{"paper_id":"210fc002-19bb-4258-9fdb-15b8484829ec","body_text":"The roles of anillin in the Drosophila nervous system | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The roles of anillin in the Drosophila nervous system Man Anh Huynh, Dang Thi Phuong Thao, Hideki Yoshida This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3968358/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Anillin (Ani) is an evolutionarily conserved protein with a multi-domain structure that cross-links cytoskeletal proteins and plays an essential role in the formation of the contractile ring during cytokinesis. However, Ani is highly expressed in the human central nervous system (CNS), which does not actively divide. Moreover, it scaffolds myelin in the CNS of mice and modulates neuronal migration and growth in Caenorhabditis elegans . This protein is also highly expressed in the Drosophila CNS. However, its role remains unclear. In the present study, Ani was highly expressed in type I and II neuroblasts, whereas it was poorly expressed in the neuromuscular junction (NMJ), axons, and some neurons in the ventral nerve cord. In addition, neuron-specific ani knockdown flies had a short lifespan and larval locomotor defects, along with an abnormal morphology of the NMJ, learning disability, and a swollen CNS. These results show that Ani plays important roles not only in proliferating cells, but also in the Drosophila nervous system. Biological sciences/Developmental biology/Cell proliferation Biological sciences/Neuroscience/Neurogenesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 INTRODUCTION Anillin (Ani) was originally isolated from Drosophila embryos as an F-actin-binding protein [ 1 ]. It is a scaffold protein conserved from yeast to humans, with a multi-domain structure that comprises myosin-binding, F-actin-binding, anillin homology, and pleckstrin homology (PH) domains. This protein forms the contractile ring by recruiting septins via the PH domain during cytokinesis [ 2 – 4 ]. Additionally, its subcellular localization changes drastically during the cell cycle in proliferating cells. Although Ani is localized to the cytoplasm and cortex during metaphase and subsequently recruited to the prospective contractile ring during anaphase, it is mainly found in the nucleus during interphase [ 5 ]. This protein is expressed in tissues with actively dividing cells, such as the lungs, bone marrow, and testes. Furthermore, its function during cytokinesis has been extensively studied. Ani has crucial functions in the regulation of cell-cell junction integrity [ 6 – 9 ] and is highly expressed in the human brain [ 10 ], even in non-dividing cells and tissues. Ani stabilizes F-actin at the leading edge of neurons during neuronal migration [ 11 ] and facilitates septin assembly to prevent abnormal myelin outfolding [ 12 , 13 ]. However, its precise functions in the nervous system remain unclear. Similar to humans, the larval central nervous system (CNS) is among the most ani mRNA-expressing tissues[ 14 ]. Although Ani contributes to the asymmetric division of the peripheral nervous system [ 15 ], its role in the Drosophila CNS has not been investigated. Therefore, this study comprehensively investigated the expression pattern of Ani in the larval nervous system and its role in the nervous system using pan-neuron-specific ani knockdown. Ani is highly expressed in dividing cells, including neuroblasts (NBs) in the brain lobe. However, it was poorly expressed in some neurons in the ventral nerve cord, axons, and neuromuscular junctions (NMJ) of motor neurons. In addition, it was hypothesized that Ani is localized along the F-actin in the axon. Furthermore, the knockdown of ani in the nervous system significantly perturbed larval learning, larval and adult locomotor ability, and viability. These results indicate that Ani plays an important role in the Drosophila nervous system. RESULTS Expression of ani in the larval nervous system The ani gene is predicted to be relatively highly expressed in the larval CNS based on the RNA-seq analysis and to have three splice variants ( SV-A , SV-B , and SV-C ) in the Drosophila database, FlyBase (Fig. 1 A) [ 16 ]. Therefore, we purified total RNA and proteins from the larval CNS and performed quantitative RT-PCR (qRT-PCR) and Western blot analyses to determine which splice variant was expressed in the larval CNS. The qRT-PCR with the primer set designed to detect SV-C or both SV-B and C showed only marginal amplification of the PCR signal. In contrast, qRT-PCR with the primer set designed to detect both SV-A and B showed extensive amplification of the signal (Fig. 1 A, B), which is similar to results reported in early embryos [ 17 ]. These results suggest that SV-A is predominantly expressed in the larval CNS. In Western blot analysis with anti-Ani IgG, the 178 kDa band corresponding to Ani predicted to be encoded by SV-A was predominantly detected (Fig. 1 C). The marginally detected 87 kDa and approximately 75 kDa bands may have been derived from SV-C or the degradation products of the 178 kDa product. These results were consistent with those of the qRT-PCR, indicating that SV-A is predominantly expressed in the larval CNS. Next, we performed immunofluorescence staining of the larval nervous system with anti-Ani IgG to comprehensively investigate Ani expression patterns. Ani signals were predominantly detected in proliferating cells of the CNS (Figs. 1 , S1). In particular, this protein was highly expressed in the NBs marked by Deadpan (Dpn) in the brain lobe, ventral nerve cord (VNC), neural epithelium, and some lamina cells in the brain lobe (Fig. 1 D). In contrast, Ani showed a mutually exclusive expression pattern with Dachshund (Dac), except for a few layers of cells next to the lamina furrow (LF) (Fig. 1 D e, f). Although Dac is a marker for lamina precursor cells and neurons [ 18 , 19 ], Dac and Ani were co-expressed in the proliferating cells that form a cell layer next to the LF in the outer proliferation center (Fig. 1 D f). Although most of the Ani was expressed in the cell nuclei of the CNS, except in cells expressing embryonic lethal abnormal vision (Elav), a neuronal marker (Figs. 2 A, S2), Ani was also detected weakly in the nuclei of Elav-expressing cells in the optic lobe and VNC (Fig. 2 B, S2). In addition, it was detected at the synaptic boutons in the neuromuscular junction (NMJ) (Fig. 2 C) and axons (Figs. 2 D, S3), whereas the strong and large signals in the PNS corresponded to the glial nuclei (Fig. 2 D). Furthermore, the Ani dot signals in the axon were connected by a filament-like structure and were localized between the plasma membrane and neural lamella, where perineurial and subperineurial glia are located outside the neurons (Figs. 2 D, S3) [ 20 ]. These results suggest that Ani functions, not only in proliferating cells, but also in non-proliferating cells in the Drosophila larval nervous system. ani knockdown in the CNS induces defective neurological phenotypes We knocked down ani using the elav -GAL4 driver, a pan-neuronal driver, or OK371 -GAL4, a glutamatergic neuronal GAL4 driver [ 21 ], combined with two independent ani-RNAi lines to investigate the role of ani in the neurons of the Drosophila nervous system. We then analyzed the phenotypes of the knockdown flies (Figs. 3 , S3). The expression levels of ani mRNA and Ani in the CNS were evaluated using qRT-PCR, Western blotting, and immunostaining with anti-Ani IgG. ani mRNA levels decreased to 30% and 19% in elav > ani-IR 33465 and elav > ani-IR 53358 , respectively (Fig. 3 A). Similarly, Ani levels in the CNS of the ani knockdown larvae decreased (Figs. 3 B, C, S4). Furthermore, the target sequences of ani-IR 33465 and ani-IR 53358 corresponded to nucleotide positions 616–953 and 597–617 of SV-A , respectively, which overlap by only two nucleotides. Data from a BLAST search against the EST database and information on the Vienna Drosophila Resource Center (VDRC) homepage predicted no off-target effect in these IR strains. These results indicate that the knockdown efficiency was higher for elav > ani-IR 53358 than for elav > ani-IR 33465 . We investigated the larval learning and locomotor ability of the pan-neuronal ani knockdown flies to elucidate the role of ani in the nervous system. First, we performed an odor-taste associative learning assay with early-stage third-instar larvae to examine their learning ability [ 22 ]. Although Drosophila larvae showed no preference between amylacetate (AM) and octanol (OCT) without training, control larvae learned the association between odors and rewards. Thus, we calculated a learning index based on the AM preference after training. The learning index considerably decreased in elav > ani-IR 53358 larvae and slightly decreased in elav > ani-IR 33485 larvae. However, the difference was not statistically significant (Fig. 3 D). Next, we performed a crawling assay to investigate the effect of ani knockdown on larval locomotor abilities. elav > ani-IR 53358 and elav > ani-IR 33485 larvae showed significantly reduced locomotor ability and slightly decreased crawling speed, respectively (Figs. 3 E, F). Although most elav > ani-IR 33465 flies survived until adulthood, almost all elav > ani-IR 53358 died during the pupal stage. All escapers, albeit few, were considerably weak and died within a day after eclosion. The median longevity of ani knockdown flies was 28 d (elav > ani-IR 33465 ) and 1 d (elav > ani-IR 53358 ), which was markedly shorter than that of the control flies (38 d) (Fig. 3 G). Next, we examined the locomotor ability of only elav > ani-IR 33465 adult flies using a climbing assay because the escapers in the elav > ani-IR 53358 group failed to climb the wall and died the day after eclosion. The climbing ability of three-day-old elav > ani-IR 33465 flies showed substantial defects (Fig. 3 H). These results indicate that ani plays essential roles in elav -expressing cells of the Drosophila nervous system and that defective ani knockdown in elav > ani-IR 53358 flies is more severe than that in elav > ani-IR 33465 flies. ani knockdown in the CNS leads to abnormal neuropil formation and increases the cell size Because the mushroom body of the larval brain is the center of olfactory associative learning and memory ability [ 23 – 25 ], we conducted immunostaining of the CNS with anti-Brp IgG and anti-CadN IgG to visualize the mature neuropil [ 26 , 27 ]. Both Brp and CadN expression patterns were abnormal in elav > ani-IR 53358 larvae, especially the size of the BRP area in the brain lobe and the distribution patterns of CadN in the optic lobe and thoracic ganglion in the VNC (Fig. 4 A). The ratio of the neuropil area to the brain lobe area markedly decreased in both elav > ani-IR 33465 and elav > ani-IR 53358 larvae (Figs. 4 B, C). Elav was believed to be exclusively expressed in post-mitotic neurons [ 28 , 29 ]. However, its expression has been demonstrated in almost all embryonic lateral glial cells and some NBs. In addition, elav -GAL4 drivers (458: elav C155 -GAL4, 8765: elav.L2 -GAL4), which were not used in this study, modulate the expression of the reporter gene in embryonic glial cells and mitotically active cells [ 30 ]. Furthermore, the expression patterns of elav -GAL4 drivers differ between elav C155 -GAL4 (458) and other drivers (8760, 8765) [ 31 ]. Therefore, we monitored the mCD8-GFP reporter to investigate the expression pattern of elav -GAL4 (8760) in the larval CNS, particularly in the brain lobe. elav -GAL4 induced the expression of the reporter in cells expressing the Ani or NB marker Dpn, especially on the dorsal side of the larval brain lobe (Fig. S5). These results suggested that ani was knocked down in the NB with the elav -GAL4 driver. Therefore, we examined the distribution patterns of neurons and glial cells in the larval CNS of ani knockdown flies. The distribution patterns of neurons and glial cells in the CNS, especially in the elav > ani-IR 53358 larvae, were drastically perturbed, and the size of the brain lobe markedly increased (Figs. 5 A, B). In addition to defects in the distribution patterns of neurons and glial cells, the size of the cells was drastically enlarged in the elav > ani-IR 53358 larvae (Fig. 5 C). Similarly, the size of the whole CNS was drastically enlarged (Figs. 3 C, 5 A). However, the CNS shape was similar to that of the control. In addition, the ani knockdown larvae could crawl, although their crawling speed was significantly slower than that of the control larvae (Figs. 3 E, F). ani knockdown in the CNS affects the morphology of the NMJ and expression patterns of CadN in the NMJ ani knockdown larvae showed locomotor defects. Therefore, we investigated whether motor neurons in the ani knockdown larvae had defects by examining the morphology of the NMJ, a specialized synapse between the nerve terminals of motor neurons and muscles. A detailed inspection of the NMJ revealed a substantial increase in the total branch length of synapses, the number of