{"paper_id":"1f301e83-083b-4616-ac06-7d58c2cef1bf","body_text":"Polycystic ovarian syndrome (PCOS) is the most\ncommonly occurring cause of female infertility ( 1 ). In\nPCOS, there is an imbalance of female sex hormones,\nwhich may lead to ovarian cysts and irregular or absent\nmenstrual cycle. The abnormality has been mainly\nattributed to the suppression of the follicle stimulating\nhormone (FSH) secretion by an excess androgen\nproduced from the ovary. Accelerated early follicular\ngrowth leads to attenuated FSH responsiveness and\nthe premature luteinisation of granulosa cells (GC).\nIn turn, the development of the dominant follicle is\ndisrupted which causes cystic follicular arrest ( 2 ).\nThe cytochrome P450 aromatase, encoded by the\n CYP-19  gene, in ovarian GC that converts testosterone\nto estradiol is induced by FSH during early follicle\ndevelopment. The timely expression of  CYP-19  in\nGC plays a critical role in follicle development. In the\n CYP-19  knockout mice, antrum formation is arrested\nat a stage before ovulation and no corpora lutea are\nformed ( 3 ). The follicular arrest of PCOS has been\ncharacterized by the lack of  in vivo  FSH-induced\n CYP-19  activity in GC ( 4 ).\nThe expressions of  CYP-19  is coordinately regulated\nand efficiently inhibited by thiazolidinediones\n(TZDs) in human GC obtained from  in vitro  fertilization\n(IVF) ( 5 ,  6 ). TZDs are known as agonists of\nthe gamma isoform of the peroxisome proliferatoractivated\nreceptor ( PPARγ ), a family of nuclear receptors\nregulating the expression of genes involved in\nlipid metabolism, insulin sensitivity, and cellular differentiation.\n PPARγ  expression has been found in the\nGC ( 7 ). The  PPARγ  may regulate the steroidogenesis,\nthereby contributes to the regulation of ovarian function\n( 8 ). Previous studies have reported that retinoid\nX receptor (RXR) response elements are present in\nthe  CYP-19 ; however, no exact region that responds\nindependently to  PPARγ  has yet been identified ( 9 ).\nThere is a strong indication that omega-3 fatty acids\n(ω-3 fatty acids) have protective action against\nPCOS ( 10 ). In particular, eicosapentaenoic acid\n(EPA), a long-chain ω-3 fatty acid (PUFA), is a\nnatural high-affinity ligand for  PPARγ . Despite the\nincreasing clinical use, the mechanisms by which\nEPA exerts its effects is yet relatively unknown.\nThe aim of the present study was to investigate the\neffects of EPA on gene expression levels of  PPARγ \nand  CYP-19  in cultured GC from patients undergoing\nIVF, and also to compare these effects with\nthose in GC of PCOS patients.\n\nThis experimental study was approved by the Ethics\nCommittee of Tabriz University of Medical Sciences.\nAll patients gave a written informed consent and their\nconfidentiality and anonymity were protected.\nSampling was done by a simple consecutive\nmethod covering all patients (n=30) who were admitted\nto the IVF Center in February-March 2013\nat Alzahra Hospital, Tabriz, East Azerbaijan Province,\nIran. PCOS were defined as the presence of\n12 or more follicles measuring 2-9 mm with clinical\n(a Ferriman–Gallwey score >7) and/or biochemical\nhyperandrogenism (total testosterone >3\nnmol/l) ( 11 ). The participants (n=30) were divided\ninto two groups as PCOS (n=15) and non-PCOS\n(n=15) women (controls).