{"paper_id":"201e66ab-75d1-4749-b234-daa9e306fbd6","body_text":"Huoxue Qianyang Qutan recipe limits cardiac remodeling by regulating FUNDC1/IP3R2 signaling pathway in obese hypertensive rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Huoxue Qianyang Qutan recipe limits cardiac remodeling by regulating FUNDC1/IP3R2 signaling pathway in obese hypertensive rats Chunlei Hou, Yuxiu Zhao, Yulong Ma, Xunjie Zhou, Lei Yao, Jianhua Li, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8757875/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 10 You are reading this latest preprint version Abstract Obese hypertension (OBH) elevates cardiovascular risk through myocardial remodeling, which is associated with disrupted mitochondrial Ca²⁺ homeostasis and dysfunction of mitochondria-associated endoplasmic reticulum membranes (MAM). Huoxue Qianyang Qutan Recipe (HQQR) has been shown to lower blood pressure in OBH, yet its mechanism related to MAM remains unclear. In this study, phenotypic assessments in OBH rats included blood pressure, morphological parameters, and cardiac ultrasound. Cardiomyocyte hypertrophy and mitochondrial Ca²⁺ levels were analyzed via pathological staining, while MAM ultrastructure was examined by electron microscopy. In vitro, flow cytometry was used to evaluate mitochondrial Ca²⁺, reactive oxygen species (ROS), and membrane potential. Protein levels of FUNDC1 and IP3R2 were assessed. Co-immunoprecipitation revealed an interaction between FUNDC1 and IP3R2, and further experiments with FUNDC1 siRNA knockdown and overexpression were conducted to clarify the mechanism of HQQR. Results showed that HQQR significantly lowered blood pressure, reduced left ventricular mass, and alleviated cardiomyocyte hypertrophy in OBH rats. In vivo, HQQR enhanced MAM formation, facilitated mitochondrial Ca²⁺ transport, and modulated FUNDC1 and IP3R2 expression. In vitro, HQQR reduced ROS and preserved mitochondrial Ca²⁺ homeostasis. Both HQQR treatment and FUNDC1 knockdown attenuated angiotensin II-induced cardiomyocyte hypertrophy and mitochondrial damage, as indicated by decreased levels of ANP, BNP, β-MHC, mitochondrial Ca²⁺, and ROS. In contrast, FUNDC1 overexpression diminished the protective effects of HQQR. The interaction between FUNDC1 and IP3R2 was confirmed, and the decrease in IP3R2 was attributed to ubiquitination-mediated degradation. In conclusion, HQQR mitigates MAM dysfunction in OBH-induced myocardial remodeling by regulating the FUNDC1-IP3R2 interaction and promoting ubiquitin-dependent degradation of IP3R2. Through these actions, HQQR helps maintain mitochondrial Ca²⁺ homeostasis in cardiomyocytes, thereby improving myocardial remodeling. Health sciences/Cardiology Biological sciences/Cell biology Biological sciences/Physiology Obesity Hypertension HuoXue QianYang QuTan Recipe FUNDC1 Mitochondria-associated Endoplasmic Reticulum Membrane Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1 Introduction The global prevalence of obesity and hypertension has reached alarming levels, with projections indicating that over 4 billion people—more than half the world's population—will be overweight or obese by 2035 1 . This epidemic may incur economic losses exceeding $ 4 trillion due to reduced productivity. In China, obesity rates among women rose nearly fourfold from 2.0% in 1990 to 7.8% in 2022. Hypertension currently affects about 1.3 billion people worldwide 2 , and remains the primary contributor to cardiovascular mortality. Obesity underlies 65–78% of essential hypertension cases through mechanisms including neurohormonal activation, inflammatory pathways, and renal impairment 3 . The co-occurrence of obesity and hypertension, termed obese hypertension (OBH), accelerates myocardial remodeling, substantially increasing cardiovascular risk while creating significant socioeconomic burdens 4 , 5 . The pathophysiological mechanisms driving OBH-induced myocardial remodeling involve complex, interconnected processes 6 – 8 . Emerging evidence underscores mitochondrial dysfunction and impaired energy metabolism as central contributors to OBH-related cardiac remodeling, particularly through mitochondria-associated endoplasmic reticulum membrane (MAM)-mediated Ca²⁺ signaling 9 , 10 . MAMs form specialized membrane contact sites that physically and functionally couple the endoplasmic reticulum (ER) with mitochondria. These dynamic junctions facilitate regulated Ca²⁺ transfer between organelles via protein-protein interactions 11 , 12 , thereby maintaining critical mitochondrial processes. Pathological MAM dysfunction disrupts Ca²⁺ homeostasis, leading to chronic mitochondrial Ca²⁺ overload. This dysregulation triggers a cascade of events including metabolic imbalance, oxidative stress from reactive oxygen species (ROS) overproduction, mitochondrial structural damage, and subsequent mitochondrial DNA (mtDNA) leakage 13 , 14 . The inositol 1,4,5-trisphosphate receptor (IP3R2), a transmembrane protein located in the ER membrane, is essential for MAM formation. FUN14 domain-containing protein 1 (FUNDC1), a mitochondrial outer membrane protein enriched at MAM interfaces, has emerged as a critical modulator of cardiovascular function. In cardiomyocytes, FUNDC1 directly interacts with IP3R2 to regulate ER-derived Ca²⁺ flux into mitochondria and cytosol, thereby facilitating MAM assembly and calcium signaling 15 . Studies have shown elevated expression of FUNDC1 and IP3R2 in diabetic heart tissue, where they mediate mitophagy in cardiomyocytes 16 . Additionally, FUNDC1/IP3R1-associated MAM contributes substantially to neovascularization processes 17 . Conversely, high-fat diet (HFD)-fed mice demonstrate reduced FUNDC1 expression, and genetic ablation of FUNDC1 exacerbates diet-induced cardiac hypertrophy, fibrosis, and dysfunction 18 . Despite these advances, the mechanistic links between MAM-mediated FUNDC1/IP3R2 regulation of mitochondrial calcium dynamics in OBH-related heart disease—particularly in the context of traditional Chinese medicine (TCM) interventions—remain poorly understood. Pharmacological modulation of the FUNDC1/IP3R2 pathway could thus represent a viable strategy for attenuating myocardial remodeling. In recent years, TCM has demonstrated promising effects in preventing and treating hypertension-related target organ damage 19 , 20 . The clinically established Huoxue Qianyang Qutan Recipe (HQQR), with over twenty years of application, effectively lowers blood pressure while improving glycolipid metabolism and reducing inflammation in hypertensive patients 21 . Emerging evidence indicates HQQR's organ-protective properties, particularly its ability to mitigate cardiac fibrosis and cardiomyocyte hypertrophy in OBH. These effects may arise from the formulation's modulation of endoplasmic reticulum stress and mitochondrial function 22 – 25 . This study investigated how HQQR mitigates myocardial remodeling in OBH. By elucidating the molecular mechanisms underlying the therapeutic effects of HQQR, we aim to provide novel insights into treating OBH-induced myocardial remodeling and related cardiovascular complications. 2 Materials and methods 2.1 Experimental animals and drug treatments Five-week-old male spontaneously hypertensive rats (SHR, n = 78) and age-matched Wistar-Kyoto rats (WKY, n = 6) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. [license number: SCXK (Beijing) 2021-0006]. All animals were housed under controlled conditions (temperature: 22 ± 2°C; relative humidity: 50–60%) at the experimental animal center of Yueyang Hospital of Integrated Traditional Chinese and Western Medicine. Animal procedures were approved by the Institutional Animal Care and Use Committee of Yueyang Hospital (approval number: YYLAC-2022-172) and conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Of the 78 SHRs, 72 were fed a high-fat diet (HFD; supplied by Jiangsu Medicine Biomedical Co., Ltd.) to induce obesity. The HFD consisted of 60% standard chow, 12.5% lard, 10% sucrose, 10% egg yolk powder, 5% milk powder, 2% cholesterol, and 0.5% bile salt. After 10 weeks, SHRs in the top 1/3 of body weight were identified as OBH rats based on previous reports 26 . The remaining 6 SHRs, along with all 6 WKY rats, were fed a standard normal diet (ND; supplied by Jiangsu Medicine Biomedical Co., Ltd.) throughout the study. Rats were then divided into six groups (n = 6 per group): WKY group (WKY rats fed ND), SHR group (SHRs fed ND), OBH group (SHRs fed HFD), OBH+HQQR-L group (OBH rats fed HFD and administered a low dose of HQQR at 19.35 g crude drug/kg/day by intragastric gavage), OBH+HQQR-H group (OBH rats fed HFD and administered a high dose of HQQR at 38.7 g crude drug/kg/day by intragastric gavage), and OBH+valsartan group (OBH rats fed HFD and administered valsartan at 30 mg/kg/day by intragastric gavage). Valsartan capsules (batch number: X3230) were obtained from Beijing Novartis Pharmaceutical Co. Ltd. The dosages of HQQR and valsartan were determined based on our previous studies 23 . 2.2 Preparation of HQQR HQQR was prepared by the Department of Pharmacy, Eastern Theater General Hospital, People's Liberation Army, Nanjing, China. The formulation comprises seven herbal components: Salvia miltiorrhiza Bunge (common name: Dan Shen), Cassia Seed ( Sennae Semen , common name: Stone Cassia), Ligusticum chuanxiong Hort (common name: Chuan Xiong), Uncaria rhynchophylla (Miq.) Miq. ex Havil. (common name: Gou Teng), Taxillus chinensis (DC.) Danser (common name: Sang Ji Sheng), Crataegus pinnatifida Bunge (common name: Shan Zha), and Corn Silk ( Maydis Stigma , common name: Yu Mi Xu), in a dry weight ratio of 5:10:3:5:5:5:10. The extraction and powder preparation followed this protocol: First, Cassia Seed was decocted alone in water for 1 hour. The remaining herbs (except Uncaria rhynchophylla ) were then combined and decocted twice: initially with 10 volumes of water for 1 hour, followed by a second decoction with 8 volumes of water for 40 minutes. The two decoctions were combined, allowed to precipitate, and filtered. Uncaria rhynchophylla was then added to the combined filtrate with 8 volumes of water, decocted for 40 minutes, and filtered. All filtrates were pooled and left to stand overnight, after which they were filtered again. The final filtrate was concentrated under reduced pressure, transferred to a vacuum drying oven, and dried at 80°C. The dried extract was milled and passed through a 100-mesh sieve to obtain the HQQR fine powder. The formulation ratio and experimental doses were determined based on our previous studies 23 . 2.3 Determination of components in HQQR Methanol, acetonitrile, formic acid and isopropyl alcohol were purchased from ANPEL. All solvents were LC-MS grade. And ultra-pure water in-house prepared using a Milli-Q water purification system (Millipore, Bedford, MA, USA). Components in HQQR and HQQR-containing serum were performed by UPLC-QE-Orbitrap-MS/MS. Detailed methods were in the Supplementary Materials. The detailed parameters of the mass spectrometer were demonstrated in Table S1 . 2.4 Assessment of Physiological Parameters and Cardiac Morphology Systolic blood pressure (SBP), diastolic blood pressure (DBP), and mean blood pressure (MBP) were monitored every two weeks using a non-invasive tail-cuff system (BP-98A, Beijing Softron Biotechnology Co., Ltd, China). Prior to measurement, rats were warmed at 35°C for 5 minutes. Three consecutive readings were obtained and averaged for each session. Body weight was recorded bi-weekly, and body length was measured at the end of the treatment period. The degree of obesity was assessed using Lee’s index, calculated as: Lee ’s index = \\(\\:\\frac{{\\sqrt[3]{\\text{b}\\text{o}\\text{d}\\text{y}\\:\\text{w}\\text{e}\\text{i}\\text{g}\\text{h}\\text{t}\\:\\left(\\text{g}\\right)}\\times\\:10}^{}}{body\\:length\\:\\left(cm\\right)}\\) . After 10 weeks of treatment, cardiac function was assessed by transthoracic echocardiography. Rats were anesthetized with 2% isoflurane to maintain a heart rate between 400 and 650 beats per minute. Cardiac parameters were measured using a Vevo 2100 high-resolution imaging system (Visual Sonics Inc., Canada). Measurements, including interventricular septal thickness at end-diastole (IVSd), left ventricular internal diameter at end-diastole (LVIDd), and left ventricular posterior wall thickness at end-diastole (LVPWd), were obtained from an average of five consecutive cardiac cycles. Corrected left ventricular mass (LVM) was automatically calculated by the machine’s software. Subsequently, rats were euthanized. Blood samples were collected from the abdominal aorta, and heart and liver tissues were rapidly harvested. The liver weight, left ventricular mass index (LVMI), heart weight to body weight ratio (HW/BW), and heart weight to tibia length ratio (HW/TL) were then calculated. 2.5 Histological analysis Left ventricular tissues were fixed, paraffin-embedded, and sectioned. Sections were stained with hematoxylin and eosin (H&E) and wheat germ agglutinin (WGA) following standard protocols. Images were captured using a light microscope (NIKON, Japan) at 200× magnification for morphological assessment. 2.6 Ultrastructure and separation of MAM For transmission electron microscopy (TEM), heart tissue was fixed in 2.5% glutaraldehyde, post-fixed in 1% osmium tetroxide, and embedded in epoxy resin. Ultrathin sections were stained and observed under a TEM (Talos L120C, Thermo Fisher Scientific). Mitochondria-associated endoplasmic reticulum membrane (MAM) distance and length were quantified using ImageJ. MAMs were isolated from heart tissues by differential ultracentrifugation as described 27 . 2.7 Mitochondrial Ca 2+ and membrane potential measurement Mitochondrial Ca²⁺ levels were assessed using Rhod-2 AM (Thermo Fisher Scientific, R1244). For histological analysis, rat myocardial tissue sections were fixed, permeabilized, and blocked, followed by incubation with Rhod-2 AM overnight at 4°C. After washing, sections were incubated with an Alexa Fluor 488-conjugated secondary antibody (Beyotime, A0423) for 2 h at room temperature and imaged under a fluorescence microscope (Nikon, Japan) at 200× magnification. For flow cytometric analysis, a 5 µM working solution of Rhod-2 AM was prepared in Hank‘s Balanced Salt Solution (HBSS). Cells were harvested, washed with PBS, and incubated with the Rhod-2 AM working solution at 37°C for 30 min. After washing, cells were further incubated in HBSS at 37°C for 30 min to allow complete de-esterification, then resuspended in flow assay buffer. Mitochondrial Ca²⁺ levels were quantified using a flow cytometer. Mitochondrial membrane potential was assessed using the JC-1 assay kit (Beyotime) according to the manufacturer’s instructions. 2.8 Cell culture and treatment Primary cardiomyocytes were isolated from 1-3-day-old Sprague-Dawley rats and maintained in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum in a humidified atmosphere of 5% CO 2 and 95% air at 37 ℃. All the culture media were supplemented with penicillin (100 U/mL) and streptomycin (100 µg/mL). Cardiomyocytes were divided into the following five groups (Control, Ang Ⅱ, Ang II + HQQR-L, Ang II + HQQR-H, and Ang II + Val). The control group of cells were cultured with FBS. Cardiac hypertrophy was induced with 1 µM of Angiotensin II (Ang II) (MCE, HY-13948) for 24 h. The remaining three groups were given low-dose HQQR (0.2 mg/ mL), high-dose HQQR (0.5 mg/ mL), and Valsartan (10 µM) on this basis. The concentrations of Ang II and HQQR used in this study were based on our previous study 23 . 2.9 Cell proliferation assay Cell counting kit-8 (Beyotime Biotechnology, C0039) was utilised to assess cell proliferation. A 96-well plate was seeded with 5 × 10 3 cells/well. After being treated under different concentrations of Ang II (0 uM, 0.001 uM, 0.01 uM, 0.1 uM, 1 uM, 10 uM, and 100uM) for 24 h, the cells were mixed with the CCK-8 reagents (CP002, Signalway Antibody LLC, College Park, MD, USA), and incubated in a 5% CO2 incubator for 1 h at 37 ℃. The optical density (OD) value was read at 450 nm using a microplate reader (DNM-9602, Prelong, Beijing, China). 2.10 Transfection of FUNDC1 FUNDC1 overexpression plasmids were obtained from General Biology Co. Ltd. (Chuzhou, China). FUNDC1 shRNAs and their negative controls (shNC) were procured from GenePharma Co., Ltd. (Suzhou, China). Cardiomyocytes were transfected with shRNA or overexpression plasmids using Lipofectamine 2000 (Thermo Fisher Scientific), according to the manufacturer’s instructions. The sequences of shFUNDC1-1, shFUNDC1-2, and shFUNDC1-3 were listed in Table 1 . Table 1 Target Sites and Oligonucleotide Sequences for FUNDC1 and IP3R2 Target gene Target Site Sequence Fundc1 Fundc1-rat-167 GAGAGCGATGACGAGTCTTAC Fundc1-rat-281 GTAGCTACCCAGATAGTAATG Fundc1-rat-411 GCTATGTGCAGATCGACTGGA IP3R2 Ip3r2-Rat-929 CCTACCGAGAGGATGTATTAA Ip3r2-Rat-4785 GCAGTCCGCCTTCAGAATTTA Ip3r2-Rat-5200 TTCATGTCCAAGCTGATTAAT 2.11 Western Blot The protein concentration was determined using a BCA assay kit (Elabscience Biotechnology, E-BC-K318-M). Proteins were separated by SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes. Membranes were blocked with 5% skimmed milk for 1 h at room temperature and incubated overnight at 4 ℃ with primary antibodies: anti-FUNDC1 (CST, #49240), anti-IP3R2 (Santa, sc-398434), anti-atrial natriuretic peptide (ANP) (Abcam, Ab225844), anti-brain natriuretic peptide (BNP) (Abcam, ab19645), anti-β-myosin heavy chain (β-MHC) (Abcam, ab37484) anti-GAPDH (Proteintech, 60009-1-AP), anti-Calreticulin (Abcam, ab92516), and anti-ubiquitin (Ub) (Proteintech, 10201-2-AP). After washing thrice with TBST, the membranes were incubated with secondary antibodies at 37°C for 1 h. Protein bands were visualized using a Tanon 5200 chemiluminescence imaging system (Shanghai, China) and quantified using ImageJ version 1.53. WB experiment was repeated three times for each group. 