the zona pellucida-induced acrosome reaction in stallion spermatozoa.\\u003c/em\\u003e Journal of Andrology, 1996. \\u003cstrong\\u003e17\\u003c/strong\\u003e(6): p. 674-682.\\u003c/li\\u003e\\n\\u003cli\\u003eFr\\u0026ouml;jdman, K., V.R. Harley, and L.J. Pelliniemi, \\u003cem\\u003eSox9 protein in rat Sertoli cells is age and stage dependent.\\u003c/em\\u003e Histochemistry and Cell Biology, 2000. \\u003cstrong\\u003e113\\u003c/strong\\u003e(1): p. 31-36.\\u003c/li\\u003e\\n\\u003cli\\u003eBuaas, F.W., et al., \\u003cem\\u003ePlzf is required in adult male germ cells for stem cell self-renewal.\\u003c/em\\u003e Nature Genetics, 2004. \\u003cstrong\\u003e36\\u003c/strong\\u003e(6): p. 647-652.\\u003c/li\\u003e\\n\\u003cli\\u003eTurner, R.M., \\u003cem\\u003eMoving to the beat: a review of mammalian sperm motility regulation.\\u003c/em\\u003e Reproduction Fertility and Development, 2006. \\u003cstrong\\u003e18\\u003c/strong\\u003e(1-2): p. 25-38.\\u003c/li\\u003e\\n\\u003cli\\u003eFreitas, M.J., S. Vijayaraghavan, and M. Fardilha, \\u003cem\\u003eSignaling mechanisms in mammalian sperm motility.\\u003c/em\\u003e Biology of Reproduction, 2017. \\u003cstrong\\u003e96\\u003c/strong\\u003e(1): p. 2-12.\\u003c/li\\u003e\\n\\u003cli\\u003eJanke, C. and M.M. Magiera, \\u003cem\\u003eThe tubulin code and its role in controlling microtubule properties and functions.\\u003c/em\\u003e Nature Reviews Molecular Cell Biology, 2020. \\u003cstrong\\u003e21\\u003c/strong\\u003e(6): p. 307-326.\\u003c/li\\u003e\\n\\u003cli\\u003eShinoda, T., et al., \\u003cem\\u003eConformational alteration of DOCK5\\u0026bull;ELMO1 signalosome on lipid membrane.\\u003c/em\\u003e Communications Biology, 2025. \\u003cstrong\\u003e8\\u003c/strong\\u003e(1).\\u003c/li\\u003e\\n\\u003cli\\u003eSan Agustin, J.T., G.J. Pazour, and G.B. Witman, \\u003cem\\u003eIntraflagellar transport is essential for mammalian spermiogenesis but is absent in mature sperm.\\u003c/em\\u003e Molecular Biology of the Cell, 2015. \\u003cstrong\\u003e26\\u003c/strong\\u003e(24): p. 4358-4372.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, X.L., et al., \\u003cem\\u003eTssk4 is essential for maintaining the structural integrity of sperm flagellum.\\u003c/em\\u003e Molecular Human Reproduction, 2015. \\u003cstrong\\u003e21\\u003c/strong\\u003e(2): p. 136-145.\\u003c/li\\u003e\\n\\u003cli\\u003eJannatifar, R., et al., \\u003cem\\u003eThe correlation of Septin4 gene expression with sperm quality, DNA damage, and oxidative stress level in infertile patients.\\u003c/em\\u003e Anatomy \\u0026amp; Cell Biology, 2023. \\u003cstrong\\u003e56\\u003c/strong\\u003e(4): p. 518-525.\\u003c/li\\u003e\\n\\u003cli\\u003eLi, Y.M., et al., \\u003cem\\u003eSpliceosome-regulated RSRP1-dependent NF-\\u0026kappa;B activation promotes the glioblastoma mesenchymal phenotype.\\u003c/em\\u003e Neuro-Oncology, 2021. \\u003cstrong\\u003e23\\u003c/strong\\u003e(10): p. 1693-1708.\\u003c/li\\u003e\\n\\u003cli\\u003eKamps-Hughes, N., et al., \\u003cem\\u003eA Systematic Method for Detecting Abnormal mRNA Splicing and Assessing Its Clinical Impact in Individuals Undergoing Genetic Testing for Hereditary Cancer Syndromes.\\u003c/em\\u003e Journal of Molecular Diagnostics, 2023. \\u003cstrong\\u003e25\\u003c/strong\\u003e(3): p. 156-167.\\u003c/li\\u003e\\n\\u003cli\\u003eFrischmeyer, P.A., et al., \\u003cem\\u003eAn mRNA surveillance mechanism that eliminates transcripts lacking termination codons.\\u003c/em\\u003e Science, 2002. \\u003cstrong\\u003e295\\u003c/strong\\u003e(5563): p. 2258-2261.\\u003c/li\\u003e\\n\\u003cli\\u003eMathew, R., et al., \\u003cem\\u003ePhosphorylation of human PRP28 by SRPK2 is required for integration of the U4/U6-U5 tri-snRNP into the spliceosome.\\u003c/em\\u003e Nature Structural \\u0026amp; Molecular Biology, 2008. \\u003cstrong\\u003e15\\u003c/strong\\u003e(5): p. 435-443.