\nInclusion criteria were no alcohol consumption and\nno smoking habit. Uterus abnormalities, endometriosis,\nanovulation, positive history of endocrine disease\nand inflammatory disorders such as thyroid and adrenal\ndisorders, hormonal treatment, and history of\nrecurrent infections were considered as exclusion\ncriteria in this study. Control group (n=15) included\nindividuals with age- (27.62 ± 4.14 years) and body\nmass index (BMI)- (25.11 ± 2.57 kg/m 2 ) matched\nwith no evidence of hyperandrogenemia or menstrual\nirregularities. All patients underwent a standard infertility\nevaluation, including hormonal testing and assessment\nof the uterus and fallopian tubes by means\nof hysterosalpingography. Patients underwent a long\ngonadotropin-releasing hormone (GnRH) agonist\n(decapeptyl, Debio Pharm, Geneva, Switzerland)/\nFSH-long down regulation protocol as described previously\nby us ( 12 ). GC was isolated from aspirated\nfollicular fluid by hyaluronidase digestion, followed\nby Percoll gradient centrifugation ( 13 ).\nThree sets of experiments with both PCOS and control\ngroups were performed. GC was pooled because\nthe number of cells from follicles was insufficient to\nperform individualized culture. In the experiments,\neach group composed of GC pooled from 5 women.\nIn total, GC were isolated and pooled from 15 PCOS\nand 15 control women of reproductive age. The GC\nwere counted with a homocytometer, and approximately\n1×10 6  cells were plated in a 12-well culture\nplate containing dulbecco’s modified eagle medium/\nnutrient mixture/F-12 (DMEM/F12, Cellgro, USA) medium supplemented with 10% fetal bovine serum\n(FBS), 100 IU/ml penicillin, and 100 μg/ml streptomycin,\nfor 24 hours. Cells were maintained at 37˚C\nin 5% CO 2  in a humidified incubator. EPA (Sigma,\nSt. Louis, MO) was conjugated with bovine serum albumin\n(BSA) fatty acid-free (Sigma, St. Louis, MO)\nbefore treatment ( 14 ). GC, after serum starvation\novernight, were treated with indicated concentrations\nof EPA (25-100 μM), both either with or without pretreatment\nwith recombinant (r)FSH (100 ng/mL).\nTotal RNA was isolated using RNX-Plus according\nto the instructions of the manufacturer. RNA pellets\nwere ethanol-precipitated, washed, and resuspended\nin sterile ribonuclease-free water. Two μg of total\nRNA were reverse transcribed into cDNA using SuperScript\nII reverse transcriptase (Life Technologies,\nCarlsbad, CA, USA). Real-time polymerase chain\nreaction (PCR) was carried out using the fluorescent\ndye SYBR-Green and a Bio-Rad CFX real-time PCR\nsystem (BioRad Co, CA, USA). The primers used for\nqPCR were as follows:  PPARγ , 5΄ ATGACAGACCTCAGACAGATTG\n3΄ (sense) and 5΄ AATGTTGGCAGTGGCTCACGTG\n3΄ (antisense);  CYP-19 ,\n5΄ TCTTGGTGTGGAATTATGAG 3΄ (sense)\nand 5΄ TTGAGGACTTGCTGATAATG 3΄ (antisense);\nglyceraldehydes 3-phosphate dehydrogenase\n( GAPDH ), 5 AAGCTCATTTCCTGGTATGACG 3\n(sense) and 5΄ TCTTCCTCTTGTGCTCTTGCTGG\n3΄ (antisense).\nSamples were assayed in duplicates. The\namount of specific PCR products was normalized\nto the  GAPDH  mRNA content, and quantities\nwere expressed as an x-fold difference relative\nto a control.\nValues are presented as mean ± standard deviation\n(SD) of 3 separate experiments done in duplicate.\nData in all groups were normally distributed. Statistically\nsignificant differences in mean values between\ngroups were assessed by t tests. Analysis of variance\ntest were used for comparing the group means. Calculation\nof significance between groups was done according\nto analysis of variance (ANOVA) with post\nhoc Tukey’s tests for multiple comparisons. Repeated-\nmeasures ANOVA was used for measures of response\ntimes, and a P value of <0.05 was considered\nstatistically significant.\n\nFigure 1  shows the genes expression levels\nmeasured by quantitative PCR method in GC from\npatients with PCOS and non-PCOS women. Primarily,\nno significant differences were found in\nthe gene expression levels of  PPARγ  and  CYP-19 \nbetween the two groups.