2.12 Co-immunoprecipitation (Co-IP) Co-IP was performed using the BersinBio Co-IP kit (Bes3011, China) according to the manufacturer’s instructions. Ang II-treated cardiomyocytes were lysed in ice-cold lysis buffer (Beyotime, P0038), and the lysate was cleared by centrifugation. 300 ul of the sample was incubated overnight with specific antibodies targeting the proteins of interest at 4°C with continuous agitation (vertical mixer). Subsequently, the supernatant was incubated with 100 µL Protein A/G-Plus-Agarose beads in a vertical mixer for 1–2 h at 4°C. The precipitated complexes were collected by centrifugation, washed three times with wash buffer for 10 min each at 4℃, and boiled in 5× loading buffer to elute bound proteins. The eluted proteins were analyzed by WB as described in Section 2.11 . 2.13 MitoROS measurement MitoSOX (Thermo Fisher Scientific, M36008) was used to measure mitochondrial ROS levels. Rat myocardial tissues were fixed, permeabilised and blocked, followed by overnight incubation with MitoSOX (Thermo Fisher Scientific, M36008) at 4°C. Antibody incubation was referred to 2.6. Images were visualised and captured at 200× magnification using a microscope (NIKON, Japan). A stock solution (10 µg/13 µL) in DMSO was prepared and diluted in serum-free DMEM to prepare the working solution. Cells were washed with PBS, trypsinized, and centrifuged at 1000 rpm for 5 min to collect the cell pellet. The cells were resuspended in 1 mL of working solution and incubated at 37°C and 5% CO 2 for 30 min. After incubation, the cells were washed thrice with serum-free DMEM and analyzed using flow cytometry. 2.14 Statistical analysis Statistical analyses were conducted using GraphPad Prism version 10 (GraphPad Software, Boston, Massachusetts USA, www.graphpad.com). Data are presented as the mean ± standard deviation. One-way ANOVA was performed for statistical comparisons, followed by Fisher's Least Significant Difference (LSD) test for post-hoc analysis. A significance level of P < 0.05 was considered statistically significant. Different letters indicate significant differences ( P < 0.05), the same letters indicate no significant differences. 3 Results 3.1 Identification of compounds in HQQR and HQQR-containing Serum By analyzing the corresponding ion peaks, we obtained the MS/MS fragment information of compounds. A total of 1144 compounds were identified in HQQR (Table S1 ). The total ion current (TIC) and base peak chromatogram (BPC) of HQQR-containing serum in both positive and negative ion modes are presented in Figure S1 . 3.2 HQQR reduced BP, Lee’s index and liver weight and alleviated LVH in OBH rats OBH rats exhibited larger body size than SHR rats (Fig. 1 A), as well as higher body weight (Fig. 1 B), abdominal circumference (Fig. 1 C), and Lee's index (Fig. 1 D). Notably, compared with the WKY group (normal control), the OBH group showed significantly increased body weight, abdominal circumference, Lee's index, SBP, DBP, MAP, HW/BW, HW/TL and LVMI (P < 0.05), confirming the successful establishment of OBH rats model induced by high-fat diet. HQQR-L, HQQR-H, and valsartan all reduced elevated SBP, DBP, and MBP in OBH rats. The antihypertensive effect of HQQR was dose-dependent, with HQQR-H demonstrating a significantly better antihypertensive effect than HQQR-L. Notably, there was no significant difference in the antihypertensive effects between HQQR-H and valsartan (Fig. 1 E). Furthermore, compared to the OBH group, HQQR-H significantly reduced body weight (Fig. 1 F), Lee’s index (Fig. 1 G,) and liver weight (Fig. 1 H), while valsartan did not significantly improve body weight or liver weight. This suggested that high-dose HQQR, but not valsartan, could improve metabolic disorders and liver hypertrophy in OBH rats. HQQR-L, HQQR-H, and valsartan all alleviated the high-fat diet (HFD)-induced increase in heart weight/body weight (HW/BW) and heart weight/tibia length (HW/TL) in the OBH group (Fig. 1 I), indicating that both HQQR (regardless of dose) and valsartan could effectively alleviate HFD-induced myocardial hypertrophy in OBH rats. Representative echocardiography results are shown in Fig. 1 J. LVMI in the HQQR-H group was lower than that in the valsartan group, suggesting that high-dose HQQR had a superior effect in alleviating left ventricular hypertrophy compared to valsartan. Neither HQQR (HQQR-L or HQQR-H) nor valsartan had a significant effect on IVSd, LVIDd, or LVPWd (Fig. 1 K). 3.3 HQQR improved MAM function in OBH rats HE staining indicated that SHRs exhibited mild cardiomyocyte edema and degeneration along with myocardial fiber disarray. OBH rats displayed more severe edema, degeneration, and disorganization of myocardial fibers than SHRs, accompanied by a pronounced infiltration of inflammatory cells—an important feature of myocardial inflammation that further exacerbates myocardial damage in OBH rats. HQQR treatment alleviated these pathological changes in a dose-dependent manner: HQQR-H showed a more significant improvement than HQQR-L, with pathological manifestations close to those of the valsartan group (Fig. 2 A-B). Representative images of immunofluorescence staining are shown in Fig. 2 C and Fig. 2 D. HQQR treatment significantly reduced mitochondrial Ca²⁺ and ROS levels in cardiomyocytes, with the level of Ca 2+ in HQQR-H group showing similar to valsartan and both lower than OBH group (Fig. 2 E-F). This finding suggests that HQQR can improve mitochondrial function in OBH rats by reducing abnormal mitochondrial Ca²⁺ accumulation and excessive ROS production, which may be one of the key mechanisms underlying its myocardial protective effect. TEM revealed that the ER became aggregated and swollen, whereas the mitochondria became longer and more interconnected in OBH rats, indicating obvious structural abnormalities of ER and mitochondria. These changes were significantly improved after HQQR treatment, especially in the HQQR-H group (Fig. 2 G). Furthermore, the mitochondria and ER exhibited a closer association in OBH rats, facilitating the formation of MAMs. Abnormal MAM formation may enhance the cross-talk between ER stress and mitochondrial dysfunction, thereby accelerating myocardial injury in OBH rats. HQQR-H treatment led to a notable increase in average distance and decrease in average length of ER-mitochondria associations, similar to the effect of valsartan. Compared to the HQQR-L group, the MAM in the HQQR-H group showed a decreasing trend (Fig. 2 H), further confirming the dose-dependent therapeutic effect of HQQR on ER-mitochondrial structural abnormalities. 3.4 HQQR reduced the expression of FUNDC1 and IP3R2 while enhancing the ubiquitination of IP3R2 Consistent with its protective effects on myocardial pathology and mitochondrial function, HQQR treatment reduced the elevated expression of FUNDC1 and IP3R2 in OBH rats (Fig. 3 A). The effects of different concentrations of Ang II on cardiomyocytes were evaluated using the CCK8 assay, and 1 µM Ang II was selected for subsequent experiments (Figure S2 ). This concentration was consistent with our previous research. In vitro, HQQR decreased the expression of FUNDC1 in Ang II-injured cardiomyocytes, with the high-dose group showing superior effects to the low-dose group. HQQR also reduced the expression of IP3R2, with the high-dose group demonstrating better efficacy than the low-dose group (Fig. 3 B). Furthermore, the ubiquitination levels of IP3R2 in the OBH group were lower than those in the SHR and WKY groups, whereas HQQR and valsartan treatment improved the ubiquitination modification of IP3R2 (Fig. 3 C). A similar phenomenon was observed in vitro, where HQQR-H promoted IP3R2 ubiquitination levels (Fig. 3 D). These results indicate that HQQR may regulate IP3R2 expression by promoting its ubiquitination-dependent degradation, and jointly regulate FUNDC1 and IP3R2 to alleviate myocardial injury in OBH rats, which may be closely related to its regulation of mitochondrial and ER function observed in Fig. 2 . 3.5 Interference of FUNDC1 improved the effects of Ang II on cardiomyocytes WB analysis confirmed the successful interference of FUNDC1 (Figure S3 ). Consistent with the in vivo findings, indicators associated with cardiomyocyte hypertrophy, including ANP, BNP, and β-MHC, were pathologically elevated after treatment with Ang II, nd these indicators decreased after HQQR treatment (Fig. 4 A). To examine the effects of Ang II and FUNDC1 interference on mitochondrial function, levels of mitochondrial Ca²⁺ (Fig. 4 B), mitoROS (Fig. 4 C), and mitochondrial membrane potential (Fig. 4 D) were measured. Mitochondrial Ca²⁺ and mitochondrial membrane potential levels were significantly increased, indicating impaired mitochondrial Ca²⁺ transport. This imbalance in Ca²⁺ homeostasis was associated with increased mitochondrial oxidative stress, accompanied by a decrease in mitochondrial ATP levels (Fig. 4 E), suggesting reduced energy metabolism function in damaged mitochondria. Notably, all these Ang II-induced abnormalities were reversed by FUNDC1 interference (Fig. 4 A-E). Additionally, IP3R2 expression decreased concurrently with FUNDC1 inhibition (Fig. 4 F), further supporting the coordinated regulation of FUNDC1 and IP3R2 observed in Fig. 3 . Co-IP data demonstrated that FUNDC1 might directly bound to IP3R2 to tether the ER and mitochondria in Ang II-injured cardiomyocytes (Fig. 4 G), which may explain how FUNDC1 interference modulates ER-mitochondrial Ca²⁺ transport and mitochondrial function, thereby alleviating Ang II-induced cardiomyocyte hypertrophy and mitochondrial dysfunction. 3.6 HQQR alleviated cardiomyocyte injury via FUNDC1/IP3R2 signaling in primary cardiomyocytes To further confirm the regulatory role of FUNDC1 in HQQR-mediated myocardial protection, WB analysis confirmed the successful overexpression of FUNDC1 protein (Supplementary Figure C). Consistent with the aforementioned in vitro findings, in Ang II-injured cardiomyocytes with FUNDC1 overexpression, HQQR significantly reduced the increased expression of ANP, BNP, and β-MHC (Fig. 5 A), indicating that HQQR could alleviate cardiomyocyte hypertrophy even under conditions of FUNDC1 overexpression. Furthermore, HQQR improved mitochondrial function by reducing mitochondrial Ca²⁺ levels (Fig. 5 B), mitoROS production (Fig. 5 C), and mitochondrial membrane potential (Fig. 5 D)—abnormalities induced by Ang II and FUNDC1 overexpression. Additionally, HQQR reduced the expression of IP3R2 in Ang II-injured cardiomyocytes with FUNDC1 overexpression (Fig. 5 F). These results further demonstrated that HQQR exerts its myocardial protective effects by downregulating IP3R2 and improving mitochondrial function, even when FUNDC1 is overexpressed, suggesting that FUNDC1 acted as a downstream target of HQQR in regulating myocardial hypertrophy and mitochondrial dysfunction. 4 Discussion Our study demonstrates that HQQR significantly ameliorates key pathological features of OBH in rats, including elevated blood pressure, visceral fat deposition, and weight gain. Notably, HQQR exhibits a broader therapeutic scope than valsartan, particularly in improving metabolism. Moreover, HQQR effectively mitigates severe edema, degeneration, and disorganization of myocardial fibers in OBH rats and inhibits the progression of cardiac hypertrophy. Additionally, HQQR maintains mitochondrial Ca²⁺ homeostasis in cardiomyocytes and suppresses the expression of FUNDC1 and IP3R2 in Ang II-damaged cardiomyocytes, with more pronounced effects observed at higher doses. These findings reinforce its regulatory influence on mitochondrial function and calcium dynamics. The results demonstrate that HQQR alleviates systemic symptoms in OBH rats while exerting substantial protection against myocardial remodeling. Mitochondria occupy roughly 30% of adult cardiomyocyte volumes and are essential for normal cardiac function 28 . Accumulating evidence implicates mitochondrial damage and impaired energy metabolism as central mechanisms in OBH-induced myocardial remodeling, processes intimately connected to intracellular Ca²⁺ signaling 29 – 31 . As a key second messenger, Ca²⁺ regulates diverse cellular activities including metabolism, differentiation, proliferation, and apoptosis 32 , 33 . In cardiomyocytes, dysregulation of Ca²⁺ homeostasis is closely associated with pathological states, such as myocardial hypertrophy and heart failure 34 , 35 . MAMs serve as critical junctions between the ER and mitochondria, coordinating Ca²⁺ signaling, lipid metabolism, and mitochondrial dynamics 36 – 38 . xcessive communication between the ER and mitochondria can lead to rapid Ca²⁺ influx from the ER to the mitochondria via MAMs, disrupting mitochondrial Ca²⁺ homeostasis, stimulating ROS production, and triggering mtDNA release 39 – 41 . These findings underscore MAMs' pivotal role in preserving cardiomyocyte metabolic and physiological stability 42 . UNDC1, a mitochondrial outer membrane protein localized in MAMs, plays a critical role in MAM formation and maintenance 22 . ts deficiency reduces MAM protein abundance and disrupts mitochondrial-ER contacts, exacerbating mitochondrial dysfunction. The ER-resident IP3R2, a primary Ca²⁺ release channel, mediates rapid Ca²⁺ transfer between the ER and mitochondria while maintaining intracellular Ca²⁺ homeostasis, thereby facilitating MAM function 43 . Studies have shown that FUNDC1 and IP3R2 can form a protein complex that modulates MAM structure and function, influencing both Ca²⁺ homeostasis and mitochondrial function 15 . In OBH rats, we observed upregulation of FUNDC1 and IP3R2, key MAM regulators of Ca²⁺ homeostasis, suggesting that enhanced MAM formation promotes excessive communication between the ER and mitochondria and disrupts mitochondrial Ca²⁺ homeostasis during OBH-induced myocardial hypertrophy. Furthermore, HQQR treatment restored mitochondrial Ca²⁺ homeostasis while suppressing FUNDC1 and IP3R2 overexpression, thus maintaining the structure and function of MAMs. The amelioration of MAM-mediated mitochondrial dysfunction may be an important mechanism for HQQR to improve myocardial remodeling in OBH. Mechanistically, HQQR modulated cardiomyocyte function through FUNDC1 downregulation, which enhanced IP3R2 ubiquitination and degradation, limiting pathological ER-to-mitochondrial Ca²⁺ transfer and preserving mitochondrial integrity. Genetic manipulation experiments demonstrated that FUNDC1 knockdown rescued Ang II-induced mitochondrial dysfunction in cardiomyocytes, whereas FUNDC1 overexpression worsened these defects, establishing the central role of FUNDC1 in HQQR's mechanism of action and its regulatory control over IP3R2. Our previous studies identified blood stasis, yang hyperactivity, and phlegm dampness as key pathological factors in OBH. HQQR, formulated according to traditional Chinese medicine principles, promotes blood circulation, suppresses yang, and resolves phlegm to eliminate dampness. Previous studies have demonstrated its effectiveness in lowering blood pressure, improving cardiac and renal function, reducing ER stress, and stabilizing mitochondrial activity 23 , 44 . In the present study, HQQR maintained mitochondrial Ca²⁺ homeostasis by regulating MAMs, ameliorating myocardial remodeling while reducing blood pressure and obesity in OBH rats. FUNDC1 interference reduced IP3R2 expression, demonstrating the regulatory effect of FUNDC1 on IP3R2. This interference significantly downregulated FUNDC1 and IP3R2 expression, limiting excessive ER Ca²⁺ release and thus preventing mitochondrial Ca²⁺ overload. By attenuating mitochondrial Ca²⁺ accumulation and ROS generation, HQQR preserved mitochondrial function. Mitochondrial Ca²⁺ overload leads to excessive ROS production, which in turn induces oxidative stress and mitochondrial dysfunction. Furthermore, HQQR stabilizes MAM structure, thereby maintaining mitochondrial Ca²⁺ homeostasis and energy metabolism. Collectively, these effects attenuate myocardial remodeling in OBH rats. Clinically, OBH constitutes a prevalent high-risk phenotype characterized by poor cardiovascular outcomes resulting from combined metabolic and hemodynamic stress. Current therapeutic agents such as valsartan primarily target blood pressure reduction but fail to improve adequately metabolic dysregulation or mitochondrial dysfunction. HQQR demonstrates therapeutic potential by modulating MAM integrity and calcium signaling, offering a novel therapeutic approach to comprehensive cardioprotection in OBH. These findings could inform future clinical management, particularly for hypertensive patients with comorbid obesity and metabolic syndrome. While HQQR provides valuable insights into OBH-induced myocardial remodeling, this study has several limitations. The regulatory interactions between FUNDC1 and IP3R2 require further experimental validation. MAM structure and function involve multiple protein complexes, including tethering proteins, yet the relationship between FUNDC1 and key MAM tethering complexes such as the IP3R-GRP75-VDAC complex remains incompletely characterized 45 , 46 . The lack of metabolic-targeted positive controls, such as GLP-1 receptor agonists, precluded a comprehensive assessment of HQQR’s metabolic efficacy. Additionally, as traditional Chinese medicine formulas typically exhibit polypharmacology, future studies should integrate modern pharmacological approaches to clarify the molecular mechanisms underlying HQQR’s actions. 