{"paper_id":"1ceb4db2-d0fa-432b-bcd1-2eec1255bf39","body_text":"Emerging Threat: Highly Resistant Serratia marcescens in Iraqi ICU Patients | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Emerging Threat: Highly Resistant Serratia marcescens in Iraqi ICU Patients Israa M.S. AL-Kadmy, Nadal A. Al-Saryi, Istabreq Muhammed Ali Salman, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4055474/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Serratia marcescens has gained attention as an emerging pathogen worldwide, which causes infections and outbreaks in immune comprised individuals and patients in Intensive Care Units (ICUs). Antibiotics resistance has been shown to be increased worldwide, which limit the treatment options especially for patients in ICUs. In this study, 101 isolates of Serratia marcescens were collected from ICUs and identified by biochemical and molecular methods. The antibiotic susceptibility test showed that these isolates were resistant to most antibiotics tested as the following: 100% to Ampicillin, 93% to Ampicillin/Sulbactam, 69.3% to Ampicillin/ Clavulanic acid, 97% to Cefepime, 90.09% to Amoxicillin/ Clavulanic acid, 81.1% to Gentamycin, 77.2% to Tobramycin, 72.2% to Ciprofloxacin, 72.2% to Tetracycline, 63.3% to Cefotaxime, 61.38% to Ceftriaxone, 52.4% to Amikacin, 49.5% to Imipenem, 38.6% to Meropenem, 45.5% to Levofloxacin, 38.6% to Tigecycline, 57.4 to Piperacillin, 43.56% to and 24.7% to Colistin. Furthermore, PCR was used to detect antibiotics resistance genes for S. marcescens isolates. 100% of the isolates had bla CTX-M and bla SHV , 98% had bla CMY , 92% bla TEM genes. In addition, 69.3% of the isolates were positive for qnrB and 66.3% for qurS . aac(6')-Ib-cr gene was found in 44.5%, ant(4’)IIb in 41.5%, aph(3'')Ib in 40.5%, rmtC in 42.5% , and rmtD in 57.4% of the tested isolates. Furthermore, tet(A) , tet(X) , fasA , mpha, ompA, cat , mcr1 and Int1 genes were found in 67.3%, 65.3%, 40.5%, 40.5%, 43.5%, 53.4%, 24.7% and 39.6% of the isolates, respectively. Phenotypic and genotypic detection for carbapenemase was carried out by Hodge test and PCR. The results showed that 23.7% of the isolates were positive for Hodge test. For PCR detection, 51 isolates were positive for bla IMP , 44 isolates for bla KPC , 91 isolates for bla VIM , and 14 isolates for bla NDM1, respectively. In addition, resistance phenotype-genotypic correlation and dendrogram phylogenetic analysis were performed for the isolates. This study showed S. marcescens in ICU associated with the high frequency of resistance genes, which shows the importance to eliminate the spread of these isolates and an urgent control protocol is needed. In conclusion , this study highlights the concerning levels of antimicrobial resistance among S. marcescens isolates from ICU patients in Baghdad City. The findings underscore the urgent need for enhanced infection control measures, antimicrobial stewardship programs, and surveillance strategies to combat the spread of multidrug-resistant pathogens in healthcare settings. Further research is warranted to explore novel treatment options and strategies to mitigate the impact of antimicrobial resistance on patient outcomes. Serratia marcescens ICU antibiotics resistance β-lactamase Figures Figure 1 Figure 2 Introduction Serratia marcescens (S. marcescens) is Gram-negative bacteria belong to Enterobacteriaceae family. This bacterium occurs naturally in water and soil, was initially considered as non-pathogenic bacteria for many years, and can produce a red pigment at room temperature [1]. It is opportunistic and nosocomial pathogen causes both community-acquired and nosocomial infections such respiratory tract, urinary tract, endocarditis, septicemia, osteomyelitis, wound infections, meningitis, and eye infections [2] [3] . The main source for epidemic of these bacteria is the I ntensive C are U nits(ICU), which lead to S. marcescens colonization and infections [4]. Serratia marcescens presents a significant threat in these ICU because it is often associated with healthcare-associated infections especially immunocompromised individuals and patients with invasive medical devices such as catheters or ventilators [5][6]. Serratia marcescens has developed resistance to various antibiotics, which makes infections caused by this bacterium difficult to treat [7]. It is known that S. marcescens shows resistance to narrow-spectrum penicillins and cephalosporins; macrolides; tetracycline; nitrofurantoin; cefuroxime; cephamycins; fluoroquinolone, and colistin [8][9][10][11]. The resistance to some of these antimicrobials can be intrinsic or occurs by chromosomal resistance genes or by the acquisition of these genes via horizontal transfer. This mechanism contributes significantly to the rapid spread of resistance genes and is considered the most important mechanism caused the multiple antibiotic resistance [12][13]. Some of the antibiotics that S. marcescens may be resistant to include β-lactam antibiotics by producing β-lactamase enzymes, which can inactivate certain antibiotics, such as penicillins and cephalosporins [14]. Furthermore, S. marcescens can acquire genes that produce carbapenemases, which break down carbapenem antibiotics [15]. These antibiotics are considered important last-line treatments for severe infections. Highly resistant Serratia marcescens strains are strains developed a high level of resistance to commonly used antibiotics [16]. Furthermore, these strains are known as M ulti D rug R esistant ((MDR) Serratia marcescens or extensively drug-resistant Serratia marcescens , depending on the number and type of antibiotics they can develop resistance to [16]. These resistance strains present a new challenge in treating infections caused by these strains and cannot be treated by commonly used antibiotics, such as penicillin, cephalosporins, or fluoroquinolones. Thus, use alternative antibiotics can be effective such as carbapenems, aminoglycosides, or polymyxins [17]. However, strains have emerged showing resistance to these antibiotics. Many reports have showed the emergence of MDR S. marcescens outbreaks, which carrying either extended-spectrum β-lactamases (ESBLs) or carbapenemases, which confer extended spectrum cephalosporin and carbapenem resistance, respectively [18] [19] [20] [21] [22] [23] [24] . In Enterobacteriaceae including S. marcescens, the most common ESBL are class A, SHV (sulfhydryl variable), CTX-M-type (cefotaxime enzyme), D β-lactamases OXA (oxacillinases)) and the KPC ( K. pneumoniae carbapenemase) between the clinical isolates [25] [26]. From the beginning of the twenty-first century, KPC spread between clinical isolates of S. marcescens was notified in China, Greece, Brazil, and United States [27] [20][28][29] [30], and the most of these isolates were collected from patients in surgical intensive care [31]. Thus, it was suggested that acquisition of KPC plasmid were occurred at the nosocomial environment. An urgent prevention and control for these strains are required. Important control and prevention measures include proper hand hygiene, adherence to infection control protocols, appropriate use of antibiotics, and surveillance to detect and track the presence of these strains within healthcare settings are necessary to control the spread of these strains. Thus, we aimed to investigate antimicrobial resistance profile of S. marcescens isolated from ICUs patients in Baghdad city. \"Antimicrobial Resistance Profile of Serratia marcescens Isolated from ICU Patients in Baghdad City: A Comprehensive Study\" MATERIAL AND METHODS Study Design and Bacterial Isolates A total of 101 Serratia marcescens isolates were collected from patients admitted into Intensive Care Units in many hospitals in Baghdad city during the period from April 2018 to February 2021. The isolates were collected from different sources and the age of patients was over 20 years. The isolates were cultured on blood and Macckoncy plates for primary phenotypic identification. Identification of the Serratia marcescens isolates All isolates of S. marcescens were identified by using standard biochemical laboratory methods, VIETK II system (Bio-Merieux, France), and molecular method using 16S gene (Primers listed in Table 1). The isolates were stored at -80 until been used. Genomic DNA Extraction and PCR amplification Genomic DNA isolation was performed by boiling method as described by [32]. From each isolate, 10 single colonies were selected and transferred into eppendorf tube contain 400 μl ddH2O. Next, the cells were lysed using 100water bath for 10 min and the tubes were kept on ice immediately. Following step, the samples were frozen for 20 min at -20 o C to heat shock the cell and left to thaw at room temperature. Then, the samples were homogenized by vortex for 10s and centrifuged at 13,362 g for 15 min at 4°C. The upper aqueous layer was kept and transferred into new sterile eppendorf tube, and these DNA samples were frozen until be used. 16s gene was used to identify these isolates. In addition, the PCR was used to amplify antibiotic resistance and virulence genes. The PCR reactions were prepared in a total volume of 25 μl and consisted of: Promega Master mix 12.5 µl, forward primer 1µ; reverse primer 1 µl; nuclease free distilled water 5.5 µl; DNA template 5µl. The gene was amplified for 30 cycles by PCR as the following: the initial denaturation of DNA as 95°C for 5min, the denaturation step of DNA as 95°C for 30s ; the annealing step of the primers as ---*°C for 30s , the elongation step as 72°C for -----* sec, final extension as 72°C for 5 min. *The annealing temperature was changed occasionally depend on melting temperature of primers, while time of elongation depend on PCR product size. The primers, and size of PCR products are listed in Table 1. Table 1: The primers, and size of PCR products used in this study Primer Sequence (5'-3') Product size(bp) TM Reference 16S rRNA 5GGTGAGCTTAATACGTTCATCAATTG 3-GCAGTTCCCAGGTTGAGCC 200 60 [33] bla PER ATGAATGTCATTATAAAAGC AATTTGGGCTTAGGGCAGAA 925 51 [34] bla VIM 5 - GATGGTGTTTGGTCGCATA-3 5 -CGAATGCGCAGCACCAG-3 390 56 [35] bla CTX-M F- GTTGGGGTAGTTGCGATTGG R-CGCTTTGCGATGTGAAG 550 48 [36] bla kpc 5` -TGTCACTGTATCGCCGTC- 3` 5` -CTCAGTGCTCTACAGAAAACC- 3` 1010 58 [37] Bla CMY F-GACAGCCTCTTTCTCCACA R-TGGAACGAAGGCTACGTA 1014 57°C [38] IMP-1 F –CTACGCCAGCAGAGTCTTTG R-AACCAGTTTTGCCTTACCAT 500 55 [39] SHV F -AAGATCCACTATCGCCAGCAG R-ATTCAGTTCCGTTTCCCAGCGG 200 59 [40] TEM F-ATAAAATTCTTGAAGAC R-TTACCAATGCTTAATCA 1079 42 [40] NDM-1 F-GGTGCATGCCCGGTGAAATC R -ATGCTGGCCTTGGGGAACG 661 52 [41] qnrB F-GATCGTGAAAGCCAGAAAGG -3' R- ATGAGCAACGATGCCTGGTA - 3' 476 52 [42] qnrS F- GCAAGTTCATTGAACAGGGT- 3' R- TCTAAACCGTCGAGTTCGGCG- 3' 428 60 [43] aac(6')-Ib-cr F- TTGCGATGCTCTATGAGTGGCTA R- CTC GAA TGC CTG GCG TGT TT 482 56 [44] ant(4’)IIb F-ACGACAAGGATATGGAATTGCCCAAT R-ACAAGACCCGTTCAATTCAATTCAT 364 57 [36] aph(3'')Ib TAT CTC GGC GGC GGT CGA GT CAC GCG GGG AAA CGC GAG AA 800 55°C [36] rmtC CGA AGA AGT AAC AGC CAA AG ATC CCA ACA TCT CTC CCA CT 711 53 [36] rmtD TCAAAAAGGAAAAGGACGTG CGATGCGACGATCCATTC 500 52 [36] tet(A) F- GTGAAACCCAACATACCCC R- GAAGGCAAGCAGGATGTAG 888 55°C [45] Tet (X) F- CCGTTGGACTGACTATGGC R- TCAACTTGCGTGTCGGTAA 474 53 [46] fosA F- 5′-ATC TGT GGG TCT GCC TGT CGT-3 R-5′-ATG CCC GCA TAG GGC TTC T-3′ 245 58°C [47] mpha F: GTGAGGAGGAGCTTCGCGAG R: TGCCGCAGGACTCGGAGGTC 403 59 [48] omp(A) F- ATGAAAAAGACAGCTATCGCG R: CACCAAAAGCACCAGCGCCCA 187 54 [48] cat 5′CATGGATGAAAAATTTCTTCGAAAGT-3′ 5′-CGAGTCATTTCATTTTTCTAAAAAAC-3′ 620 54 [49] Int1 5’-ACGAGCGCAAGGTTTCGGT-3’ 5’-GAAAGGTCTGGTCATACATG-3’ 565 52 °C [50] mcr-1 5-CACTTATGGCACGGTCTATGA-3 5-CCCAAACCAATGATACGCAT-3 956 59 [51] Antimicrobial susceptibility test Kirby-Bauer disc diffusion method was used to test the antimicrobial susceptibility of the S. marcescens isolates against 18 antibiotics including: ampicillin (AMP), ampicillin/ sulbactam (SAM), amoxicillin/clavulanic acid (AMC), piperacillin/tazobactam (TZP), cefepime (FEP) ,gentamicin (GEN), tobramycin (TOB,) ciprofloxacin(CIP), tetracycline (TET), cefotaxime (CTX), ceftriaxone(CRO), amikacin (AMK), imipenem (IPM), meropenem (MEM), levofloxacin (LVX), tigecycline (TGC), azithromycin (AZM), colistin (CST), (Bioanalyse ( Turkey)). The results were interrupted according to (CLCS, 2022) http://em100.edaptivedocs. net/GetDoc.aspx?doc=CLSI%20M27M44S%20ED3:2022&scope=user). Modified Hodge test: Modified Hodge test (MHT) was performed according to Amjad et al . [52]for detection of carbapenemase production in Gram negative rods. Briefly,5 ml of brain heart infusion broth culture for Escherichia coli ATCC 25922 equals to 0.5 McFarland dilution was prepared. 