\nTo determine the effect of rFSH stimulation on\nexpression levels of  PPARγ  and  CYP-19 , GC was\ntreated with rFSH. Only  CYP-19  showed a significant\nincrease in mRNA level (P<0.001,  Fig.2 ),\nwhich was more elevated in PCOS than in non-\nPCOS (mean 4.0-fold vs. 3.5-fold, respectively,\nP=0.03). In contrast, incubation with EPA alone\nresulted in comparable upregulation of  PPARγ  expression\nlevel (1.49 ± 0.12 vs. 1.52 ± 0.11, P=0.51)\nin GCs from non-PCOS and PCOS patients. However,\nno such changes were observed for  CYP-19 \nexpression level in EPA-treated cells ( Fig.2 ).\nComparison of control rFSH with the combined\nrFSH-EPA condition showed a similar\nresponse compared to the EPA alone. To optimize\nthe assay, cultured GC from non PCOS\nwomen were incubated with the 50 μmol/L EPA\nand the incubation time ranged from 12 hours\nto 48 hours. While no significant changes were\nobserved in the expression level of  CYP-19 , the\nexpression level of  PPARγ  increased by 30%\n(P=0.02) after 24 hours. However, later no further\nchanges were observed in the expression\nlevels of both mRNAs ( Fig.3 ).\nIn the next series of experiments, three doses of\nEPA (0-100 μM) were tested in the presence of\nrFSH. Treatment of GCs with 50 and 100 μM doses\nof the EPA significantly increased  PPARγ  mRNA\ngene expression level compared to the control\nrFSH alone condition (P<0.05).  PPARγ  displayed\na larger fold change in the PCOS group than in\nthe non-PCOS group. The magnitude of this difference\nbetween non-PCOS and PCOS was more\npronounced at the higher doses of EPA (e.g., 1.42-\nfold at 25 μmol vs. 2.15-fold at 100 μM, P=0.008).\nMoreover, it was identified that the expression\nlevel of  CYP-19  was also influenced by the higher\ndoses of EPA in the PCOS GC as compared to the\ncontrol. The combination of high doses of EPA in\nthe presence of rFSH produced a strong suppressive\neffect on the  CYP-19  gene expression level in\nthe PCOS GC (0.56-fold, P=0.01,  Fig.4 ).\nQuantitative analysis of  PPARγ  (A) and  CYP-19  (B) genes expression levels by real-time PCR in GCs from PCOS and non PCOS-women.\nEach expression level was normalized to the  GAPDH  levels. The mean ± SD of three independent determinations with cells pooled from\n5 women per group per experiment (t test).\nPCR; Polymerase chain reaction, GCs; Granulosa cells and PCOS; Polycystic ovarian syndrome.\nEffect of the follicle stimulating hormone (FSH) and eicosapentaenoic acid (EPA) incubation on mRNA expression levels of  PPARγ \nand  CYP-19 . GCs, after serum starvation, were incubated for 24 hours ± 100 ng/mL FSH or 50 μmol/L EPA. Cell lysates were prepared and\nanalyzed by real-time PCR for genes expression levels. Expression levels of  PPARγ  (A) and  CYP-19  (B) in each lysate were normalized to the\namount of  GAPDH  and represented as fold of untreated control. The mean ± SD of three independent experiments with cells pooled from\n5 women per group per experiment (t test).\n*; P<0.05 and **; P<0.01 vs. untreated control and †; P<0.05 vs. non-PCOS.\nPCR; Polymerase chain reaction, GCs; Granulosa cells and PCOS; Polycystic ovarian syndrome.\nEffect of eicosapentaenoic acid (EPA) incubation time on mRNA expression levels of  PPARγ  and  CYP-19 . GCs, after serum starvation,\nwere incubated in 100 ng/mL follicle stimulating hormone (FSH) alone or in combination with 50 μmol/L EPA for 12 hours, 24 hours and\n48 hours. Cell lysates were prepared and analyzed by real-time PCR for genes expression levels. Expression levels of  PPARγ  (A) and  CYP-19 \n(B) in each lysate were normalized to the amount of  GAPDH  and represented as fold of FSH-treated control. The mean ± SD of three independent\nexperiments with cells pooled from 5 women per group per experiment (repeated-measures ANOVA. *; P<0.05 and †; P<0.05\nvs. FSH-treated control and 12-hour incubation, respectively).\nPCR; Polymerase chain reaction, GCs; Granulosa cells and h; Hours.