\\u003c/li\\u003e\\n\\u003cli\\u003eDuchemin, A., et al., \\u003cem\\u003eDHX15-independent roles for TFIP11 in U6 snRNA modification, U4/U6.U5 tri-snRNP assembly and pre-mRNA splicing fidelity.\\u003c/em\\u003e Nature Communications, 2021. \\u003cstrong\\u003e12\\u003c/strong\\u003e(1).\\u003c/li\\u003e\\n\\u003cli\\u003eMorris, G.E., \\u003cem\\u003eThe Cajal body.\\u003c/em\\u003e Biochimica Et Biophysica Acta-Molecular Cell Research, 2008. \\u003cstrong\\u003e1783\\u003c/strong\\u003e(11): p. 2108-2115.\\u003c/li\\u003e\\n\\u003cli\\u003eSu, R.B., et al., \\u003cem\\u003eGlobal profiling of RNA-binding protein target sites by LACE-seq.\\u003c/em\\u003e Nature Cell Biology, 2021. \\u003cstrong\\u003e23\\u003c/strong\\u003e(6): p. 664-+.\\u003c/li\\u003e\\n\\u003cli\\u003eHan, A., et al., \\u003cem\\u003ePrediction of PTBP1 Binding and Splicing Targets Reveals Unexpected Features of Its RNA Recognition and Function.\\u003c/em\\u003e Plos Computational Biology, 2014. \\u003cstrong\\u003e10\\u003c/strong\\u003e(1).\\u003c/li\\u003e\\n\\u003cli\\u003ePeart, N.J., et al., \\u003cem\\u003eThe germ cell-specific RNA binding protein RBM46 is essential for spermatogonial differentiation in mice.\\u003c/em\\u003e Plos Genetics, 2022. \\u003cstrong\\u003e18\\u003c/strong\\u003e(9).\\u003c/li\\u003e\\n\\u003cli\\u003eEhrmann, I., et al., \\u003cem\\u003eAn ancient germ cell-specific RNA-binding protein protects the germline from cryptic splice site poisoning.\\u003c/em\\u003e Elife, 2019. \\u003cstrong\\u003e8\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eIto, C., et al., \\u003cem\\u003ehaploinsufficiency causes a new type of decapitated and decaudated spermatozoa, Odf2-DDS, in mice.\\u003c/em\\u003e Scientific Reports, 2019. \\u003cstrong\\u003e9\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, X.L., et al., \\u003cem\\u003eTestis-specific serine/threonine protein kinase 4 (Tssk4) phosphorylates Odf2 at Ser-76.\\u003c/em\\u003e Scientific Reports, 2016. \\u003cstrong\\u003e6\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eRahban, R. and S. Nef, \\u003cem\\u003eCatSper: The complex main gate of calcium entry in mammalian spermatozoa.\\u003c/em\\u003e Molecular and Cellular Endocrinology, 2020. \\u003cstrong\\u003e518\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eSwain, D.K., et al., \\u003cem\\u003eThe essential calcium channel of sperm CatSper is temperature-gated.\\u003c/em\\u003e Nature Communications, 2025. \\u003cstrong\\u003e16\\u003c/strong\\u003e(1).\\u003c/li\\u003e\\n\\u003cli\\u003ePaushkin, S., et al., \\u003cem\\u003eThe SMN complex, an assemblyosome of ribonucleoproteins.\\u003c/em\\u003e Current Opinion in Cell Biology, 2002. \\u003cstrong\\u003e14\\u003c/strong\\u003e(3): p. 305-312.\\u003c/li\\u003e\\n\\u003cli\\u003eHu, C., et al., \\u003cem\\u003eHeat shock proteins: Biological functions, pathological roles, and therapeutic opportunities.\\u003c/em\\u003e Medcomm, 2022. \\u003cstrong\\u003e3\\u003c/strong\\u003e(3).\\u003c/li\\u003e\\n\\u003cli\\u003eDavis, T.L., et al., \\u003cem\\u003eStructural and Biochemical Characterization of the Human Cyclophilin Family of Peptidyl-Prolyl Isomerases.\\u003c/em\\u003e Plos Biology, 2010. \\u003cstrong\\u003e8\\u003c/strong\\u003e(7).\\u003c/li\\u003e\\n\\u003cli\\u003eBreitbart, H. and M. Finkelstein, \\u003cem\\u003eActin cytoskeleton and sperm function.\\u003c/em\\u003e Biochemical and Biophysical Research Communications, 2018. \\u003cstrong\\u003e506\\u003c/strong\\u003e(2): p. 372-377.\\u003c/li\\u003e\\n\\u003cli\\u003eYogo, K., \\u003cem\\u003eMolecular basis of the morphogenesis of sperm head and tail in mice.\\u003c/em\\u003e Reproductive Medicine and Biology, 2022. \\u003cstrong\\u003e21\\u003c/strong\\u003e(1).\\u003c/li\\u003e\\n\\u003cli\\u003eIwamori, N., et al., \\u003cem\\u003eMRG15 is required for pre-mRNA splicing and spermatogenesis.