{"paper_id":"1f836fe3-44fa-4c65-b2fe-140212dcb7bb","body_text":"Dual chemo- and photodynamic therapy against DMBA- induced mammary carcinoma in mice using water soluble porphyrin and phthalocyanine photosensitizers | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Dual chemo- and photodynamic therapy against DMBA- induced mammary carcinoma in mice using water soluble porphyrin and phthalocyanine photosensitizers Aya Mokhtar, Tarek Mohamed, Ahmed Osman Eigza, Mohamed E. El-Khouly This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4729891/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Breast cancer ranks as the second most widespread form of cancer globally and holds the highest mortality rate among women. Currently, combination therapy is being actively employed in clinical practice to augment the efficiency of anticancer treatment. Hence, the objective of this study was to assess the therapeutic efficacy of a combination of femtosecond laser-based PDT utilizing two distinct photosensitizers (PSs), zinc phthalocyanine tetrasulfonate (ZnPcS4) and meso-tetrakis(4-N-methylpyridyl) porphine (TMPyP) in conjunction with doxorubicin chemotherapeutic agent, on mammary carcinomas experimentally induced in female mice using 7,12-dimethylbenz (a) anthracene (DMBA). Our results showed the efficiency of the combined therapy for promoting tissue apoptosis and necrosis as evidenced by histopathological observations and the noticeable reduction of Bcl-2 and Ki-67 expression. Moreover, there was a reduction in serum levels of the carcinoma antigen CA15-3 and transforming growth factor beta (TGF-β). Co-treatment of doxorubicin with ZnPcS4-PDT or TMPyP-PDT or a combination of both resulted in a decrease in the expression of EGFR and its downstream oncogenes NRAS, NF-κB, mTERT, and c-Myc, and an increase in the expression of the caspase-3 apoptotic gene. These results validate the therapeutic potential of combining doxorubicin with photodynamic therapy, highlighting the potential of this co-treatment strategy as a promising alternative for enhancing existing anticancer approaches. Biological sciences/Biotechnology Biological sciences/Cancer Physical sciences/Chemistry Porphyrin Phthalocyanines photodynamic Therapy cancer treatment Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Breast cancer is a significant cause of female mortality globally and accounts for approximately 25% of all female cancers. It ranks as the second most common cancer and the fifth leading cause of cancer-related deaths worldwide. In 2020, there were approximately 2.3 million new cases of breast cancer diagnosed worldwide, and around 685,000 people died from this disease. 1 The anthracycline doxorubicin (DOXO) is a commonly used chemotherapeutic agent in the treatment of breast cancer. Doxorubicin exhibits various cytotoxic mechanisms, including inhibition of DNA and RNA synthesis, inhibition of topoisomerase II, and the formation of free radicals. 2 Unfortunately, chemotherapy is associated with several limitations, such as significant side effects due to non-specificity, systemic toxicity, and the development of drug resistance. 3 Combining chemotherapy with non-invasive therapeutic modalities such as photodynamic therapy can enhance treatment effectiveness, allow for the use of lower doses of chemotherapy, and reduce toxicity. Photodynamic therapy (PDT) is a therapeutic technique that selectively eliminates cancer cells through a dynamic interaction between a photosensitizer (PS), light with a certain wavelength, and molecular oxygen. 4 When the photosensitizer (PS) absorbs appropriate radiation, it can be excited from its ground state to a short-lived excited singlet state. From there, it can undergo a process called intersystem crossing, which involves a transition to a long-lived triplet state. In the triplet state, the photosensitizer has sufficient time to transfer energy to nearby biomolecules (Type I reaction) or molecular oxygen (Type II reaction), leading to the generation of reactive oxygen species (ROS) such as free radicals or highly reactive singlet oxygen. 5 The ROS generated by PDT can then induce severe oxidative damage and ultimately apoptosis and/or necrosis of the PS-containing cells. 6 While a variety of light sources can be used for PDT, including lasers, light-emitting diodes (LEDs), and lamps, pulsed femtosecond lasers have shown promise as a potential light source for this application. 7 The pulsed femtosecond laser possesses several advantages, rendering it more favorable for PDT. Firstly, femtosecond lasers possess a wide array of adjustable wavelengths, a critical feature for optimizing experimental variables and attaining desired outcomes. Secondly, their ability to generate very high intensities using minimal energy results in a precise concentration of energy in targeted samples. Thirdly, the ultrashort pulse duration of femtosecond lasers can induce non-thermal effects in the target tissue. This can reduce the potential for heat-induced damage and improve the selectivity and efficacy of PDT. 8 Porphyrin and phthalocyanine derivatives have emerged as promising candidates for second-generation photosensitizing drugs, most notably in the field of photodynamic therapy (PDT). 9 Among these derivatives, α,β,χ,δ porphyrin-Tetrakis (1-methylpyridinium-4-yl) p-Toluenesulfonate porphyrin (TMPyP) stands out with its water-soluble and cationic nature. 10 TMPyP has demonstrated high singlet oxygen generation in phosphate-buffered solution, with a quantum yield (Φ) of 0.77, showcasing its potency as a photosensitizer. TMPyP has a strong Soret band around 420 nm and Q bands in the red region, making it suitable for photodynamic therapy (PDT) in deeper tissues. 10 On a parallel note, zinc (II) tetrasulfonated phthalocyanine (ZnPcS 4 ) has emerged as a compelling photosensitizer in the realm of PDT for cancer treatment. ZnPcS 4 's tetrasulfonated nature makes it water-soluble for easy administration and systemic distribution. 11 Research studies have highlighted its unique capacity to efficiently bind to cancer tumor phospholipid membranes through metal–phosphate coordination. 12,13 This specific interaction allows ZnPcS 4 to selectively accumulate in tumor tissues, enhancing its efficacy as a targeted therapeutic agent. 11 The utilization of ZnPcS 4 and TMPyP in photodynamic therapy (PDT) has been extensively studied in the context of cancer, showing encouraging outcomes (Fig. 1 ). However, their application in combination with chemotherapeutic agents within in vivo models for breast cancer has not been thoroughly investigated. Consequently, this study aimed to investigate the effectiveness of Femtosecond laser-based photodynamic therapy using ZnPcS 4 and TMPyP as photosensitizers, alongside doxorubicin as a chemotherapeutic agent for achieving chemo-photodynamic combined therapy. Furthermore, investigating the molecular effect of this integrated therapy on the expression of epidermal growth factor receptor (EGFR) and its downstream genes, including NRAS, NF-kB, c-Myc, and hTERT which are involved in the tumorigenesis of breast cancer, and its aggressiveness. Methodology Chemical materials DMBA (7,12-dimethyl benzanthracene) was obtained from Sigma Chemicals. The hydrophilic photosensitizers zinc phthalocyanine tetrasulfonic acid (ZnPcS 4 ) and α,β,χ,δ porphyrin-Tetrakis (1-methylpyridinium-4-yl) p-Toluenesulfonate porphyrin (TMPyP) were purchased from Sigma-Aldrich. Adricin (doxorubicin HCL solution) was from Hikma Specialized Pharmaceuticals (Cairo, Egypt). All other chemicals were of reagent grade. Optimization and Setup of Femtosecond Laser System Photodynamic therapy was performed on mice with DMBA-induced breast cancer using a 690 nm femtosecond laser with an average output of 300 mW. The INSPIRE HF100 laser system was utilized to emit laser pulses powered by a mode-locked femtosecond Ti: sapphire MAI TAI HP laser (Spectra-Physics). The laser system has an average power of approximately 1.5–2.9 W, a repetition rate of 80 MHz, and emits light with wavelengths spanning from 690 to 1040 nm. As shown in Fig. 2 , we employed a beam expander consisting of two converging lenses to expand the initial laser beam from a diameter of around 2 mm to a diameter of 1 cm, covering the entire region of the breast tissue. In addition, highly reflective mirrors were employed to direct the laser beam towards the target tissue. A laser beam attenuator (A) was also employed to adjust the laser intensity provided to the breast tissue, as shown in Fig. 2 . The power meter (Newport 843R) was used for measuring the ultimate laser beam power. Animals Sixty healthy Swiss female albino mice (average weight 25 ± 3 g) were obtained from the National Research Centre, Cairo, Egypt. All mice were maintained in clean cages under typical laboratory conditions of room temperature (22 ± 3°C) and light (12 h of light and 12 h of darkness). They were supplied with access to a standard pellet diet and a loose approach to water. Ethical approval The experimental protocol was approved by the Research Ethics Committee for Animal Research at the National Hepatology and Tropical Medicine Research Institute (NHTMRI), approval No. A1-2024. This study was reported according to ARRIVE guidelines and animal handling and experiments were conducted in consonance with the guidelines of the National Institutes of Health (NIH) for animal care and use in experimental procedures. Doses determination Mammary tumors were induced in mice using the carcinogen DMBA (40 mg/kg BW) dissolved in olive oil. The hydrophilic ZnPcS 4 and TMPyP photosensitizers were dissolved in a saline solution at a concentration of 0.5 mg/mL (for a dose of 2 mg/kg body weight) freshly before injection, and 0.1 mL of each photosensitizer solution was calculated to be intravenously injected into the tail vein of a 25-g mouse. The commercial Adricin drug (doxorubicin hydrochloride, 50 mg/25 ml) was intravenously injected at a dose of 3 mg/kg/week diluted in saline. The typical DOXO dose for human breast cancer patients is 40–75 mg/m 2 in combination with other drugs (https://www.drugs.com/dosage/doxorubicin.html; last updated March 14, 2023). The selected DOXO dose of 3 mg/kg/week for two weeks, with a cumulative dose of 6 mg/kg, corresponds to a human dose of 0.48 mg/kg (or 18 mg/m2) [14], which is lower than the usual dosage for breast cancer patients. Experimental design After acclimatization, the 60 mice were divided randomly into the main four groups, and the experimental design is illustrated in Figure 3 as follows: Group I (n = 7): healthy female mice received saline intravenously via the vein tail. Group II (Toxicity, n = 7): healthy female mice were intravenously injected with a combination of Doxorubicin, ZnPcS 4 , and TMPyP at doses of 3 mg/kg, 2 mg/kg, and 2 mg/kg, respectively, once weekly for two weeks via the tail vein. Group III (control, n = 7): normal mice only received olive oil as a vehicle by oral gavage. Group IV (DMBA, n = 39): mice treated with 40 mg/kg of DMBA dissolved in olive oil by oral gavage once a week for 5 weeks. Following a 10-week period since the last dose of DMBA, the existence of breast tumors was verified through histopathological examination of breast tissues from three DMBA-treated mice. Subsequently, the remaining DMBA-treated mice were randomly divided into five subgroups (n = 7 each) as follows: Group A (DMBA): The DMBA-treated control group did not receive any treatment (no drug or light). Group B (DOXO only): DMBA-treated mice were given 3 mg/kg of Doxorubicin once per week for two weeks (for a cumulative dose of 6 mg/kg). Group C (ZnPcS4-PDT+DOXO): DMBA-treated mice were given 2 mg/kg of ZnPcS 4 and 3 mg/kg of Doxorubicin once per week for two weeks. Group D (TMPyP-PDT+DOXO): DMBA-treated mice were given 2 mg/kg of TMPyP and 3 mg/kg of Doxorubicin once per week for two weeks. Group E (ZnPcS4/TMPyP-PDT + DOXO): DMBA-treated mice were given ZnPcS4 and TMPyP at a dose of 2 mg/kg BW, along with 3 mg/kg of Doxorubicin, once per week for two weeks. Regarding PDT-mediated treatment groups (C, D, and E), laser exposure was performed 24 hours after each IV injection of photosensitizers. The animals in these groups were anesthetized with ketamine/xylazine (80/10 mg/kg), and breast tissues were irradiated with a femtosecond pulsed 690-nm laser with a power of 300 mW and an exposure time of 5 min (115 J/cm2). The mice in groups A and B were anesthetized without being exposed to the laser. Animal blood and tissue harvesting After 2 days of the last laser dose, all animals were anesthetized by diethyl ether. Blood samples were collected by cardiac puncture from mice, and serum samples were separated. Afterwards, the animals were euthanized via cervical dislocation under diethyl ether anesthesia, and mammary glands from healthy mice (Group III) and mammary tumors from subgroups of Group IV were collected. Toxicity assessment An approximate 1 mL portion of blood from healthy mice injected with either saline (group I) or a mixture of Doxorubicin + ZnPcS 4 + TMPyP (group II) was collected for a blood chemistry test and complete blood count (CBC) analysis before euthanasia. Hepatotoxicity was assessed by recording the activity of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) using commercial colorimetric assay kits (Spectrum, Egypt). In addition, the serum levels of renal function markers, including urea and creatinine, were measured using commercially available kits from Abcam (UK) and Biodiagnostic (Egypt), respectively. TGF-β and CA 15-3 enzyme-linked immunoassay (ELISA) Blood samples for transforming growth factor beta (TGF-β) and carcinoma antigen 15-3 (CA 15-3) were collected from the control group (Group III) and all DMBA subgroups (untreated and treated) in a clot activator vacutainer for serum separation. The serum was separated immediately by centrifugation and stored at -80°C. Sera was only thawed once, just before the analysis. The serum levels of TGF-β and CA 15-3 were analyzed using a sandwich enzyme-linked immunosorbent assay method using TGF-β1 (MyBioSorces, USA) and CA 15-3 (LSBio, USA) ELISA kits. The analysis was conducted according to the manufacturer’s methodology. The reaction was halted by the addition of a stop solution; absorbance is quantified at 450 nm utilizing a Microplate Reader Spectrophotometer (Thermo Scientific). The absorbance is directly proportional to the quantity of TGF-β and CA 15-3 present in each sample. A standard curve was generated by plotting the relative absorbance of each standard solution versus its respective concentration. Histology examination and immunohistochemistry For histological analysis, mammary glands were harvested from euthanized mice 48 hours after the last light dose and preserved in 10% formalin, followed by embedding in paraffin. Tissue sections were dewaxed in xylene, rehydrated by gradient ethanol, rinsed with distilled water, and then stained with hematoxylin and eosin (H&E). After staining, the slices were dehydrated with increasing concentrations of ethanol and xylene. The morphological images of the tissues were captured using a Leica fluorescence microscope. The immunohistochemical staining was performed with rabbit anti-ki-67 (ab833; Abcam) and anti-Bcl2 (ab182858; Abcam) antibodies, diluted at a ratio of 1:100. The reactions were identified by utilizing horseradish peroxidase-conjugated goat anti-rabbit IgG (Santa Cruz, USA), and the color was generated using 3,3-diaminobenzidine tetrahydrochloride (DAB, Santa Cruz, USA) and halted by rinsing in deionized water followed by microscopy. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Total RNA was isolated from mammary glands and tumors using TRIzol reagent (Thermo Fisher Scientific, USA) following the instructions provided by the manufacturer. The concentration, purity, and integrity of the isolated purified total RNA were assessed by measuring the absorbance at A260 nm/A280 nm using Nanodrop. Complementary DNA was synthesized using High-Capacity cDNA reverse transcription kit (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. Finally, the cDNA was employed for fluorescence-based relative quantitative PCR using SYBR Green qPCR Master Mix (Thermo Fisher Scientific, USA) to detect the relative mRNA expression of EGFR, NRAS, NF-κB, mTERT, c-Myc, and Caspase-3 normalized with GABDH as a housekeeping gene. The gene-specific primers were designed using the IDT-PrimerQuest tool ((http://eu.idtdna.com/primerquest/ home/index) and validated using the IDT-OligoAnalyzer Tool (https://www.idtdna.com/calc/analyzer) to analyze their melting temperature (Tm), guanine and cytosine content (percent GC), primer hairpin (ΔG), and primer dimerization (ΔG). The primers sequences are listed in Table 1. The RT-PCR reaction was prepared in a final volume of 25 µL by mixing 2 µL of each cDNA sample (diluted 1:5), 12.5 µL of SYBR Green, 1 µL of each primer, and 0.05 µL of ROX solution, and the final volume was adjusted through the addition of nuclease-free water. The amplification program was adjusted as follows: initial denaturation step for 10 min at 95°C, followed by 40 cycles (denaturation at 94°C for 15 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec). Melting curves were performed by rapid heating to 95°C for 15 sec to denature the DNA, followed by cooling to 60°C to assure the purity and specificity of the amplified products. The relative quantification of mRNA was calculated using the comparative CT method (n = 2 – ΔΔ Ct ). Table 1 : The primer sequences used in quantitative real-time PCR. Gene Forward primer (5’-3’) Reverse primer (5’-3’) EGFR ACTGCTGGTGTTGCTGACCG GTTGGGTGAGCCTGTTACTT NRAS GCCTTGACGATCCAGCTAAT CCATCAATCACCACTTGCTTTC NF-κB CATCCTCGTCCGCCTATTAC CCCAATTCTCCAATCCTCTCTC mTERT TACATCACAGAGAGCACATTCC CTCAAGGTGTTGCCTGACT c-Myc TCCTTTGGGCGTTGGAAA CGCAGATGAAATAGGGCTGTA Caspase-3 GTGTGCGAGATGAGGTGTT TTCTTAGCGTACCGTTCCAAG GAPDH TGAGCCTCCTCCAATTCAACC AAATCCGTTCACACCGACCT Statistical analysis Data are presented as mean ± standard error of the mean (SEM). All the data were tested for normality of distribution using the Shapiro-Wilk test. Statistical analysis and multiple comparisons of normally distributed data were performed by one-way ANOVA and Tukey's post-hoc test using the Statistical Package for Social Science version 20 (SPSS software package, Chicago, USA). A P-value of <0.05 was considered statistically significant. Results Optical studies As shown in Figure 4 (Left), the UV-vis absorption spectrum of TMPyP in water exhibited a conventional sharp Soret band resulting from the (S 0 →S 2 ) transition at around 422 nm, as well weak Q-bands at 518, 555, 585, and 650 nm. On the other hand, the absorption spectrum of ZnPcS 4 in methanol exhibited a maximum absorption band at 675 nm, as well several weak absorption bands at 609, 350, and 292 nm. When turning into ZnPcS 4 in an aqueous medium, the absorption spectrum exhibited different features where the maximum absorption bands were recorded at 620, 329, and 291 nm. Such difference in the absorption profiles of ZnPcS 4 in MeOH compared to that of water may rationalized by the monomer of ZnPcS 4 in water, and the aggregated ZnPcS 4 in water. [15]. When turning into the emission studies shown in Figure 4 (right), the fluorescence spectrum of ZnPcS 4 exhibited an emission band of the singlet excited state at 687 nm, while the fluorescence spectrum of H 2 TMPyP exhibited a broad emission band in the range of 600-800 nm with a maximum at 710 nm. Toxicity assessment As shown in Table 2, The injection of doxorubicin + ZnPcS 4 + TMPyP in healthy mice (Group II) did not have a noticeable impact on any of the hematological parameters when compared to the control group (Group I). In addition, no significant difference was observed in serum levels of ALT and AST between healthy mice (Group I) and drugs-injected mice (Group II). Furthermore, the blood urea level in the mice injected with doxorubicin + ZnPcS 4 + TMPyP was comparable to that of the control animals. Nevertheless, the mice injected with doxorubicin + ZnPcS 4 + TMPyP exhibited a significant elevation in creatinine levels when compared to the control mice (P<0.05). Table 2: Effects of Doxorubicin + ZnPcS 4 + TMPyP mixture on hematological and biochemical parameters of healthy Swiss female albino mice Parameters (Unit) Healthy control (Saline) Doxorubicin + ZnPcS4 + TMPyP injected group HGB (g/dl) 13.03 ± 0.51 13.13 ± 1.03 RBC (×10 6 /μL) 7.84 ± 0.23 8.1 ± 0.29 HCT (%) 45.74 ± 0.92 47.12 ± 1.06 MCV (fl) 58.54 ± 1.75 58.81 ± 3.23 MCH (pg) 16.64 ± 0.75 16.45 ± 1.57 MCHC (g/dl) 28.52 ± 1.35 27.75 ± 1.88 Platelets (×10 3 /μL) 532.85 ± 29.89 528.42 ± 25.65 WBC (×10 3 /μL) 5.6 ± 0.57 7.23 ± 1.05 Neutrophils (%) 1.71 ± 0.28 1.85 ± 0.26 Lymphocytes (%) 57.57 ± 4.51 50.57 ± 6.37 Monocytes (%) 3.57 ± 0.36 4.43 ± 0.48 Eosinophils (%) 0.57 ± 0.2 0.86 ± 0.26 AST (IU/L) 60.33 ± 1.04 53.9 ± 2.95 ALT (IU/L) 47.19 ± 2.3 40.19 ± 3.71 Urea (mg/dL) 14.03 ± 1.12 14.41 ± 1.64 Creatinine (mg/dL) 1.17 ± 0.08 2.61 ± 0.37 * Legend: HGB hemoglobin, RBC red blood cells, HCT hematocrit, MCV mean corpuscular volume, MCH mean corpuscular hemoglobin, MCHC mean corpuscular hemoglobin concentration, WBC white blood cells, AST aspartate transaminase, ALT alanine transaminase. Values are represented as mean ± standard error, n=7/group. * Significant (p<0.05) compared to the healthy control group. Effect of Doxorubicin alone and in combination with Photodynamic Therapy on TGF-β and CA 15-3 The serum levels of TGF-β and CA 15-3 showed a statistically significant increase (P<0.0001) in the DMBA group compared to the healthy control group. While treatment of tumor-bearing mice with either doxorubicin alone or in combination with ZnPcS 4 -PDT or TMPyP-PDT, or both, resulted in a significant decrease (P<0.0001) in the levels of TGF-β and CA 15-3 (Figure 5A, B, respectively). Furthermore, a statistically significant decrease (P<0.05) in CA 15-3 level was observed in the group that received combined therapy of ZnPcS 4 /TMPyP-PDT+DOXO compared to the group treated with doxorubicin monotherapy ( Figure 5B ). Histopathological examination Histological analysis of the mammary gland of healthy mice showed well-defined ducts lined by inner cuboidal epithelial cells and outer myoepithelial cells, along with average stroma, blood vessels, and fibrofatty tissue (Figure 6A). The mammary gland of the positive control DMBA group exhibited a hypercellular tumor consisting of pleomorphic spindle cells distinct from the original parenchyma with numerous mitotic figures and dispersed cytoplasmic vacuoles (Figure 6B). The mammary tissues of all treatment groups displayed tumor cells with significantly vacuolated cytoplasm (Figure 6 C—F). The doxorubicin-treated group exhibited mild apoptosis (Figure 6C), whereas the combination with ZnPcS 4 -PDT, TMPyP-PDT, or both, resulted in significant apoptosis (Figure 6 D—F, respectively). Furthermore, there was noticeable necrosis and scattered giant cells in the groups that were treated with either doxorubicin alone or TMPyP-PDT+DOXO (Figs. 6C and E, respectively). The ZnPcS 4 /TMPyP-PDT+DOXO-treated group showed a hypocellular tumor composed of mildly pleomorphic spindle cells with marked apoptosis, markedly vacuolated cytoplasm, and mildly dilated congested blood vessels (Figure 6F). Immunohistochemistry analysis of Bcl-2 and Ki-67 Immunostaining was performed on the mammary glands of the studied groups using two markers: Bcl-2, an anti-apoptotic marker, and Ki-67, a proliferation marker. The reactivity of Bcl-2 was assessed and classified into four categories: negative (0), weakly positive (+), moderately positive (++), or strongly positive (+++). The control group showed weak cytoplasmic reactivity (+) for Bcl-2 in the ductal epithelium, while the untreated DMBA group showed strong cytoplasmic reactivity (+++) for Bcl-2 in tumor cells (Figure 7A, B, respectively). For the doxorubicin-treated group, the breast tissue also exhibited a strong cytoplasmic reactivity (+++) for Bcl-2 in tumor cells (Figure 7C). However, in the combination treatment groups, the reactivity of Bcl-2 in the breast tissue varied. In the ZnPcS 4 -PDT+DOXO group, the breast showed a moderate cytoplasmic reactivity (++) for Bcl-2 (Figure 7D), while the TMPyP-PDT+DOXO and ZnPcS 4 /TMPyP-PDT+DOXO groups showed a weak reactivity (+) for Bcl-2 in tumor cells (Figure 7E, F). On the other hand, Ki-67 positivity was evaluated based on the percentage of positive cells and categorized into four degrees: (-) < 24%, (+) 25%–50% (Isolated), (++) 51%–74% (Focal) or (+++) > 75% (Diffuse) (Mocanu et al., 2012). The control group showed negative (-) Ki-67 reactivity in the ductal epithelium, while the untreated DMBA group showed diffuse nuclear reactivity (+++) for Ki-67 in tumor cells (Figure 7G, H, respectively). Also, the DMBA groups treated with doxorubicin, ZnPcS4-PDT+DOXO, or TMPyP-PDT+DOXO were very similar to the untreated DMBA control, with diffuse nuclear reactivity (+++) for Ki-67 in tumor cells (Figs. 7I, J, and K, respectively). A significant finding was observed in mice treated with ZnPcS 4 /TMPyP-PDT+DOXO, as the breast tissue showed isolated reactivity (+) for Ki-67 tumor cells (Figure 7L). Gene expression pattern The RT-qPCR assay was performed to quantify mRNA expression levels for cell proliferation-related genes (EGFR, NRAS, NF-kB, c-Myc, and mTERT) and one apoptosis-related gene (Caspase-3). The results revealed that the mRNA expression levels of EGFR, NRAS, NF-κB, c-Myc, and mTERT genes were significantly upregulated in breast tumor tissue of the untreated DMBA group relative to the healthy-control group (P<0.001) (Figure 8A—E). Remarkably, the mRNA levels of EGFR, NRAS, NF-κB, and mTERT were significantly reduced (P<0.001) in all treatment groups when compared to the DMBA group that wasn’t treated (Figure 8A, B, C, and E). While their mRNA levels were noticeably lower in the groups that received a combination of Chemotherapy and photodynamic therapy compared to the group treated with doxorubicin alone, this decrease wasn’t statistically significant. On the other hand, the mRNA levels of c-Myc were considerably decreased (P<0.05) only in the groups that received combination therapy, as compared to the DMBA group (Figure 8D). Furthermore, the group treated with ZnPcS 4 /TMPyP-PDT+DOXO showed a significant reduction in c-Myc mRNA levels (P<0.05) compared to the group treated with doxorubicin alone (Figure 8D). Additionally, the Caspase-3 mRNA levels were markedly increased only in the ZnPcS 4 /TMPyP-PDT+DOXO treated group compared to both the DMBA group and the doxorubicin-monotherapy treated group (Figure 8F). Discussion PDT has emerged as an approved therapeutic approach for various types of cancers. It involves the use of a non-toxic photosensitizer, that can be activated by light of a specific wavelength inducing cancer cell death. 16 The combination of PDT with chemotherapy exhibited a synergistic effect on improving the efficacy of cancer therapy as detailed in previous reports. 17,18 Therefore, we designed this study to address the therapeutic effect and potential mechanism of combining PDT with doxorubicin for treating mammary carcinoma chemically induced in Swiss female albino mice. Furthermore, it was reported that the use of two PSs in vivo resulted in an augmented photodynamic therapy (PDT) effect, characterized by a notable reduction in tumor growth relative to tumors treated with single PS PDT. 19,20 So that, to improve the efficiency of PDT in this study, we administrated two different PSs, hydrophilic Zinc (II) tetrasulfonated phthalocyanine (ZnPcS 4 ) and meso-tetra-(4-N-methylpyridyl) porphyrin (TMPyP) into tumor-bearing mice. The medical community is greatly concerned about the systemic toxicity of medications used in cancer treatment when they are administered in living organisms. Consequently, the study involved the measurement of hematology parameters and blood biochemistry in a cohort of healthy mice that were administered doxorubicin and photosensitizers at the exact dosages specified in the treatment protocol. In the present study, it was observed that none of the doses of photosensitizers and doxorubicin promoted statistically significant variations in hematological parameters or serum levels of liver enzymes in comparison to healthy control animals. Furthermore, there was no difference observed in the serum concentration of urea. However, there was a significant difference in the level of creatinine compared to the healthy control group. Based on these findings, the doses of doxorubicin and photosensitizers administrated did not exhibit obvious potential toxicity and may be well-tolerated. The results of the histopathological analysis indicate that the DMBA-induced tumor is malignant and originates from epithelial cells, characterized by pleomorphic spindle cells arranged in a storiform pattern with numerous mitotic figures, which confirms a high grade of malignancy. 21 Our results revealed that the combination of doxorubicin with either ZnPcS 4 -PDT or TMPyP-PDT produced marked apoptosis in tumor tissues. Furthermore, tumors with hypocellular appearance and marked necrosis were observed in mice treated with a combination of doxorubicin and PDT induced by combining the two photosensitizers, ZnPcS 4 and TMPyP. Prior studies have confirmed the synergistic effect of combining photodynamic therapy (PDT) and doxorubicin on inhibiting growth and promoting apoptosis of 4T1 breast cancer cells in vivo. 22,23 Furthermore, it was reported that PDT mediated with combined photosensitizers has shown improved tumor regression, increased tumor necrosis and enhanced overall therapeutic response compared to using a single photosensitizer. 