{"paper_id":"1f76def2-e5c0-411a-a75a-6ebd2d39c52e","body_text":"Integrated Computational and Experimental Approach to Identify Nrf2- regulated Molecular Targets in Cerebral Ischemia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Integrated Computational and Experimental Approach to Identify Nrf2- regulated Molecular Targets in Cerebral Ischemia Anita Lewczuk, Anna Boratyńska-Jasińska, Łukasz Charzewski, Małgorzata Beręsewicz-Haller, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7272615/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 15 Oct, 2025 Read the published version in Pharmacological Reports → Version 1 posted 12 You are reading this latest preprint version Abstract The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) is a master regulator of the cellular antioxidant response, playing an important role in protecting neurons from ischemic injury. The hippocampus exhibits region-specific vulnerability to ischemia, with CA1 neurons being highly susceptible, while CA2-3 and dentate gyrus (DG) neurons demonstrate greater resistance. Our previous work revealed higher basal and post-ischemia/reperfusion (I/R) Nrf2 activity in the resistant CA2-3,DG region compared to CA1 in a gerbil model of global cerebral ischemia. We used a combined computational and experimental approach to identify potential Nrf2-regulated genes that contribute to this regional neuroprotection. By utilizing the mouse Hipposeq database and Nrf2 target gene lists from the GSEA Molecular Signatures Database, we identified 15 candidate genes with predicted roles in the CA2-3,DG stress response. Quantitative RT-PCR analysis of the gerbil hippocampus following I/R confirmed distinct expression patterns. Although some genes, including MPP3, RET , and SHISA2 , showed higher basal expression in CA2-3,DG, they were unexpectedly downregulated after I/R. In contrast, others, e.g. AIFM2 , BRIP1 , and CAMK1 , were upregulated specifically in this region. Furthermore, some (GPC1) showed delayed upregulation or showed altered protein levels despite unchanged mRNA expression (FZD7, STC2). These results emphasize the regional and time-dependent regulation of gene expression in the hippocampus after I/R. The identified up- and downregulated genes represent novel molecular targets whose pharmacological modulation could enhance endogenous neuroprotective pathways, revealing new therapeutic avenues for stroke. Ischemia/Reperfusion Hippocampus CA2-3 DG Nrf2 Gerbil Regional Vulnerability Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Nuclear factor-erythroid 2-related factor 2 (Nrf2) is a crucial transcription factor for a complex cellular defense system against oxidative and electrophilic stress (Dinkova-Kostova et al., 2018 ). Under basal conditions, Nrf2 is sequestered in the cytoplasm by its repressor protein, Kelch-like ECH-associated protein 1 (Keap1), which targets Nrf2 for ubiquitination and proteasomal degradation (Itoh, 1999). However, under stress conditions, such as oxidative stress, Nrf2 is released from Keap1, allowing its translocation to the nucleus. Nuclear Nrf2 binds to antioxidant response elements (AREs) in the promoter regions of its target genes, initiating their transcription (Raghunath et al., 2018 ). The Nrf2 regulon includes hundreds of genes that are involved in various processes: antioxidant and anti-inflammatory responses, heme and iron metabolism, regulation of growth factors and other transcription factors, and metabolic adaptation (Holmström et al., 2016 ; Kerins and Ooi, 2018 ). The hippocampus, a brain structure essential for learning and memory, is an area where the protective functions of transcription factors can be particularly significant, especially given its striking regional variations in vulnerability to transient cerebral ischemia. The different subregions of the hippocampus, including the Cornu Ammonis areas (CA1, CA2, and CA3) and the dentate gyrus (DG), exhibit distinct morphological and functional characteristics, as well as differential susceptibility to insults such as Alzheimer's disease, stroke and stress (Bartsch and Wulff, 2015 ; McEwen, 2007 ). Transient cerebral ischemia selectively damages CA1 pyramidal neurons, leading to delayed neuronal death, while leaving neurons in CA2, CA3, and DG relatively intact (Kirino, 2000 ; Ziemka-Nałecz et al., 2003 ). This selective vulnerability of CA1 manifests itself morphologically within 24 hours after a brief ischemic episode, progressing to significant neuronal loss within 4–7 days (Dluzniewska et al., 2005 ; Kawalec et al., 2023 ). Mongolian gerbils have a unique cerebrovascular anatomy, specifically an incomplete circle of Willis, which makes them highly susceptible to experimentally induced cerebral ischemia, especially within the hippocampus (Levine and Sohn, 1969 ; Li and Zhang, 2021 ). This characteristic makes them an excellent model for investigating stroke mechanisms, neuroprotection, and post-ischemic recovery in this specific brain region (e.g. Himeda et al., 2005 ; Kim et al., 2019 ; Lee et al., 2020 ). The mechanisms underlying delayed neuronal death in CA1 have been extensively studied. Recent research, however, has shifted focus to elucidating the factors responsible for the relative resistance of CA2-3 and DG (e.g. Beręsewicz-Haller et al., 2021 ; Cohan et al., 2017 ). The resistance of the CA2-3,DG region likely arises from intrinsic neuroprotective mechanisms, such as enhanced antioxidant defenses, reduced oxidative stress, and increased neurotrophic factors expression, regulated by transcription factors like Nrf2 (Dudek et al., 2016 ; Einenkel and Salameh, 2024 ). Nrf2 plays a crucial role in protecting cells from oxidative stress by inducing the expression of numerous cytoprotective genes (Ma, 2013). Its activation has emerged as a promising neuroprotective strategy in various neurological disorders, including ischemic stroke, as it alleviates oxidative stress, inflammation, and excitotoxicity (Brandes and Gray, 2020 ; Mayer et al., 2024 ; Zhang et al., 2017 ). Our previous work demonstrated an increase in Nrf2 activity in the gerbil hippocampus after I/R (Lewczuk et al., 2023b ), consistent with reports of Nrf2 upregulation in other models of cerebral ischemia (Dang et al., 2012 ; Sun et al., 2023 ; Takagi et al., 2014 ). Furthermore, our previous work confirmed that I/R induces robust Nrf2 activation in the gerbil hippocampus, demonstrated by Nrf2 nuclear translocation and the significant upregulation of proteins encoded by its canonical target genes, including HO-1, GPx1, and GCLC/M. This activation was more pronounced in the resistant CA2-3,DG region, both basally and after I/R, suggesting a direct link between elevated Nrf2 activity and the endogenous neuroprotection of this region (Lewczuk et al., 2023b ). This is consistent with studies indicating that Nrf2 activation or overexpression provides neuroprotection from ischemic damage in hippocampal neurons (Goodfellow et al., 2020 ; Lan et al., 2024 ; Tulsulkar and Shah, 2013 ). Notably, the pharmacological activation of Nrf2 with compounds such as sulforaphane has also been shown to confer neuroprotection in this gerbil model of ischemia (Lewczuk et al., 2023b ), reinforcing the therapeutic potential of this pathway. We employed an integrated computational and experimental approach to investigate this topic further. Using the Hipposeq database (Cembrowski et al., 2016 ), a comprehensive transcriptomic resource derived from the mouse hippocampus, combined with curated lists of Nrf2-regulated genes from the GSEA Molecular Signatures Database (Liberzon et al., 2015 ; Liberzon et al., 2011 ), we identified new putative Nrf2 targets that are likely involved in CA2-3,DG resistance to ischemic injury. These in silico predictions were then validated by quantitative RT-PCR and Western blot analysis, examining the temporal expression profiles of selected genes in the CA1 and CA2-3,DG regions after I/R in Mongolian gerbils. This combined approach aimed to uncover new molecular targets and pathways relevant to ischemic brain injury and to advance our understanding of the complex interaction between Nrf2 signaling and regional responses to ischemia. Furthermore, by utilizing the gerbil model, we sought to explore these mechanisms in a system particularly susceptible to hippocampal ischemia. Our research contributes to ongoing efforts to identify therapeutic targets to improve outcomes after transient ischemic attacks (TIA) and stroke (Beresewicz-Haller, 2023 ; López-Morales et al., 2023 ). 2. Materials and Methods 2.1. In silico analysis Gene expression data were retrieved from the Hipposeq database (Cembrowski et al., 2016) for each available mouse hippocampal region: dorsal CA1-3 pyramidal cells (PCs), ventral CA1 and CA3 PCs, dorsal and ventral DG granule cells (GCs), and dorsal DG mossy cells (MCs) (Supplementary Figure S1). Using the graphical interface, the data were filtered to generate a list of genes with elevated or diminished expression levels in any region compared to the dorsal CA1 region. Subsequently, the data were further reduced to genes known to be Nrf2-regulated in humans. This selection was carried out employing the NFE2L2.V2 gene set from the GSEA Molecular Signatures Database (Kim et al., 2016; Mootha et al., 2003; Subramanian et al., 2005). 2.2. Ethical Statement and Animals Mongolian gerbils ( Meriones unguiculatus ) were purchased from the animal house of the Mossakowski Medical Research Institute, Polish Academy of Sciences. Animal care was in accordance with ethical guidelines (Directive 86/609/EEC of the European Communities Council). All experimental procedures were approved by the Local Commission for the Ethics of Animal Experimentation no. 2 in Warsaw (WAW2/032/2021). Every effort was made to minimize animal suffering and reduce the number of specimens used. 2.3. Transient Brain Ischemia in Gerbils Adult male gerbils weighing 60 to 70 g were subjected to transient brain ischemia by bilateral ligation of the common carotid arteries for 5 min under isoflurane anesthesia and controlled normothermic conditions, as previously described (Kawalec et al., 2023). After ischemia, the animals recovered for 24, 48, 72, or 96 h prior to decapitation, and the hippocampal subregions (CA1 and CA2-3,DG) were dissected for the immediate extraction of RNA and proteins. The hippocampi of sham-operated animals served as controls. The animals were randomly selected for the experiments. 2.4. Immunoblotting For Western blotting, the dissected hippocampal regions were homogenized in an ice-cold cell lysis buffer (Cell Signalling Technology, USA) with 1 mM PMSF (Sigma-Aldrich, Germany) and kept on ice for an additional 5 min for lysis. The samples were sonicated and cleared by centrifugation at 14,000 × g for 10 min at 4 °C. Total protein concentration was determined using the Modified Lowry Protein Assay (Thermo Fisher Scientific, USA). The reduced samples were prepared by boiling at 100 °C for 5 min in Laemmli sample buffer. An equal amount of protein (40 μg) was separated by SDS-PAGE and transferred to a nitrocellulose membrane (Amersham, Cytiva, Germany). After total protein imaging, membranes were blocked for 1 h at room temperature with 5% non-fat milk in Tris-buffered saline containing 0.05% Tween 20 (TBST). Subsequently, the membranes were incubated for 2 h in RT with the appropriate primary antibodies diluted in TBST. These included: rabbit polyclonal anti-BRIP1 (1:500; Proteintech, Germany; 24436-1-AP), mouse monoclonal anti-CaMK1 (1:500; Santa Cruz Biotechnology, USA; sc-137225), rabbit polyclonal anti-FSP1 (1:500; Proteintech; 20886-1-AP), rabbit polyclonal anti-FZD7 (1:500; Proteintech; 16974-1-AP), rabbit monoclonal anti-ITGB8 (1:500; Cell Signaling Technology; #88300), rabbit polyclonal anti-LDHB (1:1000; Proteintech; 14824-1-AP), rabbit polyclonal anti-3-PGDH (1:500; Proteintech; 14719-1-AP), rabbit polyclonal anti-SHISA2 (1:1000; Sigma-Aldrich; HPA050172), mouse monoclonal anti-STC2 (1:250; Santa Cruz Biotechnology; sc-293388) and rabbit polyclonal anti-TDO (1:500; Proteintech; 15880-1AP). The membranes were then washed with TBST and incubated for 30 min in RT with corresponding peroxidase-conjugated secondary antibodies: anti-mouse (1:8000; Sigma-Aldrich; A9044) or anti-rabbit (1:4000; Sigma-Aldrich; A0545), diluted in 5% fat-free milk in TBST. Bound antibodies were visualized with Amersham ECL Western Blotting Detection Reagent (Amersham, Cytiva) and signals were captured and quantified using the Fusion FX imaging system (Vilber Lourmat, France). The band intensities of the proteins of interest were normalized to the reference protein L-lactate dehydrogenase B chain (LDHB). After initial probing, membranes were stripped using a mild stripping buffer before being blocked again and reprobed for subsequent primary antibodies or the LDHB loading control. A single representative LDHB blot is shown for illustrative purposes, but quantification was performed for each blot individually. 2.5. Total RNA extraction and cDNA synthesis Fresh hippocampal sections (approx. 10 mg of tissue) were homogenized in the Fenozol solution supplied by the manufacturer (A&A Biotechnology, Poland) and stored at -80 °C. RNA was isolated using the Total RNA Mini Concentrator kit (A&A Biotechnology), following the manufacturer’s instructions. Quality and concentration were measured with a DeNovix DS-11 FX+ spectrophotometer (DeNovix Inc., USA). cDNA was synthesized from 2 μg RNA using the High-Capacity RNA-to-cDNA Kit (ThermoFisher Scientific, USA) in 20-μL reactions. The resulting cDNA was stored at -20 °C until it was required for analysis. 2.6. Primer Design and Quantitative Real-Time PCR The primers were designed using Primer3web version 4.1.0 (https://primer3.ut.ee/; accessed on 2 February 2023) (Untergasser et al., 2012) based on available DNA sequences of Meriones unguiculatus , verified through primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/; accessed on 3 February 2023), and synthesized by DNA Sequencing and Synthesis Facility (IBB PAS, Poland). The presence of a single peak in the melting curve of each amplicon confirmed the specificity of the primers. The primers used for RT-qPCR are listed in Table 1. Table 1 . Primer Sequences for Quantitative Real-Time PCR (RT-qPCR) Gene Accession number Primer sequences (5’-3’) Amplicon size (bp) GAPDH XM_021636934 F: AGTATGACTCTACCCACGGC R: ACTCCACAACATACTCGGCA 150 HMBS XM_021659401 F: GAAGAGTGGCCCAGCTACAG R: CACTGAACTCCTGCTGCTCA 108 AIFM2 XM_021649400.1 F: GCCTTGCCCTTCTCACATCT R: CTGCTTCACATGTCCTCGT 120 BRIP1 XM_021645850.1 F: GGCATCACCACTGCTACTT R: CTGTATTGCCTCCTCTGAACC 105 CAMK1 XM_021637624.1 F: AGAGGACAAGAGGACTCAGAAG R: CATCCAGGGCTACAATGTTAGG 137 CXCL12 XM_021662804.1 F: TGACTACAGATGCCCATGC R: TCGGGTCAATGCACACTTGT 147 FZD7 XM_021654377.1 F: TGGAGGTGAGGAGAGGTTT R: TGCAAGTCCTAAGCCAGAAG 100 GPC1 XM_021632062.1 F: GGAGAATGTTATTGGCAGTGTG R: TGGATGACCTTGGCTGTG 93 HRK XM_021642571.1 F: CGGAGTGTAAAGACCCACCC R: ATAGCATTGGGGTGGCTAGC 95 ITGB8 XM_021654173.1 F: AGCTTGGAAGAGTGTACGGC R: CCCCTTCCCAGCCACTAAAG 132 LRP8 XM_021661159.1 F: TCTTCACCAACCGACACGAG R: TTGGTAGCCACTTCCACGTC 112 MPP3 XM_021642772.1 F: GTAGAGTCCAGCCTCCCTCA R: AAGCGAGGCTTCCCACTAAC 109 PHGDH XM_021632368.1 F: GTAAGGAGGAGCTGATCGCC R: CGCTGCGRRGATGACATCAG 92 RET XM_021652718.1 F: GGTCTCTGTGGACGCTTTCA R: TTCCAAACTCGCCTTCTCCC 101 SHISA2 XM_021649050.1 F: TCATCACTGTCCTCCCGGAT R: TTGAGGATGGAGGTGGCAAC 138 STC2 XM_021635606.1 F: CGCCCTGGACTTCAATGACT R: TGTAGGGGACTCTCAGGCTC 108 TDO2 XM_021663266.1 F: CATGGAACTGCTGTGGAAATAAG R: GGAATGGAGATGATTGCTGTTTAG 101 The RT-qPCR assays were performed in a final reaction volume of 20 μl, containing 100 ng of cDNA, 7 μl of Ambion Nuclease-Free Water (Thermo Fisher Scientific), 10 μl of 2X PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, USA) and 400 nM of each primer. Each sample was run in triplicate on the Applied Biosystems 7500 Fast Real-Time PCR System (Thermo Fisher Scientific). No-template controls were added to each run. The cycling parameters were: 2 min at 50 °C (UDG activation), 2 min at 95 °C (polymerase activation), followed by 40 cycles of 95 °C for 3 s for denaturation and 60 °C for 30 s for annealing. The sets of BRIP1 and CXCL12 primers had different annealing temperatures: 62 °C and 58.6 °C, respectively. We included two housekeeping genes, GAPDH and HMBS , previously validated (Lewczuk et al., 2023a), as a normalization factor for the cycle threshold (Ct) value of each gene of interest. The Ct values were determined using SDS 2.3 software (Applied Biosystems, Thermo Fisher Scientific) and for relative quantification, the mean of triplicates was used. The relative expression ratios of the genes of interest were evaluated using the ΔΔCt method (Livak and Schmittgen, 2001) and represented as a fold change in the expression of the calibrator, cDNA from the control gerbil’s brain cortex, set as 1. 2.7. Statistical Analysis All values are expressed as a mean ± standard deviation. Statistical analysis was performed using GraphPad Prism 5.03 (GraphPad Software, San Diego, CA, USA). The significance level of α = 0.05 was selected with ∗ p<0.05, ∗∗ p<0.01, ∗∗∗ p<0.001. Statistical analysis was performed using Student’s t-test to compare means between CA1 and CA2-3,DG controls, or with one-way analysis of variance (ANOVA) followed by Dunnett’s multiple comparison test for ischemia-reperfusion groups versus control groups. 3. Results 3.1. Nrf2-Regulated Gene Selection in Hippocampal Subregions Initial computational analysis, based on the Hipposeq database (Cembrowski et al., 2016) and curated Nrf2 target gene lists, narrowed the dataset to 129 genes potentially regulated by Nrf2 in hippocampal subregions. The relative gene expression was quantified as the ratio of FPKM (Fragments Per Kilobase per Million mapped fragments) values between the dorsal CA1 region and each of the other regions (Supplementary Figure S2). A total of 31 genes with relative expression coefficients greater than 5 were retained for further analysis. Among these, 10 genes that showed a ratio greater than 40 in at least one region were selected ( BRIP1 , CXCL12 , SHISA2 , STC2 , ITGB8 , AIFM2 , RET , PHGDH , CAMK1 , FZD7 ). Five additional genes were included, whose relative expression levels, despite not reaching the 40 threshold ratio, were still significantly elevated in certain regions of the hippocampus. These genes included TDO2 and HRK in dorsal DG, MPP3 in dorsal CA2, GPC1 in dorsal CA3, and LRP8 in MC region (see Supplementary Table 1 for a complete list of genes and their corresponding proteins). To facilitate visual analysis, the relative expression values were transformed using the base-10 logarithm. A heatmap was then generated using the Plotly graphical library (Plotly Technologies Inc.) to represent the selected data (Fig. 1). 3.2. Basal Gene and Protein Expression in the Gerbil Hippocampus To validate in silico predictions of elevated expression in the CA2-3,DG region of the hippocampus, we examined the mRNA levels of selected genes in the CA1 and CA2-3,DG regions of control animals using RT-qPCR. Contrary to predictions, only three of the 15 identified genes - MPP3 , RET , SHISA2 – showed significantly higher expression in CA2-3,DG compared to CA1, which aligns with computational predictions (Fig. 2A). Two genes ( CXCL12 and STC2 ) did not reveal significant interregional differences. The remaining ten genes – AIFM2 , BRIP1 , CAMK1 , FZD7 , GPC1 , HRK , ITGB8 , LRP8 , PHGDH, and TDO2 – displayed significantly higher expression in CA1, contrasting with the in silico data. This discrepancy emphasizes the importance of experimental validation of computational predictions in vivo . Additionally, it suggests possible species-specific differences in Nrf2-mediated gene regulation or limitations in computational models. The higher expression of MPP3 , RET , and SHISA2 mRNA in CA2-3,DG indicates a potential constitutive role for Nrf2 in the regulation of these genes specifically within this hippocampal subregion under basal conditions. To assess the correlation between mRNA and protein levels, we conducted immunoblotting for a subset of these genes. Due to antibody limitations for Mongolian gerbils, only nine proteins could be analyzed (Fig. 2B). Comparison of mRNA and protein expression revealed a complex, often discordant, relationship. SHISA2, despite significantly elevated mRNA in CA2-3,DG, exhibited higher protein expression in CA1. Similarly, the STC2 protein was elevated in CA2-3,DG, even though there were no significant differences observed in STC2 mRNA. On the contrary, TDO2 displayed higher mRNA in CA1, but showed equivalent protein levels between regions. For AIFM2 /FSP1, BRIP1 , CAMK1 , FZD7 , ITGB8 , and PHGDH , both mRNA and protein levels were significantly higher in CA1, suggesting a tighter coupling between transcription and translation for these genes. Since most of the genes and proteins analyzed showed lower expression in CA2-3,DG than in CA1, we hypothesized that they may not be basally regulated by Nrf2 under normal physiological conditions in this hippocampal subregion. To further explore their potential Nrf2 responsiveness, we examined their expression profiles during an episode of ischemia/reperfusion, a condition shown to activate Nrf2 (Farina et al., 2021; Lewczuk et al., 2023b). 3.3. Expression of Selected Genes in Hippocampal Subregions Following Ischemia and Reperfusion To assess the involvement of Nrf2 in relative resistance to ischemia followed by reperfusion (I/R), we categorized the selected genes into four groups based on their expression profiles in the CA1 and CA2-3,DG regions: 1. Genes with consistent expression patterns: basal expression levels of mRNA were significantly higher in CA2-3,DG compared to CA1, aligning with predictions in silico. 