1:10 dilution was streaked as lawn on to a Mueller Hinton agar plate. Ten μg/disc meropenem susceptibility disk was placed in the center of the test area. Test organism was streaked in a straight line from the edge of the disk to the edge of the plate. The plate was incubated overnight at 37ºC for 24 hours. After 24 hrs, MHT Positive test (carbapenemase producer) showed a clover leaf like indentation of the Escherichia coli 25922 growing along the test organism growth streak within the disk diffusion zone. MHT negative test represent by normal growth for the standard strain or without the formation of clover leaf-like shape. Molecular detection of antibiotics resistance genes Polymerase chain reaction (PCR) was used to detect antibiotics resistance genes including: β-lactamase genes (bla TEM , bla SHV variants, bla PER , bla CTX–M , Bla CMY ), carbapenemase genes (bla KPC , bla IMP , bla VIM ,bla NMD ) and other resistance genes including (aac(6’)-Ib-cr), qnrB, qnrS, ant(4’)IIb, aph(3'')Ib, rmtC, rmtD, tet(A), tet (X), fosA, mcr-1, mpha, omp(A) ,cat and Int1 . These genes were amplified using specific primers designed to follow the conditions described in the references from Table 1. All primers were synthesized by Extend (Brazil). Amplicons were analyzed by gel electrophoresis in 1.0 or 1.5 % agarose and visualized under ultraviolet (UV) light. PCR conditions were used to amplify resistance genes as mentioned above. Dendrogram phylogenetic analysis Dendrogram phylogenetic analysis were constructed with the Geneious Tree Builder software using the Jukes - Cantor distance model , Neighbour-Joining tree build method and UPGMA Data analysis The statistical analysis of this study was performed using (SPSS) software version 21. The Chi Square was used to examine continuous and categorical variables. The Fisher tests (95% confidence interval) was used to calculate the difference in virulence factors and drug resistance levels. Where the p value < 0.05 was significant. Results Serratia marcescens isolation and identification A total of 101 isolates of S. marcescens were isolated from Intensive Care patients during this study and identified by biochemical tests, VITEK II and by molecular identification using 16s. The clinical source of these isolates was divided as the following: 35 (34.6 % ) from urine, 21(20.7%) from blood, 21(20.7%) from wound , 11(10.89%) from catheter, 5 (4.9%) from bronchial secretions, 4 ( 3.96%) from burns, 2(1.98%) from abscess and from 1 isolate from each eye ( 0.99% ) and pleural fluid(0.99%). Antibiotic susceptibility of Serratia marcescens isolates The antibiotic susceptibility test was performed for antibiotics belong to different groups ß-lactam, aminoglycoside, tetracycline, macrolide and fluoroquinolones. The highest resistance rate was found for ampicillin, ampicillin/sulbactam, cefepime and amoxicillin/clavulanic acid as 100%, 93% ,98%, and 90.09% respectively, while the lowest resistance was shown for colistin as 24.7%. The percentage antibiotic resistance of S. marcescens isolates was shown in Table 2. In this study, 71 isolates were classified as MDR S. marcescens . Table 2: Antibiotic resistance percentage of S. marcescens isolates tested in this study Antibiotics Number of Resistant isolates Percentage of resistance Ampicillin 101 100% Ampicillin/Sulbactam 94 93% Ampicillin/ Clavulanic acid 70 69.3% Cefepime 98 97% Amoxicillin/Clavulanic acid 91 90.09% Gentamycin 82 81.1% Tobramycin 78 77.2% Ciprofloxacin 73 72.2% Tetracycline 73 72.2% Cefotaxime 64 63.3% Ceftriaxone 62 61.38% Amikacin 53 52.4% Imipenem 50 49.5% Meropenem 39 38.6% Levofloxacin 46 45.5% Tigecycline 39 38.6% Piperacillin 58 57.4% Azithromycin 44 43.56% Colistin 25 24.7% Molecular detection of antibiotics resistance genes PCR was used to detect antibiotics resistance genes for S. marcescens isolates. For β- lactamase genes detection, all of the isolates contain bla CTX-M and blaSHV beside 98% and 92% of the isolates showed PCR products for bla CMY and bla TEM genes , respectively. In addition, these isolates were tested for harbouring qur genes, 70 ( 69.3%) of the isolates were positive for qnrB and 67(66.3%) harboured qurS. Aminoglycoside resistance genes were indicated in S. marcescens isolates as following: aac(6')-Ib- was found in 45(44.5%), ant(4’)IIb in 42(41.5%), aph(3'')Ib in 41(40.5%), rmtC in 43 (42.5%) , and rmtD in 58(57.4%) of the tested isolates. Furthermore, tet(A) and tet(X) genes were found in 68(67.3) and 66(65.3%) of the isolates, respectively. PCR analysis revealed that 41(40.5%) isolates contain fasA and mpha gene beside 44(43.5%), and 54 (53.4%) contain ompA and cat, r espectively. Furthermore, mcr1 was found in 25 (24.7%) isolates only. Beside these resistance genes detection, class 1 integrons ( Int1 ) was found in 40(39.6%) S. marcescens isolates. Hodge test Phenotypic analysis for carbapenemase activity was carried out by a modified Hodge test. The results showed that 23.7 % of the isolates were positive for this test as shown in Table 3, Fig 1. All isolates positive for this test showed resistance to imipenem and meropenem. Table 3- Isolates positive for Hodge test, their antibiotic resistance and source The isolates positive for Hodge test Number of isolates resistant for all antibiotics tested Number of isolates resistant for all antibiotics tested expect tobramycin Number of isolates resistant for all antibiotics tested expect amikacin 24 isolates 22 1 1 Source of the isolates 7 isolates from wound, 6 from urine, 7 from blood, 2 from burn, 1 from cather blood Urine Molecular detection of carbapenemase genes Beside phenotypic detection of carbapenemase by Hodge test, molecular detection for carbapenemase genes was performed. In this study, 51 isolates were positive for bla IMP , 44 isolates for bla KPC , 91 isolates for bla VIM , and 14 isolates for bla NDM1, respectively as shown in Table 4. Table (4) Frequency of carbapenemase genes in S. marcescens isolates S. marcescens Isolates Total number bla IMP bla NDM1 bla VIM1 bla KPC no % no % no % no % 101 51 50.49 14 13.8 93 92.07 44 43.56 Resistance Phenotype- genotypic correlation Appendix 1 shows the correlation between phenotypic and genotypic detection of antibiotics resistance results. In this study, 44 isolates carrying bla KPC gene showed resistance to all β-lactam including carbapenem antibiotics. Moreover , 51 isolates positive for bla IMP gene were non-susceptible to all beta lactam expect 12 isolates, which were sensitive to meropenem. Out of 93 of the isolates carrying bla VIM gene, 54 isolates were non-susceptible to imipenem. However, all these 93 isolates were sensitive to meropenem. Furthermore, all isolates with detectable bla CTX−M−1 , Bla CMY , and bla TEM genes presented ESBL phenotype. For aminoglycoside resistance and quinolones resistance, All 45 isolates with aac (6’)- Ib-cr gene were resistant to gentamicin, Tobramycin and ciprofloxacin. In addition, out of these 45 isolates, 43 isolates were non-susceptible to amikacin and 41 to levofloxacin. Out of 70 of the isolates positive for qnrB and 67 isolates harboured qurS were not suspectable to ciprofloxacin expect one isolate. In addition, 12 isolates out of both isolates with qnrB or qnrs were not susceptible for levofloxacin. 42 isolates positive for ant (4′)-II gene showed resistance against gentamicin, tobramycin, expect one isolate, which was sensitive to amikacin. 41 isolates with APH(3'')-Ib gene were found non-susceptible for aminoglycoside antibiotics tested expect one isolates susceptible to amikacin. 41 isolates with rmtC gene showed resistance to all aminoglycoside in this study expect isolate where suspectable for tobramycin. Furthermore, 58 isolates carrying rmtD genes showed resistance for all aminoglycosides expect 3 isolates sensitive for amikacin. Isolates carrying mpha gene showed resistance against azithromycin macrolide antibiotic. Of 66 isolates carrying text (x) , 62 were non susceptible to tetracycline and 42 to tigecycline. In addition, 68 isolates had tex(A) gene, 45 isolates of them were not susceptible to tigecycline, and 66 to tetracycline. Moreover, out of 25 isolates had mcr-1 , 24 isolates showed phenotypic resistance to colistin. Dendrogram phylogenetic analysis Dendrogram phylogenetic analysiswas constructed using antibiotics resistance profile and source of the isolates. The tree consists from 201 nodes and 101 tips sharing the original branch separated into as in figure 3: 1-A clade consists from 95 nodes and 48 tips and this group was divided to 3 subgroups A1- consists from 19 nodes and 10 tips that a closely related isolates although the ten isolates from different courses (urine, burn and wounds). A2- consist from 24 nodes and 12 tips with diverts isolates. A3 consist from 52 nodes and 26 tips would be consist as group of highly divergent isolates 2 - B clade consist from 105 nodes and 53 tips, B1 consist from 44 nodes and 20 tips,the isolates in this glade are closely related in their resistance in spite of their huge diversity of sources (Blood ,wound ,catheter and urine . B2 consist from 61 nodes and 31 tips would be consistent with a group of highly divergent species A clade that shows short edge lengths contains species that diverged recently from a common ancestor. A clade that shows long edge lengths contains species that diverged a long time ago from a common ancestor. Discussion Patients in the ICU are at a higher risk of developing bacterial infections due to various factors such as weak immune systems, prolonged hospital stays and invasive medical procedures [53][54]. Thus, these patients may require antibiotics and other treatments to manage these bacterial infections and prevent complications, which will help to improve their health. Serratia marcescens is the bacterium that able to survive on environmental surfaces and medical equipment, making it a common cause of healthcare-associated infections, especially in settings like the ICU[55][56]. In this study, 101 isolates of S. marcescens were collected from ICU patients, which present a challenge in our hospitals . Many studies have reported the spread of these bacteria in ICU [57]. Many factors assist in the risk of S. marcescens infections in ICU patients include compromised immune systems, invasive procedures, prolonged hospital, and use of medical devices (such as catheters or ventilators). In general, multidrug resistant S. marcescens isolates are collected from clinical settings. High levels of antibiotic resistance among Serratia species belong to many activity of intrinsic, acquired, and adaptive resistance elements. Intrinsic resistance is known as naturally occurred in microorganism which affect the activity of antimicrobials e.g. , active efflux of toxic compounds and decreased membrane permeability. Acquired resistance refers to resistance occurred due to acquisition of antibiotic resistance genes commonly by gene mutation or plasmid horizontal gene transfer. Horizontal gene transfer is considered the most important mechanism causes multiple antibiotic resistances [10] [13]. Lastly, adaptive resistance, also called phenotypic resistance, is linked to expeditious transcriptome adjusting in response to stress conditions or environmental stimuli. One other hand, adaptive resistance is known as a non-inheritable phenotype, which