5 Conclusions HQQR attenuates mitochondrial damage and ameliorates OBH-induced cardiac remodeling by modulating MAM function via FUNDC1, restoring mitochondrial Ca²⁺ homeostasis. These results support the potential use of HQQR in preventing and treating OBH while advancing our understanding of mitochondrial and calcium-targeted therapeutic approaches for cardiac remodeling (Fig. 6 ). Abbreviations OBH Obese hypertension MAM Mitochondria-associated endoplasmic reticulum membrane ER Endoplasmic reticulum ROS Reactive oxygen species mtDNA mitochondrial DNA IP3R2 Inositol 1,4,5-trisphosphate receptor FUNDC1 FUN14 domain-containing protein 1 HFD High-fat diet TCM Traditional Chinese medicine HQQR Huoxue Qianyang Qutan Recipe SHR Spontaneously hypertensive rats WKY Wistar-Kyoto rats ND Normal diet SBP Systolic blood pressure DBP Diastolic blood pressure MBP Mean blood pressure IVSD Interventricular septal thickness LVIDD Left ventricular internal diameter at end-diastole LVPWD Left ventricular posterior wall thickness in diastole LVM Left ventricular mass LVMI Left ventricular mass index HW/BW Heart weight/body weight HW/TL Heart weight/tibia length HE Hematoxylin & eosin WGA Wheat germ agglutinin HBSS Hank's Balanced Salt Solution PBS Phosphate Buffered Saline Ang II Angiotensin II PVDF Polyvinylidene difluoride ANP Atrial natriuretic peptide BNP Brain natriuretic peptide β-MHC β-myosin heavy chain Ub Ubiquitin Co-IP Co-immunoprecipitation LSD Least Significant Difference ATP Adenosine triphosphate Declarations Ethics approval The study was approved by Ethics Committee of Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine (YYLAC-2022-172) in 2022. Declaration of interest statement The authors declare that they have no competing interests. Author Contributions statement Chunlei Hou: Formal Analysis, Writing – original draft, Writing – review & editing. Yuxiu Zhao: Writing – original draft. Yulong Ma: Validation, Writing – review & editing. Xunjie Zhou: Data curation, Investigation, Writing – review & editing. Lei Yao: Data curation, Project administration, Writing – review & editing. Jianhua Li: Visualization, Writing – review & editing. Ming Tai Gui: Project administration, Validation, Writing – review & editing. Mingzhu Wang: Investigation, Methodology, Writing – review & editing. Xiaozhe Chen: Validation, Visualization, Writing – review & editing. Deyu Fu: Conceptualization, Funding acquisition, Methodology, Resources, Supervision, Writing – review & editing. Bo Lu: Conceptualization, Funding acquisition, Investigation, Methodology, Project administration, Writing – original draft, Writing – review & editing. Funding This work was supported by National Natural Science Foundation of China (82274262; 82174130), Shanghai Magnolia Talent Plan Pujiang Project (24PJD113), Program of Shanghai Municipal Health Commission (202240053), Shanghai Collaborative Innovation Center of Industrial Transformation of Hospital TCM Preparation, and High-level Chinese Medicine Key Discipline Construction Project (Integrative Chinese and Western Medicine Clinic) of National Administration of TCM (zyyzdxk-2023065). Author Contribution Chunlei Hou: Formal Analysis, Writing – original draft, Writing – review & editing. Yuxiu Zhao: Writing – original draft. Yulong Ma: Validation, Writing – review & editing. Xunjie Zhou: Data curation, Investigation, Writing – review & editing. Lei Yao: Data curation, Project administration, Writing – review & editing. Jianhua Li: Visualization, Writing – review & editing. Ming Tai Gui: Project administration, Validation, Writing – review & editing. Mingzhu Wang: Investigation, Methodology, Writing – review & editing. Xiaozhe Chen: Validation, Visualization, Writing – review & editing. Deyu Fu: Conceptualization, Funding acquisition, Methodology, Resources, Supervision, Writing – review & editing. Bo Lu: Conceptualization, Funding acquisition, Investigation, Methodology, Project administration, Writing – original draft, Writing – review & editing. Acknowledgement The authors sincerely acknowledge Bullet Edits Limited for their assistance in language editing and proofreading. The authors also thank Figdraw (www.figdraw.com) for providing the platform used to create Figure 6. Data Availability The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. References Mills, K. T., Stefanescu, A. & He, J. The global epidemiology of hypertension. Nat. Rev. Nephrol. 16 , 223–237. https://doi.org/10.1038/s41581-019-0244-2 (2020). Al-Makki, A. et al. Hypertension Pharmacological Treatment in Adults: A World Health Organization Guideline Executive Summary. Hypertension (Dallas, Tex. :) 79, 293–301 (2022). ) 79, 293–301 (2022). (1979). https://doi.org/10.1161/HYPERTENSIONAHA.121.18192 Hall, J. E., Carmo, da Silva, J. M., Wang, A. A., Hall, M. E. & Z. & Obesity-induced hypertension: interaction of neurohumoral and renal mechanisms. Circul. Res. 116 , 991–1006. https://doi.org/10.1161/CIRCRESAHA.116.305697 (2015). Bengmark, S. Obesity, the deadly quartet and the contribution of the neglected daily organ rest - a new dimension of un-health and its prevention. Hepatobiliary Surg. Nutr. 4 , 278–288. https://doi.org/10.3978/j.issn.2304-3881.2015.07.02 (2015). Yang, M. et al. Fibroblast growth factor 21 in metabolic syndrome. Front. Endocrinol. 14 , 1220426. https://doi.org/10.3389/fendo.2023.1220426 (2023). Du, W. et al. Plasma levels of heart failure biomarkers are primarily a reflection of extracardiac production. Theranostics 8 , 4155–4169. https://doi.org/10.7150/thno.26055 (2018). Tuccinardi, D. et al. Rethinking weight loss treatments as cardiovascular medicine in obesity, a comprehensive review. Eur. J. Prev. Cardiol. https://doi.org/10.1093/eurjpc/zwae171 (2024). Zhang, S. et al. Effect and mechanism of Qing Gan Zi Shen decoction on heart damage induced by obesity and hypertension. J. Ethnopharmacol. 319 , 117163. https://doi.org/10.1016/j.jep.2023.117163 (2024). Gui, M. et al. Huoxue Qianyang Qutan recipe attenuates Ang II-induced cardiomyocyte hypertrophy by regulating reactive oxygen species production. Experimental therapeutic Med. 22 , 1446. https://doi.org/10.3892/etm.2021.10881 (2021). Szymański, J. et al. Interaction of Mitochondria with the Endoplasmic Reticulum and Plasma Membrane in Calcium Homeostasis, Lipid Trafficking and Mitochondrial Structure. Int. J. Mol. Sci. 18 https://doi.org/10.3390/ijms18071576 (2017). de Brito, O. M. & Scorrano, L. Mitofusin-2 regulates mitochondrial and endoplasmic reticulum morphology and tethering: the role of Ras. Mitochondrion 9 , 222–226. https://doi.org/10.1016/j.mito.2009.02.005 (2009). D'Eletto, M. et al. Transglutaminase Type 2 Regulates ER-Mitochondria Contact Sites by Interacting with GRP75. Cell reports 25, 3573–3581 e3574 (2018). https://doi.org/10.1016/j.celrep.2018.11.094 Li, Z. et al. The SIRT3-ATAD3A axis regulates MAM dynamics and mitochondrial calcium homeostasis in cardiac hypertrophy. Int. J. Biol. Sci. 20 , 831–847. https://doi.org/10.7150/ijbs.89253 (2024). Lu, B. et al. So close, yet so far away: the relationship between MAM and cardiac disease. Front. Cardiovasc. Med. 11 , 1353533. https://doi.org/10.3389/fcvm.2024.1353533 (2024). Wu, S. et al. Binding of FUN14 Domain Containing 1 With Inositol 1,4,5-Trisphosphate Receptor in Mitochondria-Associated Endoplasmic Reticulum Membranes Maintains Mitochondrial Dynamics and Function in Hearts in Vivo. Circulation 136 , 2248–2266. https://doi.org/10.1161/CIRCULATIONAHA.117.030235 (2017). Wu, S. et al. Hyperglycemia-Driven Inhibition of AMP-Activated Protein Kinase alpha2 Induces Diabetic Cardiomyopathy by Promoting Mitochondria-Associated Endoplasmic Reticulum Membranes In Vivo. Circulation 139 , 1913–1936. https://doi.org/10.1161/CIRCULATIONAHA.118.033552 (2019). Wang, C. et al. FUNDC1-dependent mitochondria-associated endoplasmic reticulum membranes are involved in angiogenesis and neoangiogenesis. Nat. Commun. 12 , 2616. https://doi.org/10.1038/s41467-021-22771-3 (2021). Ren, J. et al. FUNDC1 interacts with FBXL2 to govern mitochondrial integrity and cardiac function through an IP3R3-dependent manner in obesity. Sci. Adv. 6 https://doi.org/10.1126/sciadv.abc8561 (2020). Tan, C. et al. Puerarin Improves Vascular Insulin Resistance and Cardiovascular Remodeling in Salt-Sensitive Hypertension. Am. J. Chin. Med. 45 , 1169–1184. https://doi.org/10.1142/S0192415X17500641 (2017). Wang, P., Hao, D. & Xiong, X. Anti-hypertension effect of Wuwei Jiangya decoction via ACE2/Ang1-7/MAS signaling pathway in SHR based on network degree-distribution analysis. J. Ethnopharmacol. 319 , 117121. https://doi.org/10.1016/j.jep.2023.117121 (2024). Xie, J. et al. Efficacy of Huoxue Qianyang Qutan Recipe on essential hypertension: A randomized, double-blind, placebo-controlled trial. J. Integr. Med. 22 , 484–492. https://doi.org/10.1016/j.joim.2024.05.002 (2024). Li, G., Li, J., Shao, R., Zhao, J. & Chen, M. FUNDC1: A Promising Mitophagy Regulator at the Mitochondria-Associated Membrane for Cardiovascular Diseases. Front. cell. Dev. biology . 9 , 788634. https://doi.org/10.3389/fcell.2021.788634 (2021). Lu, B. et al. Huoxue Qianyang Qutan recipe attenuates cardiac fibrosis by inhibiting the NLRP3 inflammasome signalling pathway in obese hypertensive rats. Pharm. Biol. 59 , 1045–1057. https://doi.org/10.1080/13880209.2021.1953541 (2021). Wang, J. et al. HuoXue QianYang QuTan Recipe attenuates left ventricular hypertrophy in obese hypertensive rats by improving mitochondrial function through SIRT1/PGC-1α deacetylation pathway. Biosci. Rep. 39 https://doi.org/10.1042/bsr20192909 (2019). Wang, M. et al. Huoxue Qianyang Qutan Recipe Protects against Early Renal Damage Induced by Obesity-Related Hypertension via the SIRT1/NF-κB/IL-6 Pathway: Integrating Network Pharmacology and Experimental Validation-Based Strategy. Evidence-based complementary and alternative medicine: eCAM 9599090 (2022). (2022). https://doi.org/10.1155/2022/9599090 Levin, B. E. Arcuate NPY neurons and energy homeostasis in diet-induced obese and resistant rats. Am. J. Physiol. 276 , R382–387. https://doi.org/10.1152/ajpregu.1999.276.2.R382 (1999). Gomez, L. et al. The SR/ER-mitochondria calcium crosstalk is regulated by GSK3beta during reperfusion injury. Cell Death Differ. 23 , 313–322. https://doi.org/10.1038/cdd.2015.101 (2016). Sun, N. & Finkel, T. Cardiac mitochondria: a surprise about size. J. Mol. Cell. Cardiol. 82 , 213–215. https://doi.org/10.1016/j.yjmcc.2015.01.009 (2015). Akhmedov, A. T., Rybin, V. & Marin-Garcia, J. Mitochondrial oxidative metabolism and uncoupling proteins in the failing heart. Heart Fail. Rev. 20 , 227–249. https://doi.org/10.1007/s10741-014-9457-4 (2015). Dia, M. et al. Effect of Metformin on T2D-Induced MAM Ca2 + Uncoupling and Contractile Dysfunction in an Early Mouse Model of Diabetic HFpEF. Int. J. Mol. Sci. 23 https://doi.org/10.3390/ijms23073569 (2022). Osanami, A. et al. Adenosine monophosphate deaminase in the endoplasmic reticulum-mitochondria interface promotes mitochondrial Ca2 + overload in type 2 diabetes rat hearts. J. diabetes Invest. 14 , 560–569. https://doi.org/10.1111/jdi.13982 (2023). Karlstad, J., Sun, Y. & Singh, B. B. Ca(2+) signaling: an outlook on the characterization of Ca(2+) channels and their importance in cellular functions. Adv. Exp. Med. Biol. 740 , 143–157. https://doi.org/10.1007/978-94-007-2888-2_6 (2012). Srikanth, S., Woo, J. S., Sun, Z. & Gwack, Y. Immunological Disorders: Regulation of Ca2 + Signaling in T Lymphocytes. Adv. Exp. Med. Biol. 993 , 397–424. https://doi.org/10.1007/978-3-319-57732-6_21 (2017). Zhang, Y., Ye, L., Duan, D. D., Yang, H. & Ma, T. TMEM16A Plays an Insignificant Role in Myocardium Remodeling but May Promote Angiogenesis of Heart During Pressure-overload. Front. Physiol. 13 , 897619. https://doi.org/10.3389/fphys.2022.897619 (2022). Abudureyimu, M. et al. Berberine alleviates myocardial diastolic dysfunction by modulating Drp1-mediated mitochondrial fission and Ca(2+) homeostasis in a murine model of HFpEF. Front. Med. 17 , 1219–1235. https://doi.org/10.1007/s11684-023-0983-0 (2023). Gao, P., Yan, Z. & Zhu, Z. Mitochondria-Associated Endoplasmic Reticulum Membranes in Cardiovascular Diseases. Front. cell. Dev. biology . 8 , 604240. https://doi.org/10.3389/fcell.2020.604240 (2020). Gong, Y. et al. Mitochondria-associated membrane-modulated Ca2 + transfer: A potential treatment target in cardiac ischemia reperfusion injury and heart failure. Life Sci. 278 , 119511. https://doi.org/10.1016/j.lfs.2021.119511 (2021). Chen, Q. et al. Endoplasmic reticulum stress and mitochondrial dysfunction during aging: Role of sphingolipids. Biochim. et Biophys. acta Mol. cell. biology lipids . 1868 , 159366. https://doi.org/10.1016/j.bbalip.2023.159366 (2023). Frey, N., McKinsey, T. A. & Olson, E. N. Decoding calcium signals involved in cardiac growth and function. Nat. Med. 6 , 1221–1227. https://doi.org/10.1038/81321 (2000). Tian, S. et al. Sulforaphane Balances Ca2 + Homeostasis Injured by Excessive Fat via Mitochondria-Associated Membrane (MAM). Molecular nutrition & food research 65, e2001076 (2021). https://doi.org/10.1002/mnfr.202001076 Chen, W. et al. Polygonatum sibiricum polysaccharide ameliorates skeletal muscle aging via mitochondria-associated membrane-mediated calcium homeostasis regulation. Phytomedicine: Int. J. phytotherapy phytopharmacology . 129 , 155567. https://doi.org/10.1016/j.phymed.2024.155567 (2024). Luan, Y. et al. Structure and Function of Mitochondria-Associated Endoplasmic Reticulum Membranes (MAMs) and Their Role in Cardiovascular Diseases. Oxidative medicine and cellular longevity 4578809 (2021). (2021). https://doi.org/10.1155/2021/4578809 Bartok, A. et al. IP3 receptor isoforms differently regulate ER-mitochondrial contacts and local calcium transfer. Nat. Commun. 10 , 3726. https://doi.org/10.1038/s41467-019-11646-3 (2019). Zhou, X. et al. Huoxue Qianyang decoction ameliorates cardiac remodeling in obese spontaneously hypertensive rats in association with ATF6-CHOP endoplasmic reticulum stress signaling pathway regulation. Biomed. pharmacotherapy = Biomedecine pharmacotherapie . 121 , 109518. https://doi.org/10.1016/j.biopha.2019.109518 (2020). Mogk, A. & Bukau, B. Mitochondria tether protein trash to rejuvenate cellular environments. Cell 159 , 471–472. https://doi.org/10.1016/j.cell.2014.10.007 (2014). Szabadkai, G. et al. Chaperone-mediated coupling of endoplasmic reticulum and mitochondrial Ca2 + channels. J. Cell Biol. 175 , 901–911. https://doi.org/10.1083/jcb.200608073 (2006). Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial.docx TableS1.xlsx Originalfigures.pdf Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 07 Apr, 2026 Reviews received at journal 06 Apr, 2026 Reviews received at journal 05 Apr, 2026 Reviewers agreed at journal 25 Mar, 2026 Reviewers agreed at journal 25 Mar, 2026 Reviewers invited by journal 24 Mar, 2026 Editor assigned by journal 15 Mar, 2026 Editor invited by journal 24 Feb, 2026 Submission checks completed at journal 20 Feb, 2026 First submitted to journal 20 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-8757875\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":612168538,\"identity\":\"124023fd-225b-4132-b4de-0f8bd7971da2\",\"order_by\":0,\"name\":\"Chunlei Hou\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Chunlei\",\"middleName\":\"\",\"lastName\":\"Hou\",\"suffix\":\"\"},{\"id\":612168540,\"identity\":\"d797326f-ee6f-4f20-8adf-6ff5fea50c55\",\"order_by\":1,\"name\":\"Yuxiu Zhao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yuxiu\",\"middleName\":\"\",\"lastName\":\"Zhao\",\"suffix\":\"\"},{\"id\":612168542,\"identity\":\"7b9fe483-4134-4931-969e-9ec59720c7a6\",\"order_by\":2,\"name\":\"Yulong Ma\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yulong\",\"middleName\":\"\",\"lastName\":\"Ma\",\"suffix\":\"\"},{\"id\":612168544,\"identity\":\"c17ba9bf-4f42-4074-99ab-2a8f3cf0cf29\",\"order_by\":3,\"name\":\"Xunjie Zhou\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xunjie\",\"middleName\":\"\",\"lastName\":\"Zhou\",\"suffix\":\"\"},{\"id\":612168545,\"identity\":\"b9638f9c-68b7-4837-a6ec-3aa9a0bbe037\",\"order_by\":4,\"name\":\"Lei Yao\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lei\",\"middleName\":\"\",\"lastName\":\"Yao\",\"suffix\":\"\"},{\"id\":612168547,\"identity\":\"31f92e06-725b-4e15-9b51-17e0330bcde2\",\"order_by\":5,\"name\":\"Jianhua Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jianhua\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":612168558,\"identity\":\"ff8912e2-2db9-47ff-87ac-36bab00629fb\",\"order_by\":6,\"name\":\"Mingtai Gui\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mingtai\",\"middleName\":\"\",\"lastName\":\"Gui\",\"suffix\":\"\"},{\"id\":612168560,\"identity\":\"46b1ed00-55a3-40e3-8baf-49a7a433707e\",\"order_by\":7,\"name\":\"Mingzhu Wang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mingzhu\",\"middleName\":\"\",\"lastName\":\"Wang\",\"suffix\":\"\"},{\"id\":612168562,\"identity\":\"b33819d2-18ed-44ba-87d5-b9be82ed86f5\",\"order_by\":8,\"name\":\"Xiaozhe Chen\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Xiaozhe\",\"middleName\":\"\",\"lastName\":\"Chen\",\"suffix\":\"\"},{\"id\":612168566,\"identity\":\"8e4d1c93-499b-49af-a194-cbc4af15a865\",\"order_by\":9,\"name\":\"Deyu Fu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Deyu\",\"middleName\":\"\",\"lastName\":\"Fu\",\"suffix\":\"\"},{\"id\":612168576,\"identity\":\"e2768259-d93d-4f93-b63f-bd3e12bdd2aa\",\"order_by\":10,\"name\":\"Bo Lu\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0UlEQVRIiWNgGAWjYBACPgYeBoYPBhJybOzNBw58qCBCCxtQC+OMChtjfp5jiQdnnCFSCzPPmbREyRk5xod5W4jRIpF78AFv2+EEgxs5Hw7wNjDI84sdIKQlL9lAsu1wnsGZtxsOSO5gMJw5O4GQlhwzCcO2w8UGx3M3HDA8w5BgcJsYLYlthxM3HMh5cCCxjVgtB4Den9mRw3DgIFFaeN4lGzZAAtngYMMZCcJ+4WfPPfj4DyQqH3/+U2Ejzy9NQAs6kCBN+SgYBaNgFIwC7AAANzpKAVWGz0QAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Bo\",\"middleName\":\"\",\"lastName\":\"Lu\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2026-02-01 17:08:17\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-8757875/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-8757875/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":105468551,\"identity\":\"183ab0d4-9a9a-4d41-aac0-65544bf16924\",\"added_by\":\"auto\",\"created_at\":\"2026-03-26 11:14:48\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":19592179,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHQQR improves metabolic and cardiovascular parameters in OBH rats\\u003c/p\\u003e\\n\\u003cp\\u003eOBH rats were modeled after high-fat dietexposure. Changes in body sizes (A) of OBH rats (n = 6). Comparisons of weight (B), abdominal circumference (C) and Lee’s index (D) among the different groups (n = 6). Effect of Huoxue Qianyang Qutan Recipe (HQQR) treatment on systolic blood pressure (SBP), diastolic blood pressure and mean blood pressure values in rats (E) (n = 6). The body weight (F) and body length of the rats in each group were measured (n = 6). (G) Lee’s index was calculated accordingly (n = 6). (H) Effect of HQQR treatment on liver weight. (I) Measurements of HW/BW and HW/TL (n = 6). (J) Representative images of echocardiography were shown (n = 6). (K) LVMI, IVSD, LVIDD and LVPWD (n = 6). WKY: Wistar-Kyoto rats. SHR: spontaneously hypertensive rats. OBH: obese hypertensive. HQQR-L: low-dose Huoxue Qianyang Qutan Recipe. HQQR-H: high-dose Huoxue Qianyang Qutan Recipe. Val: valsartan. HW/BW: heart weight/body weight. HW/TL: heart weight/tibia length. LVMI: left ventricle mass/body weight. IVSD: interventricular septal thickness. LVIDD: left ventricular internal diameter at end-diastole. LVPWD: left ventricular posterior wall thickness in diastole.