\nEffect of different doses of eicosapentaenoic acid (EPA) on expression levels of  PPARγ  and  CYP-19  in follicle stimulating hormone\n(FSH)-stimulated GCs from PCOS and non-PCOS women. GCs, after serum starvation, were incubated in 100 ng/mL FSH alone or in combination\nwith 25 μmol/L, 50 μmol/L or 100 μmol/L EPA for 24 hours. Cell lysates were prepared and analyzed by real-time PCR for genes\nexpression levels. Expression levels of  PPARγ  (A) and  CYP-19  (B) in each lysate were normalized to the amount of  GAPDH  and represented\nas fold of FSH-treated control. The mean ± SD of three independent experiments with cells pooled from 5 women per group per experiment\n(ANOVA with post hoc Tukey’s test, *; P<0.05, **; P<0.01 vs. FSH-treated control and †; P<0.01 vs. non-PCOS).\nPCR; Polymerase chain reaction, GCs; Granulosa cells and PCOS; Polycystic ovarian syndrome.\n\nPPAR-γ has been shown to be critically important\nin multiple biological functions such as fertility\n( 12 ), while EPA and docosahexanoic acid\n(DHA) are natural, preferentially-binding ligands\nfor this receptor. It has been shown that EPA and\nDHA down-regulate activation of NF-κB through\nincreasing both PPAR-γ mRNA levels and protein\nactivity in different types of cells. These effects\nmay be one of the underlying mechanisms for the\nanti-inflammatory effect of the ω-3 PUFA ( 15 ,\n 16 ). To the contrary, although no change in  PPARγ \nmRNA expression level has been reported previously\nin certain types of cells after exposure to\nEPA ( 17 ). Our results demonstrated that there were\nmRNA expression levels of  PPARγ  and  CYP-19  in\npre-ovulatory human GC, and that  PPARγ  was increased\nby EPA. This suggests that EPA may elicit\nimportant biological responses in GC via activation\nof  PPARγ .\nPPARγ  is a key transcription factor involved\nin follicular differentiation ( 18 ) and ovarian GC\ntumor ( 19 ). It has been shown that a decrease in\nexpression level of  PPARγ  in response to luteinizing\nhormone (LH) is important for ovulation and/\nor luteinization. GC differentiation into the corpus\nluteum in response to the LH surge is accompanied\nby reduced  CYP-19  activity. It has been reported\nthat the expression level of mRNA for  PPARγ  in\nfollicles is inversely related to the expression level\nof mRNA for  CYP-19  ( 20 ). Overexpression of\n PPARγ  in the KGN ovarian granulosa-like tumor\ncell line reduced FSH-stimulated  CYP-19  mRNAs\n( 21 ). These observations suggest that  PPARγ  has\nan inhibitory effect on the  CYP-19  activity as well\nas on ovulation and/or luteinization. The complete\ndisruption of FSH-induced estradiol production\nby synthetic PPAR-γ agonists in cultured human\novarian cells has been attributed to  CYP-19  ( 5 ).\nIt has been shown that  PPARγ  agonists suppress\nthe  CYP-19  mRNA expression level in human\nGC, in a dose-dependent manner, probably via\nnuclear receptor system  PPARγ : RXR heterodimer\n( 22 ). However, the data reported in the literature\nabout the effects of TZDs on  CYP-19  activity in\nthe ovary are controversial. Either no effect ( 23 ) or\nsuppressive effects ( 22 ) have been shown, which\ncould partly be attributed to a variety of  PPARγ  independent\nsignaling events ( 24 ). Furthermore, no\nspecific data is available regarding the effect of either\nthe synthetic or natural  PPARγ  agonists on the\nexpression and activity of GC aromatase in PCOS.