can revert after the triggering signal removal. pH , temperature, oxidative stress, and disinfectants exposure have been shown to be linked with gene regulation and higher bacterial survival in S. marcescens [58][59]. Bacterial exposure to antibiotics is known to be the main factor for antibiotics resistances. However, a recent analysis of S. marcescens isolates caused an outbreak in 1969 in Spanish neonatal ICU showed that these isolates carried disinfections and antibiotics resistance genes that were non commercialized by the time of their original isolation [60]. Furthermore, another study compared between strains collected during the 1940s and the beginning of the twenty-first century showed that resistance to different classes of antibiotics already existed in ancient S. marcescens isolates [61] , which suggested additional factors unrelated to drug therapy assist in evolution of resistance genes. In 2018, analysis of 32 Serratia spp. genomes conclude that strains isolated from environments represent an underestimated reservoir for antibiotic resistance determinants [10], which suggested these resistance genes are inherited [62]. Thus, clinical management of S. marcescens infections present a big challenge because its intrinsic resistance to different classes of antibiotics such as ampicillin, cephalosporins, aminoglycoside macrolides, and peptides [12]. In our study, the isolates showed high resistance profile to many antibiotics used, which present a serious problem to patients in ICU. Cefepime or carbapenems are commonly used to treat S. marcescens infections [17][63]. Furthermore, aminoglycoside amikacin is found to be effective to treat these infections. However. an increasing resistance to gentamicin and tobramycin has been reported [64] [65]. In this study, high percentage of the isolates showed resistance to gentamicin and tobramycin in addition to more than half of the isolates were not suspectable to amikacin. Furthermore, most of the isolates were resistant to fluroquinolones (ciprofloxacin). The extensive and misuse of β-lactams led to the emergence of resistance against these antibiotics. Many mechanisms are responsible for this resistance including target site modification (mutation or expression of alternative PBPs), downregulation of porin which results in reduction in cell, efflux pump and modifying enzymes (β- lactamase) [66]. β- lactamase assists in enzyme-mediated resistance, which produced by both Gram-positive and Gram-negative bacteria. Furthermore, these enzymes are encoded chromosomally or on extrachromosomal elements, which degrade the β-lactam ring . Extended-spectrum β-lactamases (ESBLs) are a group of bacterial enzymes that can be rapidly transferred via plasmid exchange [67] causing resistance to a broad range of β-lactams. TEM, SHV, CTX β-lactamase genes presence in the bacteria results in β- lactam resistance (penicillins and cephalosporins). Enterobacteriaceae members including S. marcescens possess bla CTX-M and bla SHV and these genes express classical class A β - lactamases, which hydrolyze first generation penicillins and cephalosporins and encoded on plasmid [68] . In our study, both genes were found in most of the isolates beside bla TEM . Furthermore, the main cause of antibiotics resistance in S. marcescens is the production of chromosomally encoded β-lactamases, which involve extended-spectrum β-lactamases, AmpC-type cephalosporinase, and carbapenemases. Carbapenemases are the most versatile family of β-lactamases able to hydrolyze carbapenems and many other β-lactams including penicillins, cephalosporins, and monobactams [69] . Generally, bacteria carrying the bla KPC and/or ESBLs genes usually possess other resistance genes, which confer resistance to several classes of antimicrobials [70][71]. Carbapenems are considered as main antibiotics used to treat S. marcescens infections because these bacteria showed resistance to broad-spectrum cephalosporins [72]. However, Many studies have reported the emergence of carbapenem-resistant strains around the world, which are caused by production of Ambler class A (KPC and SME), loss of porins associated with AmpC overexpression or class B metallo-β-lactamases (MβLs; IMP and VIM) [73][74]. In this study, the most of our isolates possessed bla IMP , blaNDM 1, blaVIM 1 and bla KPC and were resistant to imipenem and meropenem. carbapenem-resistant S. marcescens isolates were shown in this study, which present as a serious concern in nosocomial environment . It was reported that S. marcescens is intrinsically resistant to polymyxins [75], but in this study, only 25% of the isolates were resistance to colistin. In addition, fluoroquinolones resistance occurs by modification off target sites DNA gyrase and topoisomerase IV or by plasmid-mediated quinolone resistance (PMQR) determinant qnr, qepA, aac(6’)-Ib-cr, and oqxAB . Furthermore, the aac(6')-Ib gene encodes aminoglycoside-modifying enzymes and confers resistance to tobramycin, kanamycin, and amikacin, which is the most prevalent gene. The aac(6')-Ib-cr variant gene can induce resistance against aminoglycoside and fluoroquinolone simultaneously. In our study, isolates with aac (6’)- Ib-cr were resistant for both fluoroquinolone and/or aminoglycoside antibiotics as were found in many other studies [76][77]. In addition to beta lactam, Quinolones are widely used to treat many infections, which are synthetic antibiotics used against Gram-negative bacteria such as Enterobacteriaceae [78]. Fluoroquinolones have broad-spectrum intrinsic activity greater than quinolones. It was reported that Qnr genes are often coexisted on the same resistance plasmids as extended spectrum β-lactamase , which explain the co-resistance to β-lactams and fluoroquinolones [79]. In present study, all qnrs -positive isolates produced CTX-M1 , VIM, SHV and TEM as in appendix 1 . Previous study was found disruption of the ompA gene caused to decrease MICs of chloramphenicol, aztreonam, and nalidixic acid [80],which indicates the role of this gene in antibiotic resistance. Furthermore, Integrons have an essential role in the spread of antibiotic resistance, especially in Gram-negative bacteria, 39% from the isolates in current study had the int1 gene. Furthermore, resistance phenotype-genotypic correlation and dendrogram phylogenetic analysis were performed for the isolates. In this study showed S. marcescens in ICU associated with the high frequency of resistance genes and correlated with resistance phenotype for the antibiotics tested , while dendrogram phylogenetic analysis showed most of the isolates were closely related in their resistance in spite of their huge diversity of sources. Many studies have shown the spread of highly resistance bacteria in Iraqi hospitals [81][82][83][84][85].Form this study, it shows the emergence of highly resistance S. marcescens in Iraqi patients from ICU, which can present a higher risk for effective treatment and control the spread of these isolates. Thus, finding alternative therapy need to be considered like phage therapy, Furthermore, our study has many limitations like size samples and should collect many samples from different hospitals cross Iraq. In addition, plasmid isolation should be considered to get actual distribution of resistance genes between chromosomes and plasmids. Conclusion The spread of highly resistance bacterial isolates around the world presents a serious and urgent issue especially in ICU. S. marcescens isolates have showed a high resistance to antimicrobial agents, which were effective to treat infections caused by these isolates. The emergence of KPC S. marcescens has been reported, which need an effective plan to control infections prevent dissemination of these bacteria. Thus, in our study showed the emergence of highly resistant S. marcescens in ICU, which present a serious concern in nosocomial environments. Further research is warranted to explore novel treatment options and strategies to mitigate the impact of antimicrobial resistance on patient outcomes. Declarations Ethical approval: The ethics committee of Mustansiriyah university/ college of science/ biology department and Ministry of Health of Iraq approved this work. Author Contributions: All authors contributed equally in writing—original draft preparation, all authors have read and agreed to the published version of the manuscript. Funding: This research received no external funding. Acknowledgments: The authors would like to thank Mustansiriyah University (https://uomustansiriyah.edu.iq/ ) / Baghdad, Iraq for its support to complete this work. Conflicts of Interest: The authors declare no conflict of interest . Consent to Participate (Ethics) : the Ethics Committee of the Mustansiriyah University approved and oversaw this study. Consent to Publish (Ethics) : All authors agree to publish this work Informed consent: Not applicable. Research involving human and animals participants: Not applicable References C. Merlino, ‘BARTOLOMEO BIZIO’S LETTER TO THE MOST EMINENT PRIEST, ANGELO BELLANI, CONCERNING THE PHENOMENON OF THE RED-COLORED POLENTAa’, Journal of Bacteriology , vol. 9, no. 6, pp. 527–543, 1924. J. MILLS and D. DREW, ‘Serratia marcescens endocarditis: a regional illness associated with intravenous drug abuse’, Annals of internal medicine , vol. 84, no. 1, pp. 29–35, 1976. R. N. Jones, ‘Microbial etiologies of hospital-acquired bacterial pneumonia and ventilator-associated bacterial pneumonia’, Clinical infectious diseases , vol. 51, no. Supplement_1, pp. S81–S87, 2010. A. Khanna, M. KhAnnA, and A. AggArWAl, ‘Serratia marcescens-a rare opportunistic nosocomial pathogen and measures to limit its spread in hospitalized patients’, Journal of clinical and diagnostic research: JCDR , vol. 7, no. 2, p. 243, 2013. S. Uduman et al. , ‘An outbreak of Serratia marcescens infection in a special-care baby unit of a community hospital in United Arab Emirates: the importance of the air conditioner duct as a nosocomial reservoir’, Journal of Hospital Infection , vol. 52, no. 3, pp. 175–180, 2002. A. Dessì, M. Puddu, M. Testa, M. Marcialis, M. Pintus, and V. Fanos, ‘Serratia marcescens infections and outbreaks in neonatal intensive care units’, Journal of Chemotherapy , vol. 21, no. 5, pp. 493–499, 2009. R. Zivkovic Zaric et al. , ‘Antimicrobial Treatment of Serratia marcescens Invasive Infections: Systematic Review’, Antibiotics , vol. 12, no. 2, p. 367, 2023. I. Stock, T. Grueger, and B. Wiedemann, ‘Natural antibiotic susceptibility of strains of Serratia marcescens and the S. liquefaciens complex: S. liquefaciens sensu stricto, S. proteamaculans and S. grimesii’, International journal of antimicrobial agents , vol. 22, no. 1, pp. 35–47, 2003. Y.-Y. Liu et al. , ‘Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study’, The Lancet infectious diseases , vol. 16, no. 2, pp. 161–168, 2016. L. Sandner-Miranda, P. Vinuesa, A. Cravioto, and R. Morales-Espinosa, ‘The genomic basis of intrinsic and acquired antibiotic resistance in the genus Serratia’, Frontiers in Microbiology , vol. 9, p. 828, 2018. R. L. Ferreira et al. , ‘Characterization of KPC-Producing Serratia marcescens in an Intensive Care Unit of a Brazilian Tertiary Hospital’, Frontiers in Microbiology , vol. 11, 2020, [Online]. Available: https://www.frontiersin.org/articles/10.3389/fmicb.2020.00956 F. Tavares-Carreon, K. De Anda-Mora, I. C. Rojas-Barrera, and A. Andrade, ‘Serratia marcescens antibiotic resistance mechanisms of an opportunistic pathogen: A literature review’, PeerJ , vol. 11, p. e14399, 2023. C. von Wintersdorff, J. Penders, J. van Niekerk, N. Mills, S. Majumder, and L. van Alphen, ‘Dissemination of Antimicrobial Resistance in Microbial Ecosystems through Horizontal Gene Transfer. Front Microbiol. 