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8757875/v1/019f64d273cf5a85b68b69ea.png\"},{\"id\":105566353,\"identity\":\"690deca5-3ace-4870-b284-a62aeef4b711\",\"added_by\":\"auto\",\"created_at\":\"2026-03-27 12:56:15\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":64869570,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHQQR alleviated left ventricular hypertrophy and improved MAM function in OBH rats\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Representative images of HE and WGA staining were shown (n = 6, scale bar = 100 μm). (B) Quantification of the cross-sectional area of cardiomyocytes in rats (n = 6). (C) Representative images of mitochondrial Ca\\u003csup\\u003e2+\\u003c/sup\\u003e level (n = 6, scale bar = 100μm). (D) Representative images of mitoROS (n = 6, scale bar = 100μm). (E) Quantification of mitochondrial Ca\\u003csup\\u003e2+\\u003c/sup\\u003e level in rats (n = 6). (F) Quantification of mitochondrial reactive oxygen species (ROS) in rats (n = 6). (G) Representative images of transmission electron microscopy were shown. Asterisks indicate mitochondria with typical morphology, and the arrows indicate the typical endoplasmic reticulum morphology (n = 6, scale bar = 500nm). (H) Length and distance between mitochondrial endoplasmic reticulum in mitochondria-associated endoplasmic reticulum membranes (n = 6). WKY: Wistar-Kyoto rats. SHR: spontaneously hypertensive rats. OBH: obese hypertensive. HQQR-L: low-dose Huoxue Qianyang Qutan Recipe. HQQR-H: high-dose Huoxue Qianyang Qutan Recipe. Val: valsartan. HE: hematoxylin \\u0026amp; eosin staining. WGA: wheat germ agglutinin. DAPI: 4',6-diamidino-2-phenylindole, a fluorescent dye commonly used to label DNA. MitoROS: mitochondrial reactive oxygen species. MAM: mitochondria-associated endoplasmic reticulum membrane.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8757875/v1/25be8e84671c90208e5d25c4.png\"},{\"id\":105728070,\"identity\":\"e65656f4-7149-4923-bae9-a2a1cb3fd529\",\"added_by\":\"auto\",\"created_at\":\"2026-03-30 11:09:04\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":6872796,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHQQR downregulated the expression of FUNDC1 and IP3R2 while promoting the ubiquitination of IP3R2\\u003c/p\\u003e\\n\\u003cp\\u003e(A) Representative blot image and quantification of FUNDC1 and IP3R2 in rats. GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) was used as the internal reference of Western blot (n = 4). (B) Representative blot image and quantification of FUNDC1 and IP3R2 in vitro after Angiotensin II (Ang II) intervention (n = 4). (C-D) Effect of HQQR treatment on ubiquitination ofIP3R2 in vivo and in vitro. WKY: Wistar-Kyoto rats. SHR: spontaneously hypertensive rats. OBH: obese hypertensive. HQQR-L: low-dose Huoxue Qianyang Qutan Recipe. HQQR-H: high-dose Huoxue Qianyang Qutan Recipe. Val: valsartan. FUNDC1: FUN14 domain-containing protein 1. IP3R2: transmembrane protein inositol 1,4,5-trisphosphate receptor 2. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase. Ang II: angiotensin II. Ab: antibody. IB: Immunoblotting. Ub: ubiquitination\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8757875/v1/279b03d2f83fa69cb3d1c750.png\"},{\"id\":105468553,\"identity\":\"beb3ee0f-d352-4432-8961-98b2354e80d3\",\"added_by\":\"auto\",\"created_at\":\"2026-03-26 11:14:49\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":17213671,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eInterference of FUNDC1 improved the effects of Ang II on cardiomyocytes.\\u003c/p\\u003e\\n\\u003cp\\u003e(A) The efficiency of interference of FUNDC1 was verified. (B) WB analysis of the protein expression associated with cardiomyocyte hypertrophy, including ANP, BNP and β-MHC (n = 3). Ca\\u003csup\\u003e2+\\u003c/sup\\u003e concentration in mitochondria (C), membrane potential (D) and the levels of MitoROS (E) was quantitatively detected by flow cytometry (n = 3). (F) ATP levels in primary cardiomyocytes were detected by spectrophotometer (n = 3). (G) The protein expression levels of FUNDC1 and IP3R2 (n = 3). H) The interaction between FUNDC1 and IP3R2 in cardiomyocytes was determined by immunoprecipitation. Ang II: angiotensin II. ANP: atrial natriuretic peptide. BNP: brain natriuretic peptide. β-MHC: β-myosin heavy chain. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase. FUNDC1: FUN14 domain-containing protein 1. IP3R2: transmembrane protein inositol 1,4,5-trisphosphate receptor 2. MitoROS: mitochondrial reactive oxygen species. NC: negative control. ATP: Aadenosine Triphosphate. Ab: antibody.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8757875/v1/b8e58526a8c1f483a9485868.png\"},{\"id\":105468556,\"identity\":\"68688cf5-9ca3-4f6e-8350-3d52231570a5\",\"added_by\":\"auto\",\"created_at\":\"2026-03-26 11:14:49\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":14221402,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eHQQR alleviated the expression of FUNDC1/IP3R2 and improved MAM function in primary cardiomyocytes\\u003c/p\\u003e\\n\\u003cp\\u003e(A) The efficiency of overexpression of FUNDC1 was verified. (B) Western blot analysis of the protein expression associated with cardiomyocyte hypertrophy, including ANP, BNP and β-MHC (n = 3). Ca\\u003csup\\u003e2+\\u003c/sup\\u003e concentration in mitochondria (C), membrane potential (D) and the levels of MitoROS (E) was quantitatively detected by flow cytometry (n = 3). (F) The level of ATP in primary cardiomyocytes were detected by spectrophotometer (n = 3). (G) Western blot analysis of the protein expression of FUNDC1 and IP3R2 in primary cardiomyocytes (n = 3). (G) Ubiquitination modification of IP3R2 in vitro (n = 3). *P\\u0026lt;0.05 versus Vehicle+Vector; #P\\u0026lt;0.05 versus Vehicle+oeFUNDC1; +P\\u0026lt;0.05 versus HQQR-H+Vector. HQQR-H: high-dose Huoxue Qianyang Qutan Recipe. FUNDC1: FUN14 domain-containing protein 1. IP3R2: transmembrane protein inositol 1,4,5-trisphosphate receptor 2. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase. ANP: atrial natriuretic peptide. BNP: brain natriuretic peptide. β-MHC: β-myosin heavy chain. MitoROS: mitochondrial reactive oxygen species\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8757875/v1/68815354cc0f8f33c1096d97.png\"},{\"id\":109204408,\"identity\":\"1c2f37e0-6904-44b3-a77f-00033f3faf8e\",\"added_by\":\"auto\",\"created_at\":\"2026-05-13 14:59:23\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":104213612,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8757875/v1/08630b35-fac9-4dfb-baa9-f12e32ee03eb.pdf\"},{\"id\":105468548,\"identity\":\"ed5d50bf-4a53-41ea-93e8-aadb729b0365\",\"added_by\":\"auto\",\"created_at\":\"2026-03-26 11:14:48\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":960275,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplementarymaterial.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8757875/v1/f5c4f49725e13f09e9e94068.docx\"},{\"id\":105566687,\"identity\":\"7d3f1b13-2af6-4097-8bd8-25fcad070adb\",\"added_by\":\"auto\",\"created_at\":\"2026-03-27 12:56:58\",\"extension\":\"xlsx\",\"order_by\":2,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":327592,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"TableS1.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8757875/v1/12e04950bd106d399a054bcc.xlsx\"},{\"id\":105468552,\"identity\":\"ed76084f-8664-4212-a1b1-3a92b63b502f\",\"added_by\":\"auto\",\"created_at\":\"2026-03-26 11:14:48\",\"extension\":\"pdf\",\"order_by\":3,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":11693642,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Originalfigures.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-8757875/v1/db7c0e1f19bfaf65008081f8.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Huoxue Qianyang Qutan recipe limits cardiac remodeling by regulating FUNDC1/IP3R2 signaling pathway in obese hypertensive rats\",\"fulltext\":[{\"header\":\"1 Introduction\",\"content\":\"\\u003cp\\u003eThe global prevalence of obesity and hypertension has reached alarming levels, with projections indicating that over 4\\u0026nbsp;billion people\\u0026mdash;more than half the world's population\\u0026mdash;will be overweight or obese by 2035 \\u003csup\\u003e1\\u003c/sup\\u003e. This epidemic may incur economic losses exceeding \\u003cspan\\u003e$\\u003c/span\\u003e4 trillion due to reduced productivity. In China, obesity rates among women rose nearly fourfold from 2.0% in 1990 to 7.8% in 2022. Hypertension currently affects about 1.3\\u0026nbsp;billion people worldwide \\u003csup\\u003e\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e\\u003c/sup\\u003e, and remains the primary contributor to cardiovascular mortality. Obesity underlies 65\\u0026ndash;78% of essential hypertension cases through mechanisms including neurohormonal activation, inflammatory pathways, and renal impairment \\u003csup\\u003e\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e\\u003c/sup\\u003e. The co-occurrence of obesity and hypertension, termed obese hypertension (OBH), accelerates myocardial remodeling, substantially increasing cardiovascular risk while creating significant socioeconomic burdens \\u003csup\\u003e\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eThe pathophysiological mechanisms driving OBH-induced myocardial remodeling involve complex, interconnected processes \\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR7\\\" citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e\\u003c/sup\\u003e. Emerging evidence underscores mitochondrial dysfunction and impaired energy metabolism as central contributors to OBH-related cardiac remodeling, particularly through mitochondria-associated endoplasmic reticulum membrane (MAM)-mediated Ca\\u0026sup2;⁺ signaling \\u003csup\\u003e\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e\\u003c/sup\\u003e. MAMs form specialized membrane contact sites that physically and functionally couple the endoplasmic reticulum (ER) with mitochondria. These dynamic junctions facilitate regulated Ca\\u0026sup2;⁺ transfer between organelles via protein-protein interactions \\u003csup\\u003e\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e\\u003c/sup\\u003e, thereby maintaining critical mitochondrial processes. Pathological MAM dysfunction disrupts Ca\\u0026sup2;⁺ homeostasis, leading to chronic mitochondrial Ca\\u0026sup2;⁺ overload. This dysregulation triggers a cascade of events including metabolic imbalance, oxidative stress from reactive oxygen species (ROS) overproduction, mitochondrial structural damage, and subsequent mitochondrial DNA (mtDNA) leakage \\u003csup\\u003e\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e\\u003c/sup\\u003e. The inositol 1,4,5-trisphosphate receptor (IP3R2), a transmembrane protein located in the ER membrane, is essential for MAM formation. FUN14 domain-containing protein 1 (FUNDC1), a mitochondrial outer membrane protein enriched at MAM interfaces, has emerged as a critical modulator of cardiovascular function. In cardiomyocytes, FUNDC1 directly interacts with IP3R2 to regulate ER-derived Ca\\u0026sup2;⁺ flux into mitochondria and cytosol, thereby facilitating MAM assembly and calcium signaling \\u003csup\\u003e\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e\\u003c/sup\\u003e. Studies have shown elevated expression of FUNDC1 and IP3R2 in diabetic heart tissue, where they mediate mitophagy in cardiomyocytes \\u003csup\\u003e\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e\\u003c/sup\\u003e. Additionally, FUNDC1/IP3R1-associated MAM contributes substantially to neovascularization processes \\u003csup\\u003e\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e\\u003c/sup\\u003e. Conversely, high-fat diet (HFD)-fed mice demonstrate reduced FUNDC1 expression, and genetic ablation of FUNDC1 exacerbates diet-induced cardiac hypertrophy, fibrosis, and dysfunction \\u003csup\\u003e\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e\\u003c/sup\\u003e. Despite these advances, the mechanistic links between MAM-mediated FUNDC1/IP3R2 regulation of mitochondrial calcium dynamics in OBH-related heart disease\\u0026mdash;particularly in the context of traditional Chinese medicine (TCM) interventions\\u0026mdash;remain poorly understood. Pharmacological modulation of the FUNDC1/IP3R2 pathway could thus represent a viable strategy for attenuating myocardial remodeling.\\u003c/p\\u003e \\u003cp\\u003eIn recent years, TCM has demonstrated promising effects in preventing and treating hypertension-related target organ damage \\u003csup\\u003e\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e\\u003c/sup\\u003e. The clinically established Huoxue Qianyang Qutan Recipe (HQQR), with over twenty years of application, effectively lowers blood pressure while improving glycolipid metabolism and reducing inflammation in hypertensive patients \\u003csup\\u003e\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e\\u003c/sup\\u003e. Emerging evidence indicates HQQR's organ-protective properties, particularly its ability to mitigate cardiac fibrosis and cardiomyocyte hypertrophy in OBH. These effects may arise from the formulation's modulation of endoplasmic reticulum stress and mitochondrial function\\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR23 CR24\\\" citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eThis study investigated how HQQR mitigates myocardial remodeling in OBH. By elucidating the molecular mechanisms underlying the therapeutic effects of HQQR, we aim to provide novel insights into treating OBH-induced myocardial remodeling and related cardiovascular complications.\\u003c/p\\u003e\"},{\"header\":\"2 Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.1 Experimental animals and drug treatments\\u003c/h2\\u003e \\u003cp\\u003eFive-week-old male spontaneously hypertensive rats (SHR, n\\u0026thinsp;=\\u0026thinsp;78) and age-matched Wistar-Kyoto rats (WKY, n\\u0026thinsp;=\\u0026thinsp;6) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. [license number: SCXK (Beijing) 2021-0006]. All animals were housed under controlled conditions (temperature: 22\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2\\u0026deg;C; relative humidity: 50\\u0026ndash;60%) at the experimental animal center of Yueyang Hospital of Integrated Traditional Chinese and Western Medicine. Animal procedures were approved by the Institutional Animal Care and Use Committee of Yueyang Hospital (approval number: YYLAC-2022-172) and conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Of the 78 SHRs, 72 were fed a high-fat diet (HFD; supplied by Jiangsu Medicine Biomedical Co., Ltd.) to induce obesity. The HFD consisted of 60% standard chow, 12.5% lard, 10% sucrose, 10% egg yolk powder, 5% milk powder, 2% cholesterol, and 0.5% bile salt. After 10 weeks, SHRs in the top 1/3 of body weight were identified as OBH rats based on previous reports\\u003csup\\u003e\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e\\u003c/sup\\u003e. The remaining 6 SHRs, along with all 6 WKY rats, were fed a standard normal diet (ND; supplied by Jiangsu Medicine Biomedical Co., Ltd.) throughout the study.