2. Genes with delayed upregulation: mRNA basal expression was higher in CA1 but demonstrated significant upregulation specifically in CA2-3,DG following I/R. 3. Genes without significant change in expression in CA2-3,DG after I/R. 4. Genes with inconsistent expression patterns: mRNA expression levels did not match any of the previous categories. This classification framework enables structured analysis of region-specific transcriptional responses to I/R and facilitates the identification of potential target genes for Nrf2-mediated neuroprotection. 3.4. Temporal Expression of MPP3, RET, and SHISA2 in the Hippocampus After Ischemia/Reperfusion. Following the categorization of genes based on their basal expression patterns, we examined the temporal changes in expression for the Group 1 genes ( MPP3 , RET , and SHISA2 ), which exhibited constitutively higher expression in the CA2-3,DG region compared to CA1 under control conditions. Contrary to expectations of I/R-induced upregulation, none of these genes showed statistically significant increases in expression at any reperfusion time point in CA1 or CA2-3,DG. Instead, a prominent trend of downregulation was observed, particularly in the CA2-3,DG region. The expression of MPP3 mRNA was significantly decreased in CA2-3,DG at 72 h and 96 h after reperfusion, while remaining relatively stable in CA1 (Fig. 3A). RET expression, although not significantly altered in CA1, showed significant downregulation in CA2-3,DG with a marked decrease of approximately 70% at 24 h (***p<0.001), followed by a gradual return to baseline levels by 96 h (Fig. 3B). The high variability in RET mRNA levels observed in CA1, as indicated by the large standard deviations, contrasted with the consistent response in CA2-3,DG, suggesting a more heterogeneous response to I/R within the CA1 region. SHISA2 mRNA levels also exhibited significant downregulation in CA2-3,DG at all time points (***p<0.001, Fig. 3C), and were significantly reduced in CA1 at 24 and 48 hours post-I/R. Despite these robust changes at the mRNA level, SHISA2 protein levels remained relatively stable in both regions of the hippocampus after I/R (Fig. 3D), highlighting the potential influence of post-transcriptional regulatory mechanisms. The observed downregulation of these putatively Nrf2-regulated genes in CA2-3,DG after ischemia is unexpected and warrants further investigation. 3.5. Temporal Expression and Protein Levels of Delayed Upregulation Genes Following I/R Next, the expression profiles of AIFM2 , BRIP1 , CAMK1, and TDO2 were examined along with their corresponding proteins. These genes were classified as exhibiting upregulation specifically in the CA2-3,DG region after ischemia. Notably, AIFM2 mRNA expression significantly increased in CA2-3,DG at 96 h post I/R (Fig. 4A), while remaining unchanged in CA1. Additionally, the upregulation of the FSP1 protein (Fig. 4B) occurred prior to the increase in mRNA levels, being detectable in CA2-3,DG as early as 48 h and reaching approximately 240% at 96 h. BRIP1 displayed a sustained and significant increase in mRNA expression in CA2-3,DG starting at 48 h post-ischemia (Fig. 4C). In contrast, in CA1, BRIP1 mRNA showed a significant decrease. These transcriptional changes were partially reflected at the protein level, with the BRIP1 protein significantly decreasing in CA1 at 72 h and significantly increasing at 96 h in CA2-3,DG (Fig. 4D). Similarly to BRIP1 , CAMK1 expression was significantly upregulated in the CA2-3,DG region starting at 24 hours and through all analyzed time points of reperfusion (Fig. 4E), while in CA1 a significant decrease was observed at 72 h. CaMK1 protein levels (Fig. 4F) were significantly elevated at every time point in CA2-3,DG and remained relatively stable in CA1, further highlighting the regional differences in response to I/R. Finally, TDO2 mRNA expression in CA2-3,DG showed a trend toward upregulation at all time points post-ischemia, reaching significance at 48 h (Fig. 4G). No relevant changes were observed in the CA1 region. The levels of TDO2 protein remained relatively stable in both regions (Fig. 4H). The delayed upregulation of these genes in the CA2-3,DG region, particularly in the absence of significant changes in the CA1, suggests a specific neuroprotective response to transient ischemic injury. This response may contribute to the enhanced resistance of this region. 3.6. Temporal Expression of FZD7, ITGB8, PHGDH , and STC2 in the Hippocampus Following I/R. The third group of genes we examined were classified as exhibiting no significant change in expression in the CA2-3,DG region following I/R. FZD7 mRNA expression remained relatively stable in CA1 and CA2-3,DG throughout the reperfusion period, without significant changes (Fig. 5A). However, FZD7 protein levels increased significantly (Fig. 5B) in CA2-3,DG at all times post-ischemia, revealing a disconnection between transcriptional and translational regulation. The expression of ITGB8 showed a similar pattern, with no significant changes in mRNA levels in both hippocampal regions (Fig. 5C). ITGB8 protein levels also remained relatively constant upon reperfusion (Fig. 5D). PHGDH mRNA expression showed a tendency to increase in CA1, reaching significance at 72 h of reperfusion (Fig. 5E), while remaining unchanged in CA2-3,DG. PHGDH protein levels (Fig. 5F), on the contrary, showed a significant decrease in CA1 at 72 and 96 h, while showing a significant upregulation in CA2-3,DG at the same time points. This observation further highlights the possibility of post-transcriptional regulation. The expression of STC2 did not show statistically significant changes in the CA1 region, but in CA2-3,DG displayed a significant increase at 24 h and returned to baseline later after longer reperfusion time (Fig. 5G). However, STC-2 protein levels showed a significant increase in CA1 at 48 h and in CA2-3,DG at 72 h with a recovery towards baseline levels at later time points (Fig. 5H). The lack of significant transcriptional changes in CA2-3,DG for these Group 3 genes, despite the resistance to ischemic injury and the activation of Nrf2 under these conditions, indicates that their regulation is likely independent of the primary Nrf2-mediated neuroprotective response. 3.7. Temporal Expression of Genes with Inconsistent Expression Patterns in the Hippocampus After Ischemia/Reperfusion Finally, we analyzed the expression profiles of CXCL12 , GPC1 , HRK, and LRP8 , classified here as Group 4 due to their varied expression profiles in the CA1 and CA2-3,DG regions. The expression of CXCL12 mRNA was significantly downregulated in CA1 at 96 h after reperfusion (Fig. 6A). In CA2-3,DG, CXCL12 was also significantly downregulated at 24 h, its levels fluctuating but generally suppressed throughout the reperfusion period. GPC1 expression remained relatively stable in CA1 but showed a significant increase in CA2-3,DG at 96 h after I/R (Fig. 6B), suggesting a delayed, region-specific response. HRK mRNA levels were significantly downregulated at 72 h and 96 h in the CA2-3,DG region (Fig. 6C), while remaining unchanged in CA1. LRP8 expression was significantly reduced in CA1 at later times post-ischemia. In the CA2-3,DG region, LRP8 expression showed a tendency to decline at 96 h after I/R but remained relatively stable (Fig. 6D). 4. Discussion Although the neuroprotective role of Nrf2 is well established (Brandes and Gray, 2020 ; Dinkova-Kostova et al., 2018 ; Zgorzynska et al., 2021 ), the exact downstream genes and pathways that mediate this effect in the hippocampus, particularly after the I/R episode, remain unclear. Several computational studies have attempted to identify Nrf2-regulated genes in the hippocampus using various approaches, such as single-cell RNA sequencing (scRNA-Seq) data analysis, microarray analysis of Nrf2 knockout models, or in vitro cell culture systems exposed to Nrf2 activators (Bell et al., 2015 ; Levings et al., 2023 ; Muramatsu et al., 2013 ; Zhang et al., 2019 ). However, these studies often lack the context of i n vivo ischemic injury and may not adequately reflect the complex cellular responses in the intact brain. In addition, previous in silico analyses have not adequately addressed the differential vulnerability of hippocampal subregions to ischemic damage. Although the CA1 region is highly susceptible to I/R injury, CA2-3,DG exhibits relative resistance (Kirino, 1982 ; Schmidt-Kastner and Freund, 1991 ). Understanding the molecular mechanisms underlying the relative resistance of CA2-3,DG is of particular interest, as these mechanisms may provide potential therapeutic targets for improving neuroprotection in more vulnerable regions. Our approach used the Hipposeq database (Cembrowski et al., 2016 ), a comprehensive transcriptomic resource derived from the mouse hippocampus, and the curated lists of Nrf2-regulated genes (Liberzon et al., 2015 ; Liberzon et al., 2011 ). By integrating these datasets, we sought to identify new candidate genes that contribute to resistance of the CA2-3,DG region and subsequently validated their expression patterns in a gerbil model of global cerebral I/R. This was done to gain new insights into the molecular mechanisms underlying Nrf2-mediated neuroprotection in the hippocampus after ischemic injury. Our findings show striking heterogeneity in the temporal and regional expression patterns of Nrf2-regulated genes following I/R, illustrating the complex relationship between transcriptional and post-transcriptional regulatory mechanisms that influence the hippocampal response to ischemic injury. One of the most intriguing findings of our study was the divergent behavior of the Group 1 genes ( MPP3 , RET , and SHISA2 ) in the CA1 and CA2-3,DG regions after I/R. These genes showed higher basal expression in CA2-3,DG, consistent with in silico predictions and potentially implicating Nrf2 in their constitutive regulation. Given our previous findings that I/R induces both increased Nrf2 levels and activity in the CA2-3,DG region (Lewczuk et al., 2023b ), we initially anticipated upregulation of these putatively Nrf2-regulated genes in this region. Contrary to expectations, I/R led to a significant downregulation of these genes in CA2-3,DG, particularly at later time points (Fig. 3 ). RET displayed a transient but noticeable decrease at 24–48 h, while both MPP3 and SHISA2 were significantly and persistently downregulated in this region. While this could reflect species-specific differences in Nrf2 regulation between mice and gerbils, the observed downregulation of Group 1 genes in the CA2-3,DG region suggests interactions among multiple regulatory pathways rather than a straightforward Nrf2-mediated response. This unexpected finding adds complexity to our understanding of neuroprotection in the hippocampus following ischemia and emphasizes the possibility for region-specific regulatory mechanisms. The reduced expression of Group 1 genes in the more resistant CA2-3,DG region is counterintuitive and deserves further analysis. Several hypotheses may explain these findings. First, MPP3, RET, and SHISA2 may be involved in cellular processes that are beneficial under normal conditions but could become harmful during prolonged ischemic stress. For example, MPP3 encodes a membrane-associated guanylate kinase (MAGUK) protein, a family of proteins known to play a crucial role in establishing and maintaining cell polarity, synapse formation, and neuronal signaling (Zheng et al., 2011 ). Specifically, MPP3 has been demonstrated to be required for the maintenance of the apical junctional complex during neuronal migration and cortical development (Dudok et al., 2013 ). Its downregulation after I/R could, therefore, reflect a compensatory response aimed at limiting these processes during cellular stress. In the context of the pronounced and prolonged downregulation of RET during reperfusion, selectively in the CA2-3,DG area, it is worth noting that this gene encodes a receptor tyrosine kinase activated by ligands from the GDNF family, which typically promotes neuronal survival and differentiation (Airaksinen and Saarma, 2002 ; Treanor et al., 1996 ). Its reduced expression in this context might reflect a region-specific adaptive response. In models of focal ischemia, exogenous administration of GDNF has been established to reduce ischemic brain injury. This protective effect may be mediated, in part, by GDNF's ability to reduce NMDA receptor-mediated Ca 2+ influx through an ERK-dependent pathway, thus preventing excitotoxic neuronal death (Airaksinen and Saarma, 2002 ). Therefore, downregulation of RET in CA2-3,DG after I/R could be a mechanism to limit calcium overload and excitotoxicity in this region, potentially reflecting the protective effects of exogenous administration of GDNF. Furthermore, SHISA2 mRNA levels were significantly and persistently downregulated in CA2-3,DG at all time points post-I/R, while remaining relatively unchanged in CA1. This gene encodes a transmembrane protein belonging to the Shisa family, members of which have been shown to interact and regulate AMPA-type glutamate receptors (Abdollahi Nejat et al., 2021 ; Ramos-Vicente and Bayés, 2020 ). Given the role of excitotoxicity in ischemic brain injury (Neves et al., 2023 ), the downregulation of SHISA2 in the CA2-3,DG region could represent a protective mechanism by dampening glutamatergic signaling and reducing neuronal excitability. Interestingly, despite changes in mRNA levels, SHISA2 protein levels remained unchanged in both CA1 and CA2-3,DG during the study period after ischemia, which might be due to the long half-life or compensatory translational mechanisms. The sustained downregulation of MPP3, RET, and SHISA2 in CA2-3,DG during reperfusion occurred in a model where we have previously confirmed robust Nrf2 activation (Lewczuk et al., 2023b ), indicating that the regulation extends beyond direct Nrf2-mediated transcription. One hypothesis is that this downregulation reflects a region-specific adaptive response, potentially limiting harmful overactivation of certain pathways or reducing the burden on an already stressed system after I/R. For example, it could be related to the initiation of ferroptosis, a form of iron-dependent cell death, which has been shown to occur in CA1 neurons following ischemia, but is less pronounced in the CA3 region (Li et al., 2022 ; Park et al., 2011 ). Alternatively, CA2-3,DG neurons may shift metabolic priorities post-ischemia, reallocating resources to pathways more critical for survival and away from functions associated with Group 1 gene products. Moreover, the downregulation could be part of a negative feedback loop, fine-tuning the cellular response to I/R. Initial activation of Nrf2 target genes might trigger neuroprotective processes, such as increased antioxidant defense or the unfolded protein response, which, when reaching a certain threshold, induce feedback inhibition to prevent excessive or prolonged activation, as exemplified by the Nrf2-p97-Nrf2 loop (Shakya et al., 2023 ) and supported by the broader context of Nrf2 regulation in stroke (Khassafi et al., 2024 ). Fourthly, it cannot be excluded that while in silico analysis predicted these genes as Nrf2 targets, their regulation may also involve other transcription factors or post-transcriptional mechanisms, particularly in the context of regional stress responses. Lastly, the discordance between SHISA2 mRNA and protein levels highlights the crucial role of post-transcriptional mechanisms, such as regulation of mRNA stability, translational control, or protein degradation (Neag et al., 2022 ). These findings underline the limitations of relying solely on transcriptional profiling, especially during stress when translational and post-translational regulation can significantly alter protein abundance and activity. The observed regional differences also suggest that Nrf2 activity itself could be differentially regulated in CA1 and CA2-3,DG after I/R. Although our previous work showed post-ischemic elevated Nrf2 activity in both regions, though with different dynamics (Lewczuk et al., 2023b ), downstream effects appear to diverge, with CA2-3,DG exhibiting a more complex response involving up- and downregulation of putative Nrf2 targets. This could be due to region-specific cofactors or modulators that influence Nrf2 transcriptional activity or the activation of distinct signaling pathways that intersect Nrf2 signaling in CA2-3,DG. Future studies using cell-type-specific analyses would help further address this important issue. In contrast to Group 1, genes assigned to Group 2 ( AIFM2, BRIP1, CAMK1 , and TDO2 ) showed a pattern of delayed upregulation specifically in CA2-3,DG following I/R (Fig. 4 ). This delayed response, particularly evident for AIFM2 and BRIP1 , suggests that these genes may be involved in later-stage neuroprotective processes, possibly contributing to the enhanced recovery and repair capacity of CA2-3,DG. This delayed response, particularly evident for AIFM2 and BRIP1, suggests that these genes may be involved in later-stage neuroprotective processes, possibly contributing to the enhanced recovery and repair capacity of CA2-3,DG. The observation that AIFM2 (also known as FSP1) protein levels increased prior to mRNA upregulation (Fig. 4 A, B) suggests that AIFM2 may in part be under post-transcriptional control during reperfusion after I/R. Indeed, recent research indicates that AIFM2 acts as a crucial factor in regulating ferroptosis (Doll et al., 2019 ). This regulation depends on the GSH- and NAD(P)H-dependent antioxidant activity of the protein (Bersuker et al., 2019 ). Therapeutic interventions against ferroptosis have been proposed to be based not only on the inhibition of lipid peroxidation but also on enhancement of AIFM2 antioxidant activity. Our study also showed that BRIP1 displayed a sustained and significant increase in mRNA expression in CA2-3, DG, which contrasted with the decrease in CA1. This transcriptional change was partially reflected at the protein level. This may confirm a positive role for Nrf2 in mitigating the effects of I/R injury through modulation of BRIP1 expression in CA2-3,DG. BRIP1 encodes a DNA-dependent ATPase and a 5'-3' DNA helicase required for the maintenance of chromosomal stability and involved in the repair of DNA double-strand breaks by homologous recombination, in a manner dependent on its association with BRCA1 (Bridge et al., 2005 ; Cantor et al., 2004 ). BRIP1 has also been shown to play an important role in maintaining neuronal cell health and homeostasis by suppressing cellular oxidative stress (Mani et al., 2022 ). Similarly to BRIP1 , CAMK1 expression was significantly upregulated in the CA2-3,DG region, while protein levels (Fig. 4 F) were significantly elevated at every time point in CA2-3,DG and remained relatively stable in CA1. CaMK1 is an element of the Ca 2+ /CaM-dependent protein kinase signaling cascade (Colomer and Means, 2007 ). A CaM kinase cascade is important for many normal physiological processes that, when misregulated, can lead to a variety of disease states. These processes include neuronal growth and functions related to brain development, synaptic plasticity, as well as memory formation and maintenance (Colomer and Means, 2007 ; Najar et al., 2021 ). The expression of TDO2 mRNA in CA2-3,DG showed a tendency towards upregulation at all time points post-ischemia (Fig. 4 G), reaching significance at 48 h, further supporting the notion that delayed upregulation of specific genes in CA2-3,DG may contribute to the enhanced resistance of this region. A tryptophan 2,3-dioxygenase (TDO2) is involved in tryptophan metabolism (Moroni, 1999 ). Tryptophan is metabolized primarily along the kynurenine pathway, of which two components are known to have marked effects on neurons in the central nervous system. Quinolinic acid is an agonist at NMDA-sensitive glutamate receptors, and kynurenic acid (KYNA) is an antagonist at several glutamate receptors (Stone et al., 2003 ). It is tempting to suggest that the observed post-ischemic increase in TDO2 protein may lead to increased synthesis of the neuroprotective KYNA. However, KYNA concentration is subject to complex regulation, including its synthesis by kynurenine aminotransferases and degradation by kynureninase (Kloc and Urbanska, 2024 ). Further studies are required to determine the actual involvement of these proteins in the mechanisms protecting CA2-3,DG neurons. The group 3 genes ( FZD7 , ITGB8 , PHGDH , and STC2 ) exhibited a distinct response compared to previous groups, showing no significant transcriptional changes in CA2-3,DG after I/R (Fig. 5 ). This suggests that their regulation in this context may not be directly linked to the Nrf2-driven response seen in Group 1 and 2 genes. However, the observed increases in FZD7, PHGDH, and STC2 protein levels in CA2-3,DG at various time points post-I/R (Figs. 5 B, F, H) indicate that post-transcriptional mechanisms may play a role in modulating their abundance and activity. In particular, elevated levels of the FZD7 protein align with other studies implicating activation of Wnt signaling after cerebral ischemia (Mo et al., 2022 ). Given the established role of Wnt signaling in neuroprotection and post-ischemic brain repair, particularly in modulating the adult neural stem cell niche (Xu et al., 2024 ), the increased FZD7 protein levels could contribute to the relative resistance of the CA2-3,DG region. Finally, Group 4 genes ( CXCL12 , GPC1 , HRK , and LRP8 ) displayed inconsistent and region-specific responses to I/R (Fig. 6 ), defying easy categorization. These genes may be regulated by various factors beyond Nrf2, including interactions with other stress-responsive pathways or region-specific epigenetic modifications. For example, the divergent responses of CXCL12 in CA1 and CA2-3,DG at 24 h post-reperfusion suggest a dynamic relationship of regulatory mechanisms. CXCL12 has been proven to be broadly neuroprotective, with roles in modulating inflammatory responses (Guyon, 2014 ) and promoting neuronal regeneration after cerebral ischemia (Cheng et al., 2017 ). Moreover, CXCL12 has been shown to modulate synaptic transmission to immature neurons during post-ischemic cerebral repair (Ardelt et al., 2013 ). Changes in CXCL12 expression early after reperfusion may reflect a mobilization of protective responses, which seem to be less effective in the vulnerable CA1 region. Furthermore, our results demonstrate a delayed increase in GPC1 in CA2-3,DG only at 96 h. Interestingly, GPC1, a heparan sulfate proteoglycan, has been implicated in the clearance of amyloid-β (Aβ) in the brain (Ozsan McMillan et al., 2023 ), suggesting a potential neuroprotective role. This delayed upregulation of GPC1 may represent a specific response initiated by the CA2-3,DG region at later stages following I/R, which is not observed in CA1. Similarly, our data indicate a sustained significant decrease in HRK mRNA levels in CA2-3,DG at later time points, contrasted by unchanging levels in CA1 (Fig. 6 ). Given that HRK, also known as DP5, is a pro-apoptotic protein induced by cellular stress (Imaizumi et al., 1999 ), its sustained downregulation in CA2-3,DG could contribute to the region's resistance to ischemic injury by limiting apoptosis. Finally, LRP8 mRNA, encoding a receptor involved in Reelin signaling (Beffert et al., 2005 ; D'Arcangelo et al., 1997 ), was reduced in CA1 at 72 h and 96 h post-I/R, while in CA2-3,DG it tended to decrease at 96 h, but remained relatively stable (Fig. 6 D). The relative preservation of LRP8 expression in CA2-3,DG, coupled with HRK downregulation, could contribute to an environment that favors cell survival in this region following I/R. The functional significance of these varied responses requires further investigation. 