2016 Feb 19; 7’, 2016. A. Hejazi and F. R. Falkiner, ‘Serratia marcescens’, Journal of medical microbiology , vol. 46, no. 11, pp. 903–912, 1997. K. E. da Silva et al. , ‘Three challenging cases of infections by multidrug-resistant Serratia marcescens in patients admitted to intensive care units’, Brazilian Journal of Microbiology , vol. 52, no. 3, pp. 1341–1345, Sep. 2021, doi: 10.1007/s42770-021-00477-4. F. Tavares-Carreon, K. De Anda-Mora, I. C. Rojas-Barrera, and A. Andrade, ‘Serratia marcescens antibiotic resistance mechanisms of an opportunistic pathogen: A literature review’, PeerJ , vol. 11, p. e14399, 2023. M. J. Siedner et al. , ‘Cefepime vs other antibacterial agents for the treatment of Enterobacter species bacteremia’, Clinical infectious diseases , vol. 58, no. 11, pp. 1554–1563, 2014. N. M. Elsherbiny, I. M. Ali, K. M. Hassanein, and M. T. Ahmed, ‘Extended-spectrum β-lactamase (ESBL)-producing Serratia marcescens causing healthcare-associated infections in Assiut University Hospitals, Egypt.’, Journal of Global Antimicrobial Resistance , vol. 13, pp. 96–97, 2018. H. Phan et al. , ‘Illumina short-read and MinION long-read WGS to characterize the molecular epidemiology of an NDM-1 Serratia marcescens outbreak in Romania’, Journal of Antimicrobial Chemotherapy , vol. 73, no. 3, pp. 672–679, 2018. E. F. Firmo et al. , ‘Association of blaNDM-1 with blaKPC-2 and aminoglycoside-modifying enzyme genes among Klebsiella pneumoniae, Proteus mirabilis and Serratia marcescens clinical isolates in Brazil’, Journal of Global Antimicrobial Resistance , vol. 21, pp. 255–261, 2020. T. Bes et al. , ‘Bloodstream Infections caused by Klebsiella pneumoniae and Serratia marcescens isolates co-harboring NDM-1 and KPC-2’, Annals of clinical microbiology and antimicrobials , vol. 20, no. 1, pp. 1–8, 2021. P. D. Tamma et al. , ‘Prevalence of bla CTX-M genes in Gram-negative bloodstream isolates across 66 hospitals in the United States’, Journal of clinical microbiology , vol. 59, no. 6, pp. 10–1128, 2021. S. Loqman, N. Soraa, S. M. Diene, and J.-M. Rolain, ‘Dissemination of carbapenemases (OXA-48, NDM and VIM) producing enterobacteriaceae isolated from the Mohamed VI university hospital in marrakech, Morocco’, Antibiotics , vol. 10, no. 5, p. 492, 2021. J. Jia et al. , ‘Genomic characterization of two carbapenem-resistant Serratia marcescens isolates causing bacteremia: Emergence of KPC-2-encoding IncR plasmids’, Frontiers in Cellular and Infection Microbiology , vol. 13, p. 1075255, 2023. N. Bolourchi et al. , ‘Comprehensive pan-genomic, resistome and virulome analysis of clinical OXA-48 producing carbapenem-resistant Serratia marcescens strains’, Gene , vol. 822, p. 146355, 2022. M. Miao et al. , ‘Genetic diversity of carbapenem-resistant Enterobacteriaceae (CRE) clinical isolates from a tertiary hospital in Eastern China’, Frontiers in Microbiology , vol. 9, p. 3341, 2019. J. C. Cai, H. W. Zhou, R. Zhang, and G.-X. Chen, ‘Emergence of Serratia marcescens, Klebsiella pneumoniae, and Escherichia coli isolates possessing the plasmid-mediated carbapenem-hydrolyzing β-lactamase KPC-2 in intensive care units of a Chinese hospital’, Antimicrobial agents and chemotherapy , vol. 52, no. 6, pp. 2014–2018, 2008. H. E. Sidjabat et al. , ‘Interspecies spread of Klebsiella pneumoniae carbapenemase gene in a single patient’, Clinical infectious diseases , vol. 49, no. 11, pp. 1736–1738, 2009. A. Tsakris et al. , ‘In vivo acquisition of a plasmid-mediated bla KPC-2 gene among clonal isolates of Serratia marcescens’, Journal of clinical microbiology , vol. 48, no. 7, pp. 2546–2549, 2010. R. Zhang, H. W. Zhou, J. C. Cai, and G.-X. Chen, ‘Plasmid-mediated carbapenem-hydrolysing β-lactamase KPC-2 in carbapenem-resistant Serratia marcescens isolates from Hangzhou, China’, Journal of Antimicrobial Chemotherapy , vol. 59, no. 3, pp. 574–576, Mar. 2007, doi: 10.1093/jac/dkl541. R. L. Ferreira et al. , ‘Characterization of KPC-Producing Serratia marcescens in an Intensive Care Unit of a Brazilian Tertiary Hospital’, Frontiers in Microbiology , vol. 11, 2020, doi: 10.3389/fmicb.2020.00956. A. A. Dashti, M. M. Jadaon, A. M. Abdulsamad, and H. M. Dashti, ‘Heat treatment of bacteria: a simple method of DNA extraction for molecular techniques’, Kuwait Med J , vol. 41, no. 2, pp. 117–122, 2009. A. Iwaya et al. , ‘Rapid and quantitative detection of blood Serratia marcescens by a real-time PCR assay: Its clinical application and evaluation in a mouse infection model’, FEMS Microbiology Letters , vol. 248, no. 2, pp. 163–170, Jul. 2005, doi: 10.1016/j.femsle.2005.05.041. F. Abbaszadeh et al. , ‘Genetic characterization of extensive drug resistant Acinetobacter baumannii: an appalling impediment’, FM , vol. 63, no. 5, pp. 726–737, Oct. 2021, doi: 10.3897/folmed.63.e56566. M. F. Mushi, S. E. Mshana, C. Imirzalioglu, and F. Bwanga, ‘Carbapenemase Genes among Multidrug Resistant Gram Negative Clinical Isolates from a Tertiary Hospital in Mwanza, Tanzania’, BioMed Research International , vol. 2014, p. 303104, Feb. 2014, doi: 10.1155/2014/303104. S. S. AL_Jubori, I. M. AL_kadmy, and Z. JassimAl_Ani, ‘Emergence of multidrug resistance (MDR) Acinetobacterbaumannii isolated from Iraqi hospitals’, Advances in Environmental Biology , vol. 10, no. 5, pp. 265–276, 2016. H. Yigit et al. , ‘Novel carbapenem-hydrolyzing β-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae’, Antimicrobial agents and chemotherapy , vol. 45, no. 4, pp. 1151–1161, 2001. X. Zhou et al. , ‘Effect of sublethal concentrations of ceftriaxone on antibiotic susceptibility of multiple antibiotic-resistant Salmonella strains’, FEMS Microbiology Letters , vol. 366, no. 2, p. fny283, Jan. 2019, doi: 10.1093/femsle/fny283. R. Ramazanzadeh, ‘Etiologic agents and extended-spectrum beta-lactamase production in urinary tract infections in Sanandaj, Iran’, Eastern Journal of Medicine , vol. 15, no. 2, p. 57, 2010. S. Ohana et al. , ‘Spread of a Klebsiella pneumoniae strain producing a plasmid-mediated ACC-1 AmpC β-lactamase in a teaching hospital admitting disabled patients’, Antimicrobial agents and chemotherapy , vol. 49, no. 5, pp. 2095–2097, 2005. S. M. Shakir et al. , ‘Exceptional prevalence of blaNDM-1 gene producing Enterobacter cloacae ssp. dissolvens isolated from hospitals in Baghdad’, Reviews and Research in Medical Microbiology , pp. 10–1097, 2024. H. B. Kim, C. H. Park, C. J. Kim, E.-C. Kim, G. A. Jacoby, and D. C. Hooper, ‘Prevalence of plasmid-mediated quinolone resistance determinants over a 9-year period’, Antimicrobial agents and chemotherapy , vol. 53, no. 2, pp. 639–645, 2009. A. FarajzadehSheikh, H. Veisi, M. Shahin, M. Getso, and A. Farahani, ‘Frequency of quinolone resistance genes among extended-spectrum β-lactamase (ESBL)-producing Escherichia coli strains isolated from urinary tract infections’, Tropical Medicine and Health , vol. 47, no. 1, p. 19, Mar. 2019, doi: 10.1186/s41182-019-0147-8. A. Robicsek, J. Strahilevitz, D. Sahm, G. Jacoby, and D. Hooper, ‘qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States’, Antimicrobial agents and chemotherapy , vol. 50, no. 8, pp. 2872–2874, 2006. K. Ji et al. , ‘Harnessing efficient multiplex PCR methods to detect the expanding Tet (X) family of tigecycline resistance genes’, Virulence , vol. 11, no. 1, pp. 49–56, 2020. L. Wang et al. , ‘Novel plasmid-mediated tet (X5) gene conferring resistance to tigecycline, eravacycline, and omadacycline in a clinical Acinetobacter baumannii isolate’, Antimicrobial agents and chemotherapy , vol. 64, no. 1, pp. 10–1128, 2019. C. Loras et al. , ‘Prevalence, detection and characterisation of fosfomycin-resistant Escherichia coli strains carrying fosA genes in Community of Madrid, Spain’, Journal of Global Antimicrobial Resistance , vol. 25, pp. 137–141, 2021. P. Behruznia et al. , ‘Decreased Susceptibility of Shigella Isolates to Azithromycin in Children in Tehran, Iran’, Canadian Journal of Infectious Diseases and Medical Microbiology , vol. 2022, 2022. L. Huang et al. , ‘Type B Chloramphenicol Acetyltransferases Are Responsible for Chloramphenicol Resistance in Riemerella anatipestifer, China’, Frontiers in Microbiology , vol. 8, 2017, [Online]. Available: https://www.frontiersin.org/articles/10.3389/fmicb.2017.00297 F. Eftekhar, F. Altayar, and H. Khidaei, ‘Plasmid-mediated class 1 and 2 integron carriage in drug-resistant nosocomial isolates of Acinetobacter baumannii’, Archives of Clinical Infectious Diseases , vol. 13, no. 1, 2018. I. M. Al-Kadmy, S. A. Ibrahim, N. Al-Saryi, S. N. Aziz, A. Besinis, and H. F. Hetta, ‘Prevalence of genes involved in colistin resistance in Acinetobacter baumannii: first report from Iraq’, Microbial Drug Resistance , vol. 26, no. 6, pp. 616–622, 2020. A. Amjad, I. A. Mirza, S. Abbasi, U. Farwa, N. Malik, and F. Zia, ‘Modified Hodge test: A simple and effective test for detection of carbapenemase production’, Iranian journal of microbiology , vol. 3, no. 4, p. 189, 2011. K. Blot, N. Hammami, S. Blot, D. Vogelaers, and M.-L. Lambert, ‘Increasing burden of Escherichia coli, Klebsiella pneumoniae, and Enterococcus faecium in hospital-acquired bloodstream infections (2000–2014): a national dynamic cohort study’, Infection Control & Hospital Epidemiology , vol. 40, no. 6, pp. 705–709, 2019. S. Blot et al. , ‘Healthcare-associated infections in adult intensive care unit patients: Changes in epidemiology, diagnosis, prevention and contributions of new technologies’, Intensive and Critical Care Nursing , vol. 70, p. 103227, 2022. S. Uduman et al. , ‘An outbreak of Serratia marcescens infection in a special-care baby unit of a community hospital in United Arab Emirates: the importance of the air conditioner duct as a nosocomial reservoir’, Journal of Hospital Infection , vol. 52, no. 3, pp. 175–180, 2002. A. Dessì, M. Puddu, M. Testa, M. Marcialis, M. Pintus, and V. Fanos, ‘Serratia marcescens infections and outbreaks in neonatal intensive care units’, Journal of Chemotherapy , vol. 21, no. 5, pp. 493–499, 2009. R. Amarsy, G. P. de Ponfilly, H. Benmansour, H. Jacquier, E. Cambau, and B. Mégarbane, ‘Serratia marcescens outbreak in the intensive care unit during the COVID-19 pandemic: A paradoxical risk?’, Medecine et maladies infectieuses , vol. 50, no. 8, pp. 750–751, 2020. J. de Ondarza, ‘Ozone sensitivity and catalase activity in pigmented and non-pigmented strains of Serratia marcescens’, The Open Microbiology Journal , vol. 11, p. 12, 2017. S. Begic and E. A. Worobec, ‘The role of the Serratia marcescens SdeAB multidrug efflux pump and TolC homologue in fluoroquinolone resistance studied via gene-knockout mutagenesis’, Microbiology , vol. 154, no. 2, pp. 454–461, 2008. C. Saralegui et al. , ‘Genomics of Serratia marcescens Isolates Causing Outbreaks in the Same Pediatric Unit 47 Years Apart: Position in an Updated Phylogeny of the Species’, Frontiers in Microbiology , vol. 11, 2020, doi: 10.3389/fmicb.2020.00451. E. Fusté, G. J. Galisteo, L. Jover, T. Vinuesa, T. G. Villa, and M. Viñas, ‘Comparison of antibiotic susceptibility of old and current Serratia’, Future Microbiology , vol. 7, no. 6, pp. 781–786, 2012. E. Fusté, G. J. Galisteo, L. Jover, T. Vinuesa, T. G. Villa, and M. Viñas, ‘Comparison of antibiotic susceptibility of old and current Serratia’, Future Microbiology , vol. 7, no. 6, pp. 781–786, 2012. P. D. Tamma et al. , ‘The use of cefepime for treating AmpC β-lactamase–producing Enterobacteriaceae’, Clinical infectious diseases , vol. 57, no. 6, pp. 781–788, 2013. R. Zivkovic Zaric et al. , ‘Antimicrobial Treatment of Serratia marcescens Invasive Infections: Systematic Review’, Antibiotics , vol. 12, no. 2, p. 367, 2023. H. S. Sader, D. J. Farrell, R. K. Flamm, and R. N. Jones, ‘Antimicrobial susceptibility of Gram-negative organisms isolated from patients hospitalized in intensive care units in United States and European hospitals (2009–2011)’, Diagnostic microbiology and infectious disease , vol. 78, no. 4, pp. 443–448, 2014. M. Götte, A. Berghuis, G. Matlashewski, M. A. Wainberg, and D. Sheppard, Handbook of antimicrobial resistance . Springer, 2017. D. Rawat and D. Nair, ‘Extended-spectrum β-lactamases in Gram Negative Bacteria’, Journal of global infectious diseases , vol. 2, no. 3, p. 263, 2010. K. Bush and G. A. Jacoby, ‘Updated functional classification of β-lactamases’, Antimicrobial agents and chemotherapy , vol. 54, no. 3, pp. 969–976, 2010. J. H. Jeon et al. , ‘Structural basis for carbapenem-hydrolyzing mechanisms of carbapenemases conferring antibiotic resistance’, International journal of molecular sciences , vol. 16, no. 5, pp. 9654–9692, 2015. P. C. S. Ribeiro et al. , ‘Phenotypic and molecular detection of the bla KPC gene in clinical isolates from inpatients at hospitals in São Luis, MA, Brazil’, BMC Infectious Diseases , vol. 16, pp. 1–16, 2016. X. Cao, X. Xu, Z. Zhang, H. Shen, J. Chen, and K. Zhang, ‘Molecular characterization of clinical multidrug-resistant Klebsiella pneumoniae isolates’, Annals of clinical microbiology and antimicrobials , vol. 13, no. 1, pp. 1–5, 2014. A. Mizrahi et al. , ‘Infections caused by naturally AmpC-producing Enterobacteriaceae: Can we use third-generation cephalosporins? A narrative review’, International journal of antimicrobial agents , vol. 55, no. 2, p. 105834, 2020. F. Senchyna et al. , ‘Diversity of resistance mechanisms in carbapenem-resistant Enterobacteriaceae at a health care system in Northern California, from 2013 to 2016’, Diagnostic microbiology and infectious disease , vol. 93, no. 3, pp. 250–257, 2019. N. Alizadeh et al. , ‘Evaluation of resistance mechanisms in carbapenem-resistant Enterobacteriaceae’, Infection and Drug Resistance , pp. 1377–1385, 2020. L. Sandner-Miranda, P. Vinuesa, A. Cravioto, and R. Morales-Espinosa, ‘The Genomic Basis of Intrinsic and Acquired Antibiotic Resistance in the Genus Serratia’, Frontiers in Microbiology , vol. 9, 2018, [Online]. Available: https://www.frontiersin.org/articles/10.3389/fmicb.2018.00828 H. B. Kim, C. H. Park, C. J. Kim, E.