24 Mammary tissue of DMBA-administered mice showed excessive immunoreactivity for anti-apoptotic protein Bcl-2 and the proliferative marker ki-67 in tumor cells that were ameliorated by the combinatorial therapy strategy. Bcl-2 is a major anti-apoptotic protein which promotes cell survival by preventing programmed cell death in various cell types, including cancer cells. 25 Results revealed moderated reactivity for Bcl-2 in ZnPcS 4 -PDT+doxo, while weak reactivity was achieved in the groups treated with TMPyP-PDT+doxo or ZnPcS 4 /TMPyP-PDT+doxo unlike the doxorubicin and untreated control groups which exhibited a strong cytoplasmic reactivity (+++) for Bcl2. Our work was in line with previous study reported that PDT plus Adriamycin combined treatment improved in vivo anticancer effects in 4T1 breast carcinomas via downregulating Bcl-2. 26 Ki-67 expression is closely linked to cancer growth and serves as a reliable predictor of prognosis and outcome in the progression of breast cancer. 27 The immunostaining of ki-67 was significantly reduced only in the breast cancer group treated with a combination of ZnPcS 4 /TMPyP-PDT and doxorubicin, indicating that the combination of doxorubicin with PDT mediated by two PSs is a more effective therapeutic strategy compared to employing each therapy alone. Consistent with our findings, a study showed that the combined therapy of doxorubicin and chlorine e6 nanoparticles plus PDT significantly reduced Ki67 expression in mice with breast cancer. 28 CA15-3 is commonly used as a tumor marker for monitoring tumor progression and treatment response, especially in metastatic breast cancer. 29 In this study, the significant elevation of CA15-3 levels in DMBA-initiated mice indicated the occurrence of breast cancer, while treatment with doxorubicin alone or in combination with PDT resulted in a considerable reduction in CA15-3 levels as compared to the untreated DMBA group. It is noteworthy that a more substantial decrease in CA15-3 levels was observed in the DMBA group treated with doxorubicin and photodynamic therapy (PDT) facilitated by the combination of ZnPcS 4 and TMPyP photosensitizers. We also observed a remarkable impact of doxorubicin alone and in combination with PDT in inhibiting the circulating immunosuppressive cytokine TGF-β which is intricately connected with cancer progression by increasing invasion and metastasis of tumor cells. 30 Serum TGF-β levels were found to be significantly higher in the DMBA group compared to the control group in the current investigation. However, compared to the DMBA group, the serum TGF-β level was considerably lower in all treatment groups. In line with our findings, it has been revealed that the combination of chemotherapy (paclitaxel) and chlorin e6-PDT exhibits the capacity to inhibit the TGF-β signaling pathway in xenograft models. 31 Essential genes were significantly downregulated after treatment with doxorubicin alone or in combination with ZnPcS 4 -PDT or TMPyP-PDT or both: EGFR, NRAS, NF-κB, mTERT and c-Myc. Epidermal growth factor receptor (EGFR) is a transmembrane receptor, characterized as a mediator of a wide variety of signal transduction events that control cell proliferation, migration, and survival. 32 EGFR overexpression has been reported to occur in 16–36% of breast cancers and significantly associated with poor prognosis. 33 Neuroblastoma RAS is an essential downstream GTPase protein of the EGFR activated signaling cascade. Overexpression of wild type N-Ras is responsible for the development and progression of the aggressive Basal Like Breast Cancer. 34 Nuclear factor-kappaB (NFκB) is a transcription factor activated upon EGFR activation and its constitutive expression observed in breast cancer, and is associated with tumor aggressiveness, metastasis, chemo-resistance, and radio-resistance. 35 Telomerase reverse transcriptase (TERT) is an essential enzyme responsible for telomere maintenance and genome stability, and its overexpression detected in more than 90% of tumors. 36 The expression of TERT is regulated by various transcription activators in breast cancer cells, and one of the key activators linked to TERT regulation is the proto-oncogene c-Myc. 37 A previous study has demonstrated that treatment of MDA-MB-231 cells with gefitinib, an inhibitor of the epidermal growth factor receptor (EGFR), resulted in the downregulation of hTERT expression by inhibiting c-Myc. 38 In our study, the mRNA levels of EGFR, NRAS, NF-κB, mTERT and c-Myc were significantly decreased in all treatment groups compared to the untreated DMBA group. Interestingly, the DMBA group treated with ZnPcS 4 /TMPyP-PDT+DOXO showed a significant reduction in c-Myc mRNA levels compared to the group treated with doxorubicin alone. Caspase-3 is one of the main protease enzymes and considered a key player in the apoptotic process and is often used as a marker for apoptotic cell death in experimental studies. In this study the mRNA expression level of Caspase-3 significantly increased only in the DMBA group treated with doxorubicin and PDT mediated by combining ZnPcS 4 and TMPyP. This observation aligns with prior in vitro evidence indicating that the combination administration of 9-hydroxypheophorbide α (9-HPbD)-mediated photodynamic treatment (PDT) and Carboplatin resulted in a more pronounced upregulation of caspase-3 expression compared to each individual therapy. 39 Hence, the observed reduction in EGFR expression levels and its associated downstream target genes, coupled with the upregulation of proapoptotic caspase-3 expression, provide compelling evidence supporting the efficacy of the doxorubicin-photodynamic therapy combination as a potentially effective approach for breast cancer treatment. Conclusion The injection of Doxo + PDT resulted in an anticancer response characterized by apoptosis and necrosis. In addition, we noted a reduction in Bcl-2 and Ki-67 immunostaining, decreased serum levels of CA15-3 and TGF-β, decreased expression of some oncogenes, and an increase in the expression of caspase-3, which is implicated in the apoptosis pathway. Therefore, this combined treatment can significantly inhibit the growth of breast tumors, offering a more favorable outlook compared to existing conventional medicines. Declarations Acknowledgements M.E. El-Khouly gratefully acknowledges the financial support provided by Science, Technology & Innovation Funding Authority (STIFA), Applied Sciences Research Grants, Project no. 46207. Author contributions Aya Mokhtar: Running the experiments, data analysis, writing the manuscript. Tarek Mohamed: Collecting and analysis the data, and writing the manuscript. Ahmed O. Eigza: Conceptualization, methodology writing the manuscript, and supervision. Mohamed E. El-Khouly: Conceptualization, methodology, writing the manuscript, and supervision. Data Availability Statement Data is included within the article Conflict of Interests The author declares no competing interests. References Sung, H., Ferlay, J., Siegel, R.L., Laversanne, M., Soerjomataram, I., Jemal, A. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 71(3), 209–49, (2021). Rawat, P. S., Jaiswal, A., Khurana, A., Bhatti, J. S., Navik, U. Doxorubicin-induced cardiotoxicity: An update on the molecular mechanism and novel therapeutic strategies for effective management. Biomedicine & Pharmacotherapy 139, 111708, (2021). Anand, U., Dey, A., Chandel, A.K.S., Sanyal, R., Mishra, A., Pandey, D.K. Cancer chemotherapy and beyond: Current status, drug candidates, associated risks and progress in targeted therapeutics. Genes and Diseases 10 (4), 1367–401, (2023). Rodrigues, J.A., Correia, J.H. Enhanced Photodynamic Therapy: A Review of Combined Energy Sources. Cells 11 (24), 3995, (2022). Przygoda, M., Bartusik-Aebisher, D., Dynarowicz, K., Cieślar, G., Kawczyk-Krupka, A., Aebisher, D. Cellular Mechanisms of Singlet Oxygen in Photodynamic Therapy. International Journal of Molecular Sciences 24 (23), 16890, (2023). Zhao, Y., Ye, X., Xiong, Z., Ihsan, A., Ares, I., Martínez, M., Lopez-Torres, B., Martinez-Larranaga, M.R., Anadon, A., Wang, X., Mart \\:\\text{i} nez, M.A. Cancer Metabolism: The Role of ROS in DNA Damage and Induction of Apoptosis in Cancer Cells. Metabolites 13 (7), 796, (2023). Kars, M.D., Kara, R., Gündoǧdu, Y., Kepceoǧlu, A., Kiliç, H.S. Femtosecond laser induced photodynamic therapy on 5-ALA treated SKMEL-30 cells: An efficient theranostic strategy to combat melanoma. Biomedicine & Pharmacotherapy 68(5), 657–62, (2014). Douplik, A., Saiko, G., Schelkanova, I., Tuchin, V.V. The response of tissue to laser light. Lasers for Medical Applications: Diagnostics. Therapy and Surgery 1 , 47–109, (2013). Janas, K., Boniewska-Bernacka, E., Dyrda, G., Słota, R. Porphyrin and phthalocyanine photosensitizers designed for targeted photodynamic therapy of colorectal cancer. Bioorg. Med. Chem. 30, 115926, (2021). Gamelas, S.R.D., Moura, N.M.M., Habraken, Y., Piette, J., Neves, M.G.P.M.S., Faustino, M.A.F. Tetracationic porphyrin derivatives against human breast cancer. J. Photochem. Photobiol B 222, 112258, (2021). Razlog, R., Kruger, C.A., Abrahamse, H. Cytotoxic Effects of Combinative ZnPcS 4 Photosensitizer Photodynamic Therapy (PDT) and Cannabidiol (CBD) on a Cervical Cancer Cell Line. Int. J. Mol. Sci. 24(7), 6151, (2023). Montaseri, H., Simelane, N.W.N., Abrahamse, H. Zinc Phthalocyanine Tetrasulfonate-Loaded Ag@mSiO 2 Nanoparticles for Active Targeted Photodynamic Therapy of Colorectal Cancer. Frontiers in Nanotechnology 4, (2022). Nkune, N.W., Abrahamse, H. Anti-Hypoxia Nanoplatforms for Enhanced Photosensitizer Uptake and Photodynamic Therapy Effects in Cancer Cells, International Journal of Molecular Sciences 24 (3), 2656, (2023). Nair, A., Jacob, S. A simple practice guide for dose conversion between animals and human. J. Basic Clin. Pharm. 7(2), 27, (2016). Kuznetsova, N.A., Gretsova, N.S., Kalmykova, E.A., Makarova, E.A., Dashkevich, E.S.N., Negrimovskii, V.M., Kaliya, O.L., Luk’yanets, E.A. Relationship Between the Photochemical Properties and Structure of Porphyrins and Related Compounds. Russ. J. Gen. Chem. 70, 133–140, (2000). Kwiatkowski, S., Knap, B., Przystupski, D., Saczko, J., Kędzierska, E., Knap-Czop, K. Photodynamic therapy – mechanisms, photosensitizers and combinations. Biomedicine & Pharmacotherapy 106, 1098–107, (2018). Peng, C.L., Lai, P.S., Lin, F.H., Yueh-Hsiu, W.S., Shieh, M.J. Dual chemotherapy and photodynamic therapy in an HT-29 human colon cancer xenograft model using SN-38-loaded chlorin-core star block copolymer micelles. Biomaterials 30(21), 3614–3625, (2009). Peng, C.L., Shieh, M.J., Tsai, M.H., Chang, C.C., Lai, P.S. Self-assembled star-shaped chlorin-core poly(ɛ-caprolactone)–poly(ethylene glycol) diblock copolymer micelles for dual chemo-photodynamic therapies. Biomaterials 29(26), 3599–608, (2008). Cincotta, L., Szeto, D., Lampros, E., Hasan, T., Cincotta, A.H. Benzophenothiazine and Benzoporphyrin Derivative Combination Phototherapy Effectively Eradicates Large Murine Sarcomas. Photochemistry and Photobiology 63, 229–237, (1996). Peng, Q., Warloe, T., Moan, J., Godal, A., Apricena, F., Giercksky, K.E., Neslan, J.M. Antitumor Effect of 5-Aminolevulinic Acid-mediated Photodynamic Therapy Can Be Enhanced by the Use of a Low Dose of Photofrin in Human Tumor Xenografts. Cancer Research 61, 5824–5832, (2001). Costa, I., Solanas, M., Escrich, E. Histopathology and characterization of mammary neoplastic lesions induced with 7,12 dimethylbenz(alpha)anthracene in the rat: a comparative analysis with human breast tumors. Arch. Pathol. Lab. Med. 126, 915–927, (2002). Tong, Z.S., Miao, P.T., Liu, T.T., Jia, Y.S., Liu, X.D. Enhanced antitumor effects of BPD-MA-mediated photodynamic therapy combined with adriamycin on breast cancer in mice. Acta Pharmacol. Sin. 33(10), 1319–24, (2012). Cabral, Á.S., Leonel, E.C.R., Candido, N.M., Piva, H.L., de Melo, M.T., Taboga, S.R., Rahal, P., Tedesco, A.C., Calmon, M.F. Combined photodynamic therapy with chloroaluminum phthalocyanine and doxorubicin nanoemulsions in breast cancer model. J. Photochem. Photobiol. B. 218, 112181, (2021). Acedo, P., Stockert, J.C., Cañete, M., Villanueva, A. Two combined photosensitizers: A goal for more effective photodynamic therapy of cancer. Cell Death Dis. 5(3), e1122, (2014). Ebrahim, A.S., Sabbagh, H., Liddane, A., Raufi, A., Kandouz, M., Al-Katib, A. Hematologic malignancies: newer strategies to counter the BCL-2 protein. Journal of Cancer Research and Clinical Oncology 142 (9), 2013–2022, (2016). Tong, Z.S., Miao, P.T., Liu, T.T., Jia, Y.S., Liu, X.D. Enhanced antitumor effects of BPD-MA-mediated photodynamic therapy combined with adriamycin on breast cancer in mice. Acta Pharmacol Sin. 33(10), 1319–24, (2012). Davey, M.G., Hynes, S.O., Kerin, M.J., Miller, N., Lowery, A.J. Ki-67 as a Prognostic Biomarker in Invasive Breast Cancer. Cancers 13 (17), 4455, (2021). Hu, D., Chen, L., Qu, Y., Peng, J., Chu, B., Shi, K., Hao, Y., Zhong, L.M., Wang, M., Qian, Z. (2018) Oxygen-generating Hybrid Polymeric Nanoparticles with Encapsulated Doxorubicin and Chlorin e6 for Trimodal Imaging-Guided Combined Chemo-Photodynamic Therapy. Theranostics 8(6), 1558–1574, (2018). Duffy, M.J., Evoy, D., McDermott, E.W. CA 15 – 3: Uses and limitation as a biomarker for breast cancer. Clinica Chimica Acta. 411(23–24), 1869–1874, (2010). Batlle, E., Massagué, J. (2019) Transforming Growth Factor-β Signaling in Immunity and Cancer. Immunity 50 (4), 924–940, (2019). Tan, P., Cai, H., Wei, Q., Tang, X., Zhang, Q., Kopytynski, M., Yang, J., Yi, Y., Zhang, H., Gong, Q., Gu, Z., Chen, E., Luo, K. Enhanced chemo-photodynamic therapy of an enzyme-responsive prodrug in bladder cancer patient-derived xenograft models. Biomaterials 277, 121061, (2021). Ali, R., Wendt, M.K. The paradoxical functions of EGFR during breast cancer progression. Signal Transduct Target Ther. 2, 16042, (2017). Bhargava, R., Gerald, W.L., Li, A.R., Pan, Q., Lal, P., Ladanyi, M., Chen, B. EGFR gene amplification in breast cancer: correlation with epidermal growth factor receptor mRNA and protein expression and HER-2 status and absence of EGFR-activating mutations. Modern Pathology 18(8), 1027–1033, (2005). Zheng, Z.Y., Tian, L., Bu, W., Fan, C., Gao, X., Wang, H., Liao, Y.H., Li, Y., Lwis, M.T., Edwards, D., Zwaka, T.P., Hilsenbeck, S.G., Medina, D., Perou, C.M., Creighton, C.J., Zhang, Z.H.F., Chang, E.C. Wild-Type N-Ras, overexpressed in Basal-like Breast Cancer, Promotes Tumor Formation by Inducing IL-8 Secretion via JAK2 Activation. Cell Rep. 12(3), 511–524, (2015). Wang, W., Nag, S.A., Zhang, R. Targeting the NFKB Signaling Pathways for Breast Cancer Prevention and Therapy. Current Medicinal Chemistry 22, 264–289, (2015). Yang, R., Han, Y., Guan, X., Hong, Y., Meng, J., Ding, S., Long, Q., Yi, W. Regulation and clinical potential of telomerase reverse transcriptase (TERT/hTERT) in breast cancer. Cell Communication and Signaling 23 (21), 218, (2023). Dratwa, M., Wysoczańska, B., Wysoczańska, W., Łacina, P., Kubik, T., Bogunia-Kubik, K. TERT-Regulation and Roles in Cancer Formation. Front. Immunol. 