synaptic branches, and mature bouton numbers. In contrast, bouton sizes considerably decreased in elav > ani-IR 53358 larvae (Fig. 6 ). Although the effect was weaker than that in elav > ani-IR 53358 larvae, elav > ani-IR 343465 larvae also showed a statistically significant increase in the number of synaptic branches and a decrease in bouton size (Fig. 6 ). Ani, an F-actin-binding protein, contributes to cytoskeleton formation at the edge of cells during neuronal migration and the strength of epithelial cell-cell adhesion [ 7 , 11 ]. In addition, F-actin binds to catenin and cadherin, regulating adhesion between pre-and post-synapsis [ 32 , 33 ]. Therefore, we hypothesized that ani contributed to the strength of adhesion between pre- and post-synaptic cells. As synaptic cell adhesion molecules, such as CadN, Capricious, Dscam, and Fasciclin II (Fas II), play important roles in the connection between pre-and post-synaptic cells, we evaluated the expression pattern of CadN in the NMJ of ani knockdown larvae. In the synaptic boutons in the NMJ of both lines of ani knockdown larvae, the size of the CadN foci and the total intensity of CadN significantly decreased whereas the number of CadN foci did not change (Fig. 7 ). These results suggest that CadN levels were decreased and that CadN clustering was impaired in the NMJ of the ani knockdown larvae. DISCUSSION Ani is expressed in almost all Dpn-expressing type I and II NBs and in two layers of Dac-expressing cells in the neuroepithelium posterior to the LF [ 35 ] (Fig. 1 D). This is similar to the distribution pattern of proliferating cells in the brain lobe (Figs. 1 D, S1). Ani is mainly localized to the nucleus during interphase [ 36 – 40 ] and to the cortex during the cytokinesis of proliferating cells [ 36 , 37 , 41 ]. Moreover, it is diffusively localized to the cytoplasm of non-proliferating cells [ 7 , 42 ]. In the present study, Ani was strongly expressed in proliferating cells in the brain lobe and the thoracic region in the VNC (Figs. 1 , 2 , S1). Contrastingly, it was weakly expressed in some cells of the VNC, the axon, and the NMJ in the differentiated motor neurons (Figs. 2 , S3). Ani was localized to the boutons in the NMJ (Fig. 2 C). As actin is not required to expand membrane blebbing, it must be stabilized or retracted [ 43 – 45 ], suggesting that the bouton to which Ani is localized is robust and stabilized. Although it was predicted that decreased Ani at the bouton results in reduced mature boutons, the number of boutons contrarily increased with NMJ elongation in ani knockdown larvae (Fig. 6 ). However, the mean size of the boutons considerably decreased, which may suggest destabilization of the bouton structure. The increased NMJ length in ani knockdown larvae may be caused by a different mechanism. TGFβ/BMP and Wnt/Wg signaling are necessary for NMJ development. Null mutants of the highwire gene encoding an E3 ubiquitin ligase show a decrease in MAPKKK dial leucine zipper-containing kinase (DLK, called Wallenda in Drosophila ) levels and synaptic overgrowth [ 46 – 48 ]. In addition, the loss-of-function allele of the short stop ( shot ) encoding a member of the spectraplakin family of large cytoskeletal linker molecules that bind microtubules and actin shows substantial overgrowth of the NMJ [ 48 ]. shot negatively regulates the Wallenda/DLK involved in the axonal injury response [ 48 ]. Because Ani stabilizes the F-actin network [ 34 , 49 ], the elongation of NMJ following decreased ani levels may have been caused by a disturbance in TGFβ/BMP or Wnt/Wg signaling. Moreover, ani knockdown neurons may not sense the extracellular signal properly because the Ani reduction perturbed the distribution of CadN at the boutons in the NMJ. Although mutations and overexpression of the gene that induces NMJ overgrowth have been reported [ 49 , 50 ], the electrophysiological function of the neuron was not or only slightly disordered. In addition, the larval locomotor ability or behavior was not evaluated. The Ani size detected through Western blotting is usually larger than the predicted size calculated from the amino acid sequences [ 5 , 37 , 51 ], which is considered that the larger size is caused by an elongated coiled coil with low electrophoretic mobility. Consistent with previous results, Western blotting revealed an Ani size of approximately 178 kDa, which was larger than the 132.9 kDa calculated from the amino acid sequences in the present study. In addition, Ani dots connected by filament-like structures were detected in the axons of motor neurons (Fig. 2 D). Furthermore, ani knockdown larvae, these Ani signals connected by filament-like structures were hardly detectable, and the morphology of the actin filaments appeared abnormal in the axons (Fig. S3). These data suggest the Ani forms a dimer and the dimerized Ani has a role in the actin filament assembly in the axon. However, no study has directly revealed that this protein dimerizes to date. However, further experiments are needed to confirm this result. This study revealed the numerous roles of Ani in the nervous system of Drosophila , and the distribution patterns of Ani in the NMJ suggested its important role in nerve-muscle communication. MATERIALS and METHODS Fly stocks Flies were cultured on standard food containing 0.65% agar, 10% glucose, 4% dry yeast, 5% corn flour, and 3% rice bran under a 12:12 h light-dark cycle at 25°C. Fly strains UAS-GFP.nls (107870), UAS-mCD8::GFP (108068), y 1 v 1 (101249) were provided by the Kyoto Stock Center (Drosophila Genomics and Genetic Resources (DGGR)). Fly strains elav -GAL4 (8760), OK371 -GAL4 (26160), UAS-ani-IR (53358), and UAS-LifeAct-GFP (35544) were purchased from the Bloomington Drosophila Stock Center (BDSC), BDSC. The UAS-ani-IR (33465) strain was obtained from the VDRC. Crawling assay The crawling assay was performed as previously described [ 52 ], with some modifications. Male larvae at the wander third instar stage were randomly collected and placed on 2% agar Petri dishes. The larval movements were recorded for 1 min using a digital camera. The recorded videos were analyzed using ImageJ 1.53t [ 53 ] and the wrMTrck plugin (developed by Dr. Jesper Søndergaard Pedersen, http://www.phage.dk/plugins/wrmtrck.html ) to obtain the larval average speed [ 54 ]. Climbing assay The climbing assay was performed as previously described [ 55 ]. Newly eclosed adult male flies of each strain were collected into separate vials at a maximum density of 20 flies/vial. The flies were maintained at 28°C under a 12:12 h light-dark cycle. Flies were transferred to cylindrical tubes with a 15 cm height and 2 cm diameter to measure their climbing ability. The cylinders were tapped five times to collect the flies at the bottom, and their movements were recorded using a digital camera. The procedure was repeated five times at 1 min intervals. In all experiments, the height to which each fly climbed after 5 s was scored from 0 to 5 points at 2 cm intervals from the bottom to calculate the climbing index. The assay was performed at 3, 7, and 14 days after eclosion. Survival assay Newly eclosed adult male flies were randomly placed in food vials at a maximum density of 20 flies/vial. They were subsequently transferred to a new vial every 2–3 days, and the number of dead flies was counted simultaneously [ 56 ]. Immunostaining Larvae and adult flies were dissected in cold Phosphate Buffered Saline (PBS) and fixed with 4% paraformaldehyde (PFA) in PBS at 25°C for 20 min or 40 min for the brain lobe or NMJs, respectively. Next, they were washed with 0.3% PBS-T (PBS with 0.3% Triton X-100), blocked with 10% normal goat serum in 0.15% PBS-T, and incubated with the following primary antibodies: Anti-Ani antibody (rabbit, 1:400; kindly provided by Dr. Maria G. Giansanti [ 39 , 57 ]), anti-Dlg1 IgG (mouse, 1:200, 4F3; Developmental Studies hybridoma Bank (DSHB)), anti-Dpn IgG (rat, 1:100, 11D1BC7; Abcam, Cambridge, UK), anti-Elav IgG (mouse, 1:50, 9F8A9; DSHB), anti-Elav IgG (rat, 1:50, 7E8A10; DSHB), anti-Lamin IgG (mouse, 1:100, ADL67.10; DSHB), Alexa 647 conjugated anti-HRP IgG (goat, 1:200; Jackson ImmunoResearch, West Grove, PA, USA), FITC conjugated anti-HRP IgG (goat, 1:200; Jackson ImmunoResearch), anti-CadN IgG (rat, 1:80, DN-Ex #8; DSHB). The samples were then washed with 0.3% PBS-T and incubated with a secondary antibody at 25°C for 2 h. Finally, they were washed with 0.3% PBS-T and mounted on Vectashield mounting media (Vector Laboratories, Newark, CA, USA). The samples were imaged using a confocal microscope (FLUOVIEW FV10i, Olympus, Tokyo, Japan). The collected images were analyzed using ImageJ 1.49o software. BrdU labeling CNS dissected from third instar larvae were incubated in 75 µg/µL Bromodeoxyuridine 5-bromo-2’-deoxyuridine (BrdU) at 30°C for 2 h. They were subsequently fixed with 4% PFA at 25°C for 20 min and washed with 0.3% PBS-T. Next, the cells were incubated with anti-Ani IgG at 4°C for 16 h, incubated with 3M HCl for 30 min, and rinsed once with PBS. Incorporated BrdU was visualized using anti-BrdU IgG (1:10) and washed with 0.3% PBS-T. The samples were then incubated with the secondary antibodies at 25°C for 2 h, washed PBS-T 0.3%, and mounted with Vectashield mounting media. The samples were imaged using a confocal microscope (FLUOVIEW FV10i). The images were analyzed using ImageJ 1.53t software. RNA isolation and quantitative RT-PCR Total RNA was isolated from 20 larval CNS samples using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). Next, cDNA was synthesized using the PrimeScript RT reagent kit (TaKaRa, Kusatsu, Shiga, Japan). Quantitative RT-PCR (qRT-PCR) was subsequently performed using SYBR Premix Ex Taq II (TaKaRa) in the CFX96 Touch Real-Time PCR Detection System (BIO-RAD, Hercules, CA, USA) using a standard curve-based method calculated using the CFX Manager software (BIO-RAD). The following primers were used for qRT-PCR: GAPDH [ 58 ]: (fw 5′-GGAGCCACCTATGACGAAATC-3′ /rev 5′-TCGAACACAGACGAATGGG-3′), ani SV-A&B (fw 5′- ACTTCAGGATCACGCTAGAAATC − 3′ / rev 5′- GTCTTGATGCCACCCTTCTT-3′), ani SV-B & C (fw 5′- CCTGCCAAATACGACAAAGTG − 3′ / rev 5′- CACGACGAAATACCGAAATTG − 3′), ani SV-C (fw 5′- CTGCTTGCTATTTCTGCTCTG − 3′ / rev 5′- TTTATTGTTGGTCTTGTCTAGGG − 3′), ani all SV (fw 5′- TCACTATACGGCGGTAAACAAG-3′ / rev 5′- CTCCTGCTCCTGAATCTCAAC-3′) Western blotting Twenty larvae were dissected in cold PBS and kept at -80°C to collect the CNS. The CNS samples were homogenized in 2× sample buffer, denatured at 95°C for 5 min, separated using 8% tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Tricine SDS-PAGE), and transferred to PVDF membranes. Next, the samples were incubated with anti-Ani (1:4000) or anti-α-Tubulin (α-Tub) IgG (mouse, 1:8000, Sigma-Aldrich) as a primary antibody, followed by incubation with HRP-conjugated anti-rabbit (goat, 1:4000, Thermo Fisher Scientific, Waltham, MA, USA) or mouse IgG (goat, 1:10000, Thermo Fisher Scientific, Waltham, MA, USA) as a secondary antibody. Proteins were subsequently detected with the ECL SELECT reagent (Cytiva, Tokyo, Japan) and captured and analyzed using AE-9300H Ez-Capture MG (ATTO, Tokyo, Japan)). The specificity of anti-Ani IgG has been demonstrated by Giansanti [ 39 , 57 ]. Imaging analysis and deconvolution The immunofluorescence-stained samples were imaged using a confocal microscope (FLUOVIEW FV10i). The images were analyzed using ImageJ 1.53t software. The morphology of the NMJs was analyzed based on the parameters described by Nijhof et al. [ 59 ]. Individual data were averaged from four NMJs in Muscle 4 at segments A3 and A4. The point-spread function for deconvolution was generated using fluorescent beads from the PS-Speck™ Microscope Point Source Kit (Invitrogen, Carlsbad, CA, USA). The input image has a voxel size (height × width × depth = 0.02 × 0.02 × 0.15 µm). Deconvolution was performed using the Richardson-Lucy deconvolution method, the plugin CLIJx [ 60 ], and ImageJ 1.53t software. Data analysis All data were analyzed using GraphPad Prism version 10 for Windows (GraphPad Software, Boston, MA, USA). The sample size and statistical comparisons performed are described in the protocol of each experiment. Declarations ACKNOWLEDGEMENTS We thank Maria G. Giansanti for kindly providing anti-Ani IgG, and the DGGR, BDSC, and VDRC for fly strains. COMPETING INTERESTS The authors declare no competing or financial interests. AUTHOR CONTRIBUTIONS H.M.A. and H.Y. and designed the project, wrote the main manuscript text, prepared all figures, performed experiments, and analyzed the results. T.T.P.D provided the advice for the experiments and data analysis. All authors reviewed the manuscript. FUNDING This research was partially supported by the JSPS Core-to-Core Program, Asia-Africa Science Platforms (1202987), to H.Y. DATA AVAILABILITY All raw data used during the current study are available from the corresponding author on request. References Miller, K. G., Field, C. M. & Alberts, B. M. Actin-binding proteins from Drosophila