-C. Kim, G. A. Jacoby, and D. C. Hooper, ‘Prevalence of plasmid-mediated quinolone resistance determinants over a 9-year period’, Antimicrobial agents and chemotherapy , vol. 53, no. 2, pp. 639–645, 2009. N. H. Kim et al. , ‘Prevalence of plasmid-mediated quinolone resistance genes and ciprofloxacin resistance in pediatric bloodstream isolates of Enterobacteriaceae over a 9-year period’, Japanese Journal of Infectious Diseases , vol. 66, no. 2, pp. 151–154, 2013. G. A. Jacoby, J. Strahilevitz, and D. C. Hooper, ‘Plasmid‐mediated quinolone resistance’, Plasmids: Biology and Impact in Biotechnology and Discovery , pp. 475–503, 2015. F. D. Salah et al. , ‘Distribution of quinolone resistance gene (qnr) in ESBL-producing Escherichia coli and Klebsiella spp. in Lomé, Togo’, Antimicrobial Resistance & Infection Control , vol. 8, pp. 1–8, 2019. Y. Smani, A. Fàbrega, I. Roca, V. Sánchez-Encinales, J. Vila, and J. Pachón, ‘Role of OmpA in the multidrug resistance phenotype of Acinetobacter baumannii’, Antimicrobial agents and chemotherapy , vol. 58, no. 3, pp. 1806–1808, 2014. S. Ibrahim, N. Al-Saryi, I. M. Al-Kadmy, and S. N. Aziz, ‘Multidrug-resistant Acinetobacter baumannii as an emerging concern in hospitals’, Molecular biology reports , vol. 48, no. 10, pp. 6987–6998, 2021. S. S. Khazaal, I. M. Al-Kadmy, and S. N. Aziz, ‘Mechanism of pathogenesis in multidrug resistant Acinetobacter baumannii isolated from intensive care unit’, Gene Reports , vol. 18, p. 100557, 2020. I. M. M. Alansary and N. A. Al-Saryi, ‘Detection of biofilm formation in classical and hypervirulent Klebsiella pneumoniae’, Al-Mustansiriyah Journal of Science , vol. 33, no. 5, pp. 65–71, 2022. E. A. Muhsin, L. A. Said, and S. S. Al-Jubori, ‘Correlation of type 1 and type 3 Fimbrial genes with the type of specimen and the antibiotic resistance profile of clinically isolated Klebsiella pneumoniae in Baghdad’, Al-Mustansiriyah Journal of Science , vol. 33, no. 3, pp. 1–11, 2022. A. A. Abdulhussein and B. O. Abdulsattar, ‘Identification and Characterization of a Bacteriophage with Lytic Activity against Multidrug Resistant E. coli’, Al-Mustansiriyah Journal of Science , vol. 34, no. 1, pp. 24–31, 2023. Additional Declarations No competing interests reported. Supplementary Files appendix1.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4055474\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":278829165,\"identity\":\"12609c53-656c-47bf-b58d-dab711b88475\",\"order_by\":0,\"name\":\"Israa M.S. AL-Kadmy\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABIUlEQVRIiWNgGAWjYJCCDx8QbAkGNgYQYmAGI6yAjYFx5gwwi5kELbN5EFqgYrjVMzDIz29/2GzbZhNtcP78wc8Ffyzy+SSSnz1gqLBObGBn3oBNi8ExHsPm3La03A03kpmlZ7ZJWLZJpJkbMJxJT2xgZivAqoWNh/1xbtthoBZmBmneBgkDNokEMwnGtsNALTwGWB3Wxv6w2RKk5fxh5t88f0Ba0r9JMP7DrYXhGINhMyNIy4FkNmkeNpCWHKAtDbi1GBzLMWzsOZeWO/NGspk1bxtQC8+bMomEY+nGbTj8It98/GHDjzKb3L7zBx/f5vlTZyDfnr5N4kONtWw//2GsIYYFCCQwMAARKHaw+wUT8B9AOJtILaNgFIyCUTC8AQDeglnflmc3WwAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Mustansiriyah University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Israa\",\"middleName\":\"M.S.\",\"lastName\":\"AL-Kadmy\",\"suffix\":\"\"},{\"id\":278829166,\"identity\":\"c0d99387-619a-4ed8-b839-e7acdf4c394a\",\"order_by\":1,\"name\":\"Nadal A. Al-Saryi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Mustansiriyah University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Nadal\",\"middleName\":\"A.\",\"lastName\":\"Al-Saryi\",\"suffix\":\"\"},{\"id\":278829167,\"identity\":\"f22fd8e5-c73b-4b56-89b3-46bb3d7beb6b\",\"order_by\":2,\"name\":\"Istabreq Muhammed Ali Salman\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Mustansiriyah University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Istabreq\",\"middleName\":\"Muhammed Ali\",\"lastName\":\"Salman\",\"suffix\":\"\"},{\"id\":278829168,\"identity\":\"9f8ac32a-5efc-4d28-8b0e-3d2e7e5bcdd8\",\"order_by\":3,\"name\":\"Eman Thamer Garallah\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Mustansiriyah University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Eman\",\"middleName\":\"Thamer\",\"lastName\":\"Garallah\",\"suffix\":\"\"},{\"id\":278829169,\"identity\":\"4028ca41-907e-4811-891f-840190c9f6a0\",\"order_by\":4,\"name\":\"Sarah Naji Aziz\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Mustansiriyah University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sarah\",\"middleName\":\"Naji\",\"lastName\":\"Aziz\",\"suffix\":\"\"},{\"id\":278829170,\"identity\":\"43a48fa0-372e-41d2-83d2-b39e7924193c\",\"order_by\":5,\"name\":\"Sawsan Sajid Al-Jubori\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Mustansiriyah University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Sawsan\",\"middleName\":\"Sajid\",\"lastName\":\"Al-Jubori\",\"suffix\":\"\"},{\"id\":278829171,\"identity\":\"db13f0ce-5a7b-4821-9439-d11ff2e80fc1\",\"order_by\":6,\"name\":\"Eman Natiq Naji\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Mustansiriyah University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Eman\",\"middleName\":\"Natiq\",\"lastName\":\"Naji\",\"suffix\":\"\"},{\"id\":278829172,\"identity\":\"1eedcf56-997c-4629-b45f-90cfffd4edeb\",\"order_by\":7,\"name\":\"Eman alhomaidi\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Princess Nourah bint Abdulrahman University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Eman\",\"middleName\":\"\",\"lastName\":\"alhomaidi\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-03-09 11:33:49\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4055474/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4055474/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":52712070,\"identity\":\"823e028c-770d-4977-b75a-652dc9cdc017\",\"added_by\":\"auto\",\"created_at\":\"2024-03-14 20:06:23\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":148368,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003ephenotypic detection of carbapenemases activity. carbapenemase producer showed a clover leaf like indentation of the \\u003c/strong\\u003e\\u003cem\\u003e\\u003cstrong\\u003eEscherichia coli \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003e25922 growing along the test organism growth streak within the disk diffusion zone.\\u003c/strong\\u003e\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4055474/v1/f77ac5b97f83cc3c6c020c04.png\"},{\"id\":52712072,\"identity\":\"b87f711d-28a5-456f-b471-883bd1dfdeb1\",\"added_by\":\"auto\",\"created_at\":\"2024-03-14 20:06:23\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":576675,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eFig 3: \\u003cstrong\\u003eDendrogram phylogenetic analysis of antibiotics resistance profile\\u003c/strong\\u003e and the isolates sources. tree constructed by Geneious tree builder Software . W=wound, U=urine, B=blood, CA=catheter, bu=burns, bro= bronchial secretions, abs=abscess pleural =pleural fluid\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"image2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4055474/v1/54b31c77a068e5eaf824840f.png\"},{\"id\":55800435,\"identity\":\"75ba723c-5bf0-4824-a40d-575d02188785\",\"added_by\":\"auto\",\"created_at\":\"2024-05-03 12:30:49\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1808535,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4055474/v1/bdb7fb27-e662-43cf-baba-b62bb4ac204d.pdf\"},{\"id\":52712069,\"identity\":\"f568a8a0-7eec-405a-ba81-8d797224c0c4\",\"added_by\":\"auto\",\"created_at\":\"2024-03-14 20:06:23\",\"extension\":\"xlsx\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":21793,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"appendix1.xlsx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4055474/v1/57088fde2f6eabdb3dbc9dc5.xlsx\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"\\u003cp\\u003eEmerging Threat: Highly Resistant Serratia marcescens in Iraqi ICU Patients\\u003c/p\\u003e\",\"fulltext\":[{\"header\":\"Introduction \",\"content\":\"\\u003cp\\u003e\\u003cem\\u003eSerratia marcescens (S. marcescens) \\u003c/em\\u003eis Gram-negative bacteria belong to Enterobacteriaceae family. This bacterium occurs naturally in water and soil, was initially considered as non-pathogenic bacteria for many years, and can produce a red pigment at room temperature [1]. It is opportunistic and nosocomial pathogen causes both community-acquired and nosocomial infections such respiratory tract, urinary tract, endocarditis, septicemia, osteomyelitis, wound infections, meningitis, and eye infections [2] [3] \\u003cem\\u003e. \\u003c/em\\u003eThe main source for epidemic of these bacteria is the \\u003cstrong\\u003eI\\u003c/strong\\u003entensive \\u003cstrong\\u003eC\\u003c/strong\\u003eare \\u003cstrong\\u003eU\\u003c/strong\\u003enits(ICU), which lead to \\u003cem\\u003eS. marcescens \\u003c/em\\u003ecolonization and infections [4].\\u003cem\\u003eSerratia marcescens\\u003c/em\\u003e presents a significant threat in these ICU because it is often associated with healthcare-associated infections especially immunocompromised individuals and patients with invasive medical devices such as catheters or ventilators [5][6]. \\u003cem\\u003eSerratia marcescens\\u003c/em\\u003e has developed resistance to various antibiotics, which makes infections caused by this bacterium difficult to treat [7]. It is known that \\u003cem\\u003eS. marcescens \\u003c/em\\u003eshows resistance to narrow-spectrum penicillins and cephalosporins; macrolides; tetracycline; nitrofurantoin; cefuroxime; cephamycins; fluoroquinolone, and colistin [8][9][10][11]. The resistance to some of these antimicrobials can be intrinsic or occurs by chromosomal resistance genes or by the acquisition of these genes via horizontal transfer. This mechanism contributes significantly to the rapid spread of resistance genes and is considered the most important mechanism caused the multiple antibiotic resistance [12][13].