19, 589929, (2020). Moon, D.O., Kim, M.O., Heo M.S., Lee, J.D., Choi, Y.H., Kim, G.Y. Gefitinib induces apoptosis and decreases telomerase activity in MDA-MB-231 human breast cancer cells. Arch Pharm Res. 32(10), 1351–60, (2009). He, P., Ahn, J.C., Shin, J.I., Hwang, H.J., Kang, W., Lee, S.J., Chung, P.S. Enhanced apoptotic effect of combined modality of 9-hydroxypheophorbide α-mediated photodynamic therapy and carboplatin on AMC-HN-3 human head and neck cancer cells. Oncol Rep. 21(2), 329–334, (2009). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4729891\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Article\",\"associatedPublications\":[],\"authors\":[{\"id\":335637639,\"identity\":\"42b13cd7-0457-412e-a3b5-e22b4fb0b873\",\"order_by\":0,\"name\":\"Aya Mokhtar\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Egypt-Japan University of Science and Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Aya\",\"middleName\":\"\",\"lastName\":\"Mokhtar\",\"suffix\":\"\"},{\"id\":335637640,\"identity\":\"e9e9d8fa-e961-4c1b-9194-9c2049e646f1\",\"order_by\":1,\"name\":\"Tarek Mohamed\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Laser Institute for Research and Applications (LIRA), Beni-Suef University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Tarek\",\"middleName\":\"\",\"lastName\":\"Mohamed\",\"suffix\":\"\"},{\"id\":335637642,\"identity\":\"5acb99c7-31b5-442e-9518-bba3df0e0c3e\",\"order_by\":2,\"name\":\"Ahmed Osman Eigza\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Egypt-Japan University of Science and Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Ahmed\",\"middleName\":\"Osman\",\"lastName\":\"Eigza\",\"suffix\":\"\"},{\"id\":335637643,\"identity\":\"4679e809-f83b-4c13-a8e7-b1ba6ad2d425\",\"order_by\":3,\"name\":\"Mohamed E. El-Khouly\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABP0lEQVRIie2SMUvDQBSAXwhcltiud5zWXyCkBIKQQPGfXAhcl2QVB8FAIVkU13byLxQKzimBZjk6R1zaxbktDpGCeIlUB2PFTTDfcLzH3cd79+4AGhr+JHq5qAAaQjI4hTYAe99JflLUSsFAwlJhv1GM6uQe5SS+mW7yCxvaKuKLdYTdSRY+kZcCOq2cKcvnr4ol5h71RR/IAGXdkVTuRcKpzsAkOVPNwxol9w0aRCkYqRbRg1LJGaeyMXecM0RxrWJug9cUejtlcrfgpGBwJRVtW69YNAhlFRXNKmWMgWPZGDNkFWVVdxdh2f6sr+MUcTKcY3MomGfrHHdHYjmgNROzsmvz0b+0O+04svDq3Dm6jYX7UDjOcSvzpuuiftAl+i44C0F2VT4QgBKq+rfGJz35dZKPTNlTpaGhoeHf8Aarg2czgiY1VQAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Egypt-Japan University of Science and Technology\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Mohamed\",\"middleName\":\"E.\",\"lastName\":\"El-Khouly\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-07-12 11:21:58\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4729891/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4729891/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":62083136,\"identity\":\"8c00dfae-1ae1-465f-90aa-8033309c8a9d\",\"added_by\":\"auto\",\"created_at\":\"2024-08-09 06:09:01\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":110487,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eThe utilized photosensitizers in this study.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4729891/v1/cabce3f71f775bde6464d736.png\"},{\"id\":62083137,\"identity\":\"fb0fa09c-9a99-4483-b85f-2c4a4ea40ee5\",\"added_by\":\"auto\",\"created_at\":\"2024-08-09 06:09:01\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":119262,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eSchematic diagram of the experimental set up for irradiation of tumor-bearing mice with femto-second laser system.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4729891/v1/ec6b38012aab340a248017fa.png\"},{\"id\":62083643,\"identity\":\"f720f145-aa5a-428f-a008-56702fa3f890\",\"added_by\":\"auto\",\"created_at\":\"2024-08-09 06:17:01\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":72345,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eExperimental design and treatment protocol for different groups.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4729891/v1/b9a805e39a31a2323ebcb961.png\"},{\"id\":62083141,\"identity\":\"92f0ff5e-2bb2-4c5e-82c7-fe8f846db38a\",\"added_by\":\"auto\",\"created_at\":\"2024-08-09 06:09:01\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":253289,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e(Left) Absorption spectra of ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e in water and MeOH, as well as TMPyP in water. (Right) Fluorescence spectra of TMPyP (l\\u003csub\\u003eex\\u003c/sub\\u003e = 422 nm) and ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e (l\\u003csub\\u003eex\\u003c/sub\\u003e = 422 nm).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4729891/v1/72426c002839239d113a639f.png\"},{\"id\":62083140,\"identity\":\"06653a29-dff6-4f9c-91fb-4760b2f0f2cc\",\"added_by\":\"auto\",\"created_at\":\"2024-08-09 06:09:01\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":224721,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eLevels of serum TFG-β \\u003cstrong\\u003e(A)\\u003c/strong\\u003e and CA 15-3 \\u003cstrong\\u003e(B)\\u003c/strong\\u003e in the experimental groups. Each value is expressed as mean ± SE. Results are significant at\\u003csup\\u003e\\u003cstrong\\u003e (*) \\u003c/strong\\u003e\\u003c/sup\\u003eP\\u0026lt;0.05 and highly significant at \\u003csup\\u003e\\u003cstrong\\u003e(***) \\u003c/strong\\u003e\\u003c/sup\\u003eP\\u0026lt;0.001. \\u003csup\\u003e\\u003cstrong\\u003e(#)\\u003c/strong\\u003e\\u003c/sup\\u003e Significance versus control group, \\u003csup\\u003e(\\u003c/sup\\u003e\\u003csup\\u003e\\u003cstrong\\u003e*) \\u003c/strong\\u003e\\u003c/sup\\u003eSignificance versus DMBA group, and \\u003csup\\u003e\\u003cstrong\\u003e($)\\u003c/strong\\u003e\\u003c/sup\\u003e significance versus doxorubicin monotherapy group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4729891/v1/bf8b866f484a79f7552b3b6c.png\"},{\"id\":62083644,\"identity\":\"9cf0a3a1-a784-4b30-a15d-7a555b5c31c7\",\"added_by\":\"auto\",\"created_at\":\"2024-08-09 06:17:01\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1644272,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003ePhotomicrographs of histopathological changes in the mammary glands of control and experimental mice (H\\u0026amp;E, ×400). (A) The normal control group showing normal ducts lined by inner cuboidal epithelium (black arrow) and outer myoepithelial layer (blue arrow), alongside average stroma (red arrow). (B) The DMBA control group showing mammary tumor composed of pleomorphic spindle myoepithelial cells arranged in a storiform pattern (black arrow) displaying many mitotic figures (red arrow) and dispersed cytoplasmic vacuoles (blue arrow). (C) Doxorubicin-treated group showing mild apoptosis (black arrow), scattered multinucleated giant cells (blue arrow), and small areas of necrosis (red arrow). (D) ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e-PDT+DOXO-treated group showing a marked apoptosis (black arrow) and markedly vacuolated cytoplasm (red arrows). (E) TMPyP-PDT+DOXO-treated group showing marked apoptosis (black arrow), scattered giant cells (blue arrow), and small areas of necrosis (red arrow). (F) ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e/TMPyP-PDT+DOXO-treated group showing hypocellular tumor with marked apoptosis (black arrow), markedly vacuolated cytoplasm (blue arrow), and mildly congested blood vessels (red arrow).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4729891/v1/89a20ea018a02c8ca23c43b3.png\"},{\"id\":62083980,\"identity\":\"277703d1-bb72-44b0-b435-4a87c80a33a9\",\"added_by\":\"auto\",\"created_at\":\"2024-08-09 06:25:01\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1583296,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eImmunohistochemical stain for Bcl-2 (A—F, red arrows) and Ki-67 (G—L, red arrows) in the mammary glands of experimental groups (×400). \\u003cstrong\\u003e(A)\\u003c/strong\\u003e The control group showing weak cytoplasmic reactivity (+) for Bcl-2 in the ductal epithelium, while \\u003cstrong\\u003e(B)\\u003c/strong\\u003eDMBA and \\u003cstrong\\u003e(C)\\u003c/strong\\u003e Doxorubicin (DOXO) group showing marked cytoplasmic reactivity (+++). \\u003cstrong\\u003e(D)\\u003c/strong\\u003e ZnPcS4-PDT+DOXO group showing moderate cytoplasmic reactivity (++) reactivity for Bcl-2. \\u003cstrong\\u003e(E)\\u003c/strong\\u003e TMPyP-PDT+DOXO and \\u003cstrong\\u003e(F)\\u003c/strong\\u003eZnPcS4/TMPyP-PDT+DOXO groups showing weak cytoplasmic reactivity (+) for Bcl-2. \\u003cstrong\\u003e(G)\\u003c/strong\\u003e The control group showing negative (-) Ki-67 reactivity in the ductal epithelium, whereas \\u003cstrong\\u003e(H) \\u003c/strong\\u003eDMBA, \\u003cstrong\\u003e(I) \\u003c/strong\\u003eDoxorubicin, \\u003cstrong\\u003e(J\\u003c/strong\\u003e) ZnPcS4-PDT+DOXO, and \\u003cstrong\\u003e(K)\\u003c/strong\\u003e TMPyP-PDT+DOXO groups showing diffuse Ki-67 reactivity (+++) in tumor cells. \\u003cstrong\\u003e(L)\\u003c/strong\\u003e The ZnPcS4/TMPyP-PDT+DOXO group showing isolated reactivity (+) for ki-67 in tumor cells.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4729891/v1/34d6e6d31969e68562925550.png\"},{\"id\":62083138,\"identity\":\"2d0f7401-5b95-4350-b0ef-b9c1672316f7\",\"added_by\":\"auto\",\"created_at\":\"2024-08-09 06:09:01\",\"extension\":\"png\",\"order_by\":8,\"title\":\"Figure 8\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":185467,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eEffect of photodynamic therapy, chemotherapy, and their combination on mRNA expression levels of the cell proliferation-related genes (EGFR, NRAS, NF-kB, mTERT and c-Myc) and apoptosis-related gene (Caspase3) assessed by qRT-PCR in the mammary tissues and tumor tissues of mice in the experimental groups. Bars represent means ± SEM, as determined via One-Way ANOVA test. Results are significant at P≤0.05 and highly significant at P≤0.001. \\u003csup\\u003e\\u003cstrong\\u003e(#) \\u003c/strong\\u003e\\u003c/sup\\u003eSignificance versus control group, \\u003csup\\u003e\\u003cstrong\\u003e(*)\\u003c/strong\\u003e\\u003c/sup\\u003e Significance versus DMBA group, and \\u003csup\\u003e\\u003cstrong\\u003e($)\\u003c/strong\\u003e\\u003c/sup\\u003e Significance versus doxorubicin monotherapy group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image8.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4729891/v1/787db8e472f210ac0c0f05aa.png\"},{\"id\":66522889,\"identity\":\"f763ec24-9277-4831-a225-cfaab1730733\",\"added_by\":\"auto\",\"created_at\":\"2024-10-14 04:16:56\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":5473511,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4729891/v1/4724bc09-04bc-4f95-9a2e-ac5549198b61.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Dual chemo- and photodynamic therapy against DMBA- induced mammary carcinoma in mice using water soluble porphyrin and phthalocyanine photosensitizers\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eBreast cancer is a significant cause of female mortality globally and accounts for approximately 25% of all female cancers. It ranks as the second most common cancer and the fifth leading cause of cancer-related deaths worldwide. In 2020, there were approximately 2.3\\u0026nbsp;million new cases of breast cancer diagnosed worldwide, and around 685,000 people died from this disease.\\u003csup\\u003e1\\u003c/sup\\u003e The anthracycline doxorubicin (DOXO) is a commonly used chemotherapeutic agent in the treatment of breast cancer. Doxorubicin exhibits various cytotoxic mechanisms, including inhibition of DNA and RNA synthesis, inhibition of topoisomerase II, and the formation of free radicals.\\u003csup\\u003e2\\u003c/sup\\u003e Unfortunately, chemotherapy is associated with several limitations, such as significant side effects due to non-specificity, systemic toxicity, and the development of drug resistance.\\u003csup\\u003e3\\u003c/sup\\u003e Combining chemotherapy with non-invasive therapeutic modalities such as photodynamic therapy can enhance treatment effectiveness, allow for the use of lower doses of chemotherapy, and reduce toxicity.\\u003c/p\\u003e \\u003cp\\u003ePhotodynamic therapy (PDT) is a therapeutic technique that selectively eliminates cancer cells through a dynamic interaction between a photosensitizer (PS), light with a certain wavelength, and molecular oxygen.\\u003csup\\u003e4\\u003c/sup\\u003e When the photosensitizer (PS) absorbs appropriate radiation, it can be excited from its ground state to a short-lived excited singlet state. From there, it can undergo a process called intersystem crossing, which involves a transition to a long-lived triplet state. In the triplet state, the photosensitizer has sufficient time to transfer energy to nearby biomolecules (Type I reaction) or molecular oxygen (Type II reaction), leading to the generation of reactive oxygen species (ROS) such as free radicals or highly reactive singlet oxygen.\\u003csup\\u003e5\\u003c/sup\\u003e The ROS generated by PDT can then induce severe oxidative damage and ultimately apoptosis and/or necrosis of the PS-containing cells.\\u003csup\\u003e6\\u003c/sup\\u003e\\u003c/p\\u003e \\u003cp\\u003eWhile a variety of light sources can be used for PDT, including lasers, light-emitting diodes (LEDs), and lamps, pulsed femtosecond lasers have shown promise as a potential light source for this application.\\u003csup\\u003e7\\u003c/sup\\u003e The pulsed femtosecond laser possesses several advantages, rendering it more favorable for PDT. Firstly, femtosecond lasers possess a wide array of adjustable wavelengths, a critical feature for optimizing experimental variables and attaining desired outcomes. Secondly, their ability to generate very high intensities using minimal energy results in a precise concentration of energy in targeted samples. Thirdly, the ultrashort pulse duration of femtosecond lasers can induce non-thermal effects in the target tissue. This can reduce the potential for heat-induced damage and improve the selectivity and efficacy of PDT.\\u003csup\\u003e8\\u003c/sup\\u003e\\u003c/p\\u003e \\u003cp\\u003ePorphyrin and phthalocyanine derivatives have emerged as promising candidates for second-generation photosensitizing drugs, most notably in the field of photodynamic therapy (PDT).\\u003csup\\u003e9\\u003c/sup\\u003e Among these derivatives, α,β,χ,δ porphyrin-Tetrakis (1-methylpyridinium-4-yl) p-Toluenesulfonate porphyrin (TMPyP) stands out with its water-soluble and cationic nature.\\u003csup\\u003e10\\u003c/sup\\u003e TMPyP has demonstrated high singlet oxygen generation in phosphate-buffered solution, with a quantum yield (Φ) of 0.77, showcasing its potency as a photosensitizer. TMPyP has a strong Soret band around 420 nm and Q bands in the red region, making it suitable for photodynamic therapy (PDT) in deeper tissues.