embryos: a complex network of interacting proteins detected by F-actin affinity chromatography. J. Cell Biol. 109, 2963–2975 (1989). Straight, A. F., Field, C. M. & Mitchison, T. J. Anillin binds nonmuscle myosin II and regulates the contractile ring. Mol. Biol. Cell 16, 193–201 (2005). Zhang, L. & Maddox, A. S. Anillin. Curr. Biol. 20, R135-R136 (2010). Field, C. M., Groen, A. C., Nguyen, P. A. & Mitchison, T. J. Spindle-to-cortex communication in cleaving, polyspermic Xenopus eggs. Mol. Biol. Cell 26, 3628–3640 (2015). Field, C. M. & Alberts, B.M. Anillin, a contractile ring protein that cycles from the nucleus to the cell cortex. J. Cell Biol. 131, 165–78 (1995). Reyes, C. C., et al. Anillin regulates cell-cell junction integrity by organizing junctional accumulation of Rho-GTP and actomyosin. Curr. Biol. 24, 1263–1270 (2014). Wang, D., et al. F-actin binding protein, anillin, regulates integrity of intercellular junctions in human epithelial cells. Cell. Mol. Life Sci. 72, 3185–3200 (2015). Arnold, T. R., et al. Anillin regulates epithelial cell mechanics by structuring the medial-apical actomyosin network. eLIFE 8, e39065; 10.7554/eLife.39065 (2019). Budnar, S., et al. Anillin promotes cell contractility by cyclic resetting of RhoA residence kinetics. Dev. Cell 49, 894–906.e12. (2019). Thul, P. J., et al. A subcellular map of the human proteome. Science 356, eaal3321 (2017). Kathryn, R. & Amy Shaub M. Neuron Migration: Anillin protects leading edge actin. Curr. Biol. 25, R423-R425 (2015). Patzig, J, et al. Septin/anillin filaments scaffold central nervous system myelin to accelerate nerve conduction. eLIFE 5, e17119; 10.7554/eLife.17119 (2016). Erwig, M. S. et al. Anillin facilitates septin assembly to prevent pathological outfoldings of central nervous system myelin. eLIFE 8, e43888; 10.7554/eLife.43888 (2019). Leader, D. P., et al., FlyAtlas 2: a new version of the Drosophila melanogaster expression atlas with RNA-Seq, miRNA-Seq and sex-specific data. Nucleic Acids Res. 46, D809-D815 (2017). O’Farrell, F. & Kylsten P. Drosophila Anillin is unequally required during asymmetric cell divisions of the PNS. Biochem. Biophys. Res. Commun. 369, 407–413 (2008). Larkin, A., et al. FlyBase: updates to the Drosophila melanogaster knowledge base. Nucleic Acids Res. 49, D899-D907 (2020). Hirashima, T., Tanaka, R., Yamaguchi, M. & Yoshida, H. The ABD on the nascent polypeptide and PH domain are required for the precise Anillin localization in Drosophila syncytial blastoderm. Sci. Rep. 8, 12910; 10.1038/s41598-018-31106-0 (2018). Yasugi, T., Umetsu, D., Murakami, S., Sato, M. & Tabata, T. Drosophila optic lobe neuroblasts triggered by a wave of proneural gene expression that is negatively regulated by JAK/STAT. Development 135, 1471–1480 (2008). Gold, K. S. & Brand, A. H. Optix defines a neuroepithelial compartment in the optic lobe of the Drosophila brain. Neural. Dev. 9, 18; 10.1186/1749-8104-9-18 (2014). Xie, X. & Auld, V. J. Integrins are necessary for the development and maintenance of the glial layers in the Drosophila peripheral nerve. Development 138, 3813–3822 (2011). Mahr, A. & Aberle, H. The expression pattern of the Drosophila vesicular glutamate transporter: a marker protein for motoneurons and glutamatergic centers in the brain. Gene Expr. Patterns. 6, 299–309 (2006). Gerber, B., Biernacki, R. & Thum, J. Odor–taste learning assays in Drosophila larvae. Cold Spring Harb. Protoc. 10.1101/pdb.prot071639 (2013). McGuire, S. E., Le, P. T. & Davis, R. L. The role of Drosophila mushroom body signaling in olfactory memory. Science 293, 1330–1333 (2001). Heisenberg, M. Mushroom body memoir: from maps to models. Nat. Rev. Neurosci. 4, 266–275 (2003). Davis, R. L. Olfactory memory formation in Drosophila : from molecular to systems neuroscience. Annu. Rev. Neurosci. 28, 275–302 (2005). Enriquez, J., et al. Differing strategies despite shared lineages of motor neurons and glia to achieve robust development of an adult neuropil in Drosophila . Neuron 97, 538–554.e5 (2018). Kaur, R., et al. Pioneer interneurons instruct bilaterality in the Drosophila olfactory sensory map. Sci. Adv. 5, eaaw5537; 10.1126/sciadv.aaw5537 (2019). Robinow, S. & White, K. The locus elav of Drosophila melanogaster is expressed in neurons at all developmental stages. Dev. Biol. 126, 294–303 (1988). Robinow, S. & White, K. Characterization and spatial distribution of the ELAV protein during Drosophila melanogaster development. J. Neurobiol. 22, 443–461 1991). Berger, C., Renner, S., Lüer, K. & Technau, G. M. The commonly used marker ELAV is transiently expressed in neuroblasts and glial cells in the Drosophila embryonic CNS. Dev. Dyn. 236, 3562–3568 (2007). Ogienko, A. A., Andreyeva, E. N., Omelina, E. S., Oshchepkova, A. L. & Pindyurin, A. V. Molecular and cytological analysis of widely-used Gal4 driver lines for Drosophila neurobiology. BMC Genet. 21(Suppl 1), 96; 10.1186/s12863-020-00895-7 (2020). Kwiatkowski, A.V., Weis, W. I. & Nelson, W. J. Catenins: playing both sides of the synapse. Curr. Opin. Cell Biol. 19, 551–556 (2007). Nelson, W. J. Regulation of cell-cell adhesion by the cadherin-catenin complex. Biochem. Soc. Trans. 36, 149–155 (2008). Tian, D., et al. Anillin regulates neuronal migration and neurite growth by linking RhoG to the actin cytoskeleton. Curr. Biol. 25, 1135–1145 (2015). Nakato, H., Futch, T. A. & Selleck, S. B. The division abnormally delayed ( dally ) gene: a putative integral membrane proteoglycan required for cell division patterning during postembryonic development of the nervous system in Drosophila . Development 121, 3687–3702 (1995). Jeibmann, A. & Paulus W. Drosophila melanogaster as a model organism of brain diseases. Int. J. Mol. Sci. 10, 407–440 (2009). Piekny, A. J. & Maddox, A. S. The myriad roles of Anillin during cytokinesis. Semin. Cell Dev. Biol. 21, 881–891 (2010). Eyjolfsdottir, E., et al. Detecting social actions of fruit flies. in Computer Vision – ECCV 2014. Cham: Springer International Publishing. 772–787 (2014). Giansanti, M. G., et al. Exocyst-dependent membrane addition is required for anaphase cell elongation and cytokinesis in Drosophila . PLoS Genetics 11, e1005632; 10.1371/journal.pgen.1005632 (2015). Yildirim, K., Petri, J., Kottmeier, R. & Klämbt, C. Drosophila glia: Few cell types and many conserved functions. Glia 67, 5–26 (2019). Kremer, M. C., et al . The glia of the adult Drosophila nervous system. Glia 65, 606–638 (2017). Hall, P. A. et al. The septin-binding protein anillin is overexpressed in diverse human tumors. Clin. Cancer Res. 11, 6780–6786 (2005). Charras, G. T., Hu, C. K., Coughlin, M. & Mitchison, T. J. Reassembly of contractile actin cortex in cell blebs. J. Cell Biol. 175, 477–490 (2006). Charras, G. T., Coughlin, M., Mitchison, T. J. & Mahadevan, L. Life and times of a cellular bleb. Biophys. J. 94, 1836–1853 (2008). Fernandes, A. R., Martins, J. P., Gomes, E. R., Mendes, C. S. & Teodoro, R. O. Drosophila motor neuron boutons remodel through membrane blebbing coupled with muscle contraction. Nat. Commun. 14, 3352; 10.1038/s41467-023-38421-9 (2023). Wu, C., Wairkar, Y. P., Collins, C. A. & DiAntonio, A. Highwire function at the Drosophila neuromuscular junction: spatial, structural, and temporal requirements. J. Neurosci. 25, 9557–9566 (2005). Collins, C. A., Wairkar, Y. P., Johnson, S. L. & DiAntonio, A. Highwire restrains synaptic growth by attenuating a MAP kinase signal. Neuron. 51, 57–69 (2006). Valakh, V., Walker, L. J., Skeath, J. B. & DiAntonio, A. Loss of the spectraplakin short stop activates the DLK injury response pathway in Drosophila . J. Neurosci. 33, 17863–17873 (2013). Zhao G., et al. Drosophila S6 Kinase like inhibits neuromuscular junction growth by downregulating the BMP receptor thickveins. PLoS Genet. 11, e1004984; 10.1371/journal.pgen.1004984 (2015). Spinner, M. A., Walla, D. A. & Herman, T. G. Drosophila Syd-1 has RhoGAP activity that is required for presynaptic clustering of Bruchpilot/ELKS but not Neurexin-1. Genetics 208, 705–716 (2018). Field, C. M., Coughlin, M., Doberstein, S., Marty, T. & Sullivan, W. Characterization of anillin mutants reveals essential roles in septin localization and plasma membrane integrity. Development. 132, 2849–2860 (2005). Nichols, C. D., Becnel, J. & Pandey, U. B. Methods to assay Drosophila behavior. J. Vis. Exp. 61, 3795; 10.3791/3795 (2012). Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods. 9, 671–675 (2012). Nussbaum-Krammer, C. I., Neto, M. F., Brielmann, R. M., Pedersen, J. S. & Morimoto, R. I. Investigating the spreading and toxicity of prion-like proteins using the metazoan model organism C. elegans . J. Vis. Exp. 95, 52321; 10.3791/52321 (2015). Gargano, J. W., Martin, I., Bhandari, P. & Grotewiel, M. S. Rapid iterative negative geotaxis (RING): a new method for assessing age-related locomotor decline in Drosophila . Exp. Gerontol. 40, 386–395 (2005). Huynh, T. K. T., et al. Crucial roles of ubiquitin carboxy-terminal hydrolase L1 in motor neuronal health by Drosophila model. Antioxid. Redox Signal. 37, 257–273 (2022). Sechi, S. et al ., Rab1 interacts with GOLPH3 and controls Golgi structure and contractile ring constriction during cytokinesis in Drosophila melanogaster . Open Biol. 7, 160257; 10.1098/rsob.160257 (2017). Suda, K., et al. Novel Drosophila model for mitochondrial diseases by targeting of a solute carrier protein SLC25A46. Brain Res. 1689, 30–44 (2018). Nijhof, B., et al. A New Fiji-Based Algorithm That Systematically Quantifies Nine Synaptic Parameters Provides Insights into Drosophila NMJ Morphometry. PLoS Comput. Biol. 12, e1004823; 10.1371/journal.pcbi.1004823 (2016). Haase, R. et al. CLIJ: GPU-accelerated image processing for everyone. Nat. Methods 17, 5–6 (2020). Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3968358\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":279239807,\"identity\":\"6fd2b315-394f-434c-bfdd-7e044dae735e\",\"order_by\":0,\"name\":\"Man Anh Huynh\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Kyoto Institute of Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Man\",\"middleName\":\"Anh\",\"lastName\":\"Huynh\",\"suffix\":\"\"},{\"id\":279239808,\"identity\":\"6ef2f78b-296c-4bbf-a648-e7439f5e93cf\",\"order_by\":1,\"name\":\"Dang Thi Phuong Thao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"VNUHCM-University of Science\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Dang\",\"middleName\":\"Thi Phuong\",\"lastName\":\"Thao\",\"suffix\":\"\"},{\"id\":279239809,\"identity\":\"aecf7ce9-a23b-4765-9ab2-b2f5247e9ebc\",\"order_by\":2,\"name\":\"Hideki Yoshida\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0klEQVRIiWNgGAWjYBACAyBmZjBgZuDnYWwAi0ApIrRI9jA2NpCgBaTrDGHFEGAukXz4c0GBtbzxmcPtDxhq7BiYZxPQaTkjLU16hkG64bazjUCHHUtmYJxzgIDDbuSYMfMYHGbcdh7kF7YDDIwzEghqMf4M1GK/uR+k5R9xWgykgVoSN/ACHcbYRoyWM8/SgFrSk2ecOdg4I7EvmYewX44DQ4znj7Vtf0/6gw8fvtnJGRIKMQYBZGcA2TyGMwjoYOBHd4a8BCEto2AUjIJRMNIAAO79RezCVfKiAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Kyoto Institute of Technology\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Hideki\",\"middleName\":\"\",\"lastName\":\"Yoshida\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-02-19 00:14:14\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3968358/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3968358/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":52679432,\"identity\":\"a2fbb740-e071-4c88-9ada-2de38c504371\",\"added_by\":\"auto\",\"created_at\":\"2024-03-14 12:09:44\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":484723,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eExpression patterns of Ani in the larval CNS. (A) A diagram showing the three predicted SVs of \\u003cem\\u003eani\\u003c/em\\u003e mRNA. Gray box: 5′UTR, Orange box: coding region, Gray pentagon: 3′UTR, Black line: intron, Red line: the amplified regions for qRT-PCR, Blue line: the target regions of ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e and ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e.\\u003cem\\u003e \\u003c/em\\u003e(B) Relative expression levels of \\u003cem\\u003eani\\u003c/em\\u003e mRNA SVs in the larval CNS based on the qRT-PCR results for each primer set. Expression levels of \\u003cem\\u003eSV-B\\u003c/em\\u003e were calculated by subtracting the value for \\u003cem\\u003eSV-C\\u003c/em\\u003e from that for \\u003cem\\u003eSV-B\\u003c/em\\u003e and \\u003cem\\u003eC\\u003c/em\\u003e. Then, the expression level of\\u003cem\\u003e SV-A\\u003c/em\\u003e was calculated by subtracting the value for\\u003cem\\u003e SV-B\\u003c/em\\u003e from that for \\u003cem\\u003eSV-A \\u003c/em\\u003eand \\u003cem\\u003eB\\u003c/em\\u003e. \\u003cem\\u003eSV-A\\u003c/em\\u003e was dominantly expressed. n = 3. Error bars indicate the mean and standard deviation of data. (C) Expression of Ani in the larval CNS, as analyzed through Western blotting. (D) Expression patterns of Ani in the dorsal and ventral regions of the brain lobe of the third instar larvae. The dorsal (a, c, and e) and ventral (b, d, and f) regions of the brain lobe are shown. BrdU visualizes the proliferating cells. Dpn and Dac are type I and II neuroblast markers and lamina furrow and neuron markers, respectively. White arrowheads show the cell layers expressing both Ani and Dac next to the LF in the outer proliferation center. La: lamina; LF: lamina furrow; Lo: lobula complex; NB: neuroblast; NE: neuroepithelial cells; OPC: outer proliferation center. Scale bar, 50 µm.