5. Conclusions Our findings emphasize the complexity of the hippocampal response to ischemia/reperfusion injury, revealing distinct patterns of gene expression across different subregions and time points. The observed variability challenges the simplistic view of a uniform neuroprotective mechanism mediated by Nrf2. Instead, it suggests that Nrf2 likely interacts with other signaling pathways in a region-specific and context-specific way. The frequent discordance between mRNA and protein levels further highlights the intricacy of this issue. This illustrates the crucial role of post-transcriptional regulation in shaping the post-ischemic proteome. These results offer new insights into the molecular mechanisms that explain the varying vulnerability of the hippocampal regions to I/R injury. They also suggest that neuroprotection may involve complex interactions between transcriptional and post-transcriptional regulatory networks. Further research into these pathways is critical. Understanding how these identified up- and downregulated genes respond to pharmacological Nrf2 activation holds the potential to unlock novel strategies for enhancing endogenous neuroprotective mechanisms in the hippocampus, ultimately leading to more effective therapies for stroke. Abbreviations ARE Antioxidant Response Element CA2-3,DG Cornu Ammonis areas 2 and 3, and Dentate Gyrus (of the hippocampus) Ct Cycle Threshold ERK Extracellular signal-regulated kinase FPKM Fragments Per Kilobase per Million mapped fragments GDNF Glial cell line-derived neurotrophic factor GCLC Glutamate-cysteine ligase, catalytic subunit GCLM Glutamate-cysteine ligase, modulatory subunit GPx1 Glutathione peroxidase 1 GSEA Gene Set Enrichment Analysis GSH Glutathione I/R Ischemia/Reperfusion HO-1 Heme oxygenase-1 Keap1 Kelch-like ECH-associated protein 1 KYNA Kynurenic acid LDHB L-lactate dehydrogenase B chain MAGUK Membrane-associated guanylate kinase NAD(P)H Nicotinamide adenine dinucleotide phosphate NMDA N-methyl-D-aspartate Nrf2 Nuclear factor-erythroid 2-related factor 2 PCs Pyramidal cells PMSF Phenylmethylsulfonyl fluoride RT-qPCR Quantitative Real-Time Polymerase Chain Reaction RT Room Temperature scRNA-Seq single-cell RNA sequencing SDS-PAGE Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis TBST Tris-Buffered Saline with Tween 20 TIA Transient Ischemic Attack Wnt Wingless-related integration site. Declarations Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Funding This work was supported by the Internal MMRI PAS Project. Data availability Data will be made available on request. Declaration of generative AI and AI-assisted technologies in the writing process The writers edited and proofread the document using AI models (Writefull and Google Gemini) to improve readability and language of this work. The authors assumed complete responsibility for the publication's content and revised and edited it as needed. Author Contribution A.L. and B.Z. conceptualized and supervised the study. A.L. was responsible for funding acquisition and project administration. The methodology was designed and the investigation was performed by A.L., A.B.-J., Ł.C., and M.B.-H. Formal analysis and data curation were conducted by A.L., A.B.-J., Ł.C., and M.B.-H. Visualization and preparation of figures were performed by A.B.-J. and Ł.C. A.B.-J. wrote the original draft of the manuscript. All authors participated in the review and editing of the final manuscript. References Abdollahi Nejat M, Klaassen RV, Spijker S, Smit AB. Auxiliary subunits of the AMPA receptor: The Shisa family of proteins. Curr Opin Pharmacol. 2021;58:52–61. Airaksinen MS, Saarma M. The GDNF family: signalling, biological functions and therapeutic value. Nat Rev Neurosci. 2002;3:383–94. Ardelt AA, Bhattacharyya BJ, Belmadani A, Ren D, Miller RJ. Stromal derived growth factor-1 (CXCL12) modulates synaptic transmission to immature neurons during post-ischemic cerebral repair. Exp Neurol. 2013;248:246–53. Bartsch T, Wulff P. The hippocampus in aging and disease: From plasticity to vulnerability. Neuroscience. 2015;309:1–16. Beffert U, Weeber EJ, Durudas A, Qiu S, Masiulis I, Sweatt JD, Li WP, Adelmann G, Frotscher M, Hammer RE, Herz J. Modulation of synaptic plasticity and memory by Reelin involves differential splicing of the lipoprotein receptor Apoer2. Neuron. 2005;47:567–79. Bell KF, Al-Mubarak B, Martel MA, McKay S, Wheelan N, Hasel P, Márkus NM, Baxter P, Deighton RF, Serio A, Bilican B, Chowdhry S, Meakin PJ, Ashford ML, Wyllie DJ, Scannevin RH, Chandran S, Hayes JD, Hardingham GE. Neuronal development is promoted by weakened intrinsic antioxidant defences due to epigenetic repression of Nrf2. Nat Commun. 2015;6:7066. Beresewicz-Haller M. Hippocampal region-specific endogenous neuroprotection as an approach in the search for new neuroprotective strategies in ischemic stroke. Fiction or fact? Neurochem Int. 2023;162:105455. Bersuker K, Hendricks JM, Li Z, Magtanong L, Ford B, Tang PH, Roberts MA, Tong B, Maimone TJ, Zoncu R, Bassik MC, Nomura DK, Dixon SJ, Olzmann JA. The CoQ oxidoreductase FSP1 acts parallel to GPX4 to inhibit ferroptosis. Nature. 2019;575:688–92. Beręsewicz-Haller M, Krupska O, Bochomulski P, Dudzik D, Chęcińska A, Hilgier W, Barbas C, Zablocki K, Zablocka B. 2021. Mitochondrial Metabolism behind Region-Specific Resistance to Ischemia-Reperfusion Injury in Gerbil Hippocampus. Role of PKCβII and Phosphate-Activated Glutaminase. Int J Mol Sci 22. Brandes MS, Gray NE. NRF2 as a Therapeutic Target in Neurodegenerative Diseases. ASN Neuro. 2020;12:1759091419899782. Bridge WL, Vandenberg CJ, Franklin RJ, Hiom K. The BRIP1 helicase functions independently of BRCA1 in the Fanconi anemia pathway for DNA crosslink repair. Nat Genet. 2005;37:953–7. Cantor S, Drapkin R, Zhang F, Lin Y, Han J, Pamidi S, Livingston DM. The BRCA1-associated protein BACH1 is a DNA helicase targeted by clinically relevant inactivating mutations. Proc Natl Acad Sci U S A. 2004;101:2357–62. Cembrowski MS, Wang L, Sugino K, Shields BC, Spruston N. 2016. Hipposeq: a comprehensive RNA-seq database of gene expression in hippocampal principal neurons. Elife 5, e14997. Cheng X, Wang H, Zhang X, Zhao S, Zhou Z, Mu X, Zhao C, Teng W. The Role of SDF-1/CXCR4/CXCR7 in Neuronal Regeneration after Cerebral Ischemia. Front Neurosci. 2017;11:590. Cohan CH, Stradecki-Cohan HM, Morris-Blanco KC, Khoury N, Koronowski KB, Youbi M, Wright CB, Perez-Pinzon MA. Protein kinase C epsilon delays latency until anoxic depolarization through arc expression and GluR2 internalization. J Cereb Blood Flow Metab. 2017;37:3774–88. Colomer J, Means AR. Physiological roles of the Ca2+/CaM-dependent protein kinase cascade in health and disease. Subcell Biochem. 2007;45:169–214. D'Arcangelo G, Nakajima K, Miyata T, Ogawa M, Mikoshiba K, Curran T. Reelin is a secreted glycoprotein recognized by the CR-50 monoclonal antibody. J Neurosci. 1997;17:23–31. Dang J, Brandenburg LO, Rosen C, Fragoulis A, Kipp M, Pufe T, Beyer C, Wruck CJ. Nrf2 expression by neurons, astroglia, and microglia in the cerebral cortical penumbra of ischemic rats. J Mol Neurosci. 2012;46:578–84. Dinkova-Kostova AT, Kostov RV, Kazantsev AG. The role of Nrf2 signaling in counteracting neurodegenerative diseases. FEBS J. 2018;285:3576–90. Dluzniewska J, Sarnowska A, Beresewicz M, Johnson I, Srai SK, Ramesh B, Goldspink G, Górecki DC, Zabłocka B. A strong neuroprotective effect of the autonomous C-terminal peptide of IGF-1 Ec (MGF) in brain ischemia. FASEB J. 2005;19:1896–8. Doll S, Freitas FP, Shah R, Aldrovandi M, da Silva MC, Ingold I, Goya Grocin A, Xavier da Silva TN, Panzilius E, Scheel CH, Mourão A, Buday K, Sato M, Wanninger J, Vignane T, Mohana V, Rehberg M, Flatley A, Schepers A, Kurz A, White D, Sauer M, Sattler M, Tate EW, Schmitz W, Schulze A, Donnell V, Proneth B, Popowicz GM, Pratt DA, Angeli JPF, Conrad M. FSP1 is a glutathione-independent ferroptosis suppressor. Nature. 2019;575:693–8. Dudek SM, Alexander GM, Farris S. Rediscovering area CA2: unique properties and functions. Nat Rev Neurosci. 2016;17:89–102. Dudok JJ, Sanz AS, Lundvig DM, Wijnholds J. MPP3 is required for maintenance of the apical junctional complex, neuronal migration, and stratification in the developing cortex. J Neurosci. 2013;33:8518–27. Einenkel AM, Salameh A. Selective vulnerability of hippocampal CA1 and CA3 pyramidal cells: What are possible pathomechanisms and should more attention be paid to the CA3 region in future studies? J Neurosci Res. 2024;102:e25276. Farina M, Vieira LE, Buttari B, Profumo E, Saso L. 2021. The Nrf2 Pathway in Ischemic Stroke: A Review. Molecules 26. Goodfellow MJ, Borcar A, Proctor JL, Greco T, Rosenthal RE, Fiskum G. Transcriptional activation of antioxidant gene expression by Nrf2 protects against mitochondrial dysfunction and neuronal death associated with acute and chronic neurodegeneration. Exp Neurol. 2020;328:113247. Guyon A. CXCL12 chemokine and its receptors as major players in the interactions between immune and nervous systems. Front Cell Neurosci. 2014;8:65. Himeda T, Hayakawa N, Tounai H, Sakuma M, Kato H, Araki T. Alterations of interneurons of the gerbil hippocampus after transient cerebral ischemia: effect of pitavastatin. Neuropsychopharmacology. 2005;30:2014–25. Holmström KM, Kostov RV, Dinkova-Kostova AT. The multifaceted role of Nrf2 in mitochondrial function. Curr Opin Toxicol. 2016;1:80–91. Imaizumi K, Morihara T, Mori Y, Katayama T, Tsuda M, Furuyama T, Wanaka A, Takeda M, Tohyama M. The cell death-promoting gene DP5, which interacts with the BCL2 family, is induced during neuronal apoptosis following exposure to amyloid beta protein. J Biol Chem. 1999;274:7975–81. Kawalec M, Wojtyniak P, Bielska E, Lewczuk A, Boratyńska-Jasińska A, Beręsewicz-Haller M, Frontczak-Baniewicz M, Gewartowska M, Zabłocka B. Mitochondrial dynamics, elimination and biogenesis during post-ischemic recovery in ischemia-resistant and ischemia-vulnerable gerbil hippocampal regions. Biochim Biophys Acta Mol Basis Dis. 2023;1869:166633. Kerins MJ, Ooi A. The Roles of NRF2 in Modulating Cellular Iron Homeostasis. Antioxid Redox Signal. 2018;29:1756–73. Khassafi N, Tameh A, Mirzaei A, Rafat H, Barati A, Vahidinia S, Z. Crosstalk between Nrf2 signaling pathway and inflammation in ischemic stroke: Mechanisms of action and therapeutic implications. Exp Neurol. 2024;373:114655. Kim H, Ahn JH, Song M, Kim DW, Lee TK, Lee JC, Kim YM, Kim JD, Cho JH, Hwang IK, Yan BC, Won MH, Park JH. Pretreated fucoidan confers neuroprotection against transient global cerebral ischemic injury in the gerbil hippocampal CA1 area via reducing of glial cell activation and oxidative stress. Biomed Pharmacother. 2019;109:1718–27. Kim JW, Botvinnik OB, Abudayyeh O, Birger C, Rosenbluh J, Shrestha Y, Abazeed ME, Hammerman PS, DiCara D, Konieczkowski DJ, Johannessen CM, Liberzon A, Alizad-Rahvar AR, Alexe G, Aguirre A, Ghandi M, Greulich H, Vazquez F, Weir BA, Van Allen EM, Tsherniak A, Shao DD, Zack TI, Noble M, Getz G, Beroukhim R, Garraway LA, Ardakani M, Romualdi C, Sales G, Barbie DA, Boehm JS, Hahn WC, Mesirov JP, Tamayo P. Characterizing genomic alterations in cancer by complementary functional associations. Nat Biotechnol. 2016;34:539–46. Kirino T. Delayed neuronal death in the gerbil hippocampus following ischemia. Brain Res. 1982;239:57–69. Kirino T. Delayed neuronal death. Neuropathology. 2000;20(Suppl):S95–97. Kloc R, Urbanska EM. 2024. Memantine and the Kynurenine Pathway in the Brain: Selective Targeting of Kynurenic Acid in the Rat Cerebral Cortex. Cells 13. Lan X, Wang Q, Liu Y, You Q, Wei W, Zhu C, Hai D, Cai Z, Yu J, Zhang J, Liu N. Isoliquiritigenin alleviates cerebral ischemia-reperfusion injury by reducing oxidative stress and ameliorating mitochondrial dysfunction via activating the Nrf2 pathway. Redox Biol. 2024;77:103406. Lee TH, Yang JT, Lin JR, Hu CJ, Chou WH, Lin CP, Chi NF. Protective effects of ischemic preconditioning against neuronal apoptosis and dendritic injury in the hippocampus are age-dependent. J Neurochem. 2020;155:430–47. Levine S, Sohn D. Cerebral ischemia in infant and adult gerbils. Relation to incomplete circle of Willis. Arch Pathol. 1969;87:315–7. Levings DC, Pathak SS, Yang YM, Slattery M. Limited expression of Nrf2 in neurons across the central nervous system. Redox Biol. 2023;65:102830. Lewczuk A, Boratyńska-Jasińska A, Zabłocka B. 2023a. Validation of the Reference Genes for Expression Analysis in the Hippocampus after Transient Ischemia/Reperfusion Injury in Gerbil Brain. Int J Mol Sci 24. Lewczuk A, Zablocka B, Beresewicz-Haller M. Is Nrf2 Behind Endogenous Neuroprotection of the Hippocampal CA2-4,DG Region? Mol Neurobiol. 2023b;60:1645–58. Li C, Wu Z, Xue H, Gao Q, Zhang Y, Wang C, Zhao P. Ferroptosis contributes to hypoxic-ischemic brain injury in neonatal rats: Role of the SIRT1/Nrf2/GPx4 signaling pathway. CNS Neurosci Ther. 2022;28:2268–80. Li Y, Zhang J. Animal models of stroke. Anim Model Exp Med. 2021;4:204–19. Liberzon A, Birger C, Thorvaldsdóttir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 2015;1:417–25. Liberzon A, Subramanian A, Pinchback R, Thorvaldsdóttir H, Tamayo P, Mesirov JP. Molecular signatures database (MSigDB) 3.0. Bioinformatics. 2011;27:1739–40. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–8. López-Morales MA, Castelló-Ruiz M, Burguete MC, Hervás D, Pérez-Pinzón MA, Salom JB. Effect and mechanisms of resveratrol in animal models of ischemic stroke: A systematic review and Bayesian meta-analysis. J Cereb Blood Flow Metab. 2023;43:2013–28. Mani C, Acharya G, Kshirsagar S, Vijayan M, Khan H, Reddy PH, Palle K. A Novel Role for BRIP1/FANCJ in Neuronal Cells Health and in Resolving Oxidative Stress-Induced DNA Lesions. J Alzheimers Dis. 2022;85:207–21. Mayer C, Riera-Ponsati L, Kauppinen S, Klitgaard H, Erler JT, Hansen SN. Targeting the NRF2 pathway for disease modification in neurodegenerative diseases: mechanisms and therapeutic implications. Front Pharmacol. 2024;15:1437939. McEwen BS. Physiology and neurobiology of stress and adaptation: central role of the brain. Physiol Rev. 2007;87:873–904. Mo Z, Zeng Z, Liu Y, Zeng L, Fang J, Ma Y. Activation of Wnt/Beta-Catenin Signaling Pathway as a Promising Therapeutic Candidate for Cerebral Ischemia/Reperfusion Injury. Front Pharmacol. 2022;13:914537. Mootha VK, Lindgren CM, Eriksson KF, Subramanian A, Sihag S, Lehar J, Puigserver P, Carlsson E, Ridderstråle M, Laurila E, Houstis N, Daly MJ, Patterson N, Mesirov JP, Golub TR, Tamayo P, Spiegelman B, Lander ES, Hirschhorn JN, Altshuler D, Groop LC. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet. 2003;34:267–73. Moroni F. Tryptophan metabolism and brain function: focus on kynurenine and other indole metabolites. Eur J Pharmacol. 1999;375:87–100. Muramatsu H, Katsuoka F, Toide K, Shimizu Y, Furusako S, Yamamoto M. Nrf2 deficiency leads to behavioral, neurochemical and transcriptional changes in mice. Genes Cells. 2013;18:899–908. Najar MA, Rex DAB, Modi PK, Agarwal N, Dagamajalu S, Karthikkeyan G, Vijayakumar M, Chatterjee A, Sankar U, Prasad TSK. A complete map of the Calcium/calmodulin-dependent protein kinase kinase 2 (CAMKK2) signaling pathway. J Cell Commun Signal. 2021;15:283–90. Neag MA, Mitre AO, Burlacu CC, Inceu AI, Mihu C, Melincovici CS, Bichescu M, Buzoianu AD. miRNA Involvement in Cerebral Ischemia-Reperfusion Injury. Front Neurosci. 2022;16:901360. Neves D, Salazar IL, Almeida RD, Silva RM. Molecular mechanisms of ischemia and glutamate excitotoxicity. Life Sci. 2023;328:121814. Ozsan McMillan I, Li JP, Wang L. Heparan sulfate proteoglycan in Alzheimer's disease: aberrant expression and functions in molecular pathways related to amyloid-β metabolism. Am J Physiol Cell Physiol. 2023;324:C893–909. Park UJ, Lee YA, Won SM, Lee JH, Kang SH, Springer JE, Lee YB, Gwag BJ. Blood-derived iron mediates free radical production and neuronal death in the hippocampal CA1 area following transient forebrain ischemia in rat. Acta Neuropathol. 2011;121:459–73. Plotly Technologies Inc. Collaborative data science. Montréal. QC; 2015. https://plot.ly . Raghunath A, Sundarraj K, Nagarajan R, Arfuso F, Bian J, Kumar AP, Sethi G, Perumal E. Antioxidant response elements: Discovery, classes, regulation and potential applications. Redox Biol. 2018;17:297–314. Ramos-Vicente D, Bayés À. AMPA receptor auxiliary subunits emerged during early vertebrate evolution by neo/subfunctionalization of unrelated proteins. Open Biol. 2020;10:200234. Schmidt-Kastner R, Freund TF. Selective vulnerability of the hippocampus in brain ischemia. Neuroscience. 1991;40:599–636. Shakya A, Liu P, Godek J, McKee NW, Dodson M, Anandhan A, Ooi A, Garcia JGN, Costa M, Chapman E, Zhang DD. The NRF2-p97-NRF2 negative feedback loop. Redox Biol. 2023;65:102839. Stone TW, Mackay GM, Forrest CM, Clark CJ, Darlington LG. Tryptophan metabolites and brain disorders. Clin Chem Lab Med. 2003;41:852–9. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102:15545–50. Sun Y, Yang X, Xu L, Jia M, Zhang L, Li P, Yang P. The Role of Nrf2 in Relieving Cerebral Ischemia-Reperfusion Injury. Curr Neuropharmacol. 2023;21:1405–20. Takagi T, Kitashoji A, Iwawaki T, Tsuruma K, Shimazawa M, Yoshimura S, Iwama T, Hara H. Temporal activation of Nrf2 in the penumbra and Nrf2 activator-mediated neuroprotection in ischemia-reperfusion injury. Free Radic Biol Med. 2014;72:124–33. Treanor JJ, Goodman L, de Sauvage F, Stone DM, Poulsen KT, Beck CD, Gray C, Armanini MP, Pollock RA, Hefti F, Phillips HS, Goddard A, Moore MW, Buj-Bello A, Davies AM, Asai N, Takahashi M, Vandlen R, Henderson CE, Rosenthal A. Characterization of a multicomponent receptor for GDNF. Nature. 1996;382:80–3. Tulsulkar J, Shah ZA. Ginkgo biloba prevents transient global ischemia-induced delayed hippocampal neuronal death through antioxidant and anti-inflammatory mechanism. Neurochem Int. 2013;62:189–97. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. 2012. Primer3–new capabilities and interfaces. Nucleic Acids Res 40, e115. Xu J, Liu S, Xu L, Zhang Y, Jiang W, Chu L. Therapeutic Strategies for Ischemic Stroke: Modulating the Adult Neural Stem Cell Niche through the Wnt/β-catenin Pathway. J Integr Neurosci. 2024;23:131. Zgorzynska E, Dziedzic B, Walczewska A. 2021. An Overview of the Nrf2/ARE Pathway and Its Role in Neurodegenerative Diseases. Int J Mol Sci 22. Zhang R, Xu M, Wang Y, Xie F, Zhang G, Qin X. Nrf2-a Promising Therapeutic Target for Defensing Against Oxidative Stress in Stroke. Mol Neurobiol. 2017;54:6006–17. Zhang RJ, Li Y, Liu Q, Gao YJ, Du J, Ma J, Sun SG, Wang L. Differential Expression Profiles and Functional Prediction of Circular RNAs and Long Non-coding RNAs in the Hippocampus of Nrf2-Knockout Mice. Front Mol Neurosci. 2019;12:196. Zheng CY, Seabold GK, Horak M, Petralia RS. MAGUKs, synaptic development, and synaptic plasticity. Neuroscientist. 2011;17:493–512. Ziemka-Nałecz M, Zalewska T, Zajac H, Domańska-Janik K. Decrease of PKC precedes other cellular signs of calpain activation in area CA1 of the hippocampus after transient cerebral ischemia. Neurochem Int. 2003;42:205–14. Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial.docx Cite Share Download PDF Status: Published Journal Publication published 15 Oct, 2025 Read the published version in Pharmacological Reports → Version 1 posted Editorial decision: Revision requested 22 Aug, 2025 Reviews received at journal 18 Aug, 2025 Reviews received at journal 11 Aug, 2025 Reviewers agreed at journal 08 Aug, 2025 Reviews received at journal 07 Aug, 2025 Reviewers agreed at journal 07 Aug, 2025 Reviewers agreed at journal 07 Aug, 2025 Reviewers agreed at journal 06 Aug, 2025 Reviewers invited by journal 06 Aug, 2025 Editor assigned by journal 06 Aug, 2025 Submission checks completed at journal 06 Aug, 2025 First submitted to journal 01 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-7272615\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":false,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":498347637,\"identity\":\"763b5579-9e81-4644-bee7-bca12ca5b488\",\"order_by\":0,\"name\":\"Anita Lewczuk\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Polish Academy of Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Anita\",\"middleName\":\"\",\"lastName\":\"Lewczuk\",\"suffix\":\"\"},{\"id\":498347638,\"identity\":\"37f1d5b0-02b4-434c-9833-1ad69a306bd5\",\"order_by\":1,\"name\":\"Anna Boratyńska-Jasińska\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABAklEQVRIiWNgGAWjYDACCRiDh4HxQQIDMw9MQAa/lgSwFmYDZC08xGhhA7KZGQhq4Z/dfOzDzx+H8+R7Dj+reJhjLSPZwHvwcwHDHZxaJO4cS57Zk3C42OBsm9mNxG3pPNIMfMnSMxie4XbYjRxjBp6Ew4kb+BlAWg7zyDHwGEjzMBzGqUUeqIXxD1DL/H72bwVQLca/8WkxAGphBtnScLbHjAGkRZqBxwyvLYZAvzDLpKUnbjhzplgC5BfJZr40ax4D3H6Ru918mPGNjXXi/J70jR9/brO2lzjee/g2T8UdOZzeh4BmJDYzyHyDAwR0MNQhc8BOIqhlFIyCUTAKRg4AAIuOU2wcgHmLAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Polish Academy of Sciences\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Anna\",\"middleName\":\"\",\"lastName\":\"Boratyńska-Jasińska\",\"suffix\":\"\"},{\"id\":498347639,\"identity\":\"1af4b647-e8ea-4d52-a8b7-c39934d6fd70\",\"order_by\":2,\"name\":\"Łukasz Charzewski\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Proacta\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Łukasz\",\"middleName\":\"\",\"lastName\":\"Charzewski\",\"suffix\":\"\"},{\"id\":498347640,\"identity\":\"41163072-bb0e-4404-af10-d803d488d6f6\",\"order_by\":3,\"name\":\"Małgorzata Beręsewicz-Haller\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Polish Academy of Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Małgorzata\",\"middleName\":\"\",\"lastName\":\"Beręsewicz-Haller\",\"suffix\":\"\"},{\"id\":498347641,\"identity\":\"b49520de-6e83-4631-b91b-22652f163c52\",\"order_by\":4,\"name\":\"Barbara Zabłocka\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Polish Academy of Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Barbara\",\"middleName\":\"\",\"lastName\":\"Zabłocka\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-08-01 15:23:13\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-7272615/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-7272615/v1\",\"draftVersion\":[],\"editorialEvents\":[{\"content\":\"https://doi.org/10.1007/s43440-025-00792-9\",\"type\":\"published\",\"date\":\"2025-10-15T15:57:00+00:00\"}],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":88780339,\"identity\":\"361d64ab-898c-4349-89f4-ba67633388e2\",\"added_by\":\"auto\",\"created_at\":\"2025-08-11 10:44:46\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":94991,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eHeatmap Representation of Relative Gene Expression in Hippocampal Subregions - Comparison to Dorsal CA1.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eValues represent the base-10 logarithm of the FPKM ratio between the indicated region and the reference region (dorsal CA1). Blank cells indicate missing data in the database, probably due to undetectable or inconsistent expression.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7272615/v1/0430ea6e99a2ea24c2eee687.png\"},{\"id\":88779357,\"identity\":\"33936d44-1dd7-438b-9835-7b2fa36b7ba7\",\"added_by\":\"auto\",\"created_at\":\"2025-08-11 10:36:46\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":56200,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eExpression (A) and Immunoreactivity (B) of Selected Genes and Proteins in Hippocampal Subregions. \\u003c/strong\\u003eExpression levels were quantified using the ΔΔCt method, while immunoreactivity levels were normalized to LDHB protein immunoreactivity. Both are expressed in arbitrary units (AU).\\u003cstrong\\u003e \\u003c/strong\\u003eData represent mean ± standard deviation (n=3-6). One-sample t-tests were used to compare the CA1 and CA2-3,DG regions in control animals. *p \\u0026lt; 0.05, **p \\u0026lt; 0.01, ***p \\u0026lt; 0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7272615/v1/23b1577613936c8998ed2e88.png\"},{\"id\":88779364,\"identity\":\"a25c69c8-d125-49e3-ae20-c9dc230eb837\",\"added_by\":\"auto\",\"created_at\":\"2025-08-11 10:36:46\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":278719,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eExpression Profiles of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eMPP3\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e, \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eRET\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e, and \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eSHISA2\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e in the Hippocampus Following I/R. \\u003c/strong\\u003eRelative gene expression levels of (A) \\u003cem\\u003eMPP3\\u003c/em\\u003e, (B) \\u003cem\\u003eRET\\u003c/em\\u003e, and (C) \\u003cem\\u003eSHISA2\\u003c/em\\u003e (group of genes exhibiting consistent basal expression patterns) in the CA1 and CA2-3,DG regions of the hippocampus at various time points (24, 48, 72, and 96 hours) after 5 minutes of global cerebral ischemia followed by reperfusion. (D) Representative Western blot and densitometric analysis of SHISA2 protein levels in CA1 and CA2-3,DG lysates. SHISA2 protein levels were normalized to LDHB. For each experimental group, proteins were separated on a single gel, transferred to one membrane, and probed sequentially for proteins of interest and the LDHB loading control after stripping. A single, representative LDHB blot is shown for illustrative purposes. Data are presented as mean ± standard deviation. Individual data points represent biological replicates (n=4-7). One-way ANOVA followed by Dunnett's multiple comparison test (all columns vs. control) was performed for each hippocampal region independently. (*p\\u0026lt;0.05, **p\\u0026lt;0.01, ***p\\u0026lt;0.001).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7272615/v1/44dd55d5ead202fc10e9f5c7.png\"},{\"id\":88780343,\"identity\":\"ff21d0d3-400f-48d7-9662-f14d93491c15\",\"added_by\":\"auto\",\"created_at\":\"2025-08-11 10:44:46\",\"extension\":\"jpeg\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":244490,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eExpression Profiles of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eAIFM2\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e, \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eBRIP1\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e, \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eCAMK1, \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003eand\\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003e TDO2\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e in the Hippocampus Following I/R. \\u003c/strong\\u003eRelative gene expression levels of (A) \\u003cem\\u003eAIFM2\\u003c/em\\u003e, (C) \\u003cem\\u003eBRIP1\\u003c/em\\u003e, (E) \\u003cem\\u003eCAMK1,\\u003c/em\\u003e and (G) \\u003cem\\u003eTDO2\\u003c/em\\u003e in the CA1 and CA2-3,DG regions of the hippocampus at various time points, after 5 minutes of global cerebral ischemia followed by reperfusion. These genes showed delayed upregulation in CA2-3,DG after I/R. Representative Western blots and densitometric analyses of (B) FSP1 (\\u003cem\\u003eAIFM2\\u003c/em\\u003e protein), (D) BRIP1, (F) CaMK1, and (H) TDO protein levels in CA1 and CA2-3,DG lysates. Protein levels were normalized to LDHB. For each experimental group, proteins were separated on a single gel, transferred to one membrane, and probed sequentially for proteins of interest and the LDHB loading control after stripping. A single, representative LDHB blot is shown for illustrative purposes. Data are presented as mean ± standard deviation. Individual data points represent biological replicates (n=4-7). One-way ANOVA followed by Dunnett's multiple comparison test (all columns vs. control) was performed for each hippocampal region independently. (*p\\u0026lt;0.05, **p\\u0026lt;0.01, ***p\\u0026lt;0.001).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage4.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7272615/v1/a585dc2eee795d968ae3cae6.jpeg\"},{\"id\":88779376,\"identity\":\"18742aeb-3426-45b0-a523-43d039671d6b\",\"added_by\":\"auto\",\"created_at\":\"2025-08-11 10:36:46\",\"extension\":\"jpeg\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":450449,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eExpression Profiles of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eFZD7\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e, \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eITGB8\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e, \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003ePHGDH, \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003eand\\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003e STC2\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e in the Hippocampus Following I/R. \\u003c/strong\\u003eRelative gene expression levels of (A) \\u003cem\\u003eFZD7\\u003c/em\\u003e, (C) \\u003cem\\u003eITGB8\\u003c/em\\u003e, (E) \\u003cem\\u003ePHGDH\\u003c/em\\u003e, and (G) \\u003cem\\u003eSTC2\\u003c/em\\u003e in the CA1 and CA2-3,DG regions of the hippocampus at various time points, after 5 minutes of global cerebral ischemia followed by reperfusion. This group of genes did not show significant changes in expression in CA2-3,DG after I/R. Representative Western blots and densitometric analyses of (B) FZD7, (D) ITGB8, (F) 3-PGDH (PHGDH protein), and (H) STC-2 protein levels in CA1 and CA2-3,DG lysates. Protein levels were normalized to LDHB. For each experimental group, proteins were separated on a single gel, transferred to one membrane, and probed sequentially for proteins of interest and the LDHB loading control after stripping. A single, representative LDHB blot is shown for illustrative purposes. Data are presented as mean ± standard deviation. Individual data points represent biological replicates (n=4-7). One-way ANOVA followed by Dunnett's multiple comparison test (all columns vs. control) was performed for each hippocampal region independently. (*p\\u0026lt;0.05, **p\\u0026lt;0.01, ***p\\u0026lt;0.001).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage5.jpeg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7272615/v1/ad1accf17e7f910a665b875f.jpeg\"},{\"id\":88779368,\"identity\":\"2a613eb8-db64-4ff4-b07d-c1021a00ad46\",\"added_by\":\"auto\",\"created_at\":\"2025-08-11 10:36:46\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":213728,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eExpression Profiles of \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eCXCL12\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e, \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eGPC1\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e, \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eHRK,\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e and \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eLRP8\\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e in the Hippocampus Following I/R.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eRelative mRNA expression levels of (A) \\u003cem\\u003eCXCL12\\u003c/em\\u003e, (B) \\u003cem\\u003eGPC1\\u003c/em\\u003e, (C) \\u003cem\\u003eHRK\\u003c/em\\u003e, and (D) \\u003cem\\u003eLRP8\\u003c/em\\u003e in the CA1 and CA2-3,DG regions of the hippocampus at various time points, after 5 minutes of global cerebral ischemia followed by reperfusion. These genes displayed inconsistent expression patterns that did not fit into the previously defined groups. For each experimental group, proteins were separated on a single gel, transferred to one membrane, and probed sequentially for proteins of interest and the LDHB loading control after stripping. A single, representative LDHB blot is shown for illustrative purposes. Data are presented as mean ± standard deviation. Individual data points represent biological replicates (n=4-7). One-way ANOVA followed by Dunnett's multiple comparison test (all columns vs. control) was performed for each hippocampal region independently. (*p\\u0026lt;0.05, **p\\u0026lt;0.01, ***p\\u0026lt;0.001).\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"floatimage6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7272615/v1/98afab521d1e70b6280f7d24.png\"},{\"id\":93955901,\"identity\":\"7a463606-60b8-4728-81f1-584850d9570c\",\"added_by\":\"auto\",\"created_at\":\"2025-10-20 16:05:47\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":2212487,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7272615/v1/0226cc51-f8e7-4150-9778-5a3cfdf9e7de.pdf\"},{\"id\":88780340,\"identity\":\"791f7231-e909-43b1-bb95-b6bc72e6e862\",\"added_by\":\"auto\",\"created_at\":\"2025-08-11 10:44:46\",\"extension\":\"docx\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":295862,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplementarymaterial.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-7272615/v1/8fe26bdaea5a4270411e00fb.docx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Integrated Computational and Experimental Approach to Identify Nrf2- regulated Molecular Targets in Cerebral Ischemia\",\"fulltext\":[{\"header\":\"1. Introduction\",\"content\":\"\\u003cp\\u003eNuclear factor-erythroid 2-related factor 2 (Nrf2) is a crucial transcription factor for a complex cellular defense system against oxidative and electrophilic stress (Dinkova-Kostova et al., \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). Under basal conditions, Nrf2 is sequestered in the cytoplasm by its repressor protein, Kelch-like ECH-associated protein 1 (Keap1), which targets Nrf2 for ubiquitination and proteasomal degradation (Itoh, 1999). However, under stress conditions, such as oxidative stress, Nrf2 is released from Keap1, allowing its translocation to the nucleus. Nuclear Nrf2 binds to antioxidant response elements (AREs) in the promoter regions of its target genes, initiating their transcription (Raghunath et al., \\u003cspan citationid=\\\"CR64\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e). The Nrf2 regulon includes hundreds of genes that are involved in various processes: antioxidant and anti-inflammatory responses, heme and iron metabolism, regulation of growth factors and other transcription factors, and metabolic adaptation (Holmstr\\u0026ouml;m et al., \\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e; Kerins and Ooi, \\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eThe hippocampus, a brain structure essential for learning and memory, is an area where the protective functions of transcription factors can be particularly significant, especially given its striking regional variations in vulnerability to transient cerebral ischemia. The different subregions of the hippocampus, including the Cornu Ammonis areas (CA1, CA2, and CA3) and the dentate gyrus (DG), exhibit distinct morphological and functional characteristics, as well as differential susceptibility to insults such as Alzheimer's disease, stroke and stress (Bartsch and Wulff, \\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e; McEwen, \\u003cspan citationid=\\\"CR53\\\" class=\\\"CitationRef\\\"\\u003e2007\\u003c/span\\u003e). Transient cerebral ischemia selectively damages CA1 pyramidal neurons, leading to delayed neuronal death, while leaving neurons in CA2, CA3, and DG relatively intact (Kirino, \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e2000\\u003c/span\\u003e; Ziemka-Nałecz et al., \\u003cspan citationid=\\\"CR80\\\" class=\\\"CitationRef\\\"\\u003e2003\\u003c/span\\u003e). This selective vulnerability of CA1 manifests itself morphologically within 24 hours after a brief ischemic episode, progressing to significant neuronal loss within 4\\u0026ndash;7 days (Dluzniewska et al., \\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e; Kawalec et al., \\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e). Mongolian gerbils have a unique cerebrovascular anatomy, specifically an incomplete circle of Willis, which makes them highly susceptible to experimentally induced cerebral ischemia, especially within the hippocampus (Levine and Sohn, \\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e1969\\u003c/span\\u003e; Li and Zhang, \\u003cspan citationid=\\\"CR46\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). This characteristic makes them an excellent model for investigating stroke mechanisms, neuroprotection, and post-ischemic recovery in this specific brain region (e.g. Himeda et al., \\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e; Kim et al., \\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e; Lee et al., \\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). The mechanisms underlying delayed neuronal death in CA1 have been extensively studied. Recent research, however, has shifted focus to elucidating the factors responsible for the relative resistance of CA2-3 and DG (e.g. Beręsewicz-Haller et al., \\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e; Cohan et al., \\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). The resistance of the CA2-3,DG region likely arises from intrinsic neuroprotective mechanisms, such as enhanced antioxidant defenses, reduced oxidative stress, and increased neurotrophic factors expression, regulated by transcription factors like Nrf2 (Dudek et al., \\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e; Einenkel and Salameh, \\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e).\\u003c/p\\u003e\\u003cp\\u003eNrf2 plays a crucial role in protecting cells from oxidative stress by inducing the expression of numerous cytoprotective genes (Ma, 2013). Its activation has emerged as a promising neuroprotective strategy in various neurological disorders, including ischemic stroke, as it alleviates oxidative stress, inflammation, and excitotoxicity (Brandes and Gray, \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e; Mayer et al., \\u003cspan citationid=\\\"CR52\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e; Zhang et al., \\u003cspan citationid=\\\"CR77\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Our previous work demonstrated an increase in Nrf2 activity in the gerbil hippocampus after I/R (Lewczuk et al., \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e2023b\\u003c/span\\u003e), consistent with reports of Nrf2 upregulation in other models of cerebral ischemia (Dang et al., \\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e2012\\u003c/span\\u003e; Sun et al., \\u003cspan citationid=\\\"CR70\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e; Takagi et al., \\u003cspan citationid=\\\"CR71\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e). Furthermore, our previous work confirmed that I/R induces robust Nrf2 activation in the gerbil hippocampus, demonstrated by Nrf2 nuclear translocation and the significant upregulation of proteins encoded by its canonical target genes, including HO-1, GPx1, and GCLC/M. This activation was more pronounced in the resistant CA2-3,DG region, both basally and after I/R, suggesting a direct link between elevated Nrf2 activity and the endogenous neuroprotection of this region (Lewczuk et al., \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e2023b\\u003c/span\\u003e). This is consistent with studies indicating that Nrf2 activation or overexpression provides neuroprotection from ischemic damage in hippocampal neurons (Goodfellow et al., \\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e; Lan et al., \\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e; Tulsulkar and Shah, \\u003cspan citationid=\\\"CR73\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). Notably, the pharmacological activation of Nrf2 with compounds such as sulforaphane has also been shown to confer neuroprotection in this gerbil model of ischemia (Lewczuk et al., \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e2023b\\u003c/span\\u003e), reinforcing the therapeutic potential of this pathway.\\u003c/p\\u003e\\u003cp\\u003eWe employed an integrated computational and experimental approach to investigate this topic further. Using the Hipposeq database (Cembrowski et al., \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e), a comprehensive transcriptomic resource derived from the mouse hippocampus, combined with curated lists of Nrf2-regulated genes from the GSEA Molecular Signatures Database (Liberzon et al., \\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e; Liberzon et al., \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e), we identified new putative Nrf2 targets that are likely involved in CA2-3,DG resistance to ischemic injury. These \\u003cem\\u003ein silico\\u003c/em\\u003e predictions were then validated by quantitative RT-PCR and Western blot analysis, examining the temporal expression profiles of selected genes in the CA1 and CA2-3,DG regions after I/R in Mongolian gerbils. This combined approach aimed to uncover new molecular targets and pathways relevant to ischemic brain injury and to advance our understanding of the complex interaction between Nrf2 signaling and regional responses to ischemia. Furthermore, by utilizing the gerbil model, we sought to explore these mechanisms in a system particularly susceptible to hippocampal ischemia. Our research contributes to ongoing efforts to identify therapeutic targets to improve outcomes after transient ischemic attacks (TIA) and stroke (Beresewicz-Haller, \\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e; L\\u0026oacute;pez-Morales et al., \\u003cspan citationid=\\\"CR50\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e).