\\u003csup\\u003e10\\u003c/sup\\u003e On a parallel note, zinc (II) tetrasulfonated phthalocyanine (ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e) has emerged as a compelling photosensitizer in the realm of PDT for cancer treatment. ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e's tetrasulfonated nature makes it water-soluble for easy administration and systemic distribution.\\u003csup\\u003e11\\u003c/sup\\u003e Research studies have highlighted its unique capacity to efficiently bind to cancer tumor phospholipid membranes through metal\\u0026ndash;phosphate coordination.\\u003csup\\u003e12,13\\u003c/sup\\u003e This specific interaction allows ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e to selectively accumulate in tumor tissues, enhancing its efficacy as a targeted therapeutic agent.\\u003csup\\u003e11\\u003c/sup\\u003e\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe utilization of ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e and TMPyP in photodynamic therapy (PDT) has been extensively studied in the context of cancer, showing encouraging outcomes (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e). However, their application in combination with chemotherapeutic agents within in vivo models for breast cancer has not been thoroughly investigated. Consequently, this study aimed to investigate the effectiveness of Femtosecond laser-based photodynamic therapy using ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e and TMPyP as photosensitizers, alongside doxorubicin as a chemotherapeutic agent for achieving chemo-photodynamic combined therapy. Furthermore, investigating the molecular effect of this integrated therapy on the expression of epidermal growth factor receptor (EGFR) and its downstream genes, including NRAS, NF-kB, c-Myc, and hTERT which are involved in the tumorigenesis of breast cancer, and its aggressiveness.\\u003c/p\\u003e\"},{\"header\":\"Methodology\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eChemical materials\\u003c/h2\\u003e \\u003cp\\u003eDMBA (7,12-dimethyl benzanthracene) was obtained from Sigma Chemicals. The hydrophilic photosensitizers zinc phthalocyanine tetrasulfonic acid (ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e) and α,β,χ,δ porphyrin-Tetrakis (1-methylpyridinium-4-yl) p-Toluenesulfonate porphyrin (TMPyP) were purchased from Sigma-Aldrich. Adricin (doxorubicin HCL solution) was from Hikma Specialized Pharmaceuticals (Cairo, Egypt). All other chemicals were of reagent grade.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eOptimization and Setup of Femtosecond Laser System\\u003c/h2\\u003e \\u003cp\\u003ePhotodynamic therapy was performed on mice with DMBA-induced breast cancer using a 690 nm femtosecond laser with an average output of 300 mW. The INSPIRE HF100 laser system was utilized to emit laser pulses powered by a mode-locked femtosecond Ti: sapphire MAI TAI HP laser (Spectra-Physics). The laser system has an average power of approximately 1.5\\u0026ndash;2.9 W, a repetition rate of 80 MHz, and emits light with wavelengths spanning from 690 to 1040 nm. As shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, we employed a beam expander consisting of two converging lenses to expand the initial laser beam from a diameter of around 2 mm to a diameter of 1 cm, covering the entire region of the breast tissue. In addition, highly reflective mirrors were employed to direct the laser beam towards the target tissue. A laser beam attenuator (A) was also employed to adjust the laser intensity provided to the breast tissue, as shown in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e. The power meter (Newport 843R) was used for measuring the ultimate laser beam power.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAnimals\\u003c/h2\\u003e \\u003cp\\u003eSixty healthy Swiss female albino mice (average weight 25\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3 g) were obtained from the National Research Centre, Cairo, Egypt. All mice were maintained in clean cages under typical laboratory conditions of room temperature (22\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;3\\u0026deg;C) and light (12 h of light and 12 h of darkness). They were supplied with access to a standard pellet diet and a loose approach to water.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEthical approval\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe experimental protocol was approved by the Research Ethics Committee for Animal Research at the National Hepatology and Tropical Medicine Research Institute (NHTMRI), approval No. A1-2024. This study was reported according to ARRIVE guidelines and animal handling and experiments were conducted in consonance with the guidelines of the National Institutes of Health (NIH) for animal care and use in experimental procedures.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDoses determination\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eMammary tumors were induced in mice using the carcinogen DMBA (40\\u0026nbsp;mg/kg BW) dissolved in olive oil. The hydrophilic ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e and TMPyP photosensitizers were dissolved in a saline solution at a concentration of 0.5 mg/mL (for a dose of 2 mg/kg body weight) freshly before injection, and 0.1 mL of each photosensitizer solution was calculated to be intravenously injected into the tail vein of a 25-g mouse. The commercial Adricin drug (doxorubicin hydrochloride, 50 mg/25 ml) was intravenously injected at a dose of 3 mg/kg/week diluted in saline. The typical DOXO dose for human breast cancer patients is 40\\u0026ndash;75 mg/m\\u003csup\\u003e2\\u003c/sup\\u003e in combination with other drugs (https://www.drugs.com/dosage/doxorubicin.html; last updated March 14, 2023). The selected DOXO dose of 3 mg/kg/week for two weeks, with a cumulative dose of 6 mg/kg, corresponds to a human dose of 0.48 mg/kg (or 18 mg/m2) [14], which is lower than the usual dosage for breast cancer patients.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eExperimental design\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAfter acclimatization, the 60 mice were divided randomly into the main four groups, and the experimental design is illustrated in Figure\\u0026nbsp;3 as follows:\\u003c/p\\u003e\\n\\u003cp\\u003eGroup I (n = 7): healthy female mice received saline intravenously via the vein tail.\\u003c/p\\u003e\\n\\u003cp\\u003eGroup II (Toxicity, n = 7): healthy female mice were intravenously injected with a combination of Doxorubicin, ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e, and TMPyP at doses of 3 mg/kg, 2 mg/kg, and 2 mg/kg, respectively, once weekly for two weeks via the tail vein.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eGroup III (control, n = 7): normal mice only received olive oil as a vehicle by oral gavage.\\u003c/p\\u003e\\n\\u003cp\\u003eGroup IV (DMBA, n = 39): mice treated with 40 mg/kg of DMBA dissolved in olive oil by oral gavage once a week for 5 weeks. Following a 10-week period since the last dose of DMBA, the existence of breast tumors was verified through histopathological examination of breast tissues from three DMBA-treated mice. Subsequently, the remaining DMBA-treated mice were randomly divided into five subgroups (n = 7 each) as follows:\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eGroup A\\u0026nbsp;\\u003c/em\\u003e(DMBA): The DMBA-treated control group did not receive any treatment (no drug or light).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eGroup B (DOXO only):\\u0026nbsp;\\u003c/em\\u003eDMBA-treated mice were given 3 mg/kg of Doxorubicin once per week for two weeks (for a cumulative dose of 6 mg/kg).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eGroup C (ZnPcS4-PDT+DOXO):\\u0026nbsp;\\u003c/em\\u003eDMBA-treated mice were given 2 mg/kg of ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e and 3 mg/kg of Doxorubicin once per week for two weeks.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eGroup D (TMPyP-PDT+DOXO):\\u0026nbsp;\\u003c/em\\u003eDMBA-treated mice were given 2 mg/kg of TMPyP and 3 mg/kg of Doxorubicin once per week for two weeks.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eGroup E (ZnPcS4/TMPyP-PDT + DOXO):\\u0026nbsp;\\u003c/em\\u003eDMBA-treated mice were given ZnPcS4 and TMPyP at a dose of 2 mg/kg BW, along with 3 mg/kg of Doxorubicin, once per week for two weeks.\\u003c/p\\u003e\\n\\u003cp\\u003eRegarding PDT-mediated treatment groups (C, D, and E), laser exposure was performed 24 hours after each IV injection of photosensitizers. The animals in these groups were anesthetized with ketamine/xylazine (80/10 mg/kg), and breast tissues were irradiated with a femtosecond pulsed 690-nm laser with a power of 300 mW and an exposure time of 5 min (115 J/cm2). The mice in groups A and B were anesthetized without being exposed to the laser.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAnimal blood and tissue harvesting\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAfter 2 days of the last laser dose, all animals were anesthetized by diethyl ether. Blood samples were collected by cardiac puncture from mice, and serum samples were separated. Afterwards, the animals were euthanized via cervical dislocation under diethyl ether anesthesia, and mammary glands from healthy mice (Group III) and mammary tumors from subgroups of Group IV were collected.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eToxicity assessment\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAn approximate 1 mL portion of blood from healthy mice injected with either saline (group I) or a mixture of Doxorubicin + ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e + TMPyP (group II) was collected for a blood chemistry test and complete blood count (CBC) analysis before euthanasia. Hepatotoxicity was assessed by recording the activity of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) using commercial colorimetric assay kits (Spectrum, Egypt). In addition, the serum levels of renal function markers, including urea and creatinine, were measured using commercially available kits from Abcam (UK) and Biodiagnostic (Egypt), respectively.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTGF-\\u0026beta; and CA 15-3 enzyme-linked immunoassay (ELISA)\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eBlood samples for transforming growth factor beta (TGF-\\u0026beta;)\\u0026nbsp;and carcinoma antigen 15-3 (CA 15-3) were collected from the control group (Group III) and all DMBA subgroups (untreated and treated) in a clot activator vacutainer for serum separation. The serum was separated immediately by centrifugation and stored at -80\\u0026deg;C. Sera was only thawed once, just before the analysis. The serum levels of TGF-\\u0026beta;\\u0026nbsp;and CA 15-3 were analyzed using a sandwich enzyme-linked immunosorbent assay method using TGF-\\u0026beta;1 (MyBioSorces, USA) and CA 15-3 (LSBio, USA) ELISA kits. The analysis was conducted according to the manufacturer\\u0026rsquo;s methodology. The reaction was halted by the addition of a stop solution; absorbance is quantified at 450 nm utilizing a Microplate Reader Spectrophotometer (Thermo Scientific). The absorbance is directly proportional to the quantity of TGF-\\u0026beta;\\u0026nbsp;and CA 15-3 present in each sample. A standard curve was generated by plotting the relative absorbance of each standard solution versus its respective concentration.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eHistology examination and immunohistochemistry\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFor histological analysis, mammary glands were harvested from euthanized mice 48 hours after the last light dose and preserved in 10% formalin, followed by embedding in paraffin. Tissue sections were dewaxed in xylene, rehydrated by gradient ethanol, rinsed with distilled water, and then stained with hematoxylin and eosin (H\\u0026amp;E). After staining, the slices were dehydrated with increasing concentrations of ethanol and xylene. The morphological images of the tissues were captured using a Leica fluorescence microscope.\\u003c/p\\u003e\\n\\u003cp\\u003eThe immunohistochemical staining was performed with rabbit anti-ki-67 (ab833; Abcam) and anti-Bcl2 (ab182858; Abcam) antibodies, diluted at a ratio of 1:100. The reactions were identified by utilizing horseradish peroxidase-conjugated goat anti-rabbit IgG (Santa Cruz, USA), and the color was generated using 3,3-diaminobenzidine tetrahydrochloride (DAB, Santa Cruz, USA) and halted by rinsing in deionized water followed by microscopy.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eQuantitative Real-Time Polymerase Chain Reaction (qRT-PCR)\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTotal RNA was isolated from mammary glands and tumors using TRIzol reagent (Thermo Fisher Scientific, USA) following the instructions provided by the manufacturer. The concentration, purity, and integrity of the isolated purified total RNA were assessed by measuring the absorbance at A260 nm/A280 nm using Nanodrop. Complementary DNA was synthesized using High-Capacity cDNA reverse transcription kit (Thermo Fisher Scientific, USA) according to the manufacturer\\u0026rsquo;s instructions. Finally, the cDNA was employed for fluorescence-based relative quantitative PCR using SYBR Green qPCR Master Mix (Thermo Fisher Scientific, USA) to detect the relative mRNA expression of EGFR, NRAS, NF-\\u0026kappa;B, mTERT, c-Myc, and Caspase-3 normalized with GABDH as a housekeeping gene. The gene-specific primers were designed using the IDT-PrimerQuest tool ((http://eu.idtdna.com/primerquest/ home/index) and validated using the IDT-OligoAnalyzer Tool (https://www.idtdna.com/calc/analyzer) to analyze their melting temperature (Tm), guanine and cytosine content (percent GC), primer hairpin (\\u0026Delta;G), and primer dimerization (\\u0026Delta;G). The primers sequences are listed in Table 1. The RT-PCR reaction was prepared in a final volume of 25 \\u0026micro;L by mixing 2 \\u0026micro;L of each cDNA sample (diluted 1:5), 12.5 \\u0026micro;L of SYBR Green, 1 \\u0026micro;L of each primer, and 0.05 \\u0026micro;L of ROX solution, and the final volume was adjusted through the addition of nuclease-free water. The amplification program was adjusted as follows: initial denaturation step for 10 min at 95\\u0026deg;C, followed by 40 cycles (denaturation at 94\\u0026deg;C for 15 sec, annealing at 55\\u0026deg;C for 30 sec, and extension at 72\\u0026deg;C for 30 sec). Melting curves were performed by rapid heating to 95\\u0026deg;C for 15 sec to denature the DNA, followed by cooling to 60\\u0026deg;C to assure the purity and specificity of the amplified products. The relative quantification of mRNA was calculated using the comparative CT method (n = 2\\u003csup\\u003e\\u0026ndash;\\u003c/sup\\u003e\\u003csup\\u003e\\u0026Delta;\\u0026Delta;\\u003c/sup\\u003e\\u003csup\\u003eCt\\u003c/sup\\u003e).