\\u003cbr\\u003e\\n\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3968358/v1/dc6981fcbe2ca81e9442c4e6.png\"},{\"id\":52679431,\"identity\":\"1bec268f-ab11-4347-b9df-60d1da687926\",\"added_by\":\"auto\",\"created_at\":\"2024-03-14 12:09:44\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":498656,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eExpression patterns of Ani in the neurons within the larval nervous system.\\u003cstrong\\u003e \\u003c/strong\\u003e(A, B) Ani expression in Elav-expressing cells in the CNS, which are neurons. Scale bar, 50 µm. The expression patterns of Ani and Elav in the dorsal and ventral regions of the brain lobe (A) and in the VNC (B) are shown. (B) The right panels show higher magnification images of the white boxed regions in the left panels. White arrows show the cells expressing both Ani and Elav. Scale bar, 50 µm. (C, D) Ani, as detected in the NMJ (C) and axon (D) of the motor neuron. (C) Ani is relatively highly expressed at the boutons in the NMJ (White arrowheads). Scale bar, 10 µm. (D) The left column panels show the z-stack images of Ani and HRP localization in the axon. Ani was localized to the axon and glial nuclei (yellow arrows). White scale bar, 10 µm. The middle and right column panels show the z-stack images of Ani and F-actin in the axon. The right column panels show higher magnification images of the white boxed regions in the middle column panels. The dot signals of Ani appear connected by a filament type of Ani signal (yellow arrowhead). F-actin was visualized with LifeAct-GFP. Yellow scale bar, 2.5 µm.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3968358/v1/d77c61a0ecef5aa6ea9da24f.png\"},{\"id\":52679438,\"identity\":\"a5b0de70-a2c3-4546-a5f7-580bca9369e1\",\"added_by\":\"auto\",\"created_at\":\"2024-03-14 12:09:45\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":199118,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cem\\u003eani\\u003c/em\\u003e knockdown in the nervous system impairs larval and adult mobility and lifespan. (A) Knockdown efficiency of \\u003cem\\u003eani \\u003c/em\\u003eusing the\\u003cem\\u003e elav\\u003c/em\\u003e-GAL4 driver, as determined through qRT-PCR. n = 3. Statistical analysis was performed using one-way ANOVA, followed by Dunnett’s multiple comparisons tests. (B) The expression levels of Ani in the larval CNS, as evaluated with anti-Ani IgG through Western blotting; α-Tub was used as an internal control. (C) The expression patterns of Ani in the larval CNS, as evaluated with anti-Ani IgG using immunostaining.\\u003cem\\u003e \\u003c/em\\u003eScale bar, 100 µm.\\u003cem\\u003e \\u003c/em\\u003e(D) The learning index of third instar larvae, as calculated from AM and OCT preferences. The learning ability of the \\u003cem\\u003eani\\u003c/em\\u003e knockdown larvae was significantly lower than that of the control. (E) The 1-min crawling trajectory of third instar larvae. (F) The crawling speed of third instar larvae\\u003cem\\u003e \\u003c/em\\u003esignificantly decreased in elav\\u0026gt;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e. Statistical analysis was performed using one-way ANOVA, followed by Dunnett’s multiple comparisons tests. n = 39 (elav\\u0026gt;+), 30 (elav\\u0026gt;ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e), and 40 (elav\\u0026gt;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e). Error bars indicate the mean and the standard deviation of data. (G) The lifespan of adult male flies. n = 71 (elav\\u0026gt;+), 72 (elav\\u0026gt;ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e), and 15 (elav\\u0026gt;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e). Error bars indicate the percent and 95% confidence interval. Statistical analysis was performed using the Log-rank test. (H) Climbing ability of 3-, 7-, and 14-day-old adult male flies. n = 37, 36, and 35 (elav\\u0026gt;+) and n = 36, 32, and 32 (elav\\u0026gt;ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e) at 3, 7, and 14 days old, re\\u003cem\\u003es\\u003c/em\\u003epectively. Statistical analysis was performed using the Two-tailed Mann-Whitney test. Error bars indicate the mean and standard deviation of data.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3968358/v1/6e3d19f3a9ab6f2b84c0028b.png\"},{\"id\":52679437,\"identity\":\"2663e96e-8685-45fa-90ef-2fab71cc0ce1\",\"added_by\":\"auto\",\"created_at\":\"2024-03-14 12:09:45\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":240566,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe pattern of neuropil in the CNS was perturbed in the \\u003cem\\u003eani\\u003c/em\\u003e knockdown larvae.\\u003cstrong\\u003e \\u003c/strong\\u003e(A) The neuropil in the larval CNS was visualized with anti-Brp and anti-CadN IgGs. Merged images are shown at the bottom. Scale bar, 10 µm. (B) The relative size of the neuropil to the brain lobe was calculated. The upper panel shows the regions measured as a neuropil (a) or the brain lobe (b). The relative size of the neuropil to the brain lobe significantly decreased in the\\u003cem\\u003e ani\\u003c/em\\u003e knockdown larvae.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3968358/v1/a649c04cc1096ac82eabd441.png\"},{\"id\":52679434,\"identity\":\"9a8fcfcc-ab8e-43b1-abd0-410454ed83ab\",\"added_by\":\"auto\",\"created_at\":\"2024-03-14 12:09:44\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":381248,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eani knockdown in the larval CNS impaired the pattern of neurons and glial cells and enlarged the cell. (A) Neurons and glial cells were visualized with anti-Elav and anti-Repo IgGs, respectively. The distribution patterns of neurons and glial cells were significantly affected in the ani knockdown flies. (B) The size of the CNS was measured. Although the distribution patterns of neurons and glial cells in both ani knockdown lines were impaired, the CNS size increased in only elav\\u0026gt;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e larvae. n = 5. Statistical analysis was performed using one-way ANOVA, followed by Dunnett’s multiple comparisons test. (C) Enlarged images of the brain lobe. The nuclear membrane and DNA were visualized with anti-Lamin antibody and DAPI, respectively.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3968358/v1/0058edcf16f9cde3917049ea.png\"},{\"id\":52679436,\"identity\":\"ff95b6ce-069a-46b4-850a-503c9ea63258\",\"added_by\":\"auto\",\"created_at\":\"2024-03-14 12:09:44\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":223231,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eani knockdown in the CNS induces abnormal morphology of the NMJ. (A) The morphology of the NMJ is affected by reduced ani expression. Scale bar, 10 µm. (B) The length of the synapse branch, the number of synapse branches and boutons, and bouton size were quantified. n = 14 (elav\\u0026gt;+), 19 (elav\\u0026gt;ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e), and 16 (elav\\u0026gt;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e). Error bars indicate the mean and standard deviation of data. Statistical analysis was performed using one-way ANOVA, followed by Dunnett’s multiple comparisons test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3968358/v1/ef9f57758847558ac1197499.png\"},{\"id\":52679433,\"identity\":\"47d01c26-0afd-4268-a3c4-12dc1b58c2ea\",\"added_by\":\"auto\",\"created_at\":\"2024-03-14 12:09:44\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":309601,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eani knockdown in the CNS decreases the intensity and size of CadN foci in the NMJ. (A) CadN was localized to the membrane of the NMJ synapse; a strong CadN signal was detected at the bouton. NMJ and CadN were visualized with FITC-conjugated anti-HRP or anti-CadN IgG. (B) The density of CadN in each focus was decreased in ani knockdown larvae. n = 13 (elav\\u0026gt;+), 8 (elav\\u0026gt;ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e), and 14 (elav\\u0026gt;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e). Error bars indicate the mean and standard deviation of data. Statistical analysis was performed using one-way ANOVA, followed by Dunnett’s multiple comparisons test.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3968358/v1/e2d9c4ebcf97b5fb7d5d2925.png\"},{\"id\":54716097,\"identity\":\"0d692bce-b739-4b59-83f1-5b20f6c7f1b7\",\"added_by\":\"auto\",\"created_at\":\"2024-04-15 15:53:33\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2784987,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3968358/v1/97928da3-3348-4da1-ad4e-62e93737a10c.pdf\"},{\"id\":52679439,\"identity\":\"310951eb-a3c9-414c-bd51-96058357926e\",\"added_by\":\"auto\",\"created_at\":\"2024-03-14 12:09:46\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":26488562,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplementarymaterial.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3968358/v1/c825cafa9b1e10950e693a41.docx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"The roles of anillin in the Drosophila nervous system\",\"fulltext\":[{\"header\":\"INTRODUCTION\",\"content\":\"\\u003cp\\u003eAnillin (Ani) was originally isolated from \\u003cem\\u003eDrosophila\\u003c/em\\u003e embryos as an F-actin-binding protein [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. It is a scaffold protein conserved from yeast to humans, with a multi-domain structure that comprises myosin-binding, F-actin-binding, anillin homology, and pleckstrin homology (PH) domains. This protein forms the contractile ring by recruiting septins via the PH domain during cytokinesis [\\u003cspan additionalcitationids=\\\"CR3\\\" citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. Additionally, its subcellular localization changes drastically during the cell cycle in proliferating cells. Although Ani is localized to the cytoplasm and cortex during metaphase and subsequently recruited to the prospective contractile ring during anaphase, it is mainly found in the nucleus during interphase [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. This protein is expressed in tissues with actively dividing cells, such as the lungs, bone marrow, and testes. Furthermore, its function during cytokinesis has been extensively studied. Ani has crucial functions in the regulation of cell-cell junction integrity [\\u003cspan additionalcitationids=\\\"CR7 CR8\\\" citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e] and is highly expressed in the human brain [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e], even in non-dividing cells and tissues. Ani stabilizes F-actin at the leading edge of neurons during neuronal migration [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e] and facilitates septin assembly to prevent abnormal myelin outfolding [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. However, its precise functions in the nervous system remain unclear.\\u003c/p\\u003e \\u003cp\\u003eSimilar to humans, the larval central nervous system (CNS) is among the most \\u003cem\\u003eani\\u003c/em\\u003e mRNA-expressing tissues[\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]. Although Ani contributes to the asymmetric division of the peripheral nervous system [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e], its role in the \\u003cem\\u003eDrosophila\\u003c/em\\u003e CNS has not been investigated. Therefore, this study comprehensively investigated the expression pattern of Ani in the larval nervous system and its role in the nervous system using pan-neuron-specific \\u003cem\\u003eani\\u003c/em\\u003e knockdown. Ani is highly expressed in dividing cells, including neuroblasts (NBs) in the brain lobe. However, it was poorly expressed in some neurons in the ventral nerve cord, axons, and neuromuscular junctions (NMJ) of motor neurons. In addition, it was hypothesized that Ani is localized along the F-actin in the axon. Furthermore, the knockdown of \\u003cem\\u003eani\\u003c/em\\u003e in the nervous system significantly perturbed larval learning, larval and adult locomotor ability, and viability. These results indicate that Ani plays an important role in the \\u003cem\\u003eDrosophila\\u003c/em\\u003e nervous system.