\\u003c/em\\u003e Proceedings of the National Academy of Sciences of the United States of America, 2016. \\u003cstrong\\u003e113\\u003c/strong\\u003e(37): p. E5408-E5415.\\u003c/li\\u003e\\n\\u003cli\\u003eLegrand, J.M.D., et al., \\u003cem\\u003eDDX5 plays essential transcriptional and post-transcriptional roles in the maintenance and function of spermatogonia.\\u003c/em\\u003e Nature Communications, 2019. \\u003cstrong\\u003e10\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eBrogna, S. and J.K. Wen, \\u003cem\\u003eNonsense-mediated mRNA decay (NMD) mechanisms.\\u003c/em\\u003e Nature Structural \\u0026amp; Molecular Biology, 2009. \\u003cstrong\\u003e16\\u003c/strong\\u003e(2): p. 107-113.\\u003c/li\\u003e\\n\\u003cli\\u003eMakarova, O.V., et al., \\u003cem\\u003eProtein 61K, encoded by a gene () linked to autosomal dominant retinitis pigmentosa, is required for U4/U6\\u0026bull;U5 tri-snRNP formation and pre-mRNA splicing.\\u003c/em\\u003e Embo Journal, 2002. \\u003cstrong\\u003e21\\u003c/strong\\u003e(5): p. 1148-1157.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, H.K., et al., \\u003cem\\u003eA Novel, Single, Transmembrane Protein CATSPERG Is Associated with CATSPER1 Channel Protein.\\u003c/em\\u003e Biology of Reproduction, 2009. \\u003cstrong\\u003e81\\u003c/strong\\u003e(3): p. 539-544.\\u003c/li\\u003e\\n\\u003cli\\u003eLuo, T., et al., \\u003cem\\u003eA novel copy number variation in CATSPER2 causes idiopathic male infertility with normal semen parameters.\\u003c/em\\u003e Human Reproduction, 2019. \\u003cstrong\\u003e34\\u003c/strong\\u003e(3): p. 414-+.\\u003c/li\\u003e\\n\\u003cli\\u003eHwang, J.Y., \\u003cem\\u003eAnalysis of Ca-mediated sperm motility to evaluate the functional normality of the sperm-specific Ca channel, CatSper.\\u003c/em\\u003e Frontiers in Cell and Developmental Biology, 2024. \\u003cstrong\\u003e12\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eZhao, C., et al., \\u003cem\\u003eSplicing Factor DDX23, Transcriptionally Activated by E2F1, Promotes Ovarian Cancer Progression by Regulating FOXM1.\\u003c/em\\u003e Frontiers in Oncology, 2021. \\u003cstrong\\u003e11\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eHale, B.J., et al., \\u003cem\\u003eAcyl-CoA synthetase 6 enriches seminiferous tubules with the ?-3 fatty acid docosahexaenoic acid and is required for male fertility in the mouse.\\u003c/em\\u003e Journal of Biological Chemistry, 2019. \\u003cstrong\\u003e294\\u003c/strong\\u003e(39): p. 14394-14405.\\u003c/li\\u003e\\n\\u003cli\\u003eCollodel, G., et al., \\u003cem\\u003eRelevance of Fatty Acids to Sperm Maturation and Quality.\\u003c/em\\u003e Oxidative Medicine and Cellular Longevity, 2020. \\u003cstrong\\u003e2020\\u003c/strong\\u003e.\\u003c/li\\u003e\\n\\u003cli\\u003eGaysinskaya, V., et al., \\u003cem\\u003eOptimized flow cytometry isolation of murine spermatocytes.\\u003c/em\\u003e Cytometry Part A, 2014. \\u003cstrong\\u003e85a\\u003c/strong\\u003e(6): p. 556-565.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, Y.Y., et al., \\u003cem\\u003erMATS-turbo: an efficient and flexible computational tool for alternative splicing analysis of large-scale RNA-seq data.\\u003c/em\\u003e Nature Protocols, 2024. \\u003cstrong\\u003e19\\u003c/strong\\u003e(4).