\\u003c/p\\u003e \\u003cp\\u003eRats were then divided into six groups (n\\u0026thinsp;=\\u0026thinsp;6 per group): WKY group (WKY rats fed ND), SHR group (SHRs fed ND), OBH group (SHRs fed HFD), OBH+HQQR-L group (OBH rats fed HFD and administered a low dose of HQQR at 19.35 g crude drug/kg/day by intragastric gavage), OBH+HQQR-H group (OBH rats fed HFD and administered a high dose of HQQR at 38.7 g crude drug/kg/day by intragastric gavage), and OBH+valsartan group (OBH rats fed HFD and administered valsartan at 30 mg/kg/day by intragastric gavage). Valsartan capsules (batch number: X3230) were obtained from Beijing Novartis Pharmaceutical Co. Ltd. The dosages of HQQR and valsartan were determined based on our previous studies \\u003csup\\u003e\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.2 Preparation of HQQR\\u003c/h2\\u003e \\u003cp\\u003eHQQR was prepared by the Department of Pharmacy, Eastern Theater General Hospital, People's Liberation Army, Nanjing, China. The formulation comprises seven herbal components: \\u003cem\\u003eSalvia miltiorrhiza\\u003c/em\\u003e Bunge (common name: Dan Shen), Cassia Seed (\\u003cem\\u003eSennae Semen\\u003c/em\\u003e, common name: Stone Cassia), \\u003cem\\u003eLigusticum chuanxiong\\u003c/em\\u003e Hort (common name: Chuan Xiong), \\u003cem\\u003eUncaria rhynchophylla\\u003c/em\\u003e (Miq.) Miq. ex Havil. (common name: Gou Teng), \\u003cem\\u003eTaxillus chinensis\\u003c/em\\u003e (DC.) Danser (common name: Sang Ji Sheng), \\u003cem\\u003eCrataegus pinnatifida\\u003c/em\\u003e Bunge (common name: Shan Zha), and Corn Silk (\\u003cem\\u003eMaydis Stigma\\u003c/em\\u003e, common name: Yu Mi Xu), in a dry weight ratio of 5:10:3:5:5:5:10.\\u003c/p\\u003e \\u003cp\\u003eThe extraction and powder preparation followed this protocol: First, Cassia Seed was decocted alone in water for 1 hour. The remaining herbs (except \\u003cem\\u003eUncaria rhynchophylla\\u003c/em\\u003e) were then combined and decocted twice: initially with 10 volumes of water for 1 hour, followed by a second decoction with 8 volumes of water for 40 minutes. The two decoctions were combined, allowed to precipitate, and filtered. \\u003cem\\u003eUncaria rhynchophylla\\u003c/em\\u003e was then added to the combined filtrate with 8 volumes of water, decocted for 40 minutes, and filtered. All filtrates were pooled and left to stand overnight, after which they were filtered again. The final filtrate was concentrated under reduced pressure, transferred to a vacuum drying oven, and dried at 80\\u0026deg;C. The dried extract was milled and passed through a 100-mesh sieve to obtain the HQQR fine powder. The formulation ratio and experimental doses were determined based on our previous studies \\u003csup\\u003e\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.3 Determination of components in HQQR\\u003c/h2\\u003e \\u003cp\\u003eMethanol, acetonitrile, formic acid and isopropyl alcohol were purchased from\\u003c/p\\u003e \\u003cp\\u003eANPEL. All solvents were LC-MS grade. And ultra-pure water in-house prepared\\u003c/p\\u003e \\u003cp\\u003eusing a Milli-Q water purification system (Millipore, Bedford, MA, USA). Components in HQQR and HQQR-containing serum were performed by UPLC-QE-Orbitrap-MS/MS. Detailed methods were in the Supplementary Materials. The detailed parameters of the mass spectrometer were demonstrated in Table \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.4 Assessment of Physiological Parameters and Cardiac Morphology\\u003c/h2\\u003e \\u003cp\\u003eSystolic blood pressure (SBP), diastolic blood pressure (DBP), and mean blood pressure (MBP) were monitored every two weeks using a non-invasive tail-cuff system (BP-98A, Beijing Softron Biotechnology Co., Ltd, China). Prior to measurement, rats were warmed at 35\\u0026deg;C for 5 minutes. Three consecutive readings were obtained and averaged for each session. Body weight was recorded bi-weekly, and body length was measured at the end of the treatment period. The degree of obesity was assessed using Lee\\u0026rsquo;s index, calculated as: Lee \\u0026rsquo;s index =\\u003cspan class=\\\"InlineEquation\\\"\\u003e\\u003cspan class=\\\"mathinline\\\"\\u003e\\\\(\\\\:\\\\frac{{\\\\sqrt[3]{\\\\text{b}\\\\text{o}\\\\text{d}\\\\text{y}\\\\:\\\\text{w}\\\\text{e}\\\\text{i}\\\\text{g}\\\\text{h}\\\\text{t}\\\\:\\\\left(\\\\text{g}\\\\right)}\\\\times\\\\:10}^{}}{body\\\\:length\\\\:\\\\left(cm\\\\right)}\\\\)\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003eAfter 10 weeks of treatment, cardiac function was assessed by transthoracic echocardiography. Rats were anesthetized with 2% isoflurane to maintain a heart rate between 400 and 650 beats per minute. Cardiac parameters were measured using a Vevo 2100 high-resolution imaging system (Visual Sonics Inc., Canada). Measurements, including interventricular septal thickness at end-diastole (IVSd), left ventricular internal diameter at end-diastole (LVIDd), and left ventricular posterior wall thickness at end-diastole (LVPWd), were obtained from an average of five consecutive cardiac cycles. Corrected left ventricular mass (LVM) was automatically calculated by the machine\\u0026rsquo;s software.\\u003c/p\\u003e \\u003cp\\u003eSubsequently, rats were euthanized. Blood samples were collected from the abdominal aorta, and heart and liver tissues were rapidly harvested. The liver weight, left ventricular mass index (LVMI), heart weight to body weight ratio (HW/BW), and heart weight to tibia length ratio (HW/TL) were then calculated.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.5 Histological analysis\\u003c/h2\\u003e \\u003cp\\u003eLeft ventricular tissues were fixed, paraffin-embedded, and sectioned. Sections were stained with hematoxylin and eosin (H\\u0026amp;E) and wheat germ agglutinin (WGA) following standard protocols. Images were captured using a light microscope (NIKON, Japan) at 200\\u0026times; magnification for morphological assessment.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.6 Ultrastructure and separation of MAM\\u003c/h2\\u003e \\u003cp\\u003eFor transmission electron microscopy (TEM), heart tissue was fixed in 2.5% glutaraldehyde, post-fixed in 1% osmium tetroxide, and embedded in epoxy resin. Ultrathin sections were stained and observed under a TEM (Talos L120C, Thermo Fisher Scientific). Mitochondria-associated endoplasmic reticulum membrane (MAM) distance and length were quantified using ImageJ. MAMs were isolated from heart tissues by differential ultracentrifugation as described \\u003csup\\u003e\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.7 Mitochondrial Ca\\u003csup\\u003e2+\\u003c/sup\\u003e and membrane potential measurement\\u003c/h2\\u003e \\u003cp\\u003eMitochondrial Ca\\u0026sup2;⁺ levels were assessed using Rhod-2 AM (Thermo Fisher Scientific, R1244). For histological analysis, rat myocardial tissue sections were fixed, permeabilized, and blocked, followed by incubation with Rhod-2 AM overnight at 4\\u0026deg;C. After washing, sections were incubated with an Alexa Fluor 488-conjugated secondary antibody (Beyotime, A0423) for 2 h at room temperature and imaged under a fluorescence microscope (Nikon, Japan) at 200\\u0026times; magnification.\\u003c/p\\u003e \\u003cp\\u003eFor flow cytometric analysis, a 5 \\u0026micro;M working solution of Rhod-2 AM was prepared in Hank\\u0026lsquo;s Balanced Salt Solution (HBSS). Cells were harvested, washed with PBS, and incubated with the Rhod-2 AM working solution at 37\\u0026deg;C for 30 min. After washing, cells were further incubated in HBSS at 37\\u0026deg;C for 30 min to allow complete de-esterification, then resuspended in flow assay buffer. Mitochondrial Ca\\u0026sup2;⁺ levels were quantified using a flow cytometer.\\u003c/p\\u003e \\u003cp\\u003eMitochondrial membrane potential was assessed using the JC-1 assay kit (Beyotime) according to the manufacturer\\u0026rsquo;s instructions.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.8 Cell culture and treatment\\u003c/h2\\u003e \\u003cp\\u003ePrimary cardiomyocytes were isolated from 1-3-day-old Sprague-Dawley rats and maintained in Dulbecco\\u0026rsquo;s Modified Eagle Medium supplemented with 10% fetal bovine serum in a humidified atmosphere of 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e and 95% air at 37 ℃. All the culture media were supplemented with penicillin (100 U/mL) and streptomycin (100 \\u0026micro;g/mL). Cardiomyocytes were divided into the following five groups (Control, Ang Ⅱ, Ang II\\u0026thinsp;+\\u0026thinsp;HQQR-L, Ang II\\u0026thinsp;+\\u0026thinsp;HQQR-H, and Ang II\\u0026thinsp;+\\u0026thinsp;Val). The control group of cells were cultured with FBS. Cardiac hypertrophy was induced with 1 \\u0026micro;M of Angiotensin II (Ang II) (MCE, HY-13948) for 24 h. The remaining three groups were given low-dose HQQR (0.2 mg/ mL), high-dose HQQR (0.5 mg/ mL), and Valsartan (10 \\u0026micro;M) on this basis. The concentrations of Ang II and HQQR used in this study were based on our previous study \\u003csup\\u003e\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.9 Cell proliferation assay\\u003c/h2\\u003e \\u003cp\\u003eCell counting kit-8 (Beyotime Biotechnology, C0039) was utilised to assess cell proliferation. A 96-well plate was seeded with 5 \\u0026times; 10\\u003csup\\u003e3\\u003c/sup\\u003e cells/well. After being treated under different concentrations of Ang II (0 uM, 0.001 uM, 0.01 uM, 0.1 uM, 1 uM, 10 uM, and 100uM) for 24 h, the cells were mixed with the CCK-8 reagents (CP002, Signalway Antibody LLC, College Park, MD, USA), and incubated in a 5% CO2 incubator for 1 h at 37 ℃. The optical density (OD) value was read at 450 nm using a microplate reader (DNM-9602, Prelong, Beijing, China).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec12\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.10 Transfection of FUNDC1\\u003c/h2\\u003e \\u003cp\\u003eFUNDC1 overexpression plasmids were obtained from General Biology Co. Ltd. (Chuzhou, China). FUNDC1 shRNAs and their negative controls (shNC) were procured from GenePharma Co., Ltd. (Suzhou, China). Cardiomyocytes were transfected with shRNA or overexpression plasmids using Lipofectamine 2000 (Thermo Fisher Scientific), according to the manufacturer\\u0026rsquo;s instructions. The sequences of shFUNDC1-1, shFUNDC1-2, and shFUNDC1-3 were listed in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eTarget Sites and Oligonucleotide Sequences for FUNDC1 and IP3R2\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003eTarget gene\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eTarget Site\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eSequence\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"2\\\" rowspan=\\\"3\\\"\\u003e \\u003cp\\u003eFundc1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eFundc1-rat-167\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGAGAGCGATGACGAGTCTTAC\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eFundc1-rat-281\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGTAGCTACCCAGATAGTAATG\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eFundc1-rat-411\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGCTATGTGCAGATCGACTGGA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"2\\\" rowspan=\\\"3\\\"\\u003e \\u003cp\\u003eIP3R2\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eIp3r2-Rat-929\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eCCTACCGAGAGGATGTATTAA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eIp3r2-Rat-4785\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eGCAGTCCGCCTTCAGAATTTA\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eIp3r2-Rat-5200\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eTTCATGTCCAAGCTGATTAAT\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.11 Western Blot\\u003c/h2\\u003e \\u003cp\\u003eThe protein concentration was determined using a BCA assay kit (Elabscience Biotechnology, E-BC-K318-M). Proteins were separated by SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes. Membranes were blocked with 5% skimmed milk for 1 h at room temperature and incubated overnight at 4 ℃ with primary antibodies: anti-FUNDC1 (CST, #49240), anti-IP3R2 (Santa, sc-398434), anti-atrial natriuretic peptide (ANP) (Abcam, Ab225844), anti-brain natriuretic peptide (BNP) (Abcam, ab19645), anti-β-myosin heavy chain (β-MHC) (Abcam, ab37484) anti-GAPDH (Proteintech, 60009-1-AP), anti-Calreticulin (Abcam, ab92516), and anti-ubiquitin (Ub) (Proteintech, 10201-2-AP). After washing thrice with TBST, the membranes were incubated with secondary antibodies at 37\\u0026deg;C for 1 h. Protein bands were visualized using a Tanon 5200 chemiluminescence imaging system (Shanghai, China) and quantified using ImageJ version 1.53. WB experiment was repeated three times for each group.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec14\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.12 Co-immunoprecipitation (Co-IP)\\u003c/h2\\u003e \\u003cp\\u003eCo-IP was performed using the BersinBio Co-IP kit (Bes3011, China) according to the manufacturer\\u0026rsquo;s instructions. Ang II-treated cardiomyocytes were lysed in ice-cold lysis buffer (Beyotime, P0038), and the lysate was cleared by centrifugation. 300 ul of the sample was incubated overnight with specific antibodies targeting the proteins of interest at 4\\u0026deg;C with continuous agitation (vertical mixer). Subsequently, the supernatant was incubated with 100 \\u0026micro;L Protein A/G-Plus-Agarose beads in a vertical mixer for 1\\u0026ndash;2 h at 4\\u0026deg;C. The precipitated complexes were collected by centrifugation, washed three times with wash buffer for 10 min each at 4℃, and boiled in 5\\u0026times; loading buffer to elute bound proteins. The eluted proteins were analyzed by WB as described in Section \\u003cspan refid=\\\"Sec13\\\" class=\\\"InternalRef\\\"\\u003e2.11\\u003c/span\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec15\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.13 MitoROS measurement\\u003c/h2\\u003e \\u003cp\\u003eMitoSOX (Thermo Fisher Scientific, M36008) was used to measure mitochondrial ROS levels.\\u003c/p\\u003e \\u003cp\\u003eRat myocardial tissues were fixed, permeabilised and blocked, followed by overnight incubation with MitoSOX (Thermo Fisher Scientific, M36008) at 4\\u0026deg;C. Antibody incubation was referred to 2.6. Images were visualised and captured at 200\\u0026times; magnification using a microscope (NIKON, Japan).\\u003c/p\\u003e \\u003cp\\u003eA stock solution (10 \\u0026micro;g/13 \\u0026micro;L) in DMSO was prepared and diluted in serum-free DMEM to prepare the working solution. Cells were washed with PBS, trypsinized, and centrifuged at 1000 rpm for 5 min to collect the cell pellet. The cells were resuspended in 1 mL of working solution and incubated at 37\\u0026deg;C and 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e for 30 min. After incubation, the cells were washed thrice with serum-free DMEM and analyzed using flow cytometry.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec16\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2.14 Statistical analysis\\u003c/h2\\u003e \\u003cp\\u003eStatistical analyses were conducted using GraphPad Prism version 10 (GraphPad Software, Boston, Massachusetts USA, www.graphpad.com). Data are presented as the mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard deviation. One-way ANOVA was performed for statistical comparisons, followed by Fisher's Least Significant Difference (LSD) test for post-hoc analysis. A significance level of \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05 was considered statistically significant. Different letters indicate significant differences (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05), the same letters indicate no significant differences.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"3 Results\",\"content\":\"\\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.1 Identification of compounds in HQQR and HQQR-containing Serum\\u003c/h2\\u003e \\u003cp\\u003eBy analyzing the corresponding ion peaks, we obtained the MS/MS fragment information of compounds. A total of 1144 compounds were identified in HQQR (Table \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e). The total ion current (TIC) and base peak chromatogram (BPC) of HQQR-containing serum in both positive and negative ion modes are presented in Figure \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.2 HQQR reduced BP, Lee\\u0026rsquo;s index and liver weight and alleviated LVH in OBH rats\\u003c/h2\\u003e \\u003cp\\u003eOBH rats exhibited larger body size than SHR rats (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA), as well as higher body weight (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB), abdominal circumference (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC), and Lee's index (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD). Notably, compared with the WKY group (normal control), the OBH group showed significantly increased body weight, abdominal circumference, Lee's index, SBP, DBP, MAP, HW/BW, HW/TL and LVMI (P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05), confirming the successful establishment of OBH rats model induced by high-fat diet. HQQR-L, HQQR-H, and valsartan all reduced elevated SBP, DBP, and MBP in OBH rats. The antihypertensive effect of HQQR was dose-dependent, with HQQR-H demonstrating a significantly better antihypertensive effect than HQQR-L. Notably, there was no significant difference in the antihypertensive effects between HQQR-H and valsartan (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eE). Furthermore, compared to the OBH group, HQQR-H significantly reduced body weight (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eF), Lee\\u0026rsquo;s index (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eG,) and liver weight (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eH), while valsartan did not significantly improve body weight or liver weight. This suggested that high-dose HQQR, but not valsartan, could improve metabolic disorders and liver hypertrophy in OBH rats. HQQR-L, HQQR-H, and valsartan all alleviated the high-fat diet (HFD)-induced increase in heart weight/body weight (HW/BW) and heart weight/tibia length (HW/TL) in the OBH group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eI), indicating that both HQQR (regardless of dose) and valsartan could effectively alleviate HFD-induced myocardial hypertrophy in OBH rats. Representative echocardiography results are shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eJ. LVMI in the HQQR-H group was lower than that in the valsartan group, suggesting that high-dose HQQR had a superior effect in alleviating left ventricular hypertrophy compared to valsartan. Neither HQQR (HQQR-L or HQQR-H) nor valsartan had a significant effect on IVSd, LVIDd, or LVPWd (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eK).