\\u003c/p\\u003e\"},{\"header\":\"RESULTS\",\"content\":\"\\u003cp\\u003e \\u003cb\\u003eExpression of\\u003c/b\\u003e \\u003cb\\u003eani\\u003c/b\\u003e \\u003cb\\u003ein the larval nervous system\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003eThe \\u003cem\\u003eani\\u003c/em\\u003e gene is predicted to be relatively highly expressed in the larval CNS based on the RNA-seq analysis and to have three splice variants (\\u003cem\\u003eSV-A\\u003c/em\\u003e, \\u003cem\\u003eSV-B\\u003c/em\\u003e, and \\u003cem\\u003eSV-C\\u003c/em\\u003e) in the \\u003cem\\u003eDrosophila\\u003c/em\\u003e database, FlyBase (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA) [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. Therefore, we purified total RNA and proteins from the larval CNS and performed quantitative RT-PCR (qRT-PCR) and Western blot analyses to determine which splice variant was expressed in the larval CNS. The qRT-PCR with the primer set designed to detect \\u003cem\\u003eSV-C\\u003c/em\\u003e or both \\u003cem\\u003eSV-B\\u003c/em\\u003e and \\u003cem\\u003eC\\u003c/em\\u003e showed only marginal amplification of the PCR signal. In contrast, qRT-PCR with the primer set designed to detect both \\u003cem\\u003eSV-A\\u003c/em\\u003e and \\u003cem\\u003eB\\u003c/em\\u003e showed extensive amplification of the signal (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA, B), which is similar to results reported in early embryos [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e]. These results suggest that \\u003cem\\u003eSV-A\\u003c/em\\u003e is predominantly expressed in the larval CNS. In Western blot analysis with anti-Ani IgG, the 178 kDa band corresponding to Ani predicted to be encoded by \\u003cem\\u003eSV-A\\u003c/em\\u003e was predominantly detected (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). The marginally detected 87 kDa and approximately 75 kDa bands may have been derived from \\u003cem\\u003eSV-C\\u003c/em\\u003e or the degradation products of the 178 kDa product. These results were consistent with those of the qRT-PCR, indicating that \\u003cem\\u003eSV-A\\u003c/em\\u003e is predominantly expressed in the larval CNS. Next, we performed immunofluorescence staining of the larval nervous system with anti-Ani IgG to comprehensively investigate Ani expression patterns. Ani signals were predominantly detected in proliferating cells of the CNS (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e, S1). In particular, this protein was highly expressed in the NBs marked by Deadpan (Dpn) in the brain lobe, ventral nerve cord (VNC), neural epithelium, and some lamina cells in the brain lobe (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD). In contrast, Ani showed a mutually exclusive expression pattern with Dachshund (Dac), except for a few layers of cells next to the lamina furrow (LF) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD e, f). Although Dac is a marker for lamina precursor cells and neurons [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e], Dac and Ani were co-expressed in the proliferating cells that form a cell layer next to the LF in the outer proliferation center (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD f).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eAlthough most of the Ani was expressed in the cell nuclei of the CNS, except in cells expressing embryonic lethal abnormal vision (Elav), a neuronal marker (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA, S2), Ani was also detected weakly in the nuclei of Elav-expressing cells in the optic lobe and VNC (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB, S2). In addition, it was detected at the synaptic boutons in the neuromuscular junction (NMJ) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC) and axons (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD, S3), whereas the strong and large signals in the PNS corresponded to the glial nuclei (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD). Furthermore, the Ani dot signals in the axon were connected by a filament-like structure and were localized between the plasma membrane and neural lamella, where perineurial and subperineurial glia are located outside the neurons (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD, S3) [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e]. These results suggest that Ani functions, not only in proliferating cells, but also in non-proliferating cells in the \\u003cem\\u003eDrosophila\\u003c/em\\u003e larval nervous system.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eani\\u003c/em\\u003e knockdown in the CNS induces defective neurological phenotypes\\u003c/p\\u003e \\u003cp\\u003eWe knocked down \\u003cem\\u003eani\\u003c/em\\u003e using the \\u003cem\\u003eelav\\u003c/em\\u003e-GAL4 driver, a pan-neuronal driver, or \\u003cem\\u003eOK371\\u003c/em\\u003e-GAL4, a glutamatergic neuronal GAL4 driver [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e], combined with two independent ani-RNAi lines to investigate the role of \\u003cem\\u003eani\\u003c/em\\u003e in the neurons of the \\u003cem\\u003eDrosophila\\u003c/em\\u003e nervous system. We then analyzed the phenotypes of the knockdown flies (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e, S3). The expression levels of \\u003cem\\u003eani\\u003c/em\\u003e mRNA and Ani in the CNS were evaluated using qRT-PCR, Western blotting, and immunostaining with anti-Ani IgG. \\u003cem\\u003eani\\u003c/em\\u003e mRNA levels decreased to 30% and 19% in elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e and elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e, respectively (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). Similarly, Ani levels in the CNS of the \\u003cem\\u003eani\\u003c/em\\u003e knockdown larvae decreased (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB, C, S4). Furthermore, the target sequences of ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e and ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e corresponded to nucleotide positions 616\\u0026ndash;953 and 597\\u0026ndash;617 of \\u003cem\\u003eSV-A\\u003c/em\\u003e, respectively, which overlap by only two nucleotides. Data from a BLAST search against the EST database and information on the Vienna Drosophila Resource Center (VDRC) homepage predicted no off-target effect in these IR strains. These results indicate that the knockdown efficiency was higher for elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e than for elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e. We investigated the larval learning and locomotor ability of the pan-neuronal \\u003cem\\u003eani\\u003c/em\\u003e knockdown flies to elucidate the role of \\u003cem\\u003eani\\u003c/em\\u003e in the nervous system. First, we performed an odor-taste associative learning assay with early-stage third-instar larvae to examine their learning ability [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e]. Although \\u003cem\\u003eDrosophila\\u003c/em\\u003e larvae showed no preference between amylacetate (AM) and octanol (OCT) without training, control larvae learned the association between odors and rewards. Thus, we calculated a learning index based on the AM preference after training. The learning index considerably decreased in elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e larvae and slightly decreased in elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e33485\\u003c/sup\\u003e larvae. However, the difference was not statistically significant (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). Next, we performed a crawling assay to investigate the effect of \\u003cem\\u003eani\\u003c/em\\u003e knockdown on larval locomotor abilities. elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e and elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e33485\\u003c/sup\\u003e larvae showed significantly reduced locomotor ability and slightly decreased crawling speed, respectively (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eE, F).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eAlthough most elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e flies survived until adulthood, almost all elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e died during the pupal stage. All escapers, albeit few, were considerably weak and died within a day after eclosion. The median longevity of \\u003cem\\u003eani\\u003c/em\\u003e knockdown flies was 28 d (elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e) and 1 d (elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e), which was markedly shorter than that of the control flies (38 d) (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eG). Next, we examined the locomotor ability of only elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e adult flies using a climbing assay because the escapers in the elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e group failed to climb the wall and died the day after eclosion. The climbing ability of three-day-old elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e flies showed substantial defects (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eH). These results indicate that \\u003cem\\u003eani\\u003c/em\\u003e plays essential roles in \\u003cem\\u003eelav\\u003c/em\\u003e-expressing cells of the \\u003cem\\u003eDrosophila\\u003c/em\\u003e nervous system and that defective \\u003cem\\u003eani\\u003c/em\\u003e knockdown in elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e flies is more severe than that in elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e flies.\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eani\\u003c/em\\u003e knockdown in the CNS leads to abnormal neuropil formation and increases the cell size\\u003c/p\\u003e \\u003cp\\u003eBecause the mushroom body of the larval brain is the center of olfactory associative learning and memory ability [\\u003cspan additionalcitationids=\\\"CR24\\\" citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e], we conducted immunostaining of the CNS with anti-Brp IgG and anti-CadN IgG to visualize the mature neuropil [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. Both Brp and CadN expression patterns were abnormal in elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e larvae, especially the size of the BRP area in the brain lobe and the distribution patterns of CadN in the optic lobe and thoracic ganglion in the VNC (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). The ratio of the neuropil area to the brain lobe area markedly decreased in both elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e33465\\u003c/sup\\u003e and elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e larvae (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB, C).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eElav was believed to be exclusively expressed in post-mitotic neurons [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. However, its expression has been demonstrated in almost all embryonic lateral glial cells and some NBs. In addition, \\u003cem\\u003eelav\\u003c/em\\u003e-GAL4 drivers (458: \\u003cem\\u003eelav\\u003c/em\\u003e\\u003csup\\u003e\\u003cem\\u003eC155\\u003c/em\\u003e\\u003c/sup\\u003e-GAL4, 8765: \\u003cem\\u003eelav.L2\\u003c/em\\u003e-GAL4), which were not used in this study, modulate the expression of the reporter gene in embryonic glial cells and mitotically active cells [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e]. Furthermore, the expression patterns of \\u003cem\\u003eelav\\u003c/em\\u003e-GAL4 drivers differ between \\u003cem\\u003eelav\\u003c/em\\u003e\\u003csup\\u003e\\u003cem\\u003eC155\\u003c/em\\u003e\\u003c/sup\\u003e-GAL4 (458) and other drivers (8760, 8765) [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. Therefore, we monitored the mCD8-GFP reporter to investigate the expression pattern of \\u003cem\\u003eelav\\u003c/em\\u003e-GAL4 (8760) in the larval CNS, particularly in the brain lobe. \\u003cem\\u003eelav\\u003c/em\\u003e-GAL4 induced the expression of the reporter in cells expressing the Ani or NB marker Dpn, especially on the dorsal side of the larval brain lobe (Fig. S5). These results suggested that \\u003cem\\u003eani\\u003c/em\\u003e was knocked down in the NB with the \\u003cem\\u003eelav\\u003c/em\\u003e-GAL4 driver. Therefore, we examined the distribution patterns of neurons and glial cells in the larval CNS of \\u003cem\\u003eani\\u003c/em\\u003e knockdown flies. The distribution patterns of neurons and glial cells in the CNS, especially in the elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e larvae, were drastically perturbed, and the size of the brain lobe markedly increased (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA, B). In addition to defects in the distribution patterns of neurons and glial cells, the size of the cells was drastically enlarged in the elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e larvae (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC). Similarly, the size of the whole CNS was drastically enlarged (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC, \\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA). However, the CNS shape was similar to that of the control. In addition, the \\u003cem\\u003eani\\u003c/em\\u003e knockdown larvae could crawl, although their crawling speed was significantly slower than that of the control larvae (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eE, F).