\\u003c/p\\u003e\"},{\"header\":\"2. Materials and Methods\",\"content\":\"\\u003cp\\u003e\\u003cem\\u003e2.1.\\u0026nbsp;In silico analysis\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eGene expression data were retrieved from the Hipposeq database (Cembrowski et al., 2016) for each available mouse hippocampal region: dorsal CA1-3 pyramidal cells (PCs), ventral CA1 and CA3 PCs, dorsal and ventral DG granule cells (GCs), and dorsal DG mossy cells (MCs) (Supplementary Figure S1). Using the graphical interface, the data were filtered to generate a list of genes with elevated or diminished expression levels in any region compared to the dorsal CA1 region. Subsequently, the data were further reduced to genes known to be Nrf2-regulated in humans. This selection was carried out employing the NFE2L2.V2 gene set from the GSEA Molecular Signatures Database (Kim et al., 2016; Mootha et al., 2003; Subramanian et al., 2005).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e2.2.\\u0026nbsp;Ethical Statement and Animals\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eMongolian gerbils (\\u003cem\\u003eMeriones unguiculatus\\u003c/em\\u003e) were purchased from the animal house of the Mossakowski Medical Research Institute, Polish Academy of Sciences. Animal care was in accordance with ethical guidelines (Directive 86/609/EEC of the European Communities Council). All experimental procedures were approved by the Local Commission for the Ethics of Animal Experimentation no. 2 in Warsaw (WAW2/032/2021). Every effort was made to minimize animal suffering and reduce the number of specimens used.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e2.3.\\u0026nbsp;\\u003c/em\\u003e\\u003cem\\u003eTransient Brain Ischemia in Gerbils\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAdult male gerbils weighing 60 to 70 g were subjected to transient brain ischemia by bilateral ligation of the common carotid arteries for 5 min under isoflurane anesthesia and controlled normothermic conditions, as previously described (Kawalec et al., 2023). After ischemia, the animals recovered for 24, 48, 72, or 96 h prior to decapitation, and the hippocampal subregions (CA1 and CA2-3,DG) were dissected for the immediate extraction of RNA and proteins. The hippocampi of sham-operated animals served as controls. The animals were randomly selected for the experiments.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e2.4.\\u0026nbsp;\\u003c/em\\u003e\\u003cem\\u003eImmunoblotting\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFor Western blotting, the dissected hippocampal regions were homogenized in an ice-cold cell lysis buffer (Cell Signalling Technology, USA) with 1 mM PMSF (Sigma-Aldrich, Germany) and kept on ice for an additional 5 min for lysis. The samples were sonicated and cleared by centrifugation at 14,000 \\u0026times; g for 10 min at 4 \\u0026deg;C. Total protein concentration was determined using the Modified Lowry Protein Assay (Thermo Fisher Scientific, USA). The reduced samples were prepared by boiling at 100 \\u0026deg;C for 5 min in Laemmli sample buffer. An equal amount of protein (40 \\u0026mu;g) was separated by SDS-PAGE and transferred to a nitrocellulose membrane (Amersham, Cytiva, Germany). After total protein imaging, membranes were blocked for 1 h at room temperature with 5% non-fat milk in Tris-buffered saline containing 0.05% Tween 20 (TBST). Subsequently, the membranes were incubated for 2 h in RT with the appropriate primary antibodies diluted in TBST. These included: rabbit polyclonal anti-BRIP1 (1:500; Proteintech, Germany; 24436-1-AP), mouse monoclonal anti-CaMK1 (1:500; Santa Cruz Biotechnology, USA; sc-137225), rabbit polyclonal anti-FSP1 (1:500; Proteintech; 20886-1-AP), rabbit polyclonal anti-FZD7 (1:500; Proteintech; 16974-1-AP), rabbit monoclonal anti-ITGB8 (1:500; Cell Signaling Technology; #88300), rabbit polyclonal anti-LDHB (1:1000; Proteintech; 14824-1-AP), rabbit polyclonal anti-3-PGDH (1:500; Proteintech; 14719-1-AP), rabbit polyclonal anti-SHISA2 (1:1000; Sigma-Aldrich; HPA050172), mouse monoclonal anti-STC2 (1:250; Santa Cruz Biotechnology; sc-293388) and rabbit polyclonal anti-TDO (1:500; Proteintech; 15880-1AP). The membranes were then washed with TBST and incubated for 30 min in RT with corresponding peroxidase-conjugated secondary antibodies: anti-mouse (1:8000; Sigma-Aldrich; A9044) or anti-rabbit (1:4000; Sigma-Aldrich; A0545), diluted in 5% fat-free milk in TBST. Bound antibodies were visualized with Amersham ECL Western Blotting Detection Reagent (Amersham, Cytiva) and signals were captured and quantified using the Fusion FX imaging system (Vilber Lourmat, France). The band intensities of the proteins of interest were normalized to the reference protein L-lactate dehydrogenase B chain (LDHB). After initial probing, membranes were stripped using a mild stripping buffer before being blocked again and reprobed for subsequent primary antibodies or the LDHB loading control. A single representative LDHB blot is shown for illustrative purposes, but quantification was performed for each blot individually.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e2.5.\\u0026nbsp;Total RNA extraction and cDNA synthesis\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFresh hippocampal sections (approx. 10 mg of tissue) were homogenized in the Fenozol solution supplied by the manufacturer (A\\u0026amp;A Biotechnology, Poland) and stored at -80 \\u0026deg;C. RNA was isolated using the Total RNA Mini Concentrator kit (A\\u0026amp;A Biotechnology), following the manufacturer\\u0026rsquo;s instructions. Quality and concentration were measured with a DeNovix DS-11 FX+ spectrophotometer (DeNovix Inc., USA). cDNA was synthesized from 2 \\u0026mu;g RNA using the High-Capacity RNA-to-cDNA Kit (ThermoFisher Scientific, USA) in 20-\\u0026mu;L reactions. The resulting cDNA was stored at -20 \\u0026deg;C until it was required for analysis.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e2.6.\\u0026nbsp;Primer Design and Quantitative Real-Time PCR\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe primers were designed using Primer3web version 4.1.0 (https://primer3.ut.ee/; accessed on 2 February 2023) (Untergasser et al., 2012) based on available DNA sequences of \\u003cem\\u003eMeriones unguiculatus\\u003c/em\\u003e, verified through primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/; accessed on 3 February 2023), and synthesized by DNA Sequencing and Synthesis Facility (IBB PAS, Poland). The presence of a single peak in the melting curve of each amplicon confirmed the specificity of the primers. The primers used for RT-qPCR are listed in Table 1.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 1\\u003c/strong\\u003e. Primer Sequences for Quantitative Real-Time PCR (RT-qPCR)\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"601\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eGene\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eAccession number\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePrimer sequences (5\\u0026rsquo;-3\\u0026rsquo;)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eAmplicon size (bp)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eGAPDH\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021636934\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: AGTATGACTCTACCCACGGC\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: ACTCCACAACATACTCGGCA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e150\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eHMBS\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021659401\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: GAAGAGTGGCCCAGCTACAG\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: CACTGAACTCCTGCTGCTCA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e108\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eAIFM2\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021649400.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: GCCTTGCCCTTCTCACATCT\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: CTGCTTCACATGTCCTCGT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e120\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eBRIP1\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021645850.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: GGCATCACCACTGCTACTT\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: CTGTATTGCCTCCTCTGAACC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e105\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eCAMK1\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021637624.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: AGAGGACAAGAGGACTCAGAAG\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: CATCCAGGGCTACAATGTTAGG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e137\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eCXCL12\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021662804.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: TGACTACAGATGCCCATGC\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: TCGGGTCAATGCACACTTGT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e147\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eFZD7\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021654377.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: TGGAGGTGAGGAGAGGTTT\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: TGCAAGTCCTAAGCCAGAAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e100\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eGPC1\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021632062.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: GGAGAATGTTATTGGCAGTGTG\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: TGGATGACCTTGGCTGTG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e93\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eHRK\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021642571.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: CGGAGTGTAAAGACCCACCC\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: ATAGCATTGGGGTGGCTAGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e95\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eITGB8\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021654173.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: AGCTTGGAAGAGTGTACGGC\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: CCCCTTCCCAGCCACTAAAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e132\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eLRP8\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021661159.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: TCTTCACCAACCGACACGAG\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: TTGGTAGCCACTTCCACGTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e112\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eMPP3\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021642772.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: GTAGAGTCCAGCCTCCCTCA\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: AAGCGAGGCTTCCCACTAAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e109\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003ePHGDH\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021632368.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: GTAAGGAGGAGCTGATCGCC\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: CGCTGCGRRGATGACATCAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e92\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eRET\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021652718.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: GGTCTCTGTGGACGCTTTCA\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: TTCCAAACTCGCCTTCTCCC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e101\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eSHISA2\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021649050.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: TCATCACTGTCCTCCCGGAT\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: TTGAGGATGGAGGTGGCAAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e138\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eSTC2\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021635606.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: CGCCCTGGACTTCAATGACT\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: TGTAGGGGACTCTCAGGCTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e108\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd style=\\\"width: 122px;\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eTDO2\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 155px;\\\"\\u003e\\n \\u003cp\\u003eXM_021663266.1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 233px;\\\"\\u003e\\n \\u003cp\\u003eF: CATGGAACTGCTGTGGAAATAAG\\u0026nbsp;\\u003cbr\\u003e\\u0026nbsp; R: GGAATGGAGATGATTGCTGTTTAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd style=\\\"width: 91px;\\\"\\u003e\\n \\u003cp\\u003e101\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003eThe RT-qPCR assays were performed in a final reaction volume of 20 \\u0026mu;l, containing 100 ng of cDNA, 7 \\u0026mu;l of Ambion Nuclease-Free Water (Thermo Fisher Scientific), 10 \\u0026mu;l of 2X PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, USA) and 400 nM of each primer. Each sample was run in triplicate on the Applied Biosystems 7500 Fast Real-Time PCR System (Thermo Fisher Scientific). No-template controls were added to each run. The cycling parameters were: 2 min at 50 \\u0026deg;C (UDG activation), 2 min at 95 \\u0026deg;C (polymerase activation), followed by 40 cycles of 95 \\u0026deg;C for 3 s for denaturation and 60 \\u0026deg;C for 30 s for annealing. The sets of \\u003cem\\u003eBRIP1\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eCXCL12\\u0026nbsp;\\u003c/em\\u003eprimers had different annealing temperatures: 62 \\u0026deg;C and 58.6 \\u0026deg;C, respectively. We included two housekeeping genes, \\u003cem\\u003eGAPDH\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eHMBS\\u003c/em\\u003e, previously validated (Lewczuk et al., 2023a), as a normalization factor for the cycle threshold (Ct) value of each gene of interest. The Ct values were determined using SDS 2.3 software (Applied Biosystems, Thermo Fisher Scientific) and for relative quantification, the mean of triplicates was used. The relative expression ratios of the genes of interest were evaluated using the \\u0026Delta;\\u0026Delta;Ct method (Livak and Schmittgen, 2001) and represented as a fold change in the expression of the calibrator, cDNA from the control gerbil\\u0026rsquo;s brain cortex, set as 1.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e2.7.\\u0026nbsp;Statistical Analysis\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll values are expressed as a mean \\u0026plusmn; standard deviation. Statistical analysis was performed using GraphPad Prism 5.03 (GraphPad Software, San Diego, CA, USA). The significance level of \\u0026alpha; = 0.05 was selected with \\u0026lowast; p\\u0026lt;0.05, \\u0026lowast;\\u0026lowast; p\\u0026lt;0.01, \\u0026lowast;\\u0026lowast;\\u0026lowast; p\\u0026lt;0.001. Statistical analysis was performed using Student\\u0026rsquo;s t-test to compare means between CA1 and CA2-3,DG controls, or with one-way analysis of variance (ANOVA) followed by Dunnett\\u0026rsquo;s multiple comparison test for ischemia-reperfusion groups versus control groups.\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"3. Results\",\"content\":\"\\u003cp\\u003e\\u003cem\\u003e3.1.\\u0026nbsp;Nrf2-Regulated Gene Selection in Hippocampal Subregions\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eInitial computational analysis, based on the Hipposeq database (Cembrowski et al., 2016) and curated Nrf2 target gene lists, narrowed the dataset to 129 genes potentially regulated by Nrf2 in hippocampal subregions. The relative gene expression was quantified as the ratio of FPKM (Fragments Per Kilobase per Million mapped fragments) values between the dorsal CA1 region and each of the other regions (Supplementary Figure S2). A total of 31 genes with relative expression coefficients greater than 5 were retained for further analysis. Among these, 10 genes that showed a ratio greater than 40 in at least one region were selected (\\u003cem\\u003eBRIP1\\u003c/em\\u003e, \\u003cem\\u003eCXCL12\\u003c/em\\u003e, \\u003cem\\u003eSHISA2\\u003c/em\\u003e, \\u003cem\\u003eSTC2\\u003c/em\\u003e, \\u003cem\\u003eITGB8\\u003c/em\\u003e, \\u003cem\\u003eAIFM2\\u003c/em\\u003e, \\u003cem\\u003eRET\\u003c/em\\u003e, \\u003cem\\u003ePHGDH\\u003c/em\\u003e, \\u003cem\\u003eCAMK1\\u003c/em\\u003e, \\u003cem\\u003eFZD7\\u003c/em\\u003e). Five additional genes were included, whose relative expression levels, despite not reaching the 40 threshold ratio, were still significantly elevated in certain regions of the hippocampus. These genes included \\u003cem\\u003eTDO2\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eHRK\\u0026nbsp;\\u003c/em\\u003ein dorsal DG, \\u003cem\\u003eMPP3\\u003c/em\\u003e in dorsal CA2, \\u003cem\\u003eGPC1\\u0026nbsp;\\u003c/em\\u003ein\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003edorsal CA3,\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eand \\u003cem\\u003eLRP8 in\\u0026nbsp;\\u003c/em\\u003eMC region (see Supplementary Table 1 for a complete list of genes and their corresponding proteins).\\u003c/p\\u003e\\n\\u003cp\\u003eTo facilitate visual analysis, the relative expression values were transformed using the base-10 logarithm. A heatmap was then generated using the Plotly graphical library (Plotly Technologies Inc.) to represent the selected data (Fig. 1).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e3.2.\\u0026nbsp;Basal Gene and Protein Expression in the Gerbil Hippocampus\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo validate \\u003cem\\u003ein silico\\u003c/em\\u003e predictions of elevated expression in the CA2-3,DG region of the hippocampus, we examined the mRNA levels of selected genes in the CA1 and CA2-3,DG regions of control animals using RT-qPCR. Contrary to predictions, only three of the 15 identified genes - \\u003cem\\u003eMPP3\\u003c/em\\u003e, \\u003cem\\u003eRET\\u003c/em\\u003e, \\u003cem\\u003eSHISA2\\u003c/em\\u003e \\u0026ndash; showed significantly higher expression in CA2-3,DG compared to CA1, which aligns with computational predictions (Fig. 2A). Two genes (\\u003cem\\u003eCXCL12\\u003c/em\\u003e and \\u003cem\\u003eSTC2\\u003c/em\\u003e) did not reveal significant interregional differences. The remaining ten genes \\u0026ndash; \\u003cem\\u003eAIFM2\\u003c/em\\u003e, \\u003cem\\u003eBRIP1\\u003c/em\\u003e, \\u003cem\\u003eCAMK1\\u003c/em\\u003e, \\u003cem\\u003eFZD7\\u003c/em\\u003e, \\u003cem\\u003eGPC1\\u003c/em\\u003e, \\u003cem\\u003eHRK\\u003c/em\\u003e, \\u003cem\\u003eITGB8\\u003c/em\\u003e, \\u003cem\\u003eLRP8\\u003c/em\\u003e, \\u003cem\\u003ePHGDH,\\u003c/em\\u003e and \\u003cem\\u003eTDO2 \\u0026ndash;\\u0026nbsp;\\u003c/em\\u003edisplayed significantly higher expression in CA1, contrasting with the \\u003cem\\u003ein silico\\u003c/em\\u003e data. This discrepancy emphasizes the importance of experimental validation of computational predictions \\u003cem\\u003ein vivo\\u003c/em\\u003e. Additionally, it suggests possible species-specific differences in Nrf2-mediated gene regulation or limitations in computational models. The higher expression of \\u003cem\\u003eMPP3\\u003c/em\\u003e, \\u003cem\\u003eRET\\u003c/em\\u003e, and \\u003cem\\u003eSHISA2\\u003c/em\\u003e mRNA in CA2-3,DG indicates a potential constitutive role for Nrf2 in the regulation of these genes specifically within this hippocampal subregion under basal conditions.\\u003c/p\\u003e\\n\\u003cp\\u003eTo assess the correlation between mRNA and protein levels, we conducted immunoblotting for a subset of these genes. Due to antibody limitations for Mongolian gerbils, only nine proteins could be analyzed (Fig. 2B). Comparison of mRNA and protein expression revealed a complex, often discordant, relationship. SHISA2, despite significantly elevated mRNA in CA2-3,DG, exhibited higher protein expression in CA1. Similarly, the STC2 protein was elevated in CA2-3,DG, even though there were no significant differences observed in STC2 mRNA. On the contrary, \\u003cem\\u003eTDO2\\u003c/em\\u003e displayed higher mRNA in CA1, but showed equivalent protein levels between regions. For \\u003cem\\u003eAIFM2\\u003c/em\\u003e/FSP1, \\u003cem\\u003eBRIP1\\u003c/em\\u003e, \\u003cem\\u003eCAMK1\\u003c/em\\u003e, \\u003cem\\u003eFZD7\\u003c/em\\u003e, \\u003cem\\u003eITGB8\\u003c/em\\u003e,\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003eand\\u003cem\\u003e\\u0026nbsp;PHGDH\\u003c/em\\u003e, both mRNA and protein levels were significantly higher in CA1, suggesting a tighter coupling between transcription and translation for these genes.\\u003c/p\\u003e\\n\\u003cp\\u003eSince most of the genes and proteins analyzed showed lower expression in CA2-3,DG than in CA1, we hypothesized that they may not be basally regulated by Nrf2 under normal physiological conditions in this hippocampal subregion. To further explore their potential Nrf2 responsiveness, we examined their expression profiles during an episode of ischemia/reperfusion, a condition shown to activate Nrf2 (Farina et al., 2021; Lewczuk et al., 2023b).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e3.3.\\u0026nbsp;Expression of Selected Genes in Hippocampal Subregions Following Ischemia and Reperfusion\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo assess the involvement of Nrf2 in relative resistance to ischemia followed by reperfusion (I/R), we categorized the selected genes into four groups based on their expression profiles in the CA1 and CA2-3,DG regions:\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e1. \\u0026nbsp; \\u0026nbsp;Genes with consistent expression patterns: basal expression levels of mRNA were significantly higher in CA2-3,DG compared to CA1, aligning with predictions \\u003cem\\u003ein silico.