\\u003c/p\\u003e\\n\\u003cp\\u003eSome of the antibiotics that \\u003cem\\u003eS. marcescens\\u003c/em\\u003e may be resistant to include \\u0026beta;-lactam antibiotics by producing \\u0026beta;-lactamase enzymes, which can inactivate certain antibiotics, such as penicillins and cephalosporins [14]. Furthermore, \\u003cem\\u003eS. marcescens\\u003c/em\\u003e can acquire genes that produce carbapenemases, which break down carbapenem antibiotics [15]. These antibiotics are considered important last-line treatments for severe infections. Highly resistant \\u003cem\\u003eSerratia marcescens\\u003c/em\\u003e strains are strains developed a high level of resistance to commonly used antibiotics [16]. Furthermore, these strains are known as \\u003cstrong\\u003eM\\u003c/strong\\u003eulti \\u003cstrong\\u003eD\\u003c/strong\\u003erug \\u003cstrong\\u003eR\\u003c/strong\\u003eesistant ((MDR) \\u003cem\\u003eSerratia marcescens\\u003c/em\\u003e or extensively drug-resistant \\u003cem\\u003eSerratia marcescens\\u003c/em\\u003e, depending on the number and type of antibiotics they can develop resistance to [16]. These resistance strains present a new challenge in treating infections caused by these strains and cannot be treated by commonly used antibiotics, such as penicillin, cephalosporins, or fluoroquinolones. Thus, use alternative antibiotics can be effective such as carbapenems, aminoglycosides, or polymyxins [17]. However, strains have emerged showing resistance to these antibiotics. Many reports have showed the emergence of MDR \\u003cem\\u003eS. marcescens\\u003c/em\\u003e outbreaks, which carrying either extended-spectrum \\u0026beta;-lactamases (ESBLs) or carbapenemases, which confer extended spectrum cephalosporin and carbapenem resistance, respectively [18] [19] [20] [21] [22] [23] [24] . In Enterobacteriaceae including \\u003cem\\u003eS. marcescens, \\u003c/em\\u003ethe most common ESBL are class A, SHV (sulfhydryl variable), CTX-M-type (cefotaxime enzyme), D \\u0026beta;-lactamases OXA (oxacillinases)) and the KPC (\\u003cem\\u003eK. pneumoniae\\u003c/em\\u003e carbapenemase) between the clinical isolates [25] [26]. From the beginning of the twenty-first century, KPC spread between clinical isolates of \\u003cem\\u003eS. marcescens\\u003c/em\\u003e was notified in China, Greece, Brazil, and United States [27] [20][28][29] [30], and the most of these isolates were collected from patients in surgical intensive care [31]. Thus, it was suggested that acquisition of KPC plasmid were occurred at the nosocomial environment. An urgent prevention and control for these strains are required. Important control and prevention measures include proper hand hygiene, adherence to infection control protocols, appropriate use of antibiotics, and surveillance to detect and track the presence of these strains within healthcare settings are necessary to control the spread of these strains. Thus, we aimed to investigate antimicrobial resistance profile of \\u003cem\\u003eS. marcescens \\u003c/em\\u003eisolated from ICUs patients in Baghdad city. \\u0026quot;Antimicrobial Resistance Profile of Serratia marcescens Isolated from ICU Patients in Baghdad City: A Comprehensive Study\\u0026quot;\\u003c/p\\u003e\"},{\"header\":\"MATERIAL AND METHODS\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eStudy Design and Bacterial Isolates\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eA total of 101 \\u003cem\\u003eSerratia marcescens\\u0026nbsp;\\u003c/em\\u003eisolates were collected from patients admitted into Intensive Care Units in many hospitals in Baghdad city during the period from April 2018 to February 2021. The isolates were collected from different sources and the age of patients was over 20 years. The isolates were cultured on blood and Macckoncy plates for primary phenotypic identification.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eIdentification of the\\u0026nbsp;\\u003c/strong\\u003e\\u003cstrong\\u003e\\u003cem\\u003eSerratia marcescens\\u003c/em\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;isolates\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll isolates of \\u003cem\\u003eS. marcescens\\u0026nbsp;\\u003c/em\\u003ewere identified by using standard biochemical laboratory methods, VIETK II system (Bio-Merieux, France), and molecular method using \\u003cem\\u003e16S\\u0026nbsp;\\u003c/em\\u003egene (Primers listed in Table 1). The isolates were stored at -80 until been used.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eGenomic DNA Extraction and PCR amplification\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eGenomic DNA isolation was performed by boiling method as described by [32]. From each isolate, 10 single colonies were selected and transferred into eppendorf tube contain 400 \\u0026mu;l ddH2O. Next, the cells were lysed using 100water bath for 10 min and the tubes were kept on ice immediately. Following step, the samples were frozen for 20 min at -20\\u003csup\\u003eo\\u003c/sup\\u003eC to heat shock the cell and left to thaw at room temperature. Then, the samples were homogenized by vortex for 10s and centrifuged at 13,362 \\u003cem\\u003eg\\u0026nbsp;\\u003c/em\\u003efor 15 min at 4\\u0026deg;C. The upper aqueous layer was kept and transferred into new sterile eppendorf tube, and these DNA samples were frozen until be used.\\u003cem\\u003e16s\\u003c/em\\u003e gene was used to identify these isolates. In addition, the PCR was used to amplify antibiotic resistance and virulence genes. The PCR reactions were prepared in a total volume of 25 \\u0026mu;l and consisted of: Promega Master mix 12.5 \\u0026micro;l, forward primer 1\\u0026micro;; reverse primer 1 \\u0026micro;l; nuclease free distilled water 5.5 \\u0026micro;l; DNA template 5\\u0026micro;l. The gene was amplified for 30 cycles by PCR as the following: the initial denaturation of DNA as 95\\u0026deg;C for 5min, the denaturation step of DNA as 95\\u0026deg;C for 30s ; the annealing step of the primers as ---*\\u0026deg;C for 30s , the elongation step as 72\\u0026deg;C for -----* sec, final extension as 72\\u0026deg;C for 5 min. *The annealing temperature was changed occasionally depend on melting temperature of primers, while time of elongation depend on PCR product size. The primers, and size of PCR products are listed in Table 1.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 1: The primers, and size of PCR products used in this study\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"633\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003ePrimer\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eSequence (5\\u0026apos;-3\\u0026apos;)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eProduct size(bp)\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eTM\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eReference\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003e16S rRNA\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e5GGTGAGCTTAATACGTTCATCAATTG\\u003c/p\\u003e\\n \\u003cp\\u003e3-GCAGTTCCCAGGTTGAGCC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e200\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e60\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[33]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003ebla\\u003csub\\u003ePER\\u003c/sub\\u003e\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eATGAATGTCATTATAAAAGC\\u003c/p\\u003e\\n \\u003cp\\u003eAATTTGGGCTTAGGGCAGAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e925\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e51\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[34]\\u003c/p\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003ebla\\u003csub\\u003eVIM\\u003c/sub\\u003e\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e5 - GATGGTGTTTGGTCGCATA-3\\u003c/p\\u003e\\n \\u003cp\\u003e5 -CGAATGCGCAGCACCAG-3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e390\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e56\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[35]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003ebla\\u003csub\\u003eCTX-M\\u003c/sub\\u003e\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eF- GTTGGGGTAGTTGCGATTGG\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003eR-CGCTTTGCGATGTGAAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp; 550\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e48\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[36]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003ebla\\u003csub\\u003ekpc\\u003c/sub\\u003e\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e5` -TGTCACTGTATCGCCGTC- 3`\\u003c/p\\u003e\\n \\u003cp\\u003e5` -CTCAGTGCTCTACAGAAAACC- 3`\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e1010\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e58\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[37]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eBla\\u003csub\\u003eCMY\\u003c/sub\\u003e\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eF-GACAGCCTCTTTCTCCACA\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003eR-TGGAACGAAGGCTACGTA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1014\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e57\\u0026deg;C\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;[38]\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eIMP-1\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eF \\u0026ndash;CTACGCCAGCAGAGTCTTTG\\u003c/p\\u003e\\n \\u003cp\\u003eR-AACCAGTTTTGCCTTACCAT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e500\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e55\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u0026nbsp;[39]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eSHV\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eF -AAGATCCACTATCGCCAGCAG\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003eR-ATTCAGTTCCGTTTCCCAGCGG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e200\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e59\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u0026nbsp;[40]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eTEM\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;F-ATAAAATTCTTGAAGAC\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003eR-TTACCAATGCTTAATCA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1079\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e42\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u0026nbsp;[40]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eNDM-1\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eF-GGTGCATGCCCGGTGAAATC\\u003c/p\\u003e\\n \\u003cp\\u003eR -ATGCTGGCCTTGGGGAACG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e661\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e52\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;[41]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eqnrB\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eF-GATCGTGAAAGCCAGAAAGG -3\\u0026apos;\\u003c/p\\u003e\\n \\u003cp\\u003eR- ATGAGCAACGATGCCTGGTA - 3\\u0026apos;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e476\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e52\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;[42]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eqnrS\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eF- GCAAGTTCATTGAACAGGGT- 3\\u0026apos;\\u003c/p\\u003e\\n \\u003cp\\u003eR- TCTAAACCGTCGAGTTCGGCG- 3\\u0026apos;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp;428\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e60\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[43]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eaac(6\\u0026apos;)-Ib-cr\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eF- TTGCGATGCTCTATGAGTGGCTA\\u003c/p\\u003e\\n \\u003cp\\u003eR- CTC GAA TGC CTG GCG TGT TT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e482\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e56\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[44]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eant(4\\u0026rsquo;)IIb\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eF-ACGACAAGGATATGGAATTGCCCAAT\\u003c/p\\u003e\\n \\u003cp\\u003e\\u0026nbsp;R-ACAAGACCCGTTCAATTCAATTCAT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e364\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e57\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[36]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eaph(3\\u0026apos;\\u0026apos;)Ib\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTAT CTC GGC GGC GGT CGA GT\\u003c/p\\u003e\\n \\u003cp\\u003eCAC GCG GGG AAA CGC GAG AA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e800\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e55\\u0026deg;C\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[36]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003ermtC\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCGA AGA AGT AAC AGC CAA AG\\u0026nbsp;\\u003c/p\\u003e\\n \\u003cp\\u003eATC CCA ACA TCT CTC CCA CT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e711\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e53\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[36]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003ermtD\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTCAAAAAGGAAAAGGACGTG\\u003c/p\\u003e\\n \\u003cp\\u003eCGATGCGACGATCCATTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e500\\u003c/p\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e52\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[36]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003etet(A)\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eF- GTGAAACCCAACATACCCC\\u003c/p\\u003e\\n \\u003cp\\u003eR- GAAGGCAAGCAGGATGTAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e888\\u003c/p\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e55\\u0026deg;C\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[45]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eTet (X)\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eF- CCGTTGGACTGACTATGGC\\u003c/p\\u003e\\n \\u003cp\\u003eR- TCAACTTGCGTGTCGGTAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e474\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e53\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[46]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003efosA\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eF- 5\\u0026prime;-ATC TGT GGG TCT GCC TGT CGT-3\\u003c/p\\u003e\\n \\u003cp\\u003eR-5\\u0026prime;-ATG CCC GCA TAG GGC TTC T-3\\u0026prime;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e245\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e58\\u0026deg;C\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[47]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003empha\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\"\\u003e\\n \\u003cp\\u003eF: GTGAGGAGGAGCTTCGCGAG\\u003c/p\\u003e\\n \\u003cp\\u003eR: TGCCGCAGGACTCGGAGGTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\"\\u003e\\n \\u003cp\\u003e403\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\"\\u003e\\n \\u003cp\\u003e59\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;[48]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eomp(A)\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\"\\u003e\\n \\u003cp\\u003eF- ATGAAAAAGACAGCTATCGCG\\u003c/p\\u003e\\n \\u003cp\\u003eR: CACCAAAAGCACCAGCGCCCA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\"\\u003e\\n \\u003cp\\u003e187\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\"\\u003e\\n \\u003cp\\u003e54\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\"\\u003e\\n \\u003cp\\u003e[48]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003ecat\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e5\\u0026prime;CATGGATGAAAAATTTCTTCGAAAGT-3\\u0026prime;\\u003c/p\\u003e\\n \\u003cp\\u003e5\\u0026prime;-CGAGTCATTTCATTTTTCTAAAAAAC-3\\u0026prime;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e620\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e54\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[49]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eInt1\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e5\\u0026rsquo;-ACGAGCGCAAGGTTTCGGT-3\\u0026rsquo;\\u003c/p\\u003e\\n \\u003cp\\u003e5\\u0026rsquo;-GAAAGGTCTGGTCATACATG-3\\u0026rsquo;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e565\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e52 \\u0026deg;C\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[50]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003emcr-1\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"40.28436018957346%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e5-CACTTATGGCACGGTCTATGA-3\\u003c/p\\u003e\\n \\u003cp\\u003e5-CCCAAACCAATGATACGCAT-3\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e956\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.42654028436019%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e59\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.429699842022117%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e[51]\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAntimicrobial susceptibility test\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eKirby-Bauer disc diffusion method was used to test the antimicrobial susceptibility of the \\u003cem\\u003eS. marcescens\\u003c/em\\u003e isolates against 18 antibiotics including: ampicillin (AMP), ampicillin/ sulbactam (SAM), amoxicillin/clavulanic acid (AMC), piperacillin/tazobactam (TZP), cefepime (FEP) ,gentamicin (GEN), tobramycin (TOB,) ciprofloxacin(CIP), tetracycline (TET), cefotaxime (CTX), ceftriaxone(CRO), amikacin (AMK), imipenem (IPM), meropenem (MEM), levofloxacin (LVX), tigecycline (TGC), azithromycin (AZM), colistin (CST), (Bioanalyse ( Turkey)). The results were interrupted according to (CLCS, 2022) http://em100.edaptivedocs. net/GetDoc.aspx?doc=CLSI%20M27M44S%20ED3:2022\\u0026amp;scope=user).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eModified Hodge test:\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eModified Hodge test (MHT) was performed according to Amjad \\u003cem\\u003eet al\\u003c/em\\u003e. [52]for detection of carbapenemase production in Gram negative rods. Briefly,5 ml of brain heart infusion broth culture for \\u003cem\\u003eEscherichia coli\\u0026nbsp;\\u003c/em\\u003eATCC 25922 equals to 0.5 McFarland dilution was prepared. 1:10 dilution was streaked as lawn on to a Mueller Hinton agar plate. Ten \\u0026mu;g/disc meropenem susceptibility disk was placed in the center of the test area. Test organism was streaked in a straight line from the edge of the disk to the edge of the plate. The plate was incubated overnight at 37\\u0026ordm;C for 24 hours. After 24 hrs, MHT Positive test (carbapenemase producer) showed a clover leaf like indentation of the \\u003cem\\u003eEscherichia coli\\u0026nbsp;\\u003c/em\\u003e25922 growing along the test organism growth streak within the disk diffusion zone. MHT negative test represent by normal growth for the standard strain or without the formation of clover leaf-like shape.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMolecular detection of antibiotics resistance genes\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003ePolymerase chain reaction (PCR) was used to detect antibiotics resistance genes including: \\u0026beta;-lactamase genes (bla\\u003csub\\u003eTEM\\u003c/sub\\u003e, bla\\u003csub\\u003eSHV\\u003c/sub\\u003e variants, bla\\u003csub\\u003ePER\\u003c/sub\\u003e, bla\\u003csub\\u003eCTX\\u0026ndash;M\\u003c/sub\\u003e,\\u003cstrong\\u003e\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003e\\u003c/strong\\u003e\\u003cem\\u003eBla\\u003csub\\u003eCMY\\u003c/sub\\u003e),\\u0026nbsp;\\u003c/em\\u003ecarbapenemase genes (bla\\u003csub\\u003eKPC\\u003c/sub\\u003e, bla\\u003csub\\u003eIMP\\u003c/sub\\u003e, bla\\u003csub\\u003eVIM\\u003c/sub\\u003e,bla\\u003csub\\u003eNMD\\u003c/sub\\u003e) and other resistance genes including (aac(6\\u0026rsquo;)-Ib-cr), \\u003cem\\u003eqnrB, qnrS, ant(4\\u0026rsquo;)IIb, aph(3\\u0026apos;\\u0026apos;)Ib, rmtC, rmtD, tet(A), tet (X), fosA, mcr-1, mpha, omp(A) ,cat and Int1 .\\u003c/em\\u003eThese genes were amplified using specific primers designed to follow the conditions described in the references from Table 1. All primers were synthesized by Extend (Brazil). Amplicons were analyzed by gel electrophoresis in 1.0 or 1.5 % agarose and visualized under ultraviolet (UV) light.\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003ePCR conditions were used to amplify resistance genes as mentioned above.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDendrogram phylogenetic analysis\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eDendrogram phylogenetic analysis were constructed with the \\u003cem\\u003eGeneious Tree Builder\\u003c/em\\u003e software using the \\u003cem\\u003eJukes\\u003c/em\\u003e-\\u003cem\\u003eCantor distance model\\u003c/em\\u003e, Neighbour-Joining \\u003cem\\u003etree build method\\u003c/em\\u003e and UPGMA\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData analysis\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe statistical analysis of this study was performed using (SPSS) software version 21. The Chi Square was used to examine continuous and categorical variables. The Fisher tests (95% confidence interval) was used to calculate the difference in virulence factors and drug resistance levels. Where the p value \\u0026lt; 0.05 was significant.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003eSerratia marcescens\\u003c/em\\u003e\\u003c/strong\\u003e\\u003cstrong\\u003e\\u0026nbsp;isolation and identification\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eA total of 101 isolates of \\u003cem\\u003eS. marcescens\\u003c/em\\u003e were isolated from Intensive Care patients during this study and identified by biochemical tests, VITEK II and by molecular identification using \\u003cem\\u003e16s.\\u003c/em\\u003eThe clinical source of these isolates was divided as the following: 35 (34.6 % ) from urine, 21(20.7%) from blood, 21(20.7%) from wound , 11(10.89%) from catheter, 5 (4.9%) from bronchial secretions, 4 ( 3.96%) from burns, 2(1.98%) from abscess and from 1 isolate from each eye ( 0.99% ) and pleural fluid(0.99%).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAntibiotic susceptibility of \\u003cem\\u003eSerratia marcescens\\u0026nbsp;\\u003c/em\\u003eisolates\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe antibiotic susceptibility test was performed for antibiotics belong to different groups \\u0026szlig;-lactam, aminoglycoside, tetracycline, macrolide and fluoroquinolones. The highest resistance rate was found for ampicillin, ampicillin/sulbactam, cefepime and amoxicillin/clavulanic acid as 100%, 93% ,98%, and 90.09% respectively, while the lowest resistance was shown for colistin as 24.7%. The percentage antibiotic resistance of \\u003cem\\u003eS. marcescens\\u0026nbsp;\\u003c/em\\u003eisolates was shown in Table 2. In this study, 71 isolates were classified as MDR \\u003cem\\u003eS. marcescens\\u003c/em\\u003e.