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 1\\u003c/strong\\u003e: The primer sequences used in quantitative real-time PCR.\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"15.692307692307692%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eGene\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"41.53846153846154%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eForward primer (5\\u0026rsquo;-3\\u0026rsquo;)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"42.76923076923077%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eReverse primer (5\\u0026rsquo;-3\\u0026rsquo;)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"15.692307692307692%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eEGFR\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"41.53846153846154%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eACTGCTGGTGTTGCTGACCG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"42.76923076923077%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGTTGGGTGAGCCTGTTACTT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"15.692307692307692%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNRAS\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"41.53846153846154%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGCCTTGACGATCCAGCTAAT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"42.76923076923077%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCCATCAATCACCACTTGCTTTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"15.692307692307692%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNF-\\u0026kappa;B\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"41.53846153846154%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCATCCTCGTCCGCCTATTAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"42.76923076923077%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCCCAATTCTCCAATCCTCTCTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"15.692307692307692%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003emTERT\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"41.53846153846154%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTACATCACAGAGAGCACATTCC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"42.76923076923077%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCTCAAGGTGTTGCCTGACT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"15.692307692307692%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ec-Myc\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"41.53846153846154%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTCCTTTGGGCGTTGGAAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"42.76923076923077%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCGCAGATGAAATAGGGCTGTA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"15.692307692307692%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eCaspase-3\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"41.53846153846154%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGTGTGCGAGATGAGGTGTT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"42.76923076923077%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTTCTTAGCGTACCGTTCCAAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"15.692307692307692%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eGAPDH\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"41.53846153846154%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTGAGCCTCCTCCAATTCAACC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"42.76923076923077%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAAATCCGTTCACACCGACCT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cbr\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eStatistical analysis\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eData are presented as mean \\u0026plusmn; standard error of the mean (SEM). All the data were tested for normality of distribution using the Shapiro-Wilk test. Statistical analysis and multiple comparisons of normally distributed data were performed by one-way ANOVA and Tukey\\u0026apos;s post-hoc test using the Statistical Package for Social Science version 20 (SPSS software package, Chicago, USA). A P-value of \\u0026lt;0.05 was considered statistically significant.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eOptical studies\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAs shown in Figure 4 (Left),\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003ethe UV-vis absorption spectrum of TMPyP in water exhibited a conventional sharp Soret band resulting from the (S\\u003csub\\u003e0\\u003c/sub\\u003e\\u0026rarr;S\\u003csub\\u003e2\\u003c/sub\\u003e) transition at around 422 nm, as well weak Q-bands at 518, 555, 585, and 650 nm. On the other hand, the absorption spectrum of ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e in methanol exhibited a maximum absorption band at 675 nm, as well several weak absorption bands at 609, 350, and 292 nm. When turning into ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e in an aqueous medium, the absorption spectrum exhibited different features where the maximum absorption bands were recorded at 620, 329, and 291 nm. Such difference in the absorption profiles of ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e in MeOH compared to that of water may rationalized by the monomer of ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e in water, and the aggregated ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e in water. \\u003csup\\u003e[15].\\u003c/sup\\u003e When turning into the emission studies shown in Figure 4 (right), the fluorescence spectrum of ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e exhibited an emission band of the singlet excited state at 687 nm, while the fluorescence spectrum of H\\u003csub\\u003e2\\u003c/sub\\u003eTMPyP exhibited a broad emission band in the range of 600-800 nm with a maximum at 710 nm.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eToxicity assessment\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAs shown in Table 2, The injection of doxorubicin + ZnPcS\\u003csub\\u003e4\\u0026nbsp;\\u003c/sub\\u003e+ TMPyP in healthy mice (Group II) did not have a noticeable impact on any of the hematological parameters when compared to the control group (Group I). In addition, no significant difference was observed in serum levels of ALT and AST between healthy mice (Group I) and drugs-injected mice (Group II). Furthermore, the blood urea level in the mice injected with doxorubicin + ZnPcS\\u003csub\\u003e4\\u0026nbsp;\\u003c/sub\\u003e+ TMPyP was comparable to that of the control animals. Nevertheless, the mice injected with doxorubicin + ZnPcS\\u003csub\\u003e4\\u0026nbsp;\\u003c/sub\\u003e+ TMPyP exhibited a significant elevation in creatinine levels when compared to the control mice (P\\u0026lt;0.05).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 2:\\u003c/strong\\u003e Effects of Doxorubicin + ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e + TMPyP mixture on hematological and biochemical parameters of healthy Swiss female albino mice\\u003c/p\\u003e\\n\\u003ctable border=\\\"0\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eParameters (Unit)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eHealthy control\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e(Saline)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eDoxorubicin + ZnPcS4 + TMPyP injected group\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eHGB (g/dl)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e13.03 \\u0026plusmn; 0.51\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e13.13 \\u0026plusmn; 1.03\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eRBC (\\u0026times;10\\u003csup\\u003e6\\u003c/sup\\u003e/\\u0026mu;L)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e7.84 \\u0026plusmn; 0.23\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e8.1 \\u0026plusmn; 0.29\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eHCT (%)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e45.74 \\u0026plusmn; 0.92\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e47.12 \\u0026plusmn; 1.06\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eMCV (fl)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e58.54 \\u0026plusmn; 1.75\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e58.81 \\u0026plusmn; 3.23\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eMCH (pg)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e16.64 \\u0026plusmn; 0.75\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e16.45 \\u0026plusmn; 1.57\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eMCHC (g/dl)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e28.52 \\u0026plusmn; 1.35\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e27.75 \\u0026plusmn; 1.88\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePlatelets (\\u0026times;10\\u003csup\\u003e3\\u003c/sup\\u003e/\\u0026mu;L)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e532.85 \\u0026plusmn; 29.89\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e528.42 \\u0026plusmn; 25.65\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eWBC (\\u0026times;10\\u003csup\\u003e3\\u003c/sup\\u003e/\\u0026mu;L)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e5.6 \\u0026plusmn; 0.57\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e7.23 \\u0026plusmn; 1.05\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNeutrophils (%)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1.71 \\u0026plusmn; 0.28\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1.85 \\u0026plusmn; 0.26\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eLymphocytes (%)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e57.57 \\u0026plusmn; 4.51\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e50.57 \\u0026plusmn; 6.37\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eMonocytes (%)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e3.57 \\u0026plusmn; 0.36\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e4.43 \\u0026plusmn; 0.48\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eEosinophils (%)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e0.57 \\u0026plusmn; 0.2\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e0.86 \\u0026plusmn; 0.26\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eAST (IU/L)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e60.33 \\u0026plusmn; 1.04\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e53.9 \\u0026plusmn; 2.95\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eALT (IU/L)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e47.19 \\u0026plusmn; 2.3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e40.19 \\u0026plusmn; 3.71\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eUrea (mg/dL)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e14.03 \\u0026plusmn; 1.12\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e14.41 \\u0026plusmn; 1.64\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"35.79454253611557%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eCreatinine (mg/dL)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"30.818619582664528%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1.17 \\u0026plusmn; 0.08\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"33.386837881219904%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e2.61 \\u0026plusmn; 0.37\\u003cstrong\\u003e*\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eLegend:\\u003c/strong\\u003e HGB hemoglobin, RBC red blood cells, HCT hematocrit, MCV mean corpuscular volume, MCH mean corpuscular hemoglobin, MCHC mean corpuscular hemoglobin concentration, WBC white blood cells, AST aspartate transaminase, ALT alanine transaminase. Values are represented as mean \\u0026plusmn; standard error, n=7/group. * Significant (p\\u0026lt;0.05) compared to the healthy control group.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eEffect of Doxorubicin alone and in combination with Photodynamic Therapy on TGF-\\u0026beta; and CA 15-3\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe serum levels of TGF-\\u0026beta; and CA 15-3 showed a statistically significant increase (P\\u0026lt;0.0001) in the DMBA group compared to the healthy control group. While treatment of tumor-bearing mice with either doxorubicin alone or in combination with ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e-PDT or TMPyP-PDT, or both, resulted in a significant decrease (P\\u0026lt;0.0001) in the levels of TGF-\\u0026beta; and CA 15-3 (Figure 5A, B, respectively). Furthermore, a statistically significant decrease (P\\u0026lt;0.05) in CA 15-3 level was observed in the group that received combined therapy of ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e/TMPyP-PDT+DOXO compared to the group treated with doxorubicin monotherapy (\\u003cstrong\\u003eFigure 5B\\u003c/strong\\u003e).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eHistopathological examination\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eHistological analysis of the mammary gland of healthy mice showed well-defined ducts lined by inner cuboidal epithelial cells and outer myoepithelial cells, along with average stroma, blood vessels, and fibrofatty tissue (Figure 6A). The mammary gland of the positive control DMBA group exhibited a hypercellular tumor consisting of pleomorphic spindle cells distinct from the original parenchyma with numerous mitotic figures and dispersed cytoplasmic vacuoles (Figure 6B). The mammary tissues of all treatment groups displayed tumor cells with significantly vacuolated cytoplasm (Figure 6 C\\u0026mdash;F). The doxorubicin-treated group exhibited mild apoptosis (Figure 6C), whereas the combination with ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e-PDT, TMPyP-PDT, or both, resulted in significant apoptosis (Figure 6 D\\u0026mdash;F, respectively). Furthermore, there was noticeable necrosis and scattered giant cells in the groups that were treated with either doxorubicin alone or TMPyP-PDT+DOXO (Figs. 6C and E, respectively). The ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e/TMPyP-PDT+DOXO-treated group showed a hypocellular tumor composed of mildly pleomorphic spindle cells with marked apoptosis, markedly vacuolated cytoplasm, and mildly dilated congested blood vessels (Figure 6F). \\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eImmunohistochemistry analysis of Bcl-2 and Ki-67\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eImmunostaining was performed on the mammary glands of the studied groups using two markers: Bcl-2, an anti-apoptotic marker, and Ki-67, a proliferation marker. The reactivity of Bcl-2 was assessed and classified into four categories: negative (0), weakly positive (+), moderately positive (++), or strongly positive (+++). The control group showed weak cytoplasmic reactivity (+) for Bcl-2 in the ductal epithelium, while the untreated DMBA group showed strong cytoplasmic reactivity (+++) for Bcl-2 in tumor cells (Figure 7A, B, respectively). For the doxorubicin-treated group, the breast tissue also exhibited a strong cytoplasmic reactivity (+++) for Bcl-2 in tumor cells (Figure 7C). However, in the combination treatment groups, the reactivity of Bcl-2 in the breast tissue varied. In the ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e-PDT+DOXO group, the breast showed a moderate cytoplasmic reactivity (++) for Bcl-2 (Figure 7D), while the TMPyP-PDT+DOXO and ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e/TMPyP-PDT+DOXO groups showed a weak reactivity (+) for Bcl-2 in tumor cells (Figure 7E, F).