\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e2. \\u0026nbsp; \\u0026nbsp;Genes with delayed upregulation: mRNA basal expression was higher in CA1 but demonstrated significant upregulation specifically in CA2-3,DG following I/R.\\u003c/p\\u003e\\n\\u003cp\\u003e3. \\u0026nbsp; \\u0026nbsp;Genes without significant change in expression in CA2-3,DG after I/R.\\u003c/p\\u003e\\n\\u003cp\\u003e4. \\u0026nbsp; \\u0026nbsp;Genes with inconsistent expression patterns: mRNA expression levels did not match any of the previous categories.\\u003c/p\\u003e\\n\\u003cp\\u003eThis classification framework enables structured analysis of region-specific transcriptional responses to I/R and facilitates the identification of potential target genes for Nrf2-mediated neuroprotection.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e3.4.\\u0026nbsp;Temporal Expression of MPP3, RET, and SHISA2 in the Hippocampus After Ischemia/Reperfusion.\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFollowing the categorization of genes based on their basal expression patterns, we examined the temporal changes in expression for the Group 1 genes (\\u003cem\\u003eMPP3\\u003c/em\\u003e, \\u003cem\\u003eRET\\u003c/em\\u003e, and \\u003cem\\u003eSHISA2\\u003c/em\\u003e), which exhibited constitutively higher expression in the CA2-3,DG region compared to CA1 under control conditions. Contrary to expectations of I/R-induced upregulation, none of these genes showed statistically significant increases in expression at any reperfusion time point in CA1 or CA2-3,DG. Instead, a prominent trend of downregulation was observed, particularly in the CA2-3,DG region. The expression of\\u003cem\\u003e\\u0026nbsp;MPP3\\u003c/em\\u003e mRNA was significantly decreased in CA2-3,DG at 72 h and 96 h after reperfusion, while remaining relatively stable in CA1 (Fig. 3A). \\u003cem\\u003eRET\\u003c/em\\u003e expression, although not significantly altered in CA1, showed significant downregulation in CA2-3,DG with a marked decrease of approximately 70% at 24 h (***p\\u0026lt;0.001), followed by a gradual return to baseline levels by 96 h (Fig. 3B). The high variability in \\u003cem\\u003eRET\\u003c/em\\u003e mRNA levels observed in CA1, as indicated by the large standard deviations, contrasted with the consistent response in CA2-3,DG, suggesting a more heterogeneous response to I/R within the CA1 region. \\u003cem\\u003eSHISA2\\u003c/em\\u003e mRNA levels also exhibited significant downregulation in CA2-3,DG at all time points (***p\\u0026lt;0.001, Fig. 3C), and were significantly reduced in CA1 at 24 and 48 hours post-I/R. Despite these robust changes at the mRNA level, SHISA2 protein levels remained relatively stable in both regions of the hippocampus after I/R (Fig. 3D), highlighting the potential influence of post-transcriptional regulatory mechanisms. The observed downregulation of these putatively Nrf2-regulated genes in CA2-3,DG after ischemia is unexpected and warrants further investigation.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e3.5.\\u0026nbsp;Temporal Expression and Protein Levels of Delayed Upregulation Genes Following I/R\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eNext, the expression profiles of \\u003cem\\u003eAIFM2\\u003c/em\\u003e, \\u003cem\\u003eBRIP1\\u003c/em\\u003e, \\u003cem\\u003eCAMK1,\\u003c/em\\u003e and \\u003cem\\u003eTDO2\\u0026nbsp;\\u003c/em\\u003ewere examined along with their corresponding proteins. These genes were classified as exhibiting upregulation specifically in the CA2-3,DG region after ischemia. Notably, \\u003cem\\u003eAIFM2\\u003c/em\\u003e mRNA expression significantly increased in CA2-3,DG at 96 h post I/R (Fig. 4A), while remaining unchanged in CA1. Additionally, the upregulation of the FSP1 protein (Fig. 4B) occurred prior to the increase in mRNA levels, being detectable in CA2-3,DG as early as 48 h and reaching approximately 240% at 96 h. \\u003cem\\u003eBRIP1\\u003c/em\\u003e displayed a sustained and significant increase in mRNA expression in CA2-3,DG starting at 48 h post-ischemia (Fig. 4C). In contrast, in CA1, \\u003cem\\u003eBRIP1\\u003c/em\\u003e mRNA showed a significant decrease. These transcriptional changes were partially reflected at the protein level, with the BRIP1 protein significantly decreasing in CA1 at 72 h and significantly increasing at 96 h in CA2-3,DG (Fig. 4D). Similarly to \\u003cem\\u003eBRIP1\\u003c/em\\u003e, \\u003cem\\u003eCAMK1\\u003c/em\\u003e expression was significantly upregulated in the CA2-3,DG region starting at 24 hours and through all analyzed time points of reperfusion (Fig. 4E), while in CA1 a significant decrease was observed at 72 h. CaMK1 protein levels (Fig. 4F) were significantly elevated at every time point in CA2-3,DG and remained relatively stable in CA1, further highlighting the regional differences in response to I/R. Finally, TDO2 mRNA expression in CA2-3,DG showed a trend toward upregulation at all time points post-ischemia, reaching significance at 48 h (Fig. 4G). No relevant changes were observed in the CA1 region. The levels of TDO2 protein remained relatively stable in both regions (Fig. 4H).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThe delayed upregulation of these genes in the CA2-3,DG region, particularly in the absence of significant changes in the CA1, suggests a specific neuroprotective response to transient ischemic injury. This response may contribute to the enhanced resistance of this region.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e3.6.\\u0026nbsp;Temporal Expression of FZD7, ITGB8, PHGDH\\u003c/em\\u003e,\\u003cem\\u003e\\u0026nbsp;and STC2 in the Hippocampus Following I/R.\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe third group of genes we examined were classified as exhibiting no significant change in expression in the CA2-3,DG region following I/R. \\u0026nbsp;\\u003cem\\u003eFZD7\\u003c/em\\u003e mRNA expression remained relatively stable in CA1 and CA2-3,DG throughout the reperfusion period, without significant changes (Fig. 5A). However, FZD7 protein levels increased significantly (Fig. 5B) in CA2-3,DG at all times post-ischemia, revealing a disconnection between transcriptional and translational regulation. The expression\\u003cem\\u003e\\u0026nbsp;of ITGB8\\u003c/em\\u003e showed a similar pattern, with no significant changes in mRNA levels in both hippocampal regions (Fig. 5C). ITGB8 protein levels also remained relatively constant upon reperfusion (Fig. 5D). \\u003cem\\u003ePHGDH\\u003c/em\\u003e mRNA expression showed a tendency to increase in CA1, reaching significance at 72 h of reperfusion (Fig. 5E), while remaining unchanged in CA2-3,DG. PHGDH protein levels (Fig. 5F), on the contrary, showed a significant decrease in CA1 at 72 and 96 h, while showing a significant upregulation in CA2-3,DG at the same time points. This observation further highlights the possibility of post-transcriptional regulation. The expression of\\u003cem\\u003e\\u0026nbsp;STC2\\u003c/em\\u003e did not show statistically significant changes in the CA1 region, but in CA2-3,DG displayed a significant increase at 24 h and returned to baseline later after longer reperfusion time (Fig. 5G). However, STC-2 protein levels showed a significant increase in CA1 at 48 h and in CA2-3,DG at 72 h with a recovery towards baseline levels at later time points (Fig. 5H). The lack of significant transcriptional changes in CA2-3,DG for these Group 3 genes, despite the resistance to ischemic injury and the activation of Nrf2 under these conditions, indicates that their regulation is likely independent of the primary Nrf2-mediated neuroprotective response.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003e3.7.\\u0026nbsp;Temporal Expression of Genes with Inconsistent Expression Patterns in the Hippocampus After Ischemia/Reperfusion\\u003c/em\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFinally, we analyzed the expression profiles of \\u003cem\\u003eCXCL12\\u003c/em\\u003e, \\u003cem\\u003eGPC1\\u003c/em\\u003e, \\u003cem\\u003eHRK,\\u003c/em\\u003e and \\u003cem\\u003eLRP8\\u003c/em\\u003e, classified here as Group 4 due to their varied expression profiles in the CA1 and CA2-3,DG regions. The expression of\\u003cem\\u003e\\u0026nbsp;CXCL12\\u003c/em\\u003e mRNA was significantly downregulated in CA1 at 96 h after reperfusion (Fig. 6A). In CA2-3,DG, \\u003cem\\u003eCXCL12\\u003c/em\\u003e was also significantly downregulated at 24 h, its levels fluctuating but generally suppressed throughout the reperfusion period.\\u003cem\\u003e\\u0026nbsp;GPC1\\u003c/em\\u003e expression remained relatively stable in CA1 but showed a significant increase in CA2-3,DG at 96 h after I/R (Fig. 6B), suggesting a delayed, region-specific response.\\u003cem\\u003e\\u0026nbsp;HRK\\u003c/em\\u003e mRNA levels were significantly downregulated at 72 h and 96 h in the CA2-3,DG region (Fig. 6C), while remaining unchanged in CA1. \\u003cem\\u003eLRP8\\u003c/em\\u003e expression was significantly reduced in CA1 at later times post-ischemia. In the CA2-3,DG region, \\u003cem\\u003eLRP8\\u0026nbsp;\\u003c/em\\u003eexpression showed a tendency to decline at 96 h after I/R but remained relatively stable (Fig. 6D).\\u003c/p\\u003e\"},{\"header\":\"4. Discussion\",\"content\":\"\\u003cp\\u003eAlthough the neuroprotective role of Nrf2 is well established (Brandes and Gray, \\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e; Dinkova-Kostova et al., \\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e2018\\u003c/span\\u003e; Zgorzynska et al., \\u003cspan citationid=\\\"CR76\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e), the exact downstream genes and pathways that mediate this effect in the hippocampus, particularly after the I/R episode, remain unclear. Several computational studies have attempted to identify Nrf2-regulated genes in the hippocampus using various approaches, such as single-cell RNA sequencing (scRNA-Seq) data analysis, microarray analysis of Nrf2 knockout models, or \\u003cem\\u003ein vitro\\u003c/em\\u003e cell culture systems exposed to Nrf2 activators (Bell et al., \\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e; Levings et al., \\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e; Muramatsu et al., \\u003cspan citationid=\\\"CR57\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e; Zhang et al., \\u003cspan citationid=\\\"CR78\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). However, these studies often lack the context of i\\u003cem\\u003en vivo\\u003c/em\\u003e ischemic injury and may not adequately reflect the complex cellular responses in the intact brain. In addition, previous \\u003cem\\u003ein silico\\u003c/em\\u003e analyses have not adequately addressed the differential vulnerability of hippocampal subregions to ischemic damage. Although the CA1 region is highly susceptible to I/R injury, CA2-3,DG exhibits relative resistance (Kirino, \\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e1982\\u003c/span\\u003e; Schmidt-Kastner and Freund, \\u003cspan citationid=\\\"CR66\\\" class=\\\"CitationRef\\\"\\u003e1991\\u003c/span\\u003e). Understanding the molecular mechanisms underlying the relative resistance of CA2-3,DG is of particular interest, as these mechanisms may provide potential therapeutic targets for improving neuroprotection in more vulnerable regions. Our approach used the Hipposeq database (Cembrowski et al., \\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e2016\\u003c/span\\u003e), a comprehensive transcriptomic resource derived from the mouse hippocampus, and the curated lists of Nrf2-regulated genes (Liberzon et al., \\u003cspan citationid=\\\"CR47\\\" class=\\\"CitationRef\\\"\\u003e2015\\u003c/span\\u003e; Liberzon et al., \\u003cspan citationid=\\\"CR48\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e). By integrating these datasets, we sought to identify new candidate genes that contribute to resistance of the CA2-3,DG region and subsequently validated their expression patterns in a gerbil model of global cerebral I/R. This was done to gain new insights into the molecular mechanisms underlying Nrf2-mediated neuroprotection in the hippocampus after ischemic injury. Our findings show striking heterogeneity in the temporal and regional expression patterns of Nrf2-regulated genes following I/R, illustrating the complex relationship between transcriptional and post-transcriptional regulatory mechanisms that influence the hippocampal response to ischemic injury.\\u003c/p\\u003e\\u003cp\\u003eOne of the most intriguing findings of our study was the divergent behavior of the Group 1 genes (\\u003cem\\u003eMPP3\\u003c/em\\u003e, \\u003cem\\u003eRET\\u003c/em\\u003e, and \\u003cem\\u003eSHISA2\\u003c/em\\u003e) in the CA1 and CA2-3,DG regions after I/R. These genes showed higher basal expression in CA2-3,DG, consistent with \\u003cem\\u003ein silico\\u003c/em\\u003e predictions and potentially implicating Nrf2 in their constitutive regulation. Given our previous findings that I/R induces both increased Nrf2 levels and activity in the CA2-3,DG region (Lewczuk et al., \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e2023b\\u003c/span\\u003e), we initially anticipated upregulation of these putatively Nrf2-regulated genes in this region. Contrary to expectations, I/R led to a significant downregulation of these genes in CA2-3,DG, particularly at later time points (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003e). \\u003cem\\u003eRET\\u003c/em\\u003e displayed a transient but noticeable decrease at 24\\u0026ndash;48 h, while both \\u003cem\\u003eMPP3\\u003c/em\\u003e and \\u003cem\\u003eSHISA2\\u003c/em\\u003e were significantly and persistently downregulated in this region. While this could reflect species-specific differences in Nrf2 regulation between mice and gerbils, the observed downregulation of Group 1 genes in the CA2-3,DG region suggests interactions among multiple regulatory pathways rather than a straightforward Nrf2-mediated response. This unexpected finding adds complexity to our understanding of neuroprotection in the hippocampus following ischemia and emphasizes the possibility for region-specific regulatory mechanisms.\\u003c/p\\u003e\\u003cp\\u003eThe reduced expression of Group 1 genes in the more resistant CA2-3,DG region is counterintuitive and deserves further analysis. Several hypotheses may explain these findings. First, MPP3, RET, and SHISA2 may be involved in cellular processes that are beneficial under normal conditions but could become harmful during prolonged ischemic stress. For example, MPP3 encodes a membrane-associated guanylate kinase (MAGUK) protein, a family of proteins known to play a crucial role in establishing and maintaining cell polarity, synapse formation, and neuronal signaling (Zheng et al., \\u003cspan citationid=\\\"CR79\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e). Specifically, MPP3 has been demonstrated to be required for the maintenance of the apical junctional complex during neuronal migration and cortical development (Dudok et al., \\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). Its downregulation after I/R could, therefore, reflect a compensatory response aimed at limiting these processes during cellular stress. In the context of the pronounced and prolonged downregulation of RET during reperfusion, selectively in the CA2-3,DG area, it is worth noting that this gene encodes a receptor tyrosine kinase activated by ligands from the GDNF family, which typically promotes neuronal survival and differentiation (Airaksinen and Saarma, \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2002\\u003c/span\\u003e; Treanor et al., \\u003cspan citationid=\\\"CR72\\\" class=\\\"CitationRef\\\"\\u003e1996\\u003c/span\\u003e). Its reduced expression in this context might reflect a region-specific adaptive response. In models of focal ischemia, exogenous administration of GDNF has been established to reduce ischemic brain injury. This protective effect may be mediated, in part, by GDNF's ability to reduce NMDA receptor-mediated Ca\\u003csup\\u003e2+\\u003c/sup\\u003e influx through an ERK-dependent pathway, thus preventing excitotoxic neuronal death (Airaksinen and Saarma, \\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2002\\u003c/span\\u003e). Therefore, downregulation of RET in CA2-3,DG after I/R could be a mechanism to limit calcium overload and excitotoxicity in this region, potentially reflecting the protective effects of exogenous administration of GDNF. Furthermore, SHISA2 mRNA levels were significantly and persistently downregulated in CA2-3,DG at all time points post-I/R, while remaining relatively unchanged in CA1. This gene encodes a transmembrane protein belonging to the Shisa family, members of which have been shown to interact and regulate AMPA-type glutamate receptors (Abdollahi Nejat et al., \\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e; Ramos-Vicente and Bay\\u0026eacute;s, \\u003cspan citationid=\\\"CR65\\\" class=\\\"CitationRef\\\"\\u003e2020\\u003c/span\\u003e). Given the role of excitotoxicity in ischemic brain injury (Neves et al., \\u003cspan citationid=\\\"CR60\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e), the downregulation of SHISA2 in the CA2-3,DG region could represent a protective mechanism by dampening glutamatergic signaling and reducing neuronal excitability. Interestingly, despite changes in mRNA levels, SHISA2 protein levels remained unchanged in both CA1 and CA2-3,DG during the study period after ischemia, which might be due to the long half-life or compensatory translational mechanisms.\\u003c/p\\u003e\\u003cp\\u003eThe sustained downregulation of MPP3, RET, and SHISA2 in CA2-3,DG during reperfusion occurred in a model where we have previously confirmed robust Nrf2 activation (Lewczuk et al., \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e2023b\\u003c/span\\u003e), indicating that the regulation extends beyond direct Nrf2-mediated transcription. One hypothesis is that this downregulation reflects a region-specific adaptive response, potentially limiting harmful overactivation of certain pathways or reducing the burden on an already stressed system after I/R. For example, it could be related to the initiation of ferroptosis, a form of iron-dependent cell death, which has been shown to occur in CA1 neurons following ischemia, but is less pronounced in the CA3 region (Li et al., \\u003cspan citationid=\\\"CR45\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e; Park et al., \\u003cspan citationid=\\\"CR62\\\" class=\\\"CitationRef\\\"\\u003e2011\\u003c/span\\u003e). Alternatively, CA2-3,DG neurons may shift metabolic priorities post-ischemia, reallocating resources to pathways more critical for survival and away from functions associated with Group 1 gene products. Moreover, the downregulation could be part of a negative feedback loop, fine-tuning the cellular response to I/R. Initial activation of Nrf2 target genes might trigger neuroprotective processes, such as increased antioxidant defense or the unfolded protein response, which, when reaching a certain threshold, induce feedback inhibition to prevent excessive or prolonged activation, as exemplified by the Nrf2-p97-Nrf2 loop (Shakya et al., \\u003cspan citationid=\\\"CR67\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e) and supported by the broader context of Nrf2 regulation in stroke (Khassafi et al., \\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). Fourthly, it cannot be excluded that while \\u003cem\\u003ein silico\\u003c/em\\u003e analysis predicted these genes as Nrf2 targets, their regulation may also involve other transcription factors or post-transcriptional mechanisms, particularly in the context of regional stress responses. Lastly, the discordance between SHISA2 mRNA and protein levels highlights the crucial role of post-transcriptional mechanisms, such as regulation of mRNA stability, translational control, or protein degradation (Neag et al., \\u003cspan citationid=\\\"CR59\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). These findings underline the limitations of relying solely on transcriptional profiling, especially during stress when translational and post-translational regulation can significantly alter protein abundance and activity. The observed regional differences also suggest that Nrf2 activity itself could be differentially regulated in CA1 and CA2-3,DG after I/R. Although our previous work showed post-ischemic elevated Nrf2 activity in both regions, though with different dynamics (Lewczuk et al., \\u003cspan citationid=\\\"CR44\\\" class=\\\"CitationRef\\\"\\u003e2023b\\u003c/span\\u003e), downstream effects appear to diverge, with CA2-3,DG exhibiting a more complex response involving up- and downregulation of putative Nrf2 targets. This could be due to region-specific cofactors or modulators that influence Nrf2 transcriptional activity or the activation of distinct signaling pathways that intersect Nrf2 signaling in CA2-3,DG. Future studies using cell-type-specific analyses would help further address this important issue.