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eani\\u003c/b\\u003e \\u003cb\\u003eknockdown in the CNS affects the morphology of the NMJ and expression patterns of CadN in the NMJ\\u003c/b\\u003e\\u003c/p\\u003e \\u003cp\\u003e \\u003cem\\u003eani\\u003c/em\\u003e knockdown larvae showed locomotor defects. Therefore, we investigated whether motor neurons in the \\u003cem\\u003eani\\u003c/em\\u003e knockdown larvae had defects by examining the morphology of the NMJ, a specialized synapse between the nerve terminals of motor neurons and muscles. A detailed inspection of the NMJ revealed a substantial increase in the total branch length of synapses, the number of synaptic branches, and mature bouton numbers. In contrast, bouton sizes considerably decreased in elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e larvae (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). Although the effect was weaker than that in elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e53358\\u003c/sup\\u003e larvae, elav\\u0026thinsp;\\u0026gt;\\u0026thinsp;ani-IR\\u003csup\\u003e343465\\u003c/sup\\u003e larvae also showed a statistically significant increase in the number of synaptic branches and a decrease in bouton size (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). Ani, an F-actin-binding protein, contributes to cytoskeleton formation at the edge of cells during neuronal migration and the strength of epithelial cell-cell adhesion [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. In addition, F-actin binds to catenin and cadherin, regulating adhesion between pre-and post-synapsis [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]. Therefore, we hypothesized that \\u003cem\\u003eani\\u003c/em\\u003e contributed to the strength of adhesion between pre- and post-synaptic cells. As synaptic cell adhesion molecules, such as CadN, Capricious, Dscam, and Fasciclin II (Fas II), play important roles in the connection between pre-and post-synaptic cells, we evaluated the expression pattern of CadN in the NMJ of \\u003cem\\u003eani\\u003c/em\\u003e knockdown larvae. In the synaptic boutons in the NMJ of both lines of \\u003cem\\u003eani\\u003c/em\\u003e knockdown larvae, the size of the CadN foci and the total intensity of CadN significantly decreased whereas the number of CadN foci did not change (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e). These results suggest that CadN levels were decreased and that CadN clustering was impaired in the NMJ of the \\u003cem\\u003eani\\u003c/em\\u003e knockdown larvae.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"DISCUSSION\",\"content\":\"\\u003cp\\u003eAni is expressed in almost all Dpn-expressing type I and II NBs and in two layers of Dac-expressing cells in the neuroepithelium posterior to the LF [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e] (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD). This is similar to the distribution pattern of proliferating cells in the brain lobe (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD, S1). Ani is mainly localized to the nucleus during interphase [\\u003cspan additionalcitationids=\\\"CR37 CR38 CR39\\\" citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e] and to the cortex during the cytokinesis of proliferating cells [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]. Moreover, it is diffusively localized to the cytoplasm of non-proliferating cells [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]. In the present study, Ani was strongly expressed in proliferating cells in the brain lobe and the thoracic region in the VNC (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e, \\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, S1). Contrastingly, it was weakly expressed in some cells of the VNC, the axon, and the NMJ in the differentiated motor neurons (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, S3). Ani was localized to the boutons in the NMJ (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC). As actin is not required to expand membrane blebbing, it must be stabilized or retracted [\\u003cspan additionalcitationids=\\\"CR44\\\" citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e], suggesting that the bouton to which Ani is localized is robust and stabilized. Although it was predicted that decreased Ani at the bouton results in reduced mature boutons, the number of boutons contrarily increased with NMJ elongation in \\u003cem\\u003eani\\u003c/em\\u003e knockdown larvae (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). However, the mean size of the boutons considerably decreased, which may suggest destabilization of the bouton structure. The increased NMJ length in \\u003cem\\u003eani\\u003c/em\\u003e knockdown larvae may be caused by a different mechanism. TGFβ/BMP and Wnt/Wg signaling are necessary for NMJ development. Null mutants of the \\u003cem\\u003ehighwire\\u003c/em\\u003e gene encoding an E3 ubiquitin ligase show a decrease in MAPKKK dial leucine zipper-containing kinase (DLK, called Wallenda in \\u003cem\\u003eDrosophila\\u003c/em\\u003e) levels and synaptic overgrowth [\\u003cspan additionalcitationids=\\\"CR47\\\" citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e]. In addition, the loss-of-function allele of the \\u003cem\\u003eshort stop\\u003c/em\\u003e (\\u003cem\\u003eshot\\u003c/em\\u003e) encoding a member of the spectraplakin family of large cytoskeletal linker molecules that bind microtubules and actin shows substantial overgrowth of the NMJ [\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e]. \\u003cem\\u003eshot\\u003c/em\\u003e negatively regulates the Wallenda/DLK involved in the axonal injury response [\\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e48\\u003c/span\\u003e]. Because Ani stabilizes the F-actin network [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e], the elongation of NMJ following decreased \\u003cem\\u003eani\\u003c/em\\u003e levels may have been caused by a disturbance in TGFβ/BMP or Wnt/Wg signaling. Moreover, \\u003cem\\u003eani\\u003c/em\\u003e knockdown neurons may not sense the extracellular signal properly because the Ani reduction perturbed the distribution of CadN at the boutons in the NMJ. Although mutations and overexpression of the gene that induces NMJ overgrowth have been reported [\\u003cspan citationid=\\\"CR49\\\" class=\\\"CitationRef\\\"\\u003e49\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e50\\u003c/span\\u003e], the electrophysiological function of the neuron was not or only slightly disordered. In addition, the larval locomotor ability or behavior was not evaluated.\\u003c/p\\u003e \\u003cp\\u003eThe Ani size detected through Western blotting is usually larger than the predicted size calculated from the amino acid sequences [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e51\\u003c/span\\u003e], which is considered that the larger size is caused by an elongated coiled coil with low electrophoretic mobility. Consistent with previous results, Western blotting revealed an Ani size of approximately 178 kDa, which was larger than the 132.9 kDa calculated from the amino acid sequences in the present study. In addition, Ani dots connected by filament-like structures were detected in the axons of motor neurons (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD). Furthermore, \\u003cem\\u003eani\\u003c/em\\u003e knockdown larvae, these Ani signals connected by filament-like structures were hardly detectable, and the morphology of the actin filaments appeared abnormal in the axons (Fig. S3). These data suggest the Ani forms a dimer and the dimerized Ani has a role in the actin filament assembly in the axon. However, no study has directly revealed that this protein dimerizes to date. However, further experiments are needed to confirm this result.\\u003c/p\\u003e \\u003cp\\u003eThis study revealed the numerous roles of Ani in the nervous system of \\u003cem\\u003eDrosophila\\u003c/em\\u003e, and the distribution patterns of Ani in the NMJ suggested its important role in nerve-muscle communication.\\u003c/p\\u003e\"},{\"header\":\"MATERIALS and METHODS\",\"content\":\"\\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eFly stocks\\u003c/h2\\u003e \\u003cp\\u003eFlies were cultured on standard food containing 0.65% agar, 10% glucose, 4% dry yeast, 5% corn flour, and 3% rice bran under a 12:12 h light-dark cycle at 25\\u0026deg;C. Fly strains \\u003cem\\u003eUAS-GFP.nls\\u003c/em\\u003e (107870), \\u003cem\\u003eUAS-mCD8::GFP\\u003c/em\\u003e (108068), \\u003cem\\u003ey\\u003c/em\\u003e\\u003csup\\u003e\\u003cem\\u003e1\\u003c/em\\u003e\\u003c/sup\\u003e\\u003cem\\u003ev\\u003c/em\\u003e\\u003csup\\u003e\\u003cem\\u003e1\\u003c/em\\u003e\\u003c/sup\\u003e (101249) were provided by the Kyoto Stock Center (Drosophila Genomics and Genetic Resources (DGGR)). Fly strains \\u003cem\\u003eelav\\u003c/em\\u003e-GAL4 (8760), \\u003cem\\u003eOK371\\u003c/em\\u003e-GAL4 (26160), \\u003cem\\u003eUAS-ani-IR\\u003c/em\\u003e (53358), and \\u003cem\\u003eUAS-LifeAct-GFP\\u003c/em\\u003e (35544) were purchased from the Bloomington Drosophila Stock Center (BDSC), BDSC. The \\u003cem\\u003eUAS-ani-IR\\u003c/em\\u003e (33465) strain was obtained from the VDRC.\\u003c/p\\u003e \\u003cp\\u003eCrawling assay\\u003c/p\\u003e \\u003cp\\u003eThe crawling assay was performed as previously described [\\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e52\\u003c/span\\u003e], with some modifications. Male larvae at the wander third instar stage were randomly collected and placed on 2% agar Petri dishes. The larval movements were recorded for 1 min using a digital camera. The recorded videos were analyzed using ImageJ 1.53t [\\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e53\\u003c/span\\u003e] and the wrMTrck plugin (developed by Dr. Jesper S\\u0026oslash;ndergaard Pedersen, \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttp://www.phage.dk/plugins/wrmtrck.html\\u003c/span\\u003e\\u003cspan address=\\\"http://www.phage.dk/plugins/wrmtrck.html\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) to obtain the larval average speed [\\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e54\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eClimbing assay\\u003c/p\\u003e \\u003cp\\u003eThe climbing assay was performed as previously described [\\u003cspan citationid=\\\"CR55\\\" class=\\\"CitationRef\\\"\\u003e55\\u003c/span\\u003e]. Newly eclosed adult male flies of each strain were collected into separate vials at a maximum density of 20 flies/vial. The flies were maintained at 28\\u0026deg;C under a 12:12 h light-dark cycle. Flies were transferred to cylindrical tubes with a 15 cm height and 2 cm diameter to measure their climbing ability. The cylinders were tapped five times to collect the flies at the bottom, and their movements were recorded using a digital camera. The procedure was repeated five times at 1 min intervals. In all experiments, the height to which each fly climbed after 5 s was scored from 0 to 5 points at 2 cm intervals from the bottom to calculate the climbing index. The assay was performed at 3, 7, and 14 days after eclosion.\\u003c/p\\u003e \\u003cp\\u003eSurvival assay\\u003c/p\\u003e \\u003cp\\u003eNewly eclosed adult male flies were randomly placed in food vials at a maximum density of 20 flies/vial. They were subsequently transferred to a new vial every 2\\u0026ndash;3 days, and the number of dead flies was counted simultaneously [\\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e56\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eImmunostaining\\u003c/p\\u003e \\u003cp\\u003eLarvae and adult flies were dissected in cold Phosphate Buffered Saline (PBS) and fixed with 4% paraformaldehyde (PFA) in PBS at 25\\u0026deg;C for 20 min or 40 min for the brain lobe or NMJs, respectively. Next, they were washed with 0.3% PBS-T (PBS with 0.3% Triton X-100), blocked with 10% normal goat serum in 0.15% PBS-T, and incubated with the following primary antibodies: Anti-Ani antibody (rabbit, 1:400; kindly provided by Dr. Maria G. Giansanti [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e57\\u003c/span\\u003e]), anti-Dlg1 IgG (mouse, 1:200, 4F3; Developmental Studies hybridoma Bank (DSHB)), anti-Dpn IgG (rat, 1:100, 11D1BC7; Abcam, Cambridge, UK), anti-Elav IgG (mouse, 1:50, 9F8A9; DSHB), anti-Elav IgG (rat, 1:50, 7E8A10; DSHB), anti-Lamin IgG (mouse, 1:100, ADL67.10; DSHB), Alexa 647 conjugated anti-HRP IgG (goat, 1:200; Jackson ImmunoResearch, West Grove, PA, USA), FITC conjugated anti-HRP IgG (goat, 1:200; Jackson ImmunoResearch), anti-CadN IgG (rat, 1:80, DN-Ex #8; DSHB). The samples were then washed with 0.3% PBS-T and incubated with a secondary antibody at 25\\u0026deg;C for 2 h. Finally, they were washed with 0.3% PBS-T and mounted on Vectashield mounting media (Vector Laboratories, Newark, CA, USA). The samples were imaged using a confocal microscope (FLUOVIEW FV10i, Olympus, Tokyo, Japan). The collected images were analyzed using ImageJ 1.49o software.