\\u003c/p\\u003e\\n\\u003cp\\u003eOn the other hand, Ki-67 positivity was evaluated based on the percentage of positive cells and categorized into four degrees: (-) \\u0026lt; 24%, (+) 25%\\u0026ndash;50% (Isolated), (++) 51%\\u0026ndash;74% (Focal) or (+++) \\u0026gt; 75% (Diffuse) (Mocanu et al., 2012). The control group showed negative (-) Ki-67 reactivity in the ductal epithelium, while the untreated DMBA group showed diffuse nuclear reactivity (+++) for Ki-67 in tumor cells (Figure 7G, H, respectively). Also, the DMBA groups treated with doxorubicin, ZnPcS4-PDT+DOXO, or TMPyP-PDT+DOXO were very similar to the untreated DMBA control, with diffuse nuclear reactivity (+++) for Ki-67 in tumor cells (Figs. 7I, J, and K, respectively). A significant finding was observed in mice treated with ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e/TMPyP-PDT+DOXO, as the breast tissue showed isolated reactivity (+) for Ki-67 tumor cells (Figure 7L).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eGene expression pattern\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe RT-qPCR assay was performed to quantify mRNA expression levels for cell proliferation-related genes (EGFR, NRAS, NF-kB, c-Myc, and mTERT) and one apoptosis-related gene (Caspase-3). The results revealed that the mRNA expression levels of EGFR, NRAS, NF-\\u0026kappa;B, c-Myc, and mTERT genes were significantly upregulated in breast tumor tissue of the untreated DMBA group relative to the healthy-control group (P\\u0026lt;0.001) (Figure 8A\\u0026mdash;E). Remarkably, the mRNA levels of EGFR, NRAS, NF-\\u0026kappa;B, and mTERT were significantly reduced (P\\u0026lt;0.001) in all treatment groups when compared to the DMBA group that wasn\\u0026rsquo;t treated (Figure 8A, B, C, and E). While their mRNA levels were noticeably lower in the groups that received a combination of Chemotherapy and photodynamic therapy compared to the group treated with doxorubicin alone, this decrease wasn\\u0026rsquo;t statistically significant. On the other hand, the mRNA levels of c-Myc were considerably decreased (P\\u0026lt;0.05) only in the groups that received combination therapy, as compared to the DMBA group (Figure 8D). Furthermore, the group treated with ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e/TMPyP-PDT+DOXO showed a significant reduction in c-Myc mRNA levels (P\\u0026lt;0.05) compared to the group treated with doxorubicin alone (Figure 8D). Additionally, the Caspase-3 mRNA levels were markedly increased only in the ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e/TMPyP-PDT+DOXO treated group compared to both the DMBA group and the doxorubicin-monotherapy treated group (Figure 8F).\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003ePDT has emerged as an approved therapeutic approach for various types of cancers. It involves the use of a non-toxic photosensitizer, that can be activated by light of a specific wavelength inducing cancer cell death.\\u003csup\\u003e16\\u003c/sup\\u003e The combination of PDT with chemotherapy exhibited a synergistic effect on improving the efficacy of cancer therapy as detailed in previous reports.\\u003csup\\u003e17,18\\u003c/sup\\u003e Therefore, we designed this study to address the therapeutic effect and potential mechanism of combining PDT with doxorubicin for treating mammary carcinoma chemically induced in Swiss female albino mice. Furthermore, it was reported that the use of two PSs in vivo resulted in an augmented photodynamic therapy (PDT) effect, characterized by a notable reduction in tumor growth relative to tumors treated with single PS PDT.\\u003csup\\u003e19,20 \\u0026nbsp;\\u003c/sup\\u003eSo that, to improve the efficiency of PDT in this study, we administrated two different PSs, hydrophilic Zinc (II) tetrasulfonated phthalocyanine (ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e) and meso-tetra-(4-N-methylpyridyl) porphyrin (TMPyP) into tumor-bearing mice.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThe medical community is greatly concerned about the systemic toxicity of medications used in cancer treatment when they are administered in living organisms. Consequently, the study involved the measurement of hematology parameters and blood biochemistry in a cohort of healthy mice that were administered doxorubicin and photosensitizers at the exact dosages specified in the treatment protocol. In the present study, it was observed that none of the doses of photosensitizers and doxorubicin promoted statistically significant variations in hematological parameters or serum levels of liver enzymes in comparison to healthy control animals. Furthermore, there was no difference observed in the serum concentration of urea. However, there was a significant difference in the level of creatinine compared to the healthy control group. Based on these findings, the doses of doxorubicin and photosensitizers administrated did not exhibit obvious potential toxicity and may be well-tolerated.\\u003c/p\\u003e\\n\\u003cp\\u003eThe results of the histopathological analysis indicate that the DMBA-induced tumor is malignant and originates from epithelial cells, characterized by pleomorphic spindle cells arranged in a storiform pattern with numerous mitotic figures, which confirms a high grade of malignancy.\\u003csup\\u003e21\\u0026nbsp;\\u003c/sup\\u003eOur results revealed that the combination of doxorubicin with either ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e-PDT or TMPyP-PDT produced marked apoptosis in tumor tissues. Furthermore, tumors with hypocellular appearance and marked necrosis were observed in mice treated with a combination of doxorubicin and PDT induced by combining the two photosensitizers, ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e and TMPyP. Prior studies have confirmed the synergistic effect of combining photodynamic therapy (PDT) and doxorubicin on inhibiting growth and promoting apoptosis of 4T1 breast cancer cells in vivo.\\u003csup\\u003e22,23\\u003c/sup\\u003e Furthermore, it was reported that PDT mediated with combined photosensitizers has shown improved tumor regression, increased tumor necrosis and enhanced overall therapeutic response compared to using a single photosensitizer.\\u003csup\\u003e24\\u003c/sup\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eMammary tissue of DMBA-administered mice showed excessive immunoreactivity for anti-apoptotic protein Bcl-2 and the proliferative marker ki-67 in tumor cells that were ameliorated by the combinatorial therapy strategy. Bcl-2 is a major anti-apoptotic protein which promotes cell survival by preventing programmed cell death in various cell types, including cancer cells.\\u003csup\\u003e25\\u003c/sup\\u003e Results revealed moderated reactivity for Bcl-2 in ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e-PDT+doxo, while weak reactivity was achieved in the groups treated with TMPyP-PDT+doxo or ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e/TMPyP-PDT+doxo unlike the doxorubicin and untreated control groups which exhibited a strong cytoplasmic reactivity (+++) for Bcl2. Our work was in line with previous study reported that PDT plus Adriamycin combined treatment improved in vivo anticancer effects in 4T1 breast carcinomas via downregulating Bcl-2.\\u003csup\\u003e26\\u003c/sup\\u003e Ki-67 expression is closely linked to cancer growth and serves as a reliable predictor of prognosis and outcome in the progression of breast cancer.\\u003csup\\u003e27\\u003c/sup\\u003e The immunostaining of ki-67 was significantly reduced only in the breast cancer group treated with a combination of ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e/TMPyP-PDT and doxorubicin, indicating that the combination of doxorubicin with PDT mediated by two PSs is a more effective therapeutic strategy compared to employing each therapy alone. Consistent with our findings, a study showed that the combined therapy of doxorubicin and chlorine e6 nanoparticles plus PDT significantly reduced Ki67 expression in mice with breast cancer.\\u003csup\\u003e28\\u003c/sup\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCA15-3 is commonly used as a tumor marker for monitoring tumor progression and treatment response, especially in metastatic breast cancer.\\u003csup\\u003e29\\u0026nbsp;\\u003c/sup\\u003eIn this study, the significant elevation of CA15-3 levels in DMBA-initiated mice indicated the occurrence of breast cancer, while treatment with doxorubicin alone or in combination with PDT resulted in a considerable reduction in CA15-3 levels as compared to the untreated DMBA group. It is noteworthy that a more substantial decrease in CA15-3 levels was observed in the DMBA group treated with doxorubicin and photodynamic therapy (PDT) facilitated by the combination of ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e and TMPyP photosensitizers. We also observed a remarkable impact of doxorubicin alone and in combination with PDT in inhibiting the circulating immunosuppressive cytokine TGF-\\u0026beta; which is intricately connected with cancer progression by increasing invasion and metastasis of tumor cells.\\u003csup\\u003e30\\u003c/sup\\u003e Serum TGF-\\u0026beta; levels were found to be significantly higher in the DMBA group compared to the control group in the current investigation. However, compared to the DMBA group, the serum TGF-\\u0026beta; level was considerably lower in all treatment groups. In line with our findings, it has been revealed that the combination of chemotherapy (paclitaxel) and chlorin e6-PDT exhibits the capacity to inhibit the TGF-\\u0026beta; signaling pathway in xenograft models.\\u003csup\\u003e31\\u003c/sup\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eEssential genes were significantly downregulated after treatment with doxorubicin alone or in combination with ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e-PDT or TMPyP-PDT or both: EGFR, NRAS, NF-\\u0026kappa;B, mTERT and c-Myc. Epidermal growth factor receptor (EGFR) is a transmembrane receptor, characterized as a mediator of a wide variety of signal transduction events that control cell proliferation, migration, and survival.\\u003csup\\u003e32\\u003c/sup\\u003e EGFR overexpression has been reported to occur in 16\\u0026ndash;36% of breast cancers and significantly associated with poor prognosis.\\u003csup\\u003e33\\u003c/sup\\u003e Neuroblastoma RAS is an essential downstream GTPase protein of the EGFR activated signaling cascade. Overexpression of wild type N-Ras is responsible for the development and progression of the aggressive Basal Like Breast Cancer.\\u003csup\\u003e34\\u003c/sup\\u003e Nuclear factor-kappaB (NF\\u0026kappa;B) is a transcription factor activated upon EGFR activation and its constitutive expression observed in breast cancer, and is associated with tumor aggressiveness, metastasis, chemo-resistance, and radio-resistance.\\u003csup\\u003e35\\u003c/sup\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTelomerase reverse transcriptase (TERT) is an essential enzyme responsible for telomere maintenance and genome stability, and its overexpression detected in more than 90% of tumors.\\u003csup\\u003e36\\u003c/sup\\u003e The expression of TERT is regulated by various transcription activators in breast cancer cells,\\u0026nbsp;and one of the key activators linked to TERT regulation is the proto-oncogene c-Myc.\\u003csup\\u003e37\\u0026nbsp;\\u003c/sup\\u003eA previous study has demonstrated that treatment of MDA-MB-231 cells with gefitinib, an inhibitor of the epidermal growth factor receptor (EGFR), resulted in the downregulation of hTERT expression by inhibiting c-Myc.\\u003csup\\u003e38\\u003c/sup\\u003e In our study, the mRNA levels of EGFR, NRAS, NF-\\u0026kappa;B, mTERT and c-Myc were significantly decreased in all treatment groups compared to the untreated DMBA group. Interestingly, the DMBA group treated with ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e/TMPyP-PDT+DOXO showed a significant reduction in c-Myc mRNA levels compared to the group treated with doxorubicin alone.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eCaspase-3 is one of the main protease enzymes and considered a key player in the apoptotic process and is often used as a marker for apoptotic cell death in experimental studies. In this study the mRNA expression level of Caspase-3 significantly increased only in the DMBA group treated with doxorubicin and PDT mediated by combining ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e and TMPyP. This observation aligns with prior in vitro evidence indicating that the combination administration of 9-hydroxypheophorbide \\u0026alpha; (9-HPbD)-mediated photodynamic treatment (PDT) and Carboplatin resulted in a more pronounced upregulation of caspase-3 expression compared to each individual therapy.\\u003csup\\u003e39\\u003c/sup\\u003e Hence, the observed reduction in EGFR expression levels and its associated downstream target genes, coupled with the upregulation of proapoptotic caspase-3 expression, provide compelling evidence supporting the efficacy of the doxorubicin-photodynamic therapy combination as a potentially effective approach for breast cancer treatment.\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eThe injection of Doxo + PDT resulted in an anticancer response characterized by apoptosis and necrosis. In addition, we noted a reduction in Bcl-2 and Ki-67 immunostaining, decreased serum levels of CA15-3 and TGF-\\u0026beta;, decreased expression of some oncogenes, and an increase in the expression of caspase-3, which is implicated in the apoptosis pathway. Therefore, this combined treatment can significantly inhibit the growth of breast tumors, offering a more favorable outlook compared to existing conventional medicines.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgements\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eM.E. El-Khouly gratefully acknowledges the financial support provided by Science, Technology \\u0026amp; Innovation Funding Authority (STIFA), Applied Sciences Research Grants, Project no. 46207.