\\u003c/p\\u003e\\u003cp\\u003eIn contrast to Group 1, genes assigned to Group 2 (\\u003cem\\u003eAIFM2, BRIP1, CAMK1\\u003c/em\\u003e, and \\u003cem\\u003eTDO2\\u003c/em\\u003e) showed a pattern of delayed upregulation specifically in CA2-3,DG following I/R (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003e). This delayed response, particularly evident for \\u003cem\\u003eAIFM2\\u003c/em\\u003e and \\u003cem\\u003eBRIP1\\u003c/em\\u003e, suggests that these genes may be involved in later-stage neuroprotective processes, possibly contributing to the enhanced recovery and repair capacity of CA2-3,DG. This delayed response, particularly evident for AIFM2 and BRIP1, suggests that these genes may be involved in later-stage neuroprotective processes, possibly contributing to the enhanced recovery and repair capacity of CA2-3,DG. The observation that AIFM2 (also known as FSP1) protein levels increased prior to mRNA upregulation (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eA, B) suggests that AIFM2 may in part be under post-transcriptional control during reperfusion after I/R. Indeed, recent research indicates that AIFM2 acts as a crucial factor in regulating ferroptosis (Doll et al., \\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). This regulation depends on the GSH- and NAD(P)H-dependent antioxidant activity of the protein (Bersuker et al., \\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e2019\\u003c/span\\u003e). Therapeutic interventions against ferroptosis have been proposed to be based not only on the inhibition of lipid peroxidation but also on enhancement of AIFM2 antioxidant activity. Our study also showed that \\u003cem\\u003eBRIP1\\u003c/em\\u003e displayed a sustained and significant increase in mRNA expression in CA2-3, DG, which contrasted with the decrease in CA1. This transcriptional change was partially reflected at the protein level. This may confirm a positive role for Nrf2 in mitigating the effects of I/R injury through modulation of \\u003cem\\u003eBRIP1\\u003c/em\\u003e expression in CA2-3,DG. \\u003cem\\u003eBRIP1\\u003c/em\\u003e encodes a DNA-dependent ATPase and a 5'-3' DNA helicase required for the maintenance of chromosomal stability and involved in the repair of DNA double-strand breaks by homologous recombination, in a manner dependent on its association with BRCA1 (Bridge et al., \\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e; Cantor et al., \\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e2004\\u003c/span\\u003e). BRIP1 has also been shown to play an important role in maintaining neuronal cell health and homeostasis by suppressing cellular oxidative stress (Mani et al., \\u003cspan citationid=\\\"CR51\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). Similarly to \\u003cem\\u003eBRIP1\\u003c/em\\u003e, \\u003cem\\u003eCAMK1\\u003c/em\\u003e expression was significantly upregulated in the CA2-3,DG region, while protein levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eF) were significantly elevated at every time point in CA2-3,DG and remained relatively stable in CA1. CaMK1 is an element of the Ca\\u003csup\\u003e2+\\u003c/sup\\u003e/CaM-dependent protein kinase signaling cascade (Colomer and Means, \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2007\\u003c/span\\u003e). A CaM kinase cascade is important for many normal physiological processes that, when misregulated, can lead to a variety of disease states. These processes include neuronal growth and functions related to brain development, synaptic plasticity, as well as memory formation and maintenance (Colomer and Means, \\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e2007\\u003c/span\\u003e; Najar et al., \\u003cspan citationid=\\\"CR58\\\" class=\\\"CitationRef\\\"\\u003e2021\\u003c/span\\u003e). The expression of TDO2 mRNA in CA2-3,DG showed a tendency towards upregulation at all time points post-ischemia (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig4\\\" class=\\\"InternalRef\\\"\\u003e4\\u003c/span\\u003eG), reaching significance at 48 h, further supporting the notion that delayed upregulation of specific genes in CA2-3,DG may contribute to the enhanced resistance of this region. A tryptophan 2,3-dioxygenase (TDO2) is involved in tryptophan metabolism (Moroni, \\u003cspan citationid=\\\"CR56\\\" class=\\\"CitationRef\\\"\\u003e1999\\u003c/span\\u003e). Tryptophan is metabolized primarily along the kynurenine pathway, of which two components are known to have marked effects on neurons in the central nervous system. Quinolinic acid is an agonist at NMDA-sensitive glutamate receptors, and kynurenic acid (KYNA) is an antagonist at several glutamate receptors (Stone et al., \\u003cspan citationid=\\\"CR68\\\" class=\\\"CitationRef\\\"\\u003e2003\\u003c/span\\u003e). It is tempting to suggest that the observed post-ischemic increase in TDO2 protein may lead to increased synthesis of the neuroprotective KYNA. However, KYNA concentration is subject to complex regulation, including its synthesis by kynurenine aminotransferases and degradation by kynureninase (Kloc and Urbanska, \\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e). Further studies are required to determine the actual involvement of these proteins in the mechanisms protecting CA2-3,DG neurons.\\u003c/p\\u003e\\u003cp\\u003eThe group 3 genes (\\u003cem\\u003eFZD7\\u003c/em\\u003e, \\u003cem\\u003eITGB8\\u003c/em\\u003e, \\u003cem\\u003ePHGDH\\u003c/em\\u003e, and \\u003cem\\u003eSTC2\\u003c/em\\u003e) exhibited a distinct response compared to previous groups, showing no significant transcriptional changes in CA2-3,DG after I/R (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003e). This suggests that their regulation in this context may not be directly linked to the Nrf2-driven response seen in Group 1 and 2 genes. However, the observed increases in FZD7, PHGDH, and STC2 protein levels in CA2-3,DG at various time points post-I/R (Figs.\\u0026nbsp;\\u003cspan refid=\\\"Fig5\\\" class=\\\"InternalRef\\\"\\u003e5\\u003c/span\\u003eB, F, H) indicate that post-transcriptional mechanisms may play a role in modulating their abundance and activity. In particular, elevated levels of the FZD7 protein align with other studies implicating activation of Wnt signaling after cerebral ischemia (Mo et al., \\u003cspan citationid=\\\"CR54\\\" class=\\\"CitationRef\\\"\\u003e2022\\u003c/span\\u003e). Given the established role of Wnt signaling in neuroprotection and post-ischemic brain repair, particularly in modulating the adult neural stem cell niche (Xu et al., \\u003cspan citationid=\\\"CR75\\\" class=\\\"CitationRef\\\"\\u003e2024\\u003c/span\\u003e), the increased FZD7 protein levels could contribute to the relative resistance of the CA2-3,DG region.\\u003c/p\\u003e\\u003cp\\u003eFinally, Group 4 genes (\\u003cem\\u003eCXCL12\\u003c/em\\u003e, \\u003cem\\u003eGPC1\\u003c/em\\u003e, \\u003cem\\u003eHRK\\u003c/em\\u003e, and \\u003cem\\u003eLRP8\\u003c/em\\u003e) displayed inconsistent and region-specific responses to I/R (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e), defying easy categorization. These genes may be regulated by various factors beyond Nrf2, including interactions with other stress-responsive pathways or region-specific epigenetic modifications. For example, the divergent responses of \\u003cem\\u003eCXCL12\\u003c/em\\u003e in CA1 and CA2-3,DG at 24 h post-reperfusion suggest a dynamic relationship of regulatory mechanisms. CXCL12 has been proven to be broadly neuroprotective, with roles in modulating inflammatory responses (Guyon, \\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e2014\\u003c/span\\u003e) and promoting neuronal regeneration after cerebral ischemia (Cheng et al., \\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e2017\\u003c/span\\u003e). Moreover, CXCL12 has been shown to modulate synaptic transmission to immature neurons during post-ischemic cerebral repair (Ardelt et al., \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e2013\\u003c/span\\u003e). Changes in \\u003cem\\u003eCXCL12\\u003c/em\\u003e expression early after reperfusion may reflect a mobilization of protective responses, which seem to be less effective in the vulnerable CA1 region. Furthermore, our results demonstrate a delayed increase in GPC1 in CA2-3,DG only at 96 h. Interestingly, GPC1, a heparan sulfate proteoglycan, has been implicated in the clearance of amyloid-β (Aβ) in the brain (Ozsan McMillan et al., \\u003cspan citationid=\\\"CR61\\\" class=\\\"CitationRef\\\"\\u003e2023\\u003c/span\\u003e), suggesting a potential neuroprotective role. This delayed upregulation of GPC1 may represent a specific response initiated by the CA2-3,DG region at later stages following I/R, which is not observed in CA1. Similarly, our data indicate a sustained significant decrease in HRK mRNA levels in CA2-3,DG at later time points, contrasted by unchanging levels in CA1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003e). Given that HRK, also known as DP5, is a pro-apoptotic protein induced by cellular stress (Imaizumi et al., \\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e1999\\u003c/span\\u003e), its sustained downregulation in CA2-3,DG could contribute to the region's resistance to ischemic injury by limiting apoptosis. Finally, \\u003cem\\u003eLRP8\\u003c/em\\u003e mRNA, encoding a receptor involved in Reelin signaling (Beffert et al., \\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e2005\\u003c/span\\u003e; D'Arcangelo et al., \\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e1997\\u003c/span\\u003e), was reduced in CA1 at 72 h and 96 h post-I/R, while in CA2-3,DG it tended to decrease at 96 h, but remained relatively stable (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig6\\\" class=\\\"InternalRef\\\"\\u003e6\\u003c/span\\u003eD). The relative preservation of \\u003cem\\u003eLRP8\\u003c/em\\u003e expression in CA2-3,DG, coupled with \\u003cem\\u003eHRK\\u003c/em\\u003e downregulation, could contribute to an environment that favors cell survival in this region following I/R. The functional significance of these varied responses requires further investigation.\\u003c/p\\u003e\"},{\"header\":\"5. Conclusions\",\"content\":\"\\u003cp\\u003eOur findings emphasize the complexity of the hippocampal response to ischemia/reperfusion injury, revealing distinct patterns of gene expression across different subregions and time points. The observed variability challenges the simplistic view of a uniform neuroprotective mechanism mediated by Nrf2. Instead, it suggests that Nrf2 likely interacts with other signaling pathways in a region-specific and context-specific way. The frequent discordance between mRNA and protein levels further highlights the intricacy of this issue. This illustrates the crucial role of post-transcriptional regulation in shaping the post-ischemic proteome. These results offer new insights into the molecular mechanisms that explain the varying vulnerability of the hippocampal regions to I/R injury. They also suggest that neuroprotection may involve complex interactions between transcriptional and post-transcriptional regulatory networks. Further research into these pathways is critical. Understanding how these identified up- and downregulated genes respond to pharmacological Nrf2 activation holds the potential to unlock novel strategies for enhancing endogenous neuroprotective mechanisms in the hippocampus, ultimately leading to more effective therapies for stroke.\\u003c/p\\u003e\"},{\"header\":\"Abbreviations\",\"content\":\"\\u003cdiv class=\\\"DefinitionList\\\"\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eARE\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eAntioxidant Response Element\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCA2-3,DG\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eCornu Ammonis areas 2 and 3, and Dentate Gyrus (of the hippocampus)\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eCt\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eCycle Threshold\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eERK\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eExtracellular signal-regulated kinase\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eFPKM\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eFragments Per Kilobase per Million mapped fragments\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eGDNF\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eGlial cell line-derived neurotrophic factor\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eGCLC\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eGlutamate-cysteine ligase, catalytic subunit\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eGCLM\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eGlutamate-cysteine ligase, modulatory subunit\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eGPx1\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eGlutathione peroxidase 1\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eGSEA\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eGene Set Enrichment Analysis\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eGSH\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eGlutathione\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eI/R\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eIschemia/Reperfusion\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eHO-1\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eHeme oxygenase-1\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eKeap1\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eKelch-like ECH-associated protein 1\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eKYNA\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eKynurenic acid\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eLDHB\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eL-lactate dehydrogenase B chain\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eMAGUK\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eMembrane-associated guanylate kinase\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eNAD(P)H\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eNicotinamide adenine dinucleotide phosphate\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eNMDA\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eN-methyl-D-aspartate\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eNrf2\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eNuclear factor-erythroid 2-related factor 2\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003ePCs\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003ePyramidal cells\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003ePMSF\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003ePhenylmethylsulfonyl fluoride\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eRT-qPCR\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eQuantitative Real-Time Polymerase Chain Reaction\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eRT\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eRoom Temperature\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003escRNA-Seq\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003esingle-cell RNA sequencing\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eSDS-PAGE\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eSodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eTBST\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eTris-Buffered Saline with Tween 20\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eTIA\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eTransient Ischemic Attack\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003cdiv class=\\\"DefinitionListEntry\\\"\\u003e\\u003cdiv class=\\\"Term\\\"\\u003eWnt\\u003c/div\\u003e\\u003cdiv class=\\\"Description\\\"\\u003e\\u003cp\\u003eWingless-related integration site.\\u003c/p\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\\u003c/div\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eDeclaration of Competing Interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis work was supported by the Internal MMRI PAS Project.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eData will be made available on request.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDeclaration of generative AI and AI-assisted technologies in the writing process\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe writers edited and proofread the document using AI models (Writefull and Google Gemini) to improve readability and language of this work. The authors assumed complete responsibility for the publication\\u0026apos;s content and revised and edited it as needed.\\u003c/p\\u003e\\u003ch2\\u003eAuthor Contribution\\u003c/h2\\u003e\\u003cp\\u003eA.L. and B.Z. conceptualized and supervised the study. A.L. was responsible for funding acquisition and project administration. The methodology was designed and the investigation was performed by A.L., A.B.-J., Ł.C., and M.B.-H. Formal analysis and data curation were conducted by A.L., A.B.-J., Ł.C., and M.B.-H. Visualization and preparation of figures were performed by A.B.-J. and Ł.C. A.B.-J. wrote the original draft of the manuscript. All authors participated in the review and editing of the final manuscript.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eAbdollahi Nejat M, Klaassen RV, Spijker S, Smit AB. Auxiliary subunits of the AMPA receptor: The Shisa family of proteins. Curr Opin Pharmacol. 2021;58:52\\u0026ndash;61.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eAiraksinen MS, Saarma M. The GDNF family: signalling, biological functions and therapeutic value. Nat Rev Neurosci. 2002;3:383\\u0026ndash;94.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eArdelt AA, Bhattacharyya BJ, Belmadani A, Ren D, Miller RJ. Stromal derived growth factor-1 (CXCL12) modulates synaptic transmission to immature neurons during post-ischemic cerebral repair. Exp Neurol. 2013;248:246\\u0026ndash;53.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBartsch T, Wulff P. The hippocampus in aging and disease: From plasticity to vulnerability. Neuroscience. 2015;309:1\\u0026ndash;16.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBeffert U, Weeber EJ, Durudas A, Qiu S, Masiulis I, Sweatt JD, Li WP, Adelmann G, Frotscher M, Hammer RE, Herz J. Modulation of synaptic plasticity and memory by Reelin involves differential splicing of the lipoprotein receptor Apoer2. Neuron. 2005;47:567\\u0026ndash;79.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBell KF, Al-Mubarak B, Martel MA, McKay S, Wheelan N, Hasel P, M\\u0026aacute;rkus NM, Baxter P, Deighton RF, Serio A, Bilican B, Chowdhry S, Meakin PJ, Ashford ML, Wyllie DJ, Scannevin RH, Chandran S, Hayes JD, Hardingham GE. Neuronal development is promoted by weakened intrinsic antioxidant defences due to epigenetic repression of Nrf2. Nat Commun. 2015;6:7066.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBeresewicz-Haller M. Hippocampal region-specific endogenous neuroprotection as an approach in the search for new neuroprotective strategies in ischemic stroke. Fiction or fact? Neurochem Int. 2023;162:105455.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBersuker K, Hendricks JM, Li Z, Magtanong L, Ford B, Tang PH, Roberts MA, Tong B, Maimone TJ, Zoncu R, Bassik MC, Nomura DK, Dixon SJ, Olzmann JA. The CoQ oxidoreductase FSP1 acts parallel to GPX4 to inhibit ferroptosis. Nature. 2019;575:688\\u0026ndash;92.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBeręsewicz-Haller M, Krupska O, Bochomulski P, Dudzik D, Chęcińska A, Hilgier W, Barbas C, Zablocki K, Zablocka B. 2021. Mitochondrial Metabolism behind Region-Specific Resistance to Ischemia-Reperfusion Injury in Gerbil Hippocampus. Role of PKCβII and Phosphate-Activated Glutaminase. Int J Mol Sci 22.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBrandes MS, Gray NE. NRF2 as a Therapeutic Target in Neurodegenerative Diseases. ASN Neuro. 2020;12:1759091419899782.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eBridge WL, Vandenberg CJ, Franklin RJ, Hiom K. The BRIP1 helicase functions independently of BRCA1 in the Fanconi anemia pathway for DNA crosslink repair. Nat Genet. 2005;37:953\\u0026ndash;7.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eCantor S, Drapkin R, Zhang F, Lin Y, Han J, Pamidi S, Livingston DM. The BRCA1-associated protein BACH1 is a DNA helicase targeted by clinically relevant inactivating mutations. Proc Natl Acad Sci U S A. 2004;101:2357\\u0026ndash;62.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eCembrowski MS, Wang L, Sugino K, Shields BC, Spruston N. 2016. Hipposeq: a comprehensive RNA-seq database of gene expression in hippocampal principal neurons. Elife 5, e14997.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eCheng X, Wang H, Zhang X, Zhao S, Zhou Z, Mu X, Zhao C, Teng W. The Role of SDF-1/CXCR4/CXCR7 in Neuronal Regeneration after Cerebral Ischemia. Front Neurosci. 2017;11:590.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eCohan CH, Stradecki-Cohan HM, Morris-Blanco KC, Khoury N, Koronowski KB, Youbi M, Wright CB, Perez-Pinzon MA. Protein kinase C epsilon delays latency until anoxic depolarization through arc expression and GluR2 internalization. J Cereb Blood Flow Metab. 2017;37:3774\\u0026ndash;88.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eColomer J, Means AR. Physiological roles of the Ca2+/CaM-dependent protein kinase cascade in health and disease. Subcell Biochem. 2007;45:169\\u0026ndash;214.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eD'Arcangelo G, Nakajima K, Miyata T, Ogawa M, Mikoshiba K, Curran T. Reelin is a secreted glycoprotein recognized by the CR-50 monoclonal antibody. J Neurosci. 1997;17:23\\u0026ndash;31.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eDang J, Brandenburg LO, Rosen C, Fragoulis A, Kipp M, Pufe T, Beyer C, Wruck CJ. Nrf2 expression by neurons, astroglia, and microglia in the cerebral cortical penumbra of ischemic rats. J Mol Neurosci. 2012;46:578\\u0026ndash;84.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eDinkova-Kostova AT, Kostov RV, Kazantsev AG. The role of Nrf2 signaling in counteracting neurodegenerative diseases. FEBS J. 2018;285:3576\\u0026ndash;90.