\\u003c/p\\u003e \\u003cp\\u003eBrdU labeling\\u003c/p\\u003e \\u003cp\\u003eCNS dissected from third instar larvae were incubated in 75 \\u0026micro;g/\\u0026micro;L Bromodeoxyuridine 5-bromo-2\\u0026rsquo;-deoxyuridine (BrdU) at 30\\u0026deg;C for 2 h. They were subsequently fixed with 4% PFA at 25\\u0026deg;C for 20 min and washed with 0.3% PBS-T. Next, the cells were incubated with anti-Ani IgG at 4\\u0026deg;C for 16 h, incubated with 3M HCl for 30 min, and rinsed once with PBS. Incorporated BrdU was visualized using anti-BrdU IgG (1:10) and washed with 0.3% PBS-T. The samples were then incubated with the secondary antibodies at 25\\u0026deg;C for 2 h, washed PBS-T 0.3%, and mounted with Vectashield mounting media. The samples were imaged using a confocal microscope (FLUOVIEW FV10i). The images were analyzed using ImageJ 1.53t software.\\u003c/p\\u003e \\u003cp\\u003eRNA isolation and quantitative RT-PCR\\u003c/p\\u003e \\u003cp\\u003eTotal RNA was isolated from 20 larval CNS samples using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). Next, cDNA was synthesized using the PrimeScript RT reagent kit (TaKaRa, Kusatsu, Shiga, Japan). Quantitative RT-PCR (qRT-PCR) was subsequently performed using SYBR Premix Ex Taq II (TaKaRa) in the CFX96 Touch Real-Time PCR Detection System (BIO-RAD, Hercules, CA, USA) using a standard curve-based method calculated using the CFX Manager software (BIO-RAD). The following primers were used for qRT-PCR: \\u003cem\\u003eGAPDH\\u003c/em\\u003e [\\u003cspan citationid=\\\"CR58\\\" class=\\\"CitationRef\\\"\\u003e58\\u003c/span\\u003e]: (fw 5\\u0026prime;-GGAGCCACCTATGACGAAATC-3\\u0026prime; /rev 5\\u0026prime;-TCGAACACAGACGAATGGG-3\\u0026prime;), \\u003cem\\u003eani SV-A\\u0026amp;B\\u003c/em\\u003e (fw 5\\u0026prime;- ACTTCAGGATCACGCTAGAAATC \\u0026minus;\\u0026thinsp;3\\u0026prime; / rev 5\\u0026prime;- GTCTTGATGCCACCCTTCTT-3\\u0026prime;), \\u003cem\\u003eani SV-B \\u0026amp; C\\u003c/em\\u003e (fw 5\\u0026prime;- CCTGCCAAATACGACAAAGTG \\u0026minus;\\u0026thinsp;3\\u0026prime; / rev 5\\u0026prime;- CACGACGAAATACCGAAATTG \\u0026minus;\\u0026thinsp;3\\u0026prime;), \\u003cem\\u003eani SV-C\\u003c/em\\u003e (fw 5\\u0026prime;- CTGCTTGCTATTTCTGCTCTG \\u0026minus;\\u0026thinsp;3\\u0026prime; / rev 5\\u0026prime;- TTTATTGTTGGTCTTGTCTAGGG \\u0026minus;\\u0026thinsp;3\\u0026prime;), \\u003cem\\u003eani all SV\\u003c/em\\u003e (fw 5\\u0026prime;- TCACTATACGGCGGTAAACAAG-3\\u0026prime; / rev 5\\u0026prime;- CTCCTGCTCCTGAATCTCAAC-3\\u0026prime;)\\u003c/p\\u003e \\u003cp\\u003eWestern blotting\\u003c/p\\u003e \\u003cp\\u003eTwenty larvae were dissected in cold PBS and kept at -80\\u0026deg;C to collect the CNS. The CNS samples were homogenized in 2\\u0026times; sample buffer, denatured at 95\\u0026deg;C for 5 min, separated using 8% tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Tricine SDS-PAGE), and transferred to PVDF membranes. Next, the samples were incubated with anti-Ani (1:4000) or anti-α-Tubulin (α-Tub) IgG (mouse, 1:8000, Sigma-Aldrich) as a primary antibody, followed by incubation with HRP-conjugated anti-rabbit (goat, 1:4000, Thermo Fisher Scientific, Waltham, MA, USA) or mouse IgG (goat, 1:10000, Thermo Fisher Scientific, Waltham, MA, USA) as a secondary antibody. Proteins were subsequently detected with the ECL SELECT reagent (Cytiva, Tokyo, Japan) and captured and analyzed using AE-9300H Ez-Capture MG (ATTO, Tokyo, Japan)). The specificity of anti-Ani IgG has been demonstrated by Giansanti [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e57\\u003c/span\\u003e].\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eImaging analysis and deconvolution\\u003c/h3\\u003e\\n\\u003cp\\u003eThe immunofluorescence-stained samples were imaged using a confocal microscope (FLUOVIEW FV10i). The images were analyzed using ImageJ 1.53t software. The morphology of the NMJs was analyzed based on the parameters described by Nijhof et al. [\\u003cspan citationid=\\\"CR59\\\" class=\\\"CitationRef\\\"\\u003e59\\u003c/span\\u003e]. Individual data were averaged from four NMJs in Muscle 4 at segments A3 and A4. The point-spread function for deconvolution was generated using fluorescent beads from the PS-Speck\\u0026trade; Microscope Point Source Kit (Invitrogen, Carlsbad, CA, USA). The input image has a voxel size (height \\u0026times; width \\u0026times; depth\\u0026thinsp;=\\u0026thinsp;0.02 \\u0026times; 0.02 \\u0026times; 0.15 \\u0026micro;m). Deconvolution was performed using the Richardson-Lucy deconvolution method, the plugin CLIJx [\\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e60\\u003c/span\\u003e], and ImageJ 1.53t software.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eData analysis\\u003c/h2\\u003e \\u003cp\\u003eAll data were analyzed using GraphPad Prism version 10 for Windows (GraphPad Software, Boston, MA, USA). The sample size and statistical comparisons performed are described in the protocol of each experiment.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eACKNOWLEDGEMENTS\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe thank Maria G. Giansanti for kindly providing anti-Ani IgG, and the DGGR, BDSC, and VDRC for fly strains.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCOMPETING INTERESTS\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no competing or financial interests.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAUTHOR CONTRIBUTIONS\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eH.M.A. and H.Y. and designed the project, wrote the main manuscript text, prepared all figures, performed experiments, and analyzed the results. T.T.P.D provided the advice for the experiments and data analysis. All authors reviewed the manuscript.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFUNDING\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis research was partially supported by the JSPS Core-to-Core Program, Asia-Africa Science Platforms (1202987), to H.Y.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDATA AVAILABILITY\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll raw data used during the current study are available from the corresponding author on request.\\u003cbr\\u003e\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eMiller, K. G., Field, C. M. \\u0026amp; Alberts, B. M. Actin-binding proteins from \\u003cem\\u003eDrosophila\\u003c/em\\u003e embryos: a complex network of interacting proteins detected by F-actin affinity chromatography. J. Cell Biol. 109, 2963\\u0026ndash;2975 (1989).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eStraight, A. F., Field, C. M. \\u0026amp; Mitchison, T. J. Anillin binds nonmuscle myosin II and regulates the contractile ring. Mol. Biol. Cell 16, 193\\u0026ndash;201 (2005).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang, L. \\u0026amp; Maddox, A. S. Anillin. Curr. Biol. 20, R135-R136 (2010).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eField, C. M., Groen, A. C., Nguyen, P. A. \\u0026amp; Mitchison, T. J. Spindle-to-cortex communication in cleaving, polyspermic \\u003cem\\u003eXenopus\\u003c/em\\u003e eggs. Mol. Biol. Cell 26, 3628\\u0026ndash;3640 (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eField, C. M. \\u0026amp; Alberts, B.M. Anillin, a contractile ring protein that cycles from the nucleus to the cell cortex. J. Cell Biol. 131, 165\\u0026ndash;78 (1995).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eReyes, C. C., \\u003cem\\u003eet al.\\u003c/em\\u003e Anillin regulates cell-cell junction integrity by organizing junctional accumulation of Rho-GTP and actomyosin. Curr. Biol. 24, 1263\\u0026ndash;1270 (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, D., \\u003cem\\u003eet al.\\u003c/em\\u003e F-actin binding protein, anillin, regulates integrity of intercellular junctions in human epithelial cells. Cell. Mol. Life Sci. 72, 3185\\u0026ndash;3200 (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eArnold, T. R., \\u003cem\\u003eet al.\\u003c/em\\u003e Anillin regulates epithelial cell mechanics by structuring the medial-apical actomyosin network. eLIFE 8, e39065; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.7554/eLife.39065\\u003c/span\\u003e\\u003cspan address=\\\"10.7554/eLife.39065\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBudnar, S., \\u003cem\\u003eet al.\\u003c/em\\u003e Anillin promotes cell contractility by cyclic resetting of RhoA residence kinetics. Dev. Cell 49, 894\\u0026ndash;906.e12. (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eThul, P. J., \\u003cem\\u003eet al.\\u003c/em\\u003e A subcellular map of the human proteome. Science 356, eaal3321 (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKathryn, R. \\u0026amp; Amy Shaub M. Neuron Migration: Anillin protects leading edge actin. Curr. Biol. 25, R423-R425 (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePatzig, J, \\u003cem\\u003eet al.\\u003c/em\\u003e Septin/anillin filaments scaffold central nervous system myelin to accelerate nerve conduction. eLIFE 5, e17119; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.7554/eLife.17119\\u003c/span\\u003e\\u003cspan address=\\\"10.7554/eLife.17119\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2016).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eErwig, M. S. \\u003cem\\u003eet al.\\u003c/em\\u003e Anillin facilitates septin assembly to prevent pathological outfoldings of central nervous system myelin. eLIFE 8, e43888; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.7554/eLife.43888\\u003c/span\\u003e\\u003cspan address=\\\"10.7554/eLife.43888\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLeader, D. P., et al., FlyAtlas 2: a new version of the \\u003cem\\u003eDrosophila melanogaster\\u003c/em\\u003e expression atlas with RNA-Seq, miRNA-Seq and sex-specific data. Nucleic Acids Res. 46, D809-D815 (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eO\\u0026rsquo;Farrell, F. \\u0026amp; Kylsten P. \\u003cem\\u003eDrosophila\\u003c/em\\u003e Anillin is unequally required during asymmetric cell divisions of the PNS. \\u003cem\\u003eBiochem. Biophys. Res. Commun.\\u003c/em\\u003e 369, 407\\u0026ndash;413 (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLarkin, A., \\u003cem\\u003eet al.\\u003c/em\\u003e FlyBase: updates to the \\u003cem\\u003eDrosophila melanogaster\\u003c/em\\u003e knowledge base. Nucleic Acids Res. 49, D899-D907 (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHirashima, T., Tanaka, R., Yamaguchi, M. \\u0026amp; Yoshida, H. The ABD on the nascent polypeptide and PH domain are required for the precise Anillin localization in \\u003cem\\u003eDrosophila\\u003c/em\\u003e syncytial blastoderm. Sci. Rep. 8, 12910; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41598-018-31106-0\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41598-018-31106-0\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYasugi, T., Umetsu, D., Murakami, S., Sato, M. \\u0026amp; Tabata, T. \\u003cem\\u003eDrosophila\\u003c/em\\u003e optic lobe neuroblasts triggered by a wave of proneural gene expression that is negatively regulated by JAK/STAT. Development 135, 1471\\u0026ndash;1480 (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGold, K. S. \\u0026amp; Brand, A. H. Optix defines a neuroepithelial compartment in the optic lobe of the \\u003cem\\u003eDrosophila\\u003c/em\\u003e brain. \\u003cem\\u003eNeural. Dev.\\u003c/em\\u003e 9, 18; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/1749-8104-9-18\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/1749-8104-9-18\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXie, X. \\u0026amp; Auld, V. J. Integrins are necessary for the development and maintenance of the glial layers in the \\u003cem\\u003eDrosophila\\u003c/em\\u003e peripheral nerve. Development 138, 3813\\u0026ndash;3822 (2011).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMahr, A. \\u0026amp; Aberle, H. The expression pattern of the \\u003cem\\u003eDrosophila\\u003c/em\\u003e vesicular glutamate transporter: a marker protein for motoneurons and glutamatergic centers in the brain. Gene Expr. Patterns. 6, 299\\u0026ndash;309 (2006).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGerber, B., Biernacki, R. \\u0026amp; Thum, J. Odor\\u0026ndash;taste learning assays in \\u003cem\\u003eDrosophila\\u003c/em\\u003e larvae. Cold Spring Harb. Protoc. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1101/pdb.prot071639\\u003c/span\\u003e\\u003cspan address=\\\"10.1101/pdb.prot071639\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2013).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMcGuire, S. E., Le, P. T. \\u0026amp; Davis, R. L. The role of \\u003cem\\u003eDrosophila\\u003c/em\\u003e mushroom body signaling in olfactory memory. Science 293, 1330\\u0026ndash;1333 (2001).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHeisenberg, M. Mushroom body memoir: from maps to models. Nat. Rev. Neurosci. 