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec20\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.3 HQQR improved MAM function in OBH rats\\u003c/h2\\u003e \\u003cp\\u003eHE staining indicated that SHRs exhibited mild cardiomyocyte edema and degeneration along with myocardial fiber disarray. OBH rats displayed more severe edema, degeneration, and disorganization of myocardial fibers than SHRs, accompanied by a pronounced infiltration of inflammatory cells\\u0026mdash;an important feature of myocardial inflammation that further exacerbates myocardial damage in OBH rats. HQQR treatment alleviated these pathological changes in a dose-dependent manner: HQQR-H showed a more significant improvement than HQQR-L, with pathological manifestations close to those of the valsartan group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA-B). Representative images of immunofluorescence staining are shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC and Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD. HQQR treatment significantly reduced mitochondrial Ca\\u0026sup2;⁺ and ROS levels in cardiomyocytes, with the level of Ca\\u003csup\\u003e2+\\u003c/sup\\u003e in HQQR-H group showing similar to valsartan and both lower than OBH group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE-F). This finding suggests that HQQR can improve mitochondrial function in OBH rats by reducing abnormal mitochondrial Ca\\u0026sup2;⁺ accumulation and excessive ROS production, which may be one of the key mechanisms underlying its myocardial protective effect.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eTEM revealed that the ER became aggregated and swollen, whereas the mitochondria became longer and more interconnected in OBH rats, indicating obvious structural abnormalities of ER and mitochondria. These changes were significantly improved after HQQR treatment, especially in the HQQR-H group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eG). Furthermore, the mitochondria and ER exhibited a closer association in OBH rats, facilitating the formation of MAMs. Abnormal MAM formation may enhance the cross-talk between ER stress and mitochondrial dysfunction, thereby accelerating myocardial injury in OBH rats. HQQR-H treatment led to a notable increase in average distance and decrease in average length of ER-mitochondria associations, similar to the effect of valsartan. Compared to the HQQR-L group, the MAM in the HQQR-H group showed a decreasing trend (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eH), further confirming the dose-dependent therapeutic effect of HQQR on ER-mitochondrial structural abnormalities.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec21\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.4 HQQR reduced the expression of FUNDC1 and IP3R2 while enhancing the ubiquitination of IP3R2\\u003c/h2\\u003e \\u003cp\\u003eConsistent with its protective effects on myocardial pathology and mitochondrial function, HQQR treatment reduced the elevated expression of FUNDC1 and IP3R2 in OBH rats (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eA). The effects of different concentrations of Ang II on cardiomyocytes were evaluated using the CCK8 assay, and 1 \\u0026micro;M Ang II was selected for subsequent experiments (Figure \\u003cspan refid=\\\"MOESM2\\\" class=\\\"InternalRef\\\"\\u003eS2\\u003c/span\\u003e). This concentration was consistent with our previous research. In vitro, HQQR decreased the expression of FUNDC1 in Ang II-injured cardiomyocytes, with the high-dose group showing superior effects to the low-dose group. HQQR also reduced the expression of IP3R2, with the high-dose group demonstrating better efficacy than the low-dose group (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eB). Furthermore, the ubiquitination levels of IP3R2 in the OBH group were lower than those in the SHR and WKY groups, whereas HQQR and valsartan treatment improved the ubiquitination modification of IP3R2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eC). A similar phenomenon was observed in vitro, where HQQR-H promoted IP3R2 ubiquitination levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eD). These results indicate that HQQR may regulate IP3R2 expression by promoting its ubiquitination-dependent degradation, and jointly regulate FUNDC1 and IP3R2 to alleviate myocardial injury in OBH rats, which may be closely related to its regulation of mitochondrial and ER function observed in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec22\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.5 Interference of FUNDC1 improved the effects of Ang II on cardiomyocytes\\u003c/h2\\u003e \\u003cp\\u003eWB analysis confirmed the successful interference of FUNDC1 (Figure \\u003cspan refid=\\\"MOESM3\\\" class=\\\"InternalRef\\\"\\u003eS3\\u003c/span\\u003e). Consistent with the in vivo findings, indicators associated with cardiomyocyte hypertrophy, including ANP, BNP, and β-MHC, were pathologically elevated after treatment with Ang II, nd these indicators decreased after HQQR treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA). To examine the effects of Ang II and FUNDC1 interference on mitochondrial function, levels of mitochondrial Ca\\u0026sup2;⁺ (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eB), mitoROS (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eC), and mitochondrial membrane potential (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eD) were measured. Mitochondrial Ca\\u0026sup2;⁺ and mitochondrial membrane potential levels were significantly increased, indicating impaired mitochondrial Ca\\u0026sup2;⁺ transport. This imbalance in Ca\\u0026sup2;⁺ homeostasis was associated with increased mitochondrial oxidative stress, accompanied by a decrease in mitochondrial ATP levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eE), suggesting reduced energy metabolism function in damaged mitochondria. Notably, all these Ang II-induced abnormalities were reversed by FUNDC1 interference (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA-E). Additionally, IP3R2 expression decreased concurrently with FUNDC1 inhibition (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eF), further supporting the coordinated regulation of FUNDC1 and IP3R2 observed in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e. Co-IP data demonstrated that FUNDC1 might directly bound to IP3R2 to tether the ER and mitochondria in Ang II-injured cardiomyocytes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eG), which may explain how FUNDC1 interference modulates ER-mitochondrial Ca\\u0026sup2;⁺ transport and mitochondrial function, thereby alleviating Ang II-induced cardiomyocyte hypertrophy and mitochondrial dysfunction.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec23\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3.6 HQQR alleviated cardiomyocyte injury via FUNDC1/IP3R2 signaling in primary cardiomyocytes\\u003c/h2\\u003e \\u003cp\\u003eTo further confirm the regulatory role of FUNDC1 in HQQR-mediated myocardial protection, WB analysis confirmed the successful overexpression of FUNDC1 protein (Supplementary Figure C). Consistent with the aforementioned in vitro findings, in Ang II-injured cardiomyocytes with FUNDC1 overexpression, HQQR significantly reduced the increased expression of ANP, BNP, and β-MHC (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eA), indicating that HQQR could alleviate cardiomyocyte hypertrophy even under conditions of FUNDC1 overexpression. Furthermore, HQQR improved mitochondrial function by reducing mitochondrial Ca\\u0026sup2;⁺ levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB), mitoROS production (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eC), and mitochondrial membrane potential (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eD)\\u0026mdash;abnormalities induced by Ang II and FUNDC1 overexpression. Additionally, HQQR reduced the expression of IP3R2 in Ang II-injured cardiomyocytes with FUNDC1 overexpression (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eF). These results further demonstrated that HQQR exerts its myocardial protective effects by downregulating IP3R2 and improving mitochondrial function, even when FUNDC1 is overexpressed, suggesting that FUNDC1 acted as a downstream target of HQQR in regulating myocardial hypertrophy and mitochondrial dysfunction.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"4 Discussion\",\"content\":\"\\u003cp\\u003eOur study demonstrates that HQQR significantly ameliorates key pathological features of OBH in rats, including elevated blood pressure, visceral fat deposition, and weight gain. Notably, HQQR exhibits a broader therapeutic scope than valsartan, particularly in improving metabolism. Moreover, HQQR effectively mitigates severe edema, degeneration, and disorganization of myocardial fibers in OBH rats and inhibits the progression of cardiac hypertrophy. Additionally, HQQR maintains mitochondrial Ca\\u0026sup2;⁺ homeostasis in cardiomyocytes and suppresses the expression of FUNDC1 and IP3R2 in Ang II-damaged cardiomyocytes, with more pronounced effects observed at higher doses. These findings reinforce its regulatory influence on mitochondrial function and calcium dynamics. The results demonstrate that HQQR alleviates systemic symptoms in OBH rats while exerting substantial protection against myocardial remodeling.\\u003c/p\\u003e \\u003cp\\u003eMitochondria occupy roughly 30% of adult cardiomyocyte volumes and are essential for normal cardiac function\\u003csup\\u003e\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e\\u003c/sup\\u003e. Accumulating evidence implicates mitochondrial damage and impaired energy metabolism as central mechanisms in OBH-induced myocardial remodeling, processes intimately connected to intracellular Ca\\u0026sup2;⁺ signaling\\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR30\\\" citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e\\u003c/sup\\u003e. As a key second messenger, Ca\\u0026sup2;⁺ regulates diverse cellular activities including metabolism, differentiation, proliferation, and apoptosis\\u003csup\\u003e\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e\\u003c/sup\\u003e. In cardiomyocytes, dysregulation of Ca\\u0026sup2;⁺ homeostasis is closely associated with pathological states, such as myocardial hypertrophy and heart failure\\u003csup\\u003e\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e\\u003c/sup\\u003e. MAMs serve as critical junctions between the ER and mitochondria, coordinating Ca\\u0026sup2;⁺ signaling, lipid metabolism, and mitochondrial dynamics\\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR37\\\" citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e\\u003c/sup\\u003e. xcessive communication between the ER and mitochondria can lead to rapid Ca\\u0026sup2;⁺ influx from the ER to the mitochondria via MAMs, disrupting mitochondrial Ca\\u0026sup2;⁺ homeostasis, stimulating ROS production, and triggering mtDNA release\\u003csup\\u003e\\u003cspan additionalcitationids=\\\"CR40\\\" citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e\\u003c/sup\\u003e. These findings underscore MAMs' pivotal role in preserving cardiomyocyte metabolic and physiological stability\\u003csup\\u003e\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e\\u003c/sup\\u003e.\\u003c/p\\u003e \\u003cp\\u003eUNDC1, a mitochondrial outer membrane protein localized in MAMs, plays a critical role in MAM formation and maintenance\\u003csup\\u003e\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e\\u003c/sup\\u003e. ts deficiency reduces MAM protein abundance and disrupts mitochondrial-ER contacts, exacerbating mitochondrial dysfunction. The ER-resident IP3R2, a primary Ca\\u0026sup2;⁺ release channel, mediates rapid Ca\\u0026sup2;⁺ transfer between the ER and mitochondria while maintaining intracellular Ca\\u0026sup2;⁺ homeostasis, thereby facilitating MAM function\\u003csup\\u003e\\u003cspan citationid=\\\"CR43\\\" class=\\\"CitationRef\\\"\\u003e43\\u003c/span\\u003e\\u003c/sup\\u003e. Studies have shown that FUNDC1 and IP3R2 can form a protein complex that modulates MAM structure and function, influencing both Ca\\u0026sup2;⁺ homeostasis and mitochondrial function\\u003csup\\u003e\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e\\u003c/sup\\u003e. In OBH rats, we observed upregulation of FUNDC1 and IP3R2, key MAM regulators of Ca\\u0026sup2;⁺ homeostasis, suggesting that enhanced MAM formation promotes excessive communication between the ER and mitochondria and disrupts mitochondrial Ca\\u0026sup2;⁺ homeostasis during OBH-induced myocardial hypertrophy. Furthermore, HQQR treatment restored mitochondrial Ca\\u0026sup2;⁺ homeostasis while suppressing FUNDC1 and IP3R2 overexpression, thus maintaining the structure and function of MAMs. The amelioration of MAM-mediated mitochondrial dysfunction may be an important mechanism for HQQR to improve myocardial remodeling in OBH. Mechanistically, HQQR modulated cardiomyocyte function through FUNDC1 downregulation, which enhanced IP3R2 ubiquitination and degradation, limiting pathological ER-to-mitochondrial Ca\\u0026sup2;⁺ transfer and preserving mitochondrial integrity. Genetic manipulation experiments demonstrated that FUNDC1 knockdown rescued Ang II-induced mitochondrial dysfunction in cardiomyocytes, whereas FUNDC1 overexpression worsened these defects, establishing the central role of FUNDC1 in HQQR's mechanism of action and its regulatory control over IP3R2.\\u003c/p\\u003e \\u003cp\\u003eOur previous studies identified blood stasis, yang hyperactivity, and phlegm dampness as key pathological factors in OBH. HQQR, formulated according to traditional Chinese medicine principles, promotes blood circulation, suppresses yang, and resolves phlegm to eliminate dampness. Previous studies have demonstrated its effectiveness in lowering blood pressure, improving cardiac and renal function, reducing ER stress, and stabilizing mitochondrial activity\\u003csup\\u003e\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e44\\u003c/span\\u003e\\u003c/sup\\u003e. In the present study, HQQR maintained mitochondrial Ca\\u0026sup2;⁺ homeostasis by regulating MAMs, ameliorating myocardial remodeling while reducing blood pressure and obesity in OBH rats. FUNDC1 interference reduced IP3R2 expression, demonstrating the regulatory effect of FUNDC1 on IP3R2. This interference significantly downregulated FUNDC1 and IP3R2 expression, limiting excessive ER Ca\\u0026sup2;⁺ release and thus preventing mitochondrial Ca\\u0026sup2;⁺ overload. By attenuating mitochondrial Ca\\u0026sup2;⁺ accumulation and ROS generation, HQQR preserved mitochondrial function. Mitochondrial Ca\\u0026sup2;⁺ overload leads to excessive ROS production, which in turn induces oxidative stress and mitochondrial dysfunction. Furthermore, HQQR stabilizes MAM structure, thereby maintaining mitochondrial Ca\\u0026sup2;⁺ homeostasis and energy metabolism. Collectively, these effects attenuate myocardial remodeling in OBH rats.\\u003c/p\\u003e \\u003cp\\u003eClinically, OBH constitutes a prevalent high-risk phenotype characterized by poor cardiovascular outcomes resulting from combined metabolic and hemodynamic stress. Current therapeutic agents such as valsartan primarily target blood pressure reduction but fail to improve adequately metabolic dysregulation or mitochondrial dysfunction. HQQR demonstrates therapeutic potential by modulating MAM integrity and calcium signaling, offering a novel therapeutic approach to comprehensive cardioprotection in OBH. These findings could inform future clinical management, particularly for hypertensive patients with comorbid obesity and metabolic syndrome. While HQQR provides valuable insights into OBH-induced myocardial remodeling, this study has several limitations. The regulatory interactions between FUNDC1 and IP3R2 require further experimental validation. MAM structure and function involve multiple protein complexes, including tethering proteins, yet the relationship between FUNDC1 and key MAM tethering complexes such as the IP3R-GRP75-VDAC complex remains incompletely characterized\\u003csup\\u003e\\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e45\\u003c/span\\u003e,\\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e46\\u003c/span\\u003e\\u003c/sup\\u003e. The lack of metabolic-targeted positive controls, such as GLP-1 receptor agonists, precluded a comprehensive assessment of HQQR\\u0026rsquo;s metabolic efficacy. Additionally, as traditional Chinese medicine formulas typically exhibit polypharmacology, future studies should integrate modern pharmacological approaches to clarify the molecular mechanisms underlying HQQR\\u0026rsquo;s actions.