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eDluzniewska J, Sarnowska A, Beresewicz M, Johnson I, Srai SK, Ramesh B, Goldspink G, G\\u0026oacute;recki DC, Zabłocka B. A strong neuroprotective effect of the autonomous C-terminal peptide of IGF-1 Ec (MGF) in brain ischemia. FASEB J. 2005;19:1896\\u0026ndash;8.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eDoll S, Freitas FP, Shah R, Aldrovandi M, da Silva MC, Ingold I, Goya Grocin A, Xavier da Silva TN, Panzilius E, Scheel CH, Mour\\u0026atilde;o A, Buday K, Sato M, Wanninger J, Vignane T, Mohana V, Rehberg M, Flatley A, Schepers A, Kurz A, White D, Sauer M, Sattler M, Tate EW, Schmitz W, Schulze A, Donnell V, Proneth B, Popowicz GM, Pratt DA, Angeli JPF, Conrad M. FSP1 is a glutathione-independent ferroptosis suppressor. Nature. 2019;575:693\\u0026ndash;8.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eDudek SM, Alexander GM, Farris S. Rediscovering area CA2: unique properties and functions. Nat Rev Neurosci. 2016;17:89\\u0026ndash;102.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eDudok JJ, Sanz AS, Lundvig DM, Wijnholds J. MPP3 is required for maintenance of the apical junctional complex, neuronal migration, and stratification in the developing cortex. J Neurosci. 2013;33:8518\\u0026ndash;27.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eEinenkel AM, Salameh A. Selective vulnerability of hippocampal CA1 and CA3 pyramidal cells: What are possible pathomechanisms and should more attention be paid to the CA3 region in future studies? J Neurosci Res. 2024;102:e25276.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eFarina M, Vieira LE, Buttari B, Profumo E, Saso L. 2021. The Nrf2 Pathway in Ischemic Stroke: A Review. Molecules 26.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eGoodfellow MJ, Borcar A, Proctor JL, Greco T, Rosenthal RE, Fiskum G. Transcriptional activation of antioxidant gene expression by Nrf2 protects against mitochondrial dysfunction and neuronal death associated with acute and chronic neurodegeneration. Exp Neurol. 2020;328:113247.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eGuyon A. CXCL12 chemokine and its receptors as major players in the interactions between immune and nervous systems. Front Cell Neurosci. 2014;8:65.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eHimeda T, Hayakawa N, Tounai H, Sakuma M, Kato H, Araki T. Alterations of interneurons of the gerbil hippocampus after transient cerebral ischemia: effect of pitavastatin. Neuropsychopharmacology. 2005;30:2014\\u0026ndash;25.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eHolmstr\\u0026ouml;m KM, Kostov RV, Dinkova-Kostova AT. The multifaceted role of Nrf2 in mitochondrial function. Curr Opin Toxicol. 2016;1:80\\u0026ndash;91.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eImaizumi K, Morihara T, Mori Y, Katayama T, Tsuda M, Furuyama T, Wanaka A, Takeda M, Tohyama M. The cell death-promoting gene DP5, which interacts with the BCL2 family, is induced during neuronal apoptosis following exposure to amyloid beta protein. J Biol Chem. 1999;274:7975\\u0026ndash;81.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKawalec M, Wojtyniak P, Bielska E, Lewczuk A, Boratyńska-Jasińska A, Beręsewicz-Haller M, Frontczak-Baniewicz M, Gewartowska M, Zabłocka B. Mitochondrial dynamics, elimination and biogenesis during post-ischemic recovery in ischemia-resistant and ischemia-vulnerable gerbil hippocampal regions. Biochim Biophys Acta Mol Basis Dis. 2023;1869:166633.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKerins MJ, Ooi A. The Roles of NRF2 in Modulating Cellular Iron Homeostasis. Antioxid Redox Signal. 2018;29:1756\\u0026ndash;73.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKhassafi N, Tameh A, Mirzaei A, Rafat H, Barati A, Vahidinia S, Z. Crosstalk between Nrf2 signaling pathway and inflammation in ischemic stroke: Mechanisms of action and therapeutic implications. Exp Neurol. 2024;373:114655.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKim H, Ahn JH, Song M, Kim DW, Lee TK, Lee JC, Kim YM, Kim JD, Cho JH, Hwang IK, Yan BC, Won MH, Park JH. Pretreated fucoidan confers neuroprotection against transient global cerebral ischemic injury in the gerbil hippocampal CA1 area via reducing of glial cell activation and oxidative stress. Biomed Pharmacother. 2019;109:1718\\u0026ndash;27.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKim JW, Botvinnik OB, Abudayyeh O, Birger C, Rosenbluh J, Shrestha Y, Abazeed ME, Hammerman PS, DiCara D, Konieczkowski DJ, Johannessen CM, Liberzon A, Alizad-Rahvar AR, Alexe G, Aguirre A, Ghandi M, Greulich H, Vazquez F, Weir BA, Van Allen EM, Tsherniak A, Shao DD, Zack TI, Noble M, Getz G, Beroukhim R, Garraway LA, Ardakani M, Romualdi C, Sales G, Barbie DA, Boehm JS, Hahn WC, Mesirov JP, Tamayo P. Characterizing genomic alterations in cancer by complementary functional associations. Nat Biotechnol. 2016;34:539\\u0026ndash;46.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKirino T. Delayed neuronal death in the gerbil hippocampus following ischemia. Brain Res. 1982;239:57\\u0026ndash;69.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKirino T. Delayed neuronal death. Neuropathology. 2000;20(Suppl):S95\\u0026ndash;97.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eKloc R, Urbanska EM. 2024. Memantine and the Kynurenine Pathway in the Brain: Selective Targeting of Kynurenic Acid in the Rat Cerebral Cortex. Cells 13.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLan X, Wang Q, Liu Y, You Q, Wei W, Zhu C, Hai D, Cai Z, Yu J, Zhang J, Liu N. Isoliquiritigenin alleviates cerebral ischemia-reperfusion injury by reducing oxidative stress and ameliorating mitochondrial dysfunction via activating the Nrf2 pathway. Redox Biol. 2024;77:103406.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLee TH, Yang JT, Lin JR, Hu CJ, Chou WH, Lin CP, Chi NF. Protective effects of ischemic preconditioning against neuronal apoptosis and dendritic injury in the hippocampus are age-dependent. J Neurochem. 2020;155:430\\u0026ndash;47.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLevine S, Sohn D. Cerebral ischemia in infant and adult gerbils. Relation to incomplete circle of Willis. Arch Pathol. 1969;87:315\\u0026ndash;7.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLevings DC, Pathak SS, Yang YM, Slattery M. Limited expression of Nrf2 in neurons across the central nervous system. Redox Biol. 2023;65:102830.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLewczuk A, Boratyńska-Jasińska A, Zabłocka B. 2023a. Validation of the Reference Genes for Expression Analysis in the Hippocampus after Transient Ischemia/Reperfusion Injury in Gerbil Brain. Int J Mol Sci 24.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLewczuk A, Zablocka B, Beresewicz-Haller M. Is Nrf2 Behind Endogenous Neuroprotection of the Hippocampal CA2-4,DG Region? Mol Neurobiol. 2023b;60:1645\\u0026ndash;58.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLi C, Wu Z, Xue H, Gao Q, Zhang Y, Wang C, Zhao P. Ferroptosis contributes to hypoxic-ischemic brain injury in neonatal rats: Role of the SIRT1/Nrf2/GPx4 signaling pathway. CNS Neurosci Ther. 2022;28:2268\\u0026ndash;80.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLi Y, Zhang J. Animal models of stroke. Anim Model Exp Med. 2021;4:204\\u0026ndash;19.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLiberzon A, Birger C, Thorvaldsd\\u0026oacute;ttir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 2015;1:417\\u0026ndash;25.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLiberzon A, Subramanian A, Pinchback R, Thorvaldsd\\u0026oacute;ttir H, Tamayo P, Mesirov JP. Molecular signatures database (MSigDB) 3.0. Bioinformatics. 2011;27:1739\\u0026ndash;40.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eLivak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402\\u0026ndash;8.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eL\\u0026oacute;pez-Morales MA, Castell\\u0026oacute;-Ruiz M, Burguete MC, Herv\\u0026aacute;s D, P\\u0026eacute;rez-Pinz\\u0026oacute;n MA, Salom JB. Effect and mechanisms of resveratrol in animal models of ischemic stroke: A systematic review and Bayesian meta-analysis. J Cereb Blood Flow Metab. 2023;43:2013\\u0026ndash;28.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMani C, Acharya G, Kshirsagar S, Vijayan M, Khan H, Reddy PH, Palle K. A Novel Role for BRIP1/FANCJ in Neuronal Cells Health and in Resolving Oxidative Stress-Induced DNA Lesions. J Alzheimers Dis. 2022;85:207\\u0026ndash;21.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMayer C, Riera-Ponsati L, Kauppinen S, Klitgaard H, Erler JT, Hansen SN. Targeting the NRF2 pathway for disease modification in neurodegenerative diseases: mechanisms and therapeutic implications. Front Pharmacol. 2024;15:1437939.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMcEwen BS. Physiology and neurobiology of stress and adaptation: central role of the brain. Physiol Rev. 2007;87:873\\u0026ndash;904.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMo Z, Zeng Z, Liu Y, Zeng L, Fang J, Ma Y. Activation of Wnt/Beta-Catenin Signaling Pathway as a Promising Therapeutic Candidate for Cerebral Ischemia/Reperfusion Injury. Front Pharmacol. 2022;13:914537.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMootha VK, Lindgren CM, Eriksson KF, Subramanian A, Sihag S, Lehar J, Puigserver P, Carlsson E, Ridderstr\\u0026aring;le M, Laurila E, Houstis N, Daly MJ, Patterson N, Mesirov JP, Golub TR, Tamayo P, Spiegelman B, Lander ES, Hirschhorn JN, Altshuler D, Groop LC. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet. 2003;34:267\\u0026ndash;73.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMoroni F. Tryptophan metabolism and brain function: focus on kynurenine and other indole metabolites. Eur J Pharmacol. 1999;375:87\\u0026ndash;100.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eMuramatsu H, Katsuoka F, Toide K, Shimizu Y, Furusako S, Yamamoto M. Nrf2 deficiency leads to behavioral, neurochemical and transcriptional changes in mice. Genes Cells. 2013;18:899\\u0026ndash;908.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eNajar MA, Rex DAB, Modi PK, Agarwal N, Dagamajalu S, Karthikkeyan G, Vijayakumar M, Chatterjee A, Sankar U, Prasad TSK. A complete map of the Calcium/calmodulin-dependent protein kinase kinase 2 (CAMKK2) signaling pathway. J Cell Commun Signal. 2021;15:283\\u0026ndash;90.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eNeag MA, Mitre AO, Burlacu CC, Inceu AI, Mihu C, Melincovici CS, Bichescu M, Buzoianu AD. miRNA Involvement in Cerebral Ischemia-Reperfusion Injury. Front Neurosci. 2022;16:901360.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eNeves D, Salazar IL, Almeida RD, Silva RM. Molecular mechanisms of ischemia and glutamate excitotoxicity. Life Sci. 2023;328:121814.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eOzsan McMillan I, Li JP, Wang L. Heparan sulfate proteoglycan in Alzheimer's disease: aberrant expression and functions in molecular pathways related to amyloid-β metabolism. Am J Physiol Cell Physiol. 2023;324:C893\\u0026ndash;909.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003ePark UJ, Lee YA, Won SM, Lee JH, Kang SH, Springer JE, Lee YB, Gwag BJ. Blood-derived iron mediates free radical production and neuronal death in the hippocampal CA1 area following transient forebrain ischemia in rat. Acta Neuropathol. 2011;121:459\\u0026ndash;73.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003ePlotly Technologies Inc. Collaborative data science. Montr\\u0026eacute;al. QC; 2015. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://plot.ly\\u003c/span\\u003e\\u003cspan address=\\\"https://plot.ly\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eRaghunath A, Sundarraj K, Nagarajan R, Arfuso F, Bian J, Kumar AP, Sethi G, Perumal E. Antioxidant response elements: Discovery, classes, regulation and potential applications. Redox Biol. 2018;17:297\\u0026ndash;314.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eRamos-Vicente D, Bay\\u0026eacute;s \\u0026Agrave;. AMPA receptor auxiliary subunits emerged during early vertebrate evolution by neo/subfunctionalization of unrelated proteins. Open Biol. 2020;10:200234.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSchmidt-Kastner R, Freund TF. Selective vulnerability of the hippocampus in brain ischemia. Neuroscience. 1991;40:599\\u0026ndash;636.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eShakya A, Liu P, Godek J, McKee NW, Dodson M, Anandhan A, Ooi A, Garcia JGN, Costa M, Chapman E, Zhang DD. The NRF2-p97-NRF2 negative feedback loop. Redox Biol. 2023;65:102839.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eStone TW, Mackay GM, Forrest CM, Clark CJ, Darlington LG. Tryptophan metabolites and brain disorders. Clin Chem Lab Med. 2003;41:852\\u0026ndash;9.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSubramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102:15545\\u0026ndash;50.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eSun Y, Yang X, Xu L, Jia M, Zhang L, Li P, Yang P. The Role of Nrf2 in Relieving Cerebral Ischemia-Reperfusion Injury. Curr Neuropharmacol. 2023;21:1405\\u0026ndash;20.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eTakagi T, Kitashoji A, Iwawaki T, Tsuruma K, Shimazawa M, Yoshimura S, Iwama T, Hara H. Temporal activation of Nrf2 in the penumbra and Nrf2 activator-mediated neuroprotection in ischemia-reperfusion injury. Free Radic Biol Med. 2014;72:124\\u0026ndash;33.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eTreanor JJ, Goodman L, de Sauvage F, Stone DM, Poulsen KT, Beck CD, Gray C, Armanini MP, Pollock RA, Hefti F, Phillips HS, Goddard A, Moore MW, Buj-Bello A, Davies AM, Asai N, Takahashi M, Vandlen R, Henderson CE, Rosenthal A. Characterization of a multicomponent receptor for GDNF. Nature. 1996;382:80\\u0026ndash;3.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eTulsulkar J, Shah ZA. Ginkgo biloba prevents transient global ischemia-induced delayed hippocampal neuronal death through antioxidant and anti-inflammatory mechanism. Neurochem Int. 2013;62:189\\u0026ndash;97.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eUntergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. 2012. Primer3\\u0026ndash;new capabilities and interfaces. Nucleic Acids Res 40, e115.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eXu J, Liu S, Xu L, Zhang Y, Jiang W, Chu L. Therapeutic Strategies for Ischemic Stroke: Modulating the Adult Neural Stem Cell Niche through the Wnt/β-catenin Pathway. J Integr Neurosci. 2024;23:131.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZgorzynska E, Dziedzic B, Walczewska A. 2021. An Overview of the Nrf2/ARE Pathway and Its Role in Neurodegenerative Diseases. Int J Mol Sci 22.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhang R, Xu M, Wang Y, Xie F, Zhang G, Qin X. Nrf2-a Promising Therapeutic Target for Defensing Against Oxidative Stress in Stroke. Mol Neurobiol. 2017;54:6006\\u0026ndash;17.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZhang RJ, Li Y, Liu Q, Gao YJ, Du J, Ma J, Sun SG, Wang L. Differential Expression Profiles and Functional Prediction of Circular RNAs and Long Non-coding RNAs in the Hippocampus of Nrf2-Knockout Mice. Front Mol Neurosci. 2019;12:196.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZheng CY, Seabold GK, Horak M, Petralia RS. MAGUKs, synaptic development, and synaptic plasticity. Neuroscientist. 2011;17:493\\u0026ndash;512.\\u003c/span\\u003e\\u003c/li\\u003e\\u003cli\\u003e\\u003cspan\\u003eZiemka-Nałecz M, Zalewska T, Zajac H, Domańska-Janik K. Decrease of PKC precedes other cellular signs of calpain activation in area CA1 of the hippocampus after transient cerebral ischemia. Neurochem Int. 2003;42:205\\u0026ndash;14.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":false,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":true,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"pharmacological-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"prep\",\"sideBox\":\"Learn more about [Pharmacological Reports](https://link.springer.com/journal/43440)\",\"snPcode\":\"43440\",\"submissionUrl\":\"https://submission.springernature.com/new-submission/43440/3\",\"title\":\"Pharmacological Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false},\"keywords\":\"Ischemia/Reperfusion, Hippocampus, CA2-3, DG, Nrf2, Gerbil, Regional Vulnerability\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-7272615/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-7272615/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eThe transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) is a master regulator of the cellular antioxidant response, playing an important role in protecting neurons from ischemic injury. The hippocampus exhibits region-specific vulnerability to ischemia, with CA1 neurons being highly susceptible, while CA2-3 and dentate gyrus (DG) neurons demonstrate greater resistance. Our previous work revealed higher basal and post-ischemia/reperfusion (I/R) Nrf2 activity in the resistant CA2-3,DG region compared to CA1 in a gerbil model of global cerebral ischemia. We used a combined computational and experimental approach to identify potential Nrf2-regulated genes that contribute to this regional neuroprotection. By utilizing the mouse Hipposeq database and Nrf2 target gene lists from the GSEA Molecular Signatures Database, we identified 15 candidate genes with predicted roles in the CA2-3,DG stress response. Quantitative RT-PCR analysis of the gerbil hippocampus following I/R confirmed distinct expression patterns. Although some genes, including \\u003cem\\u003eMPP3, RET\\u003c/em\\u003e, and \\u003cem\\u003eSHISA2\\u003c/em\\u003e, showed higher basal expression in CA2-3,DG, they were unexpectedly downregulated after I/R. In contrast, others, e.g. \\u003cem\\u003eAIFM2\\u003c/em\\u003e, \\u003cem\\u003eBRIP1\\u003c/em\\u003e, and \\u003cem\\u003eCAMK1\\u003c/em\\u003e, were upregulated specifically in this region. Furthermore, some (GPC1) showed delayed upregulation or showed altered protein levels despite unchanged mRNA expression (FZD7, STC2). These results emphasize the regional and time-dependent regulation of gene expression in the hippocampus after I/R. The identified up- and downregulated genes represent novel molecular targets whose pharmacological modulation could enhance endogenous neuroprotective pathways, revealing new therapeutic avenues for stroke.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Integrated Computational and Experimental Approach to Identify Nrf2- regulated Molecular Targets in Cerebral Ischemia\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-08-11 10:36:41\",\"doi\":\"10.21203/rs.3.rs-7272615/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0},{\"type\":\"decision\",\"content\":\"Revision requested\",\"date\":\"2025-08-22T10:41:06+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-08-18T14:58:01+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-08-11T09:58:25+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"80022277165559611334527445680037344100\",\"date\":\"2025-08-08T16:44:28+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"editorInvitedReview\",\"content\":\"\",\"date\":\"2025-08-07T22:54:32+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"222205800938544335199703693731222461251\",\"date\":\"2025-08-07T14:26:41+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"194173278825034441608082875604425300690\",\"date\":\"2025-08-07T07:06:45+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewerAgreed\",\"content\":\"75250242366320835234402483016837636594\",\"date\":\"2025-08-06T17:14:33+00:00\",\"index\":\"hide\",\"fulltext\":\"\"},{\"type\":\"reviewersInvited\",\"content\":\"\",\"date\":\"2025-08-06T16:11:17+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"editorAssigned\",\"content\":\"\",\"date\":\"2025-08-06T15:25:54+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"checksComplete\",\"content\":\"\",\"date\":\"2025-08-06T10:13:54+00:00\",\"index\":\"\",\"fulltext\":\"\"},{\"type\":\"submitted\",\"content\":\"Pharmacological Reports\",\"date\":\"2025-08-01T15:09:00+00:00\",\"index\":\"\",\"fulltext\":\"\"}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"pharmacological-reports\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":false,\"externalIdentity\":\"prep\",\"sideBox\":\"Learn more about [Pharmacological Reports](https://link.springer.com/journal/43440)\",\"snPcode\":\"43440\",\"submissionUrl\":\"https://submission.springernature.com/new-submission/43440/3\",\"title\":\"Pharmacological Reports\",\"twitterHandle\":\"\",\"acdcEnabled\":true,\"dfaEnabled\":true,\"editorialSystem\":\"stoa\",\"reportingPortfolio\":\"Springer Hybrid\",\"inReviewEnabled\":true,\"inReviewRevisionsEnabled\":false}}],\"origin\":\"\",\"ownerIdentity\":\"e367d1db-5d87-49c6-875a-8bd69aebb445\",\"owner\":[],\"postedDate\":\"August 11th, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"published-in-journal\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-10-20T15:59:21+00:00\",\"versionOfRecord\":{\"articleIdentity\":\"rs-7272615\",\"link\":\"https://doi.org/10.1007/s43440-025-00792-9\",\"journal\":{\"identity\":\"pharmacological-reports\",\"isVorOnly\":false,\"title\":\"Pharmacological Reports\"},\"publishedOn\":\"2025-10-15 15:57:00\",\"publishedOnDateReadable\":\"October 15th, 2025\"},\"versionCreatedAt\":\"2025-08-11 10:36:41\",\"video\":\"\",\"vorDoi\":\"10.1007/s43440-025-00792-9\",\"vorDoiUrl\":\"https://doi.org/10.1007/s43440-025-00792-9\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-7272615\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-7272615\",\"identity\":\"rs-7272615\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}