4, 266\\u0026ndash;275 (2003).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDavis, R. L. Olfactory memory formation in \\u003cem\\u003eDrosophila\\u003c/em\\u003e: from molecular to systems neuroscience. Annu. Rev. Neurosci. 28, 275\\u0026ndash;302 (2005).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEnriquez, J., \\u003cem\\u003eet al.\\u003c/em\\u003e Differing strategies despite shared lineages of motor neurons and glia to achieve robust development of an adult neuropil in \\u003cem\\u003eDrosophila\\u003c/em\\u003e. Neuron 97, 538\\u0026ndash;554.e5 (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKaur, R., \\u003cem\\u003eet al.\\u003c/em\\u003e Pioneer interneurons instruct bilaterality in the \\u003cem\\u003eDrosophila\\u003c/em\\u003e olfactory sensory map. Sci. Adv. 5, eaaw5537; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1126/sciadv.aaw5537\\u003c/span\\u003e\\u003cspan address=\\\"10.1126/sciadv.aaw5537\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRobinow, S. \\u0026amp; White, K. The locus elav of \\u003cem\\u003eDrosophila melanogaster\\u003c/em\\u003e is expressed in neurons at all developmental stages. Dev. Biol. 126, 294\\u0026ndash;303 (1988).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRobinow, S. \\u0026amp; White, K. Characterization and spatial distribution of the ELAV protein during \\u003cem\\u003eDrosophila melanogaster\\u003c/em\\u003e development. J. Neurobiol. 22, 443\\u0026ndash;461 1991).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBerger, C., Renner, S., L\\u0026uuml;er, K. \\u0026amp; Technau, G. M. The commonly used marker ELAV is transiently expressed in neuroblasts and glial cells in the \\u003cem\\u003eDrosophila\\u003c/em\\u003e embryonic CNS. Dev. Dyn. 236, 3562\\u0026ndash;3568 (2007).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOgienko, A. A., Andreyeva, E. N., Omelina, E. S., Oshchepkova, A. L. \\u0026amp; Pindyurin, A. V. Molecular and cytological analysis of widely-used Gal4 driver lines for \\u003cem\\u003eDrosophila\\u003c/em\\u003e neurobiology. BMC Genet. 21(Suppl 1), 96; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/s12863-020-00895-7\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/s12863-020-00895-7\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKwiatkowski, A.V., Weis, W. I. \\u0026amp; Nelson, W. J. Catenins: playing both sides of the synapse. Curr. Opin. Cell Biol. 19, 551\\u0026ndash;556 (2007).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNelson, W. J. Regulation of cell-cell adhesion by the cadherin-catenin complex. Biochem. Soc. Trans. 36, 149\\u0026ndash;155 (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTian, D., \\u003cem\\u003eet al.\\u003c/em\\u003e Anillin regulates neuronal migration and neurite growth by linking RhoG to the actin cytoskeleton. Curr. Biol. 25, 1135\\u0026ndash;1145 (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNakato, H., Futch, T. A. \\u0026amp; Selleck, S. B. The \\u003cem\\u003edivision abnormally delayed\\u003c/em\\u003e (\\u003cem\\u003edally\\u003c/em\\u003e) gene: a putative integral membrane proteoglycan required for cell division patterning during postembryonic development of the nervous system in \\u003cem\\u003eDrosophila\\u003c/em\\u003e. Development 121, 3687\\u0026ndash;3702 (1995).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJeibmann, A. \\u0026amp; Paulus W. \\u003cem\\u003eDrosophila melanogaster\\u003c/em\\u003e as a model organism of brain diseases. Int. J. Mol. Sci. 10, 407\\u0026ndash;440 (2009).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePiekny, A. J. \\u0026amp; Maddox, A. S. The myriad roles of Anillin during cytokinesis. Semin. Cell Dev. Biol. 21, 881\\u0026ndash;891 (2010).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEyjolfsdottir, E., \\u003cem\\u003eet al.\\u003c/em\\u003e Detecting social actions of fruit flies. in Computer Vision \\u0026ndash; ECCV 2014. Cham: Springer International Publishing. 772\\u0026ndash;787 (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGiansanti, M. G., \\u003cem\\u003eet al.\\u003c/em\\u003e Exocyst-dependent membrane addition is required for anaphase cell elongation and cytokinesis in \\u003cem\\u003eDrosophila\\u003c/em\\u003e. PLoS Genetics 11, e1005632; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1371/journal.pgen.1005632\\u003c/span\\u003e\\u003cspan address=\\\"10.1371/journal.pgen.1005632\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYildirim, K., Petri, J., Kottmeier, R. \\u0026amp; Kl\\u0026auml;mbt, C. \\u003cem\\u003eDrosophila\\u003c/em\\u003e glia: Few cell types and many conserved functions. Glia 67, 5\\u0026ndash;26 (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKremer, M. C., \\u003cem\\u003eet al\\u003c/em\\u003e. The glia of the adult \\u003cem\\u003eDrosophila\\u003c/em\\u003e nervous system. Glia 65, 606\\u0026ndash;638 (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHall, P. A. \\u003cem\\u003eet al.\\u003c/em\\u003e The septin-binding protein anillin is overexpressed in diverse human tumors. Clin. Cancer Res. 11, 6780\\u0026ndash;6786 (2005).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCharras, G. T., Hu, C. K., Coughlin, M. \\u0026amp; Mitchison, T. J. Reassembly of contractile actin cortex in cell blebs. J. Cell Biol. 175, 477\\u0026ndash;490 (2006).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCharras, G. T., Coughlin, M., Mitchison, T. J. \\u0026amp; Mahadevan, L. Life and times of a cellular bleb. Biophys. J. 94, 1836\\u0026ndash;1853 (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFernandes, A. R., Martins, J. P., Gomes, E. R., Mendes, C. S. \\u0026amp; Teodoro, R. O. \\u003cem\\u003eDrosophila\\u003c/em\\u003e motor neuron boutons remodel through membrane blebbing coupled with muscle contraction. Nat. Commun. 14, 3352; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1038/s41467-023-38421-9\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41467-023-38421-9\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu, C., Wairkar, Y. P., Collins, C. A. \\u0026amp; DiAntonio, A. Highwire function at the \\u003cem\\u003eDrosophila\\u003c/em\\u003e neuromuscular junction: spatial, structural, and temporal requirements. J. Neurosci. 25, 9557\\u0026ndash;9566 (2005).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCollins, C. A., Wairkar, Y. P., Johnson, S. L. \\u0026amp; DiAntonio, A. Highwire restrains synaptic growth by attenuating a MAP kinase signal. Neuron. 51, 57\\u0026ndash;69 (2006).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eValakh, V., Walker, L. J., Skeath, J. B. \\u0026amp; DiAntonio, A. Loss of the spectraplakin short stop activates the DLK injury response pathway in \\u003cem\\u003eDrosophila\\u003c/em\\u003e. J. Neurosci. 33, 17863\\u0026ndash;17873 (2013).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhao G., \\u003cem\\u003eet al. Drosophila S6 Kinase like\\u003c/em\\u003e inhibits neuromuscular junction growth by downregulating the BMP receptor thickveins. \\u003cem\\u003ePLoS Genet.\\u003c/em\\u003e 11, e1004984; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1371/journal.pgen.1004984\\u003c/span\\u003e\\u003cspan address=\\\"10.1371/journal.pgen.1004984\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSpinner, M. A., Walla, D. A. \\u0026amp; Herman, T. G. \\u003cem\\u003eDrosophila\\u003c/em\\u003e Syd-1 has RhoGAP activity that is required for presynaptic clustering of Bruchpilot/ELKS but not Neurexin-1. \\u003cem\\u003eGenetics\\u003c/em\\u003e 208, 705\\u0026ndash;716 (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eField, C. M., Coughlin, M., Doberstein, S., Marty, T. \\u0026amp; Sullivan, W. Characterization of anillin mutants reveals essential roles in septin localization and plasma membrane integrity. Development. 132, 2849\\u0026ndash;2860 (2005).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNichols, C. D., Becnel, J. \\u0026amp; Pandey, U. B. Methods to assay \\u003cem\\u003eDrosophila\\u003c/em\\u003e behavior. J. Vis. Exp. 61, 3795; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3791/3795\\u003c/span\\u003e\\u003cspan address=\\\"10.3791/3795\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSchneider, C. A., Rasband, W. S. \\u0026amp; Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods. 9, 671\\u0026ndash;675 (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNussbaum-Krammer, C. I., Neto, M. F., Brielmann, R. M., Pedersen, J. S. \\u0026amp; Morimoto, R. I. Investigating the spreading and toxicity of prion-like proteins using the metazoan model organism \\u003cem\\u003eC. elegans\\u003c/em\\u003e. J. Vis. Exp. 95, 52321; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3791/52321\\u003c/span\\u003e\\u003cspan address=\\\"10.3791/52321\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGargano, J. W., Martin, I., Bhandari, P. \\u0026amp; Grotewiel, M. S. Rapid iterative negative geotaxis (RING): a new method for assessing age-related locomotor decline in \\u003cem\\u003eDrosophila\\u003c/em\\u003e. Exp. Gerontol. 40, 386\\u0026ndash;395 (2005).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHuynh, T. K. T., \\u003cem\\u003eet al.\\u003c/em\\u003e Crucial roles of ubiquitin carboxy-terminal hydrolase L1 in motor neuronal health by \\u003cem\\u003eDrosophila\\u003c/em\\u003e model. Antioxid. Redox Signal. 37, 257\\u0026ndash;273 (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSechi, S. \\u003cem\\u003eet al\\u003c/em\\u003e., Rab1 interacts with GOLPH3 and controls Golgi structure and contractile ring constriction during cytokinesis in \\u003cem\\u003eDrosophila melanogaster\\u003c/em\\u003e. Open Biol. 7, 160257; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1098/rsob.160257\\u003c/span\\u003e\\u003cspan address=\\\"10.1098/rsob.160257\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSuda, K., \\u003cem\\u003eet al.\\u003c/em\\u003e Novel \\u003cem\\u003eDrosophila\\u003c/em\\u003e model for mitochondrial diseases by targeting of a solute carrier protein SLC25A46. Brain Res. 1689, 30\\u0026ndash;44 (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNijhof, B., \\u003cem\\u003eet al.\\u003c/em\\u003e A New Fiji-Based Algorithm That Systematically Quantifies Nine Synaptic Parameters Provides Insights into \\u003cem\\u003eDrosophila\\u003c/em\\u003e NMJ Morphometry. PLoS Comput. Biol. 12, e1004823; \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1371/journal.pcbi.1004823\\u003c/span\\u003e\\u003cspan address=\\\"10.1371/journal.pcbi.1004823\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2016).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHaase, R. \\u003cem\\u003eet al.\\u003c/em\\u003e CLIJ: GPU-accelerated image processing for everyone. Nat. Methods 17, 5\\u0026ndash;6 (2020).\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3968358/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3968358/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eAnillin (Ani) is an evolutionarily conserved protein with a multi-domain structure that cross-links cytoskeletal proteins and plays an essential role in the formation of the contractile ring during cytokinesis. However, Ani is highly expressed in the human central nervous system (CNS), which does not actively divide. Moreover, it scaffolds myelin in the CNS of mice and modulates neuronal migration and growth in \\u003cem\\u003eCaenorhabditis elegans\\u003c/em\\u003e. This protein is also highly expressed in the \\u003cem\\u003eDrosophila\\u003c/em\\u003e CNS. However, its role remains unclear. In the present study, Ani was highly expressed in type I and II neuroblasts, whereas it was poorly expressed in the neuromuscular junction (NMJ), axons, and some neurons in the ventral nerve cord. In addition, neuron-specific \\u003cem\\u003eani\\u003c/em\\u003e knockdown flies had a short lifespan and larval locomotor defects, along with an abnormal morphology of the NMJ, learning disability, and a swollen CNS. These results show that Ani plays important roles not only in proliferating cells, but also in the \\u003cem\\u003eDrosophila\\u003c/em\\u003e nervous system.\\u003c/p\\u003e\",\"manuscriptTitle\":\"The roles of anillin in the Drosophila nervous system\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-03-14 12:09:39\",\"doi\":\"10.21203/rs.3.rs-3968358/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"50f41e2b-7f77-4d72-95b3-98fa3e65e6d7\",\"owner\":[],\"postedDate\":\"March 14th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":29408655,\"name\":\"Biological sciences/Developmental biology/Cell proliferation\"},{\"id\":29408656,\"name\":\"Biological sciences/Neuroscience/Neurogenesis\"}],\"tags\":[],\"updatedAt\":\"2024-04-15T15:45:26+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-03-14 12:09:39\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3968358\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3968358\",\"identity\":\"rs-3968358\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}