\\u003c/p\\u003e\"},{\"header\":\"5 Conclusions\",\"content\":\"\\u003cp\\u003eHQQR attenuates mitochondrial damage and ameliorates OBH-induced cardiac remodeling by modulating MAM function via FUNDC1, restoring mitochondrial Ca\\u0026sup2;⁺ homeostasis. These results support the potential use of HQQR in preventing and treating OBH while advancing our understanding of mitochondrial and calcium-targeted therapeutic approaches for cardiac remodeling (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cdiv class=\\\"DefinitionList\\\"\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eOBH\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eObese hypertension\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eMAM\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eMitochondria-associated endoplasmic reticulum membrane\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eER\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eEndoplasmic reticulum\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eROS\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eReactive oxygen species\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003emtDNA\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003emitochondrial DNA\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eIP3R2\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eInositol 1,4,5-trisphosphate receptor\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eFUNDC1\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eFUN14 domain-containing protein 1\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eHFD\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eHigh-fat diet\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eTCM\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eTraditional Chinese medicine\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eHQQR\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eHuoxue Qianyang Qutan Recipe\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eSHR\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eSpontaneously hypertensive rats\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eWKY\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eWistar-Kyoto rats\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eND\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eNormal diet\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eSBP\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eSystolic blood pressure\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eDBP\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eDiastolic blood pressure\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eMBP\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eMean blood pressure\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eIVSD\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eInterventricular septal thickness\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eLVIDD\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eLeft ventricular internal diameter at end-diastole\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eLVPWD\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eLeft ventricular posterior wall thickness in diastole\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eLVM\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eLeft ventricular mass\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eLVMI\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eLeft ventricular mass index\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eHW/BW\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eHeart weight/body weight\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eHW/TL\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eHeart weight/tibia length\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eHE\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eHematoxylin \\u0026amp; eosin\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eWGA\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eWheat germ agglutinin\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eHBSS\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eHank's Balanced Salt Solution\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003ePBS\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003ePhosphate Buffered Saline\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eAng II\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eAngiotensin II\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003ePVDF\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003ePolyvinylidene difluoride\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eANP\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eAtrial natriuretic peptide\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eBNP\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eBrain natriuretic peptide\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eβ-MHC\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eβ-myosin heavy chain\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eUb\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eUbiquitin\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eCo-IP\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eCo-immunoprecipitation\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eLSD\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eLeast Significant Difference\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e \\u003cdiv class=\\\"Term\\\"\\u003eATP\\u003c/div\\u003e \\u003cdiv class=\\\"Description\\\"\\u003e \\u003cp\\u003eAdenosine triphosphate\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/div\\u003e \\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003ch2\\u003eEthics approval\\u003c/h2\\u003e\\n\\u003cp\\u003eThe study was approved by Ethics Committee of Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine (YYLAC-2022-172) in 2022.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDeclaration of interest\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003estatement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests.\\u003c/p\\u003e\\n\\u003ch2\\u003eAuthor Contributions statement\\u003c/h2\\u003e\\n\\u003cp\\u003eChunlei Hou: Formal Analysis, Writing \\u0026ndash; original draft, Writing \\u0026ndash; review \\u0026amp; editing. Yuxiu Zhao: Writing \\u0026ndash; original draft. Yulong Ma: Validation, Writing \\u0026ndash; review \\u0026amp; editing. Xunjie Zhou: Data curation, Investigation, Writing \\u0026ndash; review \\u0026amp; editing. Lei Yao: Data curation, Project administration, Writing \\u0026ndash; review \\u0026amp; editing. Jianhua Li: Visualization, Writing \\u0026ndash; review \\u0026amp; editing. Ming Tai Gui: Project administration, Validation, Writing \\u0026ndash; review \\u0026amp; editing. Mingzhu Wang: Investigation, Methodology, Writing \\u0026ndash; review \\u0026amp; editing. Xiaozhe Chen: Validation, Visualization, Writing \\u0026ndash; review \\u0026amp; editing. Deyu Fu: Conceptualization, Funding acquisition, Methodology, Resources, Supervision, Writing \\u0026ndash; review \\u0026amp; editing. Bo Lu: Conceptualization, Funding acquisition, Investigation, Methodology, Project administration, Writing \\u0026ndash; original draft, Writing \\u0026ndash; review \\u0026amp; editing.\\u003c/p\\u003e\\n\\u003ch2\\u003eFunding\\u003c/h2\\u003e\\n\\u003cp\\u003eThis work was supported by National Natural Science Foundation of China (82274262; 82174130), Shanghai Magnolia Talent Plan Pujiang Project (24PJD113), Program of Shanghai Municipal Health Commission (202240053), Shanghai Collaborative Innovation Center of Industrial Transformation of Hospital TCM Preparation, and High-level Chinese Medicine Key Discipline Construction Project (Integrative Chinese and Western Medicine Clinic) of National Administration of TCM (zyyzdxk-2023065).\\u003c/p\\u003e\\n\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\n\\u003cp\\u003eChunlei Hou: Formal Analysis, Writing \\u0026ndash; original draft, Writing \\u0026ndash; review \\u0026amp; editing. Yuxiu Zhao: Writing \\u0026ndash; original draft. Yulong Ma: Validation, Writing \\u0026ndash; review \\u0026amp; editing. Xunjie Zhou: Data curation, Investigation, Writing \\u0026ndash; review \\u0026amp; editing. Lei Yao: Data curation, Project administration, Writing \\u0026ndash; review \\u0026amp; editing. Jianhua Li: Visualization, Writing \\u0026ndash; review \\u0026amp; editing. Ming Tai Gui: Project administration, Validation, Writing \\u0026ndash; review \\u0026amp; editing. Mingzhu Wang: Investigation, Methodology, Writing \\u0026ndash; review \\u0026amp; editing. Xiaozhe Chen: Validation, Visualization, Writing \\u0026ndash; review \\u0026amp; editing. Deyu Fu: Conceptualization, Funding acquisition, Methodology, Resources, Supervision, Writing \\u0026ndash; review \\u0026amp; editing. Bo Lu: Conceptualization, Funding acquisition, Investigation, Methodology, Project administration, Writing \\u0026ndash; original draft, Writing \\u0026ndash; review \\u0026amp; editing.\\u003c/p\\u003e\\n\\u003ch2\\u003eAcknowledgement\\u003c/h2\\u003e\\n\\u003cp\\u003eThe authors sincerely acknowledge Bullet Edits Limited for their assistance in language editing and proofreading. The authors also thank Figdraw (www.figdraw.com) for providing the platform used to create Figure 6.\\u003c/p\\u003e\\n\\u003ch2\\u003eData Availability\\u003c/h2\\u003e\\n\\u003cp\\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eMills, K. T., Stefanescu, A. \\u0026amp; He, J. The global epidemiology of hypertension. \\u003cem\\u003eNat. Rev. Nephrol.\\u003c/em\\u003e \\u003cb\\u003e16\\u003c/b\\u003e, 223\\u0026ndash;237. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/s41581-019-0244-2\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41581-019-0244-2\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAl-Makki, A. et al. Hypertension Pharmacological Treatment in Adults: A World Health Organization Guideline Executive Summary. \\u003cem\\u003eHypertension (Dallas, Tex.\\u003c/em\\u003e:) 79, 293\\u0026ndash;301 (2022). ) 79, 293\\u0026ndash;301 (2022). (1979). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1161/HYPERTENSIONAHA.121.18192\\u003c/span\\u003e\\u003cspan address=\\\"10.1161/HYPERTENSIONAHA.121.18192\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHall, J. E., Carmo, da Silva, J. M., Wang, A. A., Hall, M. E. \\u0026amp; Z. \\u0026amp; Obesity-induced hypertension: interaction of neurohumoral and renal mechanisms. \\u003cem\\u003eCircul. Res.\\u003c/em\\u003e \\u003cb\\u003e116\\u003c/b\\u003e, 991\\u0026ndash;1006. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1161/CIRCRESAHA.116.305697\\u003c/span\\u003e\\u003cspan address=\\\"10.1161/CIRCRESAHA.116.305697\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBengmark, S. Obesity, the deadly quartet and the contribution of the neglected daily organ rest - a new dimension of un-health and its prevention. \\u003cem\\u003eHepatobiliary Surg. Nutr.\\u003c/em\\u003e \\u003cb\\u003e4\\u003c/b\\u003e, 278\\u0026ndash;288. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3978/j.issn.2304-3881.2015.07.02\\u003c/span\\u003e\\u003cspan address=\\\"10.3978/j.issn.2304-3881.2015.07.02\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYang, M. et al. Fibroblast growth factor 21 in metabolic syndrome. \\u003cem\\u003eFront. Endocrinol.\\u003c/em\\u003e \\u003cb\\u003e14\\u003c/b\\u003e, 1220426. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fendo.2023.1220426\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fendo.2023.1220426\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDu, W. et al. Plasma levels of heart failure biomarkers are primarily a reflection of extracardiac production. \\u003cem\\u003eTheranostics\\u003c/em\\u003e \\u003cb\\u003e8\\u003c/b\\u003e, 4155\\u0026ndash;4169. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.7150/thno.26055\\u003c/span\\u003e\\u003cspan address=\\\"10.7150/thno.26055\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTuccinardi, D. et al. Rethinking weight loss treatments as cardiovascular medicine in obesity, a comprehensive review. \\u003cem\\u003eEur. J. Prev. Cardiol.\\u003c/em\\u003e \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1093/eurjpc/zwae171\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/eurjpc/zwae171\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang, S. et al. Effect and mechanism of Qing Gan Zi Shen decoction on heart damage induced by obesity and hypertension. \\u003cem\\u003eJ. Ethnopharmacol.\\u003c/em\\u003e \\u003cb\\u003e319\\u003c/b\\u003e, 117163. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.jep.2023.117163\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jep.2023.117163\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGui, M. et al. Huoxue Qianyang Qutan recipe attenuates Ang II-induced cardiomyocyte hypertrophy by regulating reactive oxygen species production. \\u003cem\\u003eExperimental therapeutic Med.\\u003c/em\\u003e \\u003cb\\u003e22\\u003c/b\\u003e, 1446. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3892/etm.2021.10881\\u003c/span\\u003e\\u003cspan address=\\\"10.3892/etm.2021.10881\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSzymański, J. et al. Interaction of Mitochondria with the Endoplasmic Reticulum and Plasma Membrane in Calcium Homeostasis, Lipid Trafficking and Mitochondrial Structure. \\u003cem\\u003eInt. J. Mol. Sci.\\u003c/em\\u003e \\u003cb\\u003e18\\u003c/b\\u003e \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3390/ijms18071576\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/ijms18071576\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ede Brito, O. M. \\u0026amp; Scorrano, L. Mitofusin-2 regulates mitochondrial and endoplasmic reticulum morphology and tethering: the role of Ras. \\u003cem\\u003eMitochondrion\\u003c/em\\u003e \\u003cb\\u003e9\\u003c/b\\u003e, 222\\u0026ndash;226. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.mito.2009.02.005\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.mito.2009.02.005\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2009).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eD'Eletto, M. et al. Transglutaminase Type 2 Regulates ER-Mitochondria Contact Sites by Interacting with GRP75. \\u003cem\\u003eCell reports\\u003c/em\\u003e 25, 3573\\u0026ndash;3581 e3574 (2018). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.celrep.2018.11.094\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.celrep.2018.11.094\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, Z. et al. The SIRT3-ATAD3A axis regulates MAM dynamics and mitochondrial calcium homeostasis in cardiac hypertrophy. \\u003cem\\u003eInt. J. Biol. Sci.\\u003c/em\\u003e \\u003cb\\u003e20\\u003c/b\\u003e, 831\\u0026ndash;847. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.7150/ijbs.89253\\u003c/span\\u003e\\u003cspan address=\\\"10.7150/ijbs.89253\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLu, B. et al. So close, yet so far away: the relationship between MAM and cardiac disease. \\u003cem\\u003eFront. Cardiovasc. Med.\\u003c/em\\u003e \\u003cb\\u003e11\\u003c/b\\u003e, 1353533. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fcvm.2024.1353533\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fcvm.2024.1353533\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu, S. et al. Binding of FUN14 Domain Containing 1 With Inositol 1,4,5-Trisphosphate Receptor in Mitochondria-Associated Endoplasmic Reticulum Membranes Maintains Mitochondrial Dynamics and Function in Hearts in Vivo. \\u003cem\\u003eCirculation\\u003c/em\\u003e \\u003cb\\u003e136\\u003c/b\\u003e, 2248\\u0026ndash;2266. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1161/CIRCULATIONAHA.117.030235\\u003c/span\\u003e\\u003cspan address=\\\"10.1161/CIRCULATIONAHA.117.030235\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWu, S. et al. Hyperglycemia-Driven Inhibition of AMP-Activated Protein Kinase alpha2 Induces Diabetic Cardiomyopathy by Promoting Mitochondria-Associated Endoplasmic Reticulum Membranes In Vivo. \\u003cem\\u003eCirculation\\u003c/em\\u003e \\u003cb\\u003e139\\u003c/b\\u003e, 1913\\u0026ndash;1936. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1161/CIRCULATIONAHA.118.033552\\u003c/span\\u003e\\u003cspan address=\\\"10.1161/CIRCULATIONAHA.118.033552\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, C. et al. FUNDC1-dependent mitochondria-associated endoplasmic reticulum membranes are involved in angiogenesis and neoangiogenesis. \\u003cem\\u003eNat. Commun.\\u003c/em\\u003e \\u003cb\\u003e12\\u003c/b\\u003e, 2616. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/s41467-021-22771-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41467-021-22771-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRen, J. et al. FUNDC1 interacts with FBXL2 to govern mitochondrial integrity and cardiac function through an IP3R3-dependent manner in obesity. \\u003cem\\u003eSci. Adv.\\u003c/em\\u003e \\u003cb\\u003e6\\u003c/b\\u003e \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1126/sciadv.abc8561\\u003c/span\\u003e\\u003cspan address=\\\"10.1126/sciadv.abc8561\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTan, C. et al. Puerarin Improves Vascular Insulin Resistance and Cardiovascular Remodeling in Salt-Sensitive Hypertension. \\u003cem\\u003eAm. J. Chin. Med.\\u003c/em\\u003e \\u003cb\\u003e45\\u003c/b\\u003e, 1169\\u0026ndash;1184. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1142/S0192415X17500641\\u003c/span\\u003e\\u003cspan address=\\\"10.1142/S0192415X17500641\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, P., Hao, D. \\u0026amp; Xiong, X. Anti-hypertension effect of Wuwei Jiangya decoction via ACE2/Ang1-7/MAS signaling pathway in SHR based on network degree-distribution analysis. \\u003cem\\u003eJ. Ethnopharmacol.\\u003c/em\\u003e \\u003cb\\u003e319\\u003c/b\\u003e, 117121. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.jep.2023.117121\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jep.2023.117121\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eXie, J. et al. Efficacy of Huoxue Qianyang Qutan Recipe on essential hypertension: A randomized, double-blind, placebo-controlled trial. \\u003cem\\u003eJ. Integr. Med.\\u003c/em\\u003e \\u003cb\\u003e22\\u003c/b\\u003e, 484\\u0026ndash;492. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.joim.2024.05.002\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.joim.2024.05.002\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi, G., Li, J., Shao, R., Zhao, J. \\u0026amp; Chen, M. FUNDC1: A Promising Mitophagy Regulator at the Mitochondria-Associated Membrane for Cardiovascular Diseases. \\u003cem\\u003eFront. cell. Dev. biology\\u003c/em\\u003e. \\u003cb\\u003e9\\u003c/b\\u003e, 788634. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fcell.2021.788634\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fcell.2021.788634\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLu, B. et al. Huoxue Qianyang Qutan recipe attenuates cardiac fibrosis by inhibiting the NLRP3 inflammasome signalling pathway in obese hypertensive rats. \\u003cem\\u003ePharm. Biol.\\u003c/em\\u003e \\u003cb\\u003e59\\u003c/b\\u003e, 1045\\u0026ndash;1057. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1080/13880209.2021.1953541\\u003c/span\\u003e\\u003cspan address=\\\"10.1080/13880209.2021.1953541\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, J. et al. HuoXue QianYang QuTan Recipe attenuates left ventricular hypertrophy in obese hypertensive rats by improving mitochondrial function through SIRT1/PGC-1α deacetylation pathway. \\u003cem\\u003eBiosci. Rep.\\u003c/em\\u003e \\u003cb\\u003e39\\u003c/b\\u003e \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1042/bsr20192909\\u003c/span\\u003e\\u003cspan address=\\\"10.1042/bsr20192909\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, M. et al. Huoxue Qianyang Qutan Recipe Protects against Early Renal Damage Induced by Obesity-Related Hypertension via the SIRT1/NF-κB/IL-6 Pathway: Integrating Network Pharmacology and Experimental Validation-Based Strategy. \\u003cem\\u003eEvidence-based complementary and alternative medicine: eCAM\\u003c/em\\u003e 9599090 (2022). (2022). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1155/2022/9599090\\u003c/span\\u003e\\u003cspan address=\\\"10.1155/2022/9599090\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLevin, B. E. Arcuate NPY neurons and energy homeostasis in diet-induced obese and resistant rats. \\u003cem\\u003eAm. J. Physiol.\\u003c/em\\u003e \\u003cb\\u003e276\\u003c/b\\u003e, R382\\u0026ndash;387. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1152/ajpregu.1999.276.2.R382\\u003c/span\\u003e\\u003cspan address=\\\"10.1152/ajpregu.1999.276.2.R382\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (1999).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGomez, L. et al. The SR/ER-mitochondria calcium crosstalk is regulated by GSK3beta during reperfusion injury. \\u003cem\\u003eCell Death Differ.\\u003c/em\\u003e \\u003cb\\u003e23\\u003c/b\\u003e, 313\\u0026ndash;322. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/cdd.2015.101\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/cdd.2015.101\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2016).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSun, N. \\u0026amp; Finkel, T. Cardiac mitochondria: a surprise about size. \\u003cem\\u003eJ. Mol. Cell. Cardiol.\\u003c/em\\u003e \\u003cb\\u003e82\\u003c/b\\u003e, 213\\u0026ndash;215. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.yjmcc.2015.01.009\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.yjmcc.2015.01.009\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAkhmedov, A. T., Rybin, V. \\u0026amp; Marin-Garcia, J. Mitochondrial oxidative metabolism and uncoupling proteins in the failing heart. \\u003cem\\u003eHeart Fail. Rev.\\u003c/em\\u003e \\u003cb\\u003e20\\u003c/b\\u003e, 227\\u0026ndash;249. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s10741-014-9457-4\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s10741-014-9457-4\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDia, M. et al. Effect of Metformin on T2D-Induced MAM Ca2\\u0026thinsp;+\\u0026thinsp;Uncoupling and Contractile Dysfunction in an Early Mouse Model of Diabetic HFpEF. \\u003cem\\u003eInt. J. Mol. Sci.\\u003c/em\\u003e \\u003cb\\u003e23\\u003c/b\\u003e \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3390/ijms23073569\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/ijms23073569\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eOsanami, A. et al. Adenosine monophosphate deaminase in the endoplasmic reticulum-mitochondria interface promotes mitochondrial Ca2\\u0026thinsp;+\\u0026thinsp;overload in type 2 diabetes rat hearts. \\u003cem\\u003eJ. diabetes Invest.\\u003c/em\\u003e \\u003cb\\u003e14\\u003c/b\\u003e, 560\\u0026ndash;569. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1111/jdi.13982\\u003c/span\\u003e\\u003cspan address=\\\"10.1111/jdi.13982\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKarlstad, J., Sun, Y. \\u0026amp; Singh, B. B. Ca(2+) signaling: an outlook on the characterization of Ca(2+) channels and their importance in cellular functions. \\u003cem\\u003eAdv. Exp. Med. Biol.\\u003c/em\\u003e \\u003cb\\u003e740\\u003c/b\\u003e, 143\\u0026ndash;157. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/978-94-007-2888-2_6\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/978-94-007-2888-2_6\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSrikanth, S., Woo, J. S., Sun, Z. \\u0026amp; Gwack, Y. Immunological Disorders: Regulation of Ca2\\u0026thinsp;+\\u0026thinsp;Signaling in T Lymphocytes. \\u003cem\\u003eAdv. Exp. Med. Biol.\\u003c/em\\u003e \\u003cb\\u003e993\\u003c/b\\u003e, 397\\u0026ndash;424. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/978-3-319-57732-6_21\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/978-3-319-57732-6_21\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang, Y., Ye, L., Duan, D. D., Yang, H. \\u0026amp; Ma, T. TMEM16A Plays an Insignificant Role in Myocardium Remodeling but May Promote Angiogenesis of Heart During Pressure-overload. \\u003cem\\u003eFront. Physiol.\\u003c/em\\u003e \\u003cb\\u003e13\\u003c/b\\u003e, 897619. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fphys.2022.897619\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fphys.2022.897619\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAbudureyimu, M. et al. Berberine alleviates myocardial diastolic dysfunction by modulating Drp1-mediated mitochondrial fission and Ca(2+) homeostasis in a murine model of HFpEF. \\u003cem\\u003eFront. Med.\\u003c/em\\u003e \\u003cb\\u003e17\\u003c/b\\u003e, 1219\\u0026ndash;1235. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1007/s11684-023-0983-0\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s11684-023-0983-0\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGao, P., Yan, Z. \\u0026amp; Zhu, Z. Mitochondria-Associated Endoplasmic Reticulum Membranes in Cardiovascular Diseases. \\u003cem\\u003eFront. cell. Dev. biology\\u003c/em\\u003e. \\u003cb\\u003e8\\u003c/b\\u003e, 604240. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.3389/fcell.2020.604240\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fcell.2020.604240\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGong, Y. et al. Mitochondria-associated membrane-modulated Ca2\\u0026thinsp;+\\u0026thinsp;transfer: A potential treatment target in cardiac ischemia reperfusion injury and heart failure. \\u003cem\\u003eLife Sci.\\u003c/em\\u003e \\u003cb\\u003e278\\u003c/b\\u003e, 119511. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.lfs.2021.119511\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.lfs.2021.119511\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen, Q. et al. Endoplasmic reticulum stress and mitochondrial dysfunction during aging: Role of sphingolipids. \\u003cem\\u003eBiochim. et Biophys. acta Mol. cell. biology lipids\\u003c/em\\u003e. \\u003cb\\u003e1868\\u003c/b\\u003e, 159366. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.bbalip.2023.159366\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.bbalip.2023.159366\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFrey, N., McKinsey, T. A. \\u0026amp; Olson, E. N. Decoding calcium signals involved in cardiac growth and function. \\u003cem\\u003eNat. Med.\\u003c/em\\u003e \\u003cb\\u003e6\\u003c/b\\u003e, 1221\\u0026ndash;1227. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/81321\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/81321\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2000).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTian, S. et al. Sulforaphane Balances Ca2\\u0026thinsp;+\\u0026thinsp;Homeostasis Injured by Excessive Fat via Mitochondria-Associated Membrane (MAM). \\u003cem\\u003eMolecular nutrition \\u0026amp; food research\\u003c/em\\u003e 65, e2001076 (2021). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1002/mnfr.202001076\\u003c/span\\u003e\\u003cspan address=\\\"10.1002/mnfr.202001076\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen, W. et al. Polygonatum sibiricum polysaccharide ameliorates skeletal muscle aging via mitochondria-associated membrane-mediated calcium homeostasis regulation. \\u003cem\\u003ePhytomedicine: Int. J. phytotherapy phytopharmacology\\u003c/em\\u003e. \\u003cb\\u003e129\\u003c/b\\u003e, 155567. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.phymed.2024.155567\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.phymed.2024.155567\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2024).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLuan, Y. et al. Structure and Function of Mitochondria-Associated Endoplasmic Reticulum Membranes (MAMs) and Their Role in Cardiovascular Diseases. \\u003cem\\u003eOxidative medicine and cellular longevity\\u003c/em\\u003e 4578809 (2021). (2021). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1155/2021/4578809\\u003c/span\\u003e\\u003cspan address=\\\"10.1155/2021/4578809\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBartok, A. et al. IP3 receptor isoforms differently regulate ER-mitochondrial contacts and local calcium transfer. \\u003cem\\u003eNat. Commun.\\u003c/em\\u003e \\u003cb\\u003e10\\u003c/b\\u003e, 3726. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1038/s41467-019-11646-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1038/s41467-019-11646-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhou, X. et al. Huoxue Qianyang decoction ameliorates cardiac remodeling in obese spontaneously hypertensive rats in association with ATF6-CHOP endoplasmic reticulum stress signaling pathway regulation. \\u003cem\\u003eBiomed. pharmacotherapy = Biomedecine pharmacotherapie\\u003c/em\\u003e. \\u003cb\\u003e121\\u003c/b\\u003e, 109518. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.biopha.2019.109518\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.biopha.2019.109518\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMogk, A. \\u0026amp; Bukau, B. Mitochondria tether protein trash to rejuvenate cellular environments. \\u003cem\\u003eCell\\u003c/em\\u003e \\u003cb\\u003e159\\u003c/b\\u003e, 471\\u0026ndash;472. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1016/j.cell.2014.10.007\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.cell.2014.10.007\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSzabadkai, G. et al. Chaperone-mediated coupling of endoplasmic reticulum and mitochondrial Ca2\\u0026thinsp;+\\u0026thinsp;channels. \\u003cem\\u003eJ. Cell Biol.\\u003c/em\\u003e \\u003cb\\u003e175\\u003c/b\\u003e, 901\\u0026ndash;911. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://doi.org/10.1083/jcb.200608073\\u003c/span\\u003e\\u003cspan address=\\\"10.1083/jcb.200608073\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e (2006).\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"scientific-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"scirep\",\"sideBox\":\"Learn more about [Scientific Reports](http://www.nature.com/srep/)\",\"snPcode\":\"\",\"submissionUrl\":\"\",\"title\":\"Scientific Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Scientific Reports\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Obesity, Hypertension, HuoXue QianYang QuTan Recipe, FUNDC1, Mitochondria-associated Endoplasmic Reticulum Membrane\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-8757875/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-8757875/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eObese hypertension (OBH) elevates cardiovascular risk through myocardial remodeling, which is associated with disrupted mitochondrial Ca\\u0026sup2;⁺ homeostasis and dysfunction of mitochondria-associated endoplasmic reticulum membranes (MAM). Huoxue Qianyang Qutan Recipe (HQQR) has been shown to lower blood pressure in OBH, yet its mechanism related to MAM remains unclear. In this study, phenotypic assessments in OBH rats included blood pressure, morphological parameters, and cardiac ultrasound. Cardiomyocyte hypertrophy and mitochondrial Ca\\u0026sup2;⁺ levels were analyzed via pathological staining, while MAM ultrastructure was examined by electron microscopy. In vitro, flow cytometry was used to evaluate mitochondrial Ca\\u0026sup2;⁺, reactive oxygen species (ROS), and membrane potential. Protein levels of FUNDC1 and IP3R2 were assessed. Co-immunoprecipitation revealed an interaction between FUNDC1 and IP3R2, and further experiments with FUNDC1 siRNA knockdown and overexpression were conducted to clarify the mechanism of HQQR. Results showed that HQQR significantly lowered blood pressure, reduced left ventricular mass, and alleviated cardiomyocyte hypertrophy in OBH rats. In vivo, HQQR enhanced MAM formation, facilitated mitochondrial Ca\\u0026sup2;⁺ transport, and modulated FUNDC1 and IP3R2 expression. In vitro, HQQR reduced ROS and preserved mitochondrial Ca\\u0026sup2;⁺ homeostasis. Both HQQR treatment and FUNDC1 knockdown attenuated angiotensin II-induced cardiomyocyte hypertrophy and mitochondrial damage, as indicated by decreased levels of ANP, BNP, β-MHC, mitochondrial Ca\\u0026sup2;⁺, and ROS. In contrast, FUNDC1 overexpression diminished the protective effects of HQQR. The interaction between FUNDC1 and IP3R2 was confirmed, and the decrease in IP3R2 was attributed to ubiquitination-mediated degradation. In conclusion, HQQR mitigates MAM dysfunction in OBH-induced myocardial remodeling by regulating the FUNDC1-IP3R2 interaction and promoting ubiquitin-dependent degradation of IP3R2. Through these actions, HQQR helps maintain mitochondrial Ca\\u0026sup2;⁺ homeostasis in cardiomyocytes, thereby improving myocardial remodeling.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Huoxue Qianyang Qutan recipe limits cardiac remodeling by regulating FUNDC1/IP3R2 signaling pathway in obese hypertensive rats\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2026-03-26 11:14:43\",\"doi\":\"10.21203/rs.3.rs-8757875/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2026-04-07T16:02:41+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-04-06T20:38:44+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2026-04-05T04:44:27+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"36000174724259659817712443883368111641\",\"date\":\"2026-03-25T12:57:48+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"181623599406575420300515162451595276036\",\"date\":\"2026-03-25T04:06:02+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2026-03-25T03:42:50+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2026-03-16T00:38:23+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvited\",\"content\":\"\",\"date\":\"2026-02-24T14:47:37+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2026-02-20T18:55:57+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Scientific Reports\",\"date\":\"2026-02-20T18:51:12+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"scientific-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"scirep\",\"sideBox\":\"Learn more about [Scientific Reports](http://www.nature.com/srep/)\",\"snPcode\":\"\",\"submissionUrl\":\"\",\"title\":\"Scientific Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Scientific Reports\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"76d03379-6164-4cea-abb5-e0f2787199f2\",\"owner\":[],\"postedDate\":\"March 26th, 2026\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"in-revision\",\"subjectAreas\":[{\"id\":65138454,\"name\":\"Health sciences/Cardiology\"},{\"id\":65138455,\"name\":\"Biological sciences/Cell biology\"},{\"id\":65138456,\"name\":\"Biological sciences/Physiology\"}],\"tags\":[],\"updatedAt\":\"2026-05-18T07:40:13+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2026-03-26 11:14:43\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-8757875\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-8757875\",\"identity\":\"rs-8757875\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}