\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"bmc-biology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"\",\"sideBox\":\"Learn more about [BMC Biology](https://bmcbiol.biomedcentral.com/)\",\"snPcode\":\"12915\",\"submissionUrl\":\"https://submission.springernature.com/new-submission/12915/3\",\"title\":\"BMC Biology\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"BMC Series\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-9239117/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-9239117/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eMale infertility has become an increasingly critical global issue, with abnormal spermiogenesis being a major contributor. The structural integrity of sperm is closely linked to male fertility. Alternative splicing (AS) is one of the key post-transcriptional regulation mechanisms that plays an essential role in spermatogenesis. However, the function of AS during spermiogenesis remains poorly understood. In this study, we demonstrated that peptidylprolyl isomerase H (PPIH), a component of the U4/U6 snRNP, acts as a critical AS regulator that participates in mouse spermiogenesis. Germ-cell-specific knock-out of \\u003cem\\u003ePpih\\u003c/em\\u003e in mice results in abnormal sperm morphology and male infertility. Mechanistically, PPIH affects the expression of spliceosome components and the assembly of the spliceosome, especially the organization of the U4/U6. U5 tri-snRNP complex. By doing so, PPIH mediates the expression of genes associated with sperm flagellum formation and motility (e.g., \\u003cem\\u003eTssk4\\u003c/em\\u003e, \\u003cem\\u003eSept4\\u003c/em\\u003e, \\u003cem\\u003eIft88\\u003c/em\\u003e) via AS. Additionally, PPIH can directly bind to the genes of \\u003cem\\u003eOdf2\\u003c/em\\u003e, \\u003cem\\u003eCatsperg1, 2\\u003c/em\\u003e, and \\u003cem\\u003eU2af1\\u003c/em\\u003e, regulating their transcription through AS. Taken together, our research identified PPIH as a pivotal regulator of AS during sperm maturation and an essential factor for male fertility.\\u003c/p\\u003e\",\"manuscriptTitle\":\"PPIH, a component of U4/U6 snRNP, regulates spermiogenesis by alternative splicing\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-04-27 15:53:34\",\"doi\":\"10.21203/rs.3.rs-9239117/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-05T14:33:47+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-01T03:44:25+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-04-23T14:01:05+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"264325589782478933269714827823166112967\",\"date\":\"2026-04-23T08:55:15+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"128895660588663437398315389122921272647\",\"date\":\"2026-04-21T01:40:30+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"154536467546152999076162644000830954706\",\"date\":\"2026-04-19T05:38:59+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2026-04-18T11:20:32+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2026-03-27T16:33:42+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2026-03-27T04:41:41+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"BMC Biology\",\"date\":\"2026-03-27T02:07:42+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"bmc-biology\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"\",\"sideBox\":\"Learn more about [BMC Biology](https://bmcbiol.biomedcentral.com/)\",\"snPcode\":\"12915\",\"submissionUrl\":\"https://submission.springernature.com/new-submission/12915/3\",\"title\":\"BMC Biology\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"BMC Series\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"715d148d-ae3a-4c5d-ac4f-82a4aace7cbe\",\"owner\":[],\"postedDate\":\"April 27th, 2026\",\"published\":true,\"recentEditorialEvents\":[{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-05T14:33:47+00:00\",\"index\":23,\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-05-01T03:44:25+00:00\",\"index\":22,\"fulltext\":\"\"}],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"under-review\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2026-04-27T15:53:35+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-04-27 15:53:34\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-9239117\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-9239117\",\"identity\":\"rs-9239117\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}