\nAs shown herein and reported previously, FSH\ninduces the expression level of  CYP-19  ( 25 ,  26 ). In\ncontrast, levels of mRNA for  PPARγ  were not affected\nby treatment with rFSH, in agreement with\nthe observations made previously in rats ( 27 ). Cotreatment\nwith EPA and rFSH resulted in enhanced\n PPARγ  expression level both in control and PCOS\nGC. However, altered levels of gene expression in\nPCOS granulosa in response to the combined drug\ncondition was not similar to that observed in control\ngranulosa. In cultured GC obtained from patients\nwith PCOS, EPA induced a more pronounced\neffect with rFSH treatment on the mRNA expression\nlevel of  PPARγ . Furthermore, EPA treatment\nof PCOS GC remarkably down regulated  CYP-19 \ngene, as compared with non-PCOS patients. Coffler\net al. have shown that women with PCOS exhibited\ndose-dependent GC hyperresponsiveness\nto FSH and increased production of estradiol ( 28 ,\n 29 ). The above results implied a possibility that the\napparent suppressive effect of EPA on hypersensitivity\nof PCOS GC to rFSH may be due to a negative\nregulation of the rFSH signaling by activated\n PPARγ . Accordingly,  CYP-19  down-regulation via\ninduction of  PPARγ  has recently been noted in GC\nfrom subjects undergoing IVF ( 21 ).\nThe deregulated synthesis of estradiol (E 2 ) by\nPCOS GC has been associated with the arrest of\nearly antral follicle development ( 30 ). The GC\nfrom PCO antral follicles produce normal or increased\nE 2  amounts  in vitro  ( 31 ), even though follicles\nin women with PCOS contain low levels of\n CYP-19  mRNA ( 32 ). This would suggest an in\nvivo blockade of estrogen production by follicular\nenvironment in PCOS. This is in accordance\nwith our findings of no statistically significant difference\nin the expression of  CYP-19  in primary\nculture between GC from patients with PCOS and\nthose from control non-PCOS.\nUnlike the response to combination of rFSH and\nEPA, the gene expression of  PPARγ  in response to\nEPA alone was not different between control and\nPCOS GC. On the other hand, rFSH alone exerted\nno apparent effect on  PPARγ  gene expression level\nin the both control and PCOS GC. Based on these\nresults, the higher EPA-induced  PPARγ  expression\nlevel in PCOS than in control GC may be somewhat\nexplained by concomitant hypersensitivity of PCOS cells to FSH. FSH activates several signaling\nmechanisms through its surface G proteincoupled\nreceptor (GPCR) such as the MEK and\nPI3K pathways, which are potentially involved\nin the regulation of  PPARγ -mediated signaling in\nGCs ( 33 ).\nSeveral clinical evidences support the preventive\nand therapeutic effects of ω-3 fatty acids in menopausal\nproblems ( 10 ). Recently, ω-3 fatty acids\nsupplementation has been related to the improvement\nin insulin sensitivity ( 34 ), and less androgenic\nand atherogenic lipid profiles ( 35 ) in women\nwith PCOS. The results of the present study confirmed\nthe potential effect of ω-3 fatty acids on the\novulatory function of PCOS. It is suggested that\nthe modulatory effect of ω-3 fatty acids on the GC\nsteroidogenesis could also play an important role\nin the oocyte maturation and subsequent ovulation.\nAlthough previous research has shown beneficial\neffect of  PPARγ  agonists in PCOS, this is the\nfirst study to examine the combined effect of EPA\nand rFSH on the gene expression levels of  PPARγ \nand  CYP-19  in human GC. The small sample size,\npooled estimate and lack of assessment of  CYP-19 \nactivity may be seen as limitations of this study.\nHowever, the regulatory effects were simultaneously\nanalyzed by studying the expression level in\ncontrol and PCOS GC, which made it possible to\nidentify similarities and differences. Since the preliminary\nfindings of the present study were derived\nfrom cultured GC, it remained to confirm the in\nvivo effect of EPA and to further assess the possible\nmechanism of action of EPA in the treatment\nof PCOS.\n\nOur study showed that EPA and FSH signaling\npathway affect differentially on the gene expression\nlevels of  PPARγ  and  CYP-19  in PCOS GC. We\nspeculated that altered FSH-induced  PPARγ  activity\nin PCOS GC may modulate the  CYP-19  gene expression\nlevel in response to EPA, and subsequently\nmodulates the steroidogenesis of these cells.","source_license":"CC-BY-4.0","license_restricted":false}