\\u003cstrong\\u003e\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAya Mokhtar: Running the experiments, data analysis, writing the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003eTarek Mohamed: Collecting and analysis the data, and writing the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003eAhmed O. Eigza: Conceptualization, methodology writing the manuscript, and supervision.\\u003c/p\\u003e\\n\\u003cp\\u003eMohamed E. El-Khouly: Conceptualization, methodology, writing the manuscript, and supervision.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData Availability Statement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eData is included within the article\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of Interests\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe author declares no competing interests.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eSung, H., Ferlay, J., Siegel, R.L., Laversanne, M., Soerjomataram, I., Jemal, A. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 71(3), 209\\u0026ndash;49, (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRawat, P. S., Jaiswal, A., Khurana, A., Bhatti, J. S., Navik, U. Doxorubicin-induced cardiotoxicity: An update on the molecular mechanism and novel therapeutic strategies for effective management. Biomedicine \\u0026amp; Pharmacotherapy 139, 111708, (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAnand, U., Dey, A., Chandel, A.K.S., Sanyal, R., Mishra, A., Pandey, D.K. Cancer chemotherapy and beyond: Current status, drug candidates, associated risks and progress in targeted therapeutics. Genes and Diseases 10 (4), 1367\\u0026ndash;401, (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRodrigues, J.A., Correia, J.H. Enhanced Photodynamic Therapy: A Review of Combined Energy Sources. Cells 11 (24), 3995, (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePrzygoda, M., Bartusik-Aebisher, D., Dynarowicz, K., Cieślar, G., Kawczyk-Krupka, A., Aebisher, D. Cellular Mechanisms of Singlet Oxygen in Photodynamic Therapy. International Journal of Molecular Sciences 24 (23), 16890, (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhao, Y., Ye, X., Xiong, Z., Ihsan, A., Ares, I., Mart\\u0026iacute;nez, M., Lopez-Torres, B., Martinez-Larranaga, M.R., Anadon, A., Wang, X., Mart\\u003cdiv id=\\\"IEq1\\\" class=\\\"InlineEquation\\\"\\u003e\\u003cdiv format=\\\"TEX\\\" class=\\\"mathinline\\\" id=\\\"FileID_IEq1\\\" name=\\\"EquationSource\\\"\\u003e\\u003cscript type=\\\"math/tex; mode=inline\\\"\\u003e\\\\:\\\\text{i}\\u003c/script\\u003e\\u003c/div\\u003e\\u003c/div\\u003enez, M.A. Cancer Metabolism: The Role of ROS in DNA Damage and Induction of Apoptosis in Cancer Cells. Metabolites 13 (7), 796, (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKars, M.D., Kara, R., G\\u0026uuml;ndoǧdu, Y., Kepceoǧlu, A., Kili\\u0026ccedil;, H.S. Femtosecond laser induced photodynamic therapy on 5-ALA treated SKMEL-30 cells: An efficient theranostic strategy to combat melanoma. Biomedicine \\u0026amp; Pharmacotherapy 68(5), 657\\u0026ndash;62, (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDouplik, A., Saiko, G., Schelkanova, I., Tuchin, V.V. The response of tissue to laser light. Lasers for Medical Applications: Diagnostics. Therapy and Surgery \\u003cem\\u003e1\\u003c/em\\u003e, 47\\u0026ndash;109, (2013).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eJanas, K., Boniewska-Bernacka, E., Dyrda, G., Słota, R. Porphyrin and phthalocyanine photosensitizers designed for targeted photodynamic therapy of colorectal cancer. Bioorg. Med. Chem. 30, 115926, (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGamelas, S.R.D., Moura, N.M.M., Habraken, Y., Piette, J., Neves, M.G.P.M.S., Faustino, M.A.F. Tetracationic porphyrin derivatives against human breast cancer. J. Photochem. Photobiol B 222, 112258, (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRazlog, R., Kruger, C.A., Abrahamse, H. Cytotoxic Effects of Combinative ZnPcS\\u003csub\\u003e4\\u003c/sub\\u003e Photosensitizer Photodynamic Therapy (PDT) and Cannabidiol (CBD) on a Cervical Cancer Cell Line. Int. J. Mol. Sci. 24(7), 6151, (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMontaseri, H., Simelane, N.W.N., Abrahamse, H. Zinc Phthalocyanine Tetrasulfonate-Loaded Ag@mSiO\\u003csub\\u003e2\\u003c/sub\\u003e Nanoparticles for Active Targeted Photodynamic Therapy of Colorectal Cancer. Frontiers in Nanotechnology 4, (2022).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNkune, N.W., Abrahamse, H. Anti-Hypoxia Nanoplatforms for Enhanced Photosensitizer Uptake and Photodynamic Therapy Effects in Cancer Cells, International Journal of Molecular Sciences 24 (3), 2656, (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNair, A., Jacob, S. A simple practice guide for dose conversion between animals and human. J. Basic Clin. Pharm. 7(2), 27, (2016).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKuznetsova, N.A., Gretsova, N.S., Kalmykova, E.A., Makarova, E.A., Dashkevich, E.S.N., Negrimovskii, V.M., Kaliya, O.L., Luk\\u0026rsquo;yanets, E.A. Relationship Between the Photochemical Properties and Structure of Porphyrins and Related Compounds. Russ. J. Gen. Chem. 70, 133\\u0026ndash;140, (2000).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKwiatkowski, S., Knap, B., Przystupski, D., Saczko, J., Kędzierska, E., Knap-Czop, K. Photodynamic therapy \\u0026ndash; mechanisms, photosensitizers and combinations. Biomedicine \\u0026amp; Pharmacotherapy 106, 1098\\u0026ndash;107, (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePeng, C.L., Lai, P.S., Lin, F.H., Yueh-Hsiu, W.S., Shieh, M.J. Dual chemotherapy and photodynamic therapy in an HT-29 human colon cancer xenograft model using SN-38-loaded chlorin-core star block copolymer micelles. Biomaterials 30(21), 3614\\u0026ndash;3625, (2009).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePeng, C.L., Shieh, M.J., Tsai, M.H., Chang, C.C., Lai, P.S. Self-assembled star-shaped chlorin-core poly(ɛ-caprolactone)\\u0026ndash;poly(ethylene glycol) diblock copolymer micelles for dual chemo-photodynamic therapies. Biomaterials 29(26), 3599\\u0026ndash;608, (2008).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCincotta, L., Szeto, D., Lampros, E., Hasan, T., Cincotta, A.H. Benzophenothiazine and Benzoporphyrin Derivative Combination Phototherapy Effectively Eradicates Large Murine Sarcomas. Photochemistry and Photobiology 63, 229\\u0026ndash;237, (1996).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePeng, Q., Warloe, T., Moan, J., Godal, A., Apricena, F., Giercksky, K.E., Neslan, J.M. Antitumor Effect of 5-Aminolevulinic Acid-mediated Photodynamic Therapy Can Be Enhanced by the Use of a Low Dose of Photofrin in Human Tumor Xenografts. Cancer Research 61, 5824\\u0026ndash;5832, (2001).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCosta, I., Solanas, M., Escrich, E. Histopathology and characterization of mammary neoplastic lesions induced with 7,12 dimethylbenz(alpha)anthracene in the rat: a comparative analysis with human breast tumors. Arch. Pathol. Lab. Med. 126, 915\\u0026ndash;927, (2002).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTong, Z.S., Miao, P.T., Liu, T.T., Jia, Y.S., Liu, X.D. Enhanced antitumor effects of BPD-MA-mediated photodynamic therapy combined with adriamycin on breast cancer in mice. Acta Pharmacol. Sin. 33(10), 1319\\u0026ndash;24, (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCabral, \\u0026Aacute;.S., Leonel, E.C.R., Candido, N.M., Piva, H.L., de Melo, M.T., Taboga, S.R., Rahal, P., Tedesco, A.C., Calmon, M.F. Combined photodynamic therapy with chloroaluminum phthalocyanine and doxorubicin nanoemulsions in breast cancer model. J. Photochem. Photobiol. B. 218, 112181, (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAcedo, P., Stockert, J.C., Ca\\u0026ntilde;ete, M., Villanueva, A. Two combined photosensitizers: A goal for more effective photodynamic therapy of cancer. Cell Death Dis. 5(3), e1122, (2014).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEbrahim, A.S., Sabbagh, H., Liddane, A., Raufi, A., Kandouz, M., Al-Katib, A. Hematologic malignancies: newer strategies to counter the BCL-2 protein. Journal of Cancer Research and Clinical Oncology 142 (9), 2013\\u0026ndash;2022, (2016).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTong, Z.S., Miao, P.T., Liu, T.T., Jia, Y.S., Liu, X.D. Enhanced antitumor effects of BPD-MA-mediated photodynamic therapy combined with adriamycin on breast cancer in mice. Acta Pharmacol Sin. 33(10), 1319\\u0026ndash;24, (2012).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDavey, M.G., Hynes, S.O., Kerin, M.J., Miller, N., Lowery, A.J. Ki-67 as a Prognostic Biomarker in Invasive Breast Cancer. Cancers 13 (17), 4455, (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHu, D., Chen, L., Qu, Y., Peng, J., Chu, B., Shi, K., Hao, Y., Zhong, L.M., Wang, M., Qian, Z. (2018) Oxygen-generating Hybrid Polymeric Nanoparticles with Encapsulated Doxorubicin and Chlorin e6 for Trimodal Imaging-Guided Combined Chemo-Photodynamic Therapy. \\u003cem\\u003eTheranostics\\u003c/em\\u003e 8(6), 1558\\u0026ndash;1574, (2018).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDuffy, M.J., Evoy, D., McDermott, E.W. CA 15\\u0026thinsp;\\u0026ndash;\\u0026thinsp;3: Uses and limitation as a biomarker for breast cancer. Clinica Chimica Acta. 411(23\\u0026ndash;24), 1869\\u0026ndash;1874, (2010).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBatlle, E., Massagu\\u0026eacute;, J. (2019) Transforming Growth Factor-β Signaling in Immunity and Cancer. \\u003cem\\u003eImmunity\\u003c/em\\u003e 50 (4), 924\\u0026ndash;940, (2019).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eTan, P., Cai, H., Wei, Q., Tang, X., Zhang, Q., Kopytynski, M., Yang, J., Yi, Y., Zhang, H., Gong, Q., Gu, Z., Chen, E., Luo, K. Enhanced chemo-photodynamic therapy of an enzyme-responsive prodrug in bladder cancer patient-derived xenograft models. Biomaterials 277, 121061, (2021).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eAli, R., Wendt, M.K. The paradoxical functions of EGFR during breast cancer progression. Signal Transduct Target Ther. 2, 16042, (2017).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBhargava, R., Gerald, W.L., Li, A.R., Pan, Q., Lal, P., Ladanyi, M., Chen, B. EGFR gene amplification in breast cancer: correlation with epidermal growth factor receptor mRNA and protein expression and HER-2 status and absence of EGFR-activating mutations. Modern Pathology 18(8), 1027\\u0026ndash;1033, (2005).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZheng, Z.Y., Tian, L., Bu, W., Fan, C., Gao, X., Wang, H., Liao, Y.H., Li, Y., Lwis, M.T., Edwards, D., Zwaka, T.P., Hilsenbeck, S.G., Medina, D., Perou, C.M., Creighton, C.J., Zhang, Z.H.F., Chang, E.C. Wild-Type N-Ras, overexpressed in Basal-like Breast Cancer, Promotes Tumor Formation by Inducing IL-8 Secretion via JAK2 Activation. Cell Rep. 12(3), 511\\u0026ndash;524, (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang, W., Nag, S.A., Zhang, R. Targeting the NFKB Signaling Pathways for Breast Cancer Prevention and Therapy. Current Medicinal Chemistry 22, 264\\u0026ndash;289, (2015).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYang, R., Han, Y., Guan, X., Hong, Y., Meng, J., Ding, S., Long, Q., Yi, W. Regulation and clinical potential of telomerase reverse transcriptase (TERT/hTERT) in breast cancer. Cell Communication and Signaling 23 (21), 218, (2023).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eDratwa, M., Wysoczańska, B., Wysoczańska, W., Łacina, P., Kubik, T., Bogunia-Kubik, K. TERT-Regulation and Roles in Cancer Formation. Front. Immunol. 19, 589929, (2020).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMoon, D.O., Kim, M.O., Heo M.S., Lee, J.D., Choi, Y.H., Kim, G.Y. Gefitinib induces apoptosis and decreases telomerase activity in MDA-MB-231 human breast cancer cells. Arch Pharm Res. 32(10), 1351\\u0026ndash;60, (2009).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHe, P., Ahn, J.C., Shin, J.I., Hwang, H.J., Kang, W., Lee, S.J., Chung, P.S. Enhanced apoptotic effect of combined modality of 9-hydroxypheophorbide α-mediated photodynamic therapy and carboplatin on AMC-HN-3 human head and neck cancer cells. Oncol Rep. 21(2), 329\\u0026ndash;334, (2009).\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Porphyrin, Phthalocyanines, photodynamic Therapy, cancer treatment\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4729891/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4729891/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eBreast cancer ranks as the second most widespread form of cancer globally and holds the highest mortality rate among women. Currently, combination therapy is being actively employed in clinical practice to augment the efficiency of anticancer treatment. Hence, the objective of this study was to assess the therapeutic efficacy of a combination of femtosecond laser-based PDT utilizing two distinct photosensitizers (PSs), zinc phthalocyanine tetrasulfonate (ZnPcS4) and meso-tetrakis(4-N-methylpyridyl) porphine (TMPyP) in conjunction with doxorubicin chemotherapeutic agent, on mammary carcinomas experimentally induced in female mice using 7,12-dimethylbenz (a) anthracene (DMBA). Our results showed the efficiency of the combined therapy for promoting tissue apoptosis and necrosis as evidenced by histopathological observations and the noticeable reduction of Bcl-2 and Ki-67 expression. Moreover, there was a reduction in serum levels of the carcinoma antigen CA15-3 and transforming growth factor beta (TGF-β). Co-treatment of doxorubicin with ZnPcS4-PDT or TMPyP-PDT or a combination of both resulted in a decrease in the expression of EGFR and its downstream oncogenes NRAS, NF-κB, mTERT, and c-Myc, and an increase in the expression of the caspase-3 apoptotic gene. These results validate the therapeutic potential of combining doxorubicin with photodynamic therapy, highlighting the potential of this co-treatment strategy as a promising alternative for enhancing existing anticancer approaches.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Dual chemo- and photodynamic therapy against DMBA- induced mammary carcinoma in mice using water soluble porphyrin and phthalocyanine photosensitizers\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-08-09 06:08:56\",\"doi\":\"10.21203/rs.3.rs-4729891/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"4bdea1c9-8eb1-49fb-99d8-e289d261e4d1\",\"owner\":[],\"postedDate\":\"August 9th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":35546431,\"name\":\"Biological sciences/Biotechnology\"},{\"id\":35546432,\"name\":\"Biological sciences/Cancer\"},{\"id\":35546433,\"name\":\"Physical sciences/Chemistry\"}],\"tags\":[],\"updatedAt\":\"2024-10-14T04:08:44+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-08-09 06:08:56\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4729891\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4729891\",\"identity\":\"rs-4729891\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}