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 2: Antibiotic resistance percentage of \\u003cem\\u003eS. marcescens\\u0026nbsp;\\u003c/em\\u003eisolates tested in this study\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAntibiotics\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eNumber of\\u003c/p\\u003e\\n \\u003cp\\u003eResistant isolates\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePercentage of resistance\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAmpicillin\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e101\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e100%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAmpicillin/Sulbactam\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e94\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e93%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAmpicillin/\\u0026nbsp;Clavulanic acid\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e70\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e69.3%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCefepime\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e98\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e97%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAmoxicillin/Clavulanic acid\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e91\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e90.09%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGentamycin\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e82\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e81.1%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTobramycin\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e78\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e77.2%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCiprofloxacin\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e73\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e72.2%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTetracycline\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e73\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e72.2%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCefotaxime\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e64\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e63.3%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCeftriaxone\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e62\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e61.38%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAmikacin\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e53\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e52.4%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eImipenem\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e50\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e49.5%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eMeropenem\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e39\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e38.6%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eLevofloxacin\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e46\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e45.5%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTigecycline\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e39\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e38.6%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ePiperacillin\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e58\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e57.4%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAzithromycin\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e44\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e43.56%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"40.08810572687225%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eColistin\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"36.12334801762115%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e25\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"23.788546255506606%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e24.7%\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMolecular detection of antibiotics resistance genes\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003ePCR was used to detect antibiotics resistance genes for \\u003cem\\u003eS. marcescens\\u003c/em\\u003e isolates. For \\u0026beta;- lactamase genes detection, all of the isolates contain\\u003cspan dir=\\\"RTL\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003e\\u003cem\\u003ebla\\u003csub\\u003eCTX-M\\u0026nbsp;\\u003c/sub\\u003eand blaSHV beside\\u003c/em\\u003e 98% and 92% of the isolates showed PCR products for \\u003cem\\u003ebla\\u003csub\\u003eCMY\\u0026nbsp;\\u003c/sub\\u003e\\u003c/em\\u003eand\\u003cem\\u003e\\u003csub\\u003e\\u0026nbsp;\\u003c/sub\\u003ebla\\u003csub\\u003eTEM\\u003c/sub\\u003e\\u0026nbsp;\\u003c/em\\u003egenes\\u003cem\\u003e,\\u0026nbsp;\\u003c/em\\u003erespectively. In addition, these isolates were tested for harbouring \\u003cem\\u003equr\\u003c/em\\u003e genes, 70 ( 69.3%) of the isolates were positive for \\u003cem\\u003eqnrB\\u003c/em\\u003e and 67(66.3%) harboured \\u003cem\\u003equrS.\\u0026nbsp;\\u003c/em\\u003eAminoglycoside resistance genes were indicated in \\u003cem\\u003eS. marcescens\\u003c/em\\u003e isolates as following: \\u003cem\\u003eaac(6\\u0026apos;)-Ib-\\u003c/em\\u003e was found in 45(44.5%), \\u003cem\\u003eant(4\\u0026rsquo;)IIb\\u003c/em\\u003e in 42(41.5%), \\u003cem\\u003eaph(3\\u0026apos;\\u0026apos;)Ib\\u003c/em\\u003e in 41(40.5%), \\u003cem\\u003ermtC\\u003c/em\\u003e in 43 (42.5%) , and \\u003cem\\u003ermtD\\u003c/em\\u003e in 58(57.4%) of the tested isolates. Furthermore, \\u003cem\\u003etet(A)\\u003c/em\\u003e and \\u003cem\\u003etet(X)\\u003c/em\\u003e genes were found in 68(67.3) and 66(65.3%) of the isolates, respectively. PCR analysis revealed that 41(40.5%) isolates contain \\u003cem\\u003efasA\\u003c/em\\u003e and \\u003cem\\u003empha\\u003c/em\\u003e gene beside 44(43.5%), and 54 (53.4%) contain \\u003cem\\u003eompA\\u003c/em\\u003e and \\u003cem\\u003ecat, r\\u003c/em\\u003eespectively. Furthermore, \\u003cem\\u003emcr1\\u003c/em\\u003e was found in 25 (24.7%) isolates only. Beside these resistance genes detection, class 1 integrons (\\u003cem\\u003eInt1\\u003c/em\\u003e) was found in 40(39.6%) \\u003cem\\u003eS. marcescens\\u0026nbsp;\\u003c/em\\u003eisolates.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eHodge test\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003ePhenotypic analysis for carbapenemase activity was carried out by a modified Hodge test. The results showed that 23.7 % of the isolates were positive for this test as shown in Table 3, Fig 1. All isolates positive for this test showed resistance to imipenem and meropenem.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable 3- Isolates positive for Hodge test, their antibiotic resistance and source\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"28.73194221508828%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eThe isolates positive for Hodge test\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"22.792937399678973%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNumber of isolates resistant for all antibiotics tested\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.23756019261637%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNumber of isolates resistant for all antibiotics tested expect tobramycin\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.23756019261637%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eNumber of isolates resistant for all antibiotics tested expect amikacin\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"28.73194221508828%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e24 isolates\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"22.792937399678973%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e22\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.23756019261637%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.23756019261637%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"28.73194221508828%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eSource of the isolates\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"22.792937399678973%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e7 isolates from wound, 6 from urine, 7 from blood, 2 from burn, 1 from cather\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.23756019261637%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eblood\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"24.23756019261637%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eUrine\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eMolecular detection of carbapenemase genes\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eBeside phenotypic detection of carbapenemase by Hodge test, molecular detection for carbapenemase genes was performed. In this study, 51 isolates were positive for \\u003cem\\u003ebla\\u003csub\\u003eIMP\\u003c/sub\\u003e\\u003c/em\\u003e,\\u003cem\\u003e\\u003csub\\u003e\\u0026nbsp;\\u003c/sub\\u003e\\u003c/em\\u003e44 isolates for \\u003cem\\u003ebla\\u003csub\\u003eKPC\\u003c/sub\\u003e ,\\u0026nbsp;\\u003c/em\\u003e91 isolates\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003efor\\u003cem\\u003e\\u0026nbsp;bla\\u003csub\\u003eVIM\\u003c/sub\\u003e\\u003c/em\\u003e, and 14 isolates for \\u003cem\\u003ebla\\u003csub\\u003eNDM1,\\u003c/sub\\u003e\\u003c/em\\u003e respectively as shown in Table 4.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eTable (4) Frequency of carbapenemase genes in \\u003cem\\u003eS. marcescens\\u0026nbsp;\\u003c/em\\u003eisolates\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"575\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"18.118466898954704%\\\" rowspan=\\\"3\\\"\\u003e\\n \\u003cp\\u003e\\u003cem\\u003eS. marcescens \\u0026nbsp;\\u003c/em\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"16.37630662020906%\\\" rowspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eIsolates\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eTotal number\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"18.989547038327526%\\\" colspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003ebla\\u003csub\\u003eIMP\\u003c/sub\\u003e\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"14.634146341463415%\\\" colspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003ebla\\u003csub\\u003eNDM1\\u003c/sub\\u003e\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"14.80836236933798%\\\" colspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003ebla\\u003csub\\u003eVIM1\\u003c/sub\\u003e\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.073170731707318%\\\" colspan=\\\"2\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e\\u003cem\\u003ebla\\u003csub\\u003eKPC\\u003c/sub\\u003e\\u003c/em\\u003e\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"16.22340425531915%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eno\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"12.76595744680851%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e%\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"11.436170212765957%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eno\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"11.170212765957446%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e%\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.372340425531915%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eno\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"12.23404255319149%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e%\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"12.23404255319149%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003eno\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"13.563829787234043%\\\"\\u003e\\n \\u003cp\\u003e\\u003cstrong\\u003e%\\u003c/strong\\u003e\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"20%\\\"\\u003e\\n \\u003cp\\u003e101\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"12.97872340425532%\\\"\\u003e\\n \\u003cp\\u003e51\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.212765957446809%\\\"\\u003e\\n \\u003cp\\u003e50.49\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"9.148936170212766%\\\"\\u003e\\n \\u003cp\\u003e14\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"8.936170212765957%\\\"\\u003e\\n \\u003cp\\u003e13.8\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"8.297872340425531%\\\"\\u003e\\n \\u003cp\\u003e93\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"9.787234042553191%\\\"\\u003e\\n \\u003cp\\u003e92.07\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"9.787234042553191%\\\"\\u003e\\n \\u003cp\\u003e44\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"10.851063829787234%\\\"\\u003e\\n \\u003cp\\u003e43.56\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eResistance Phenotype- genotypic correlation\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAppendix 1 shows the correlation between phenotypic and genotypic detection of antibiotics resistance results. In this study, 44 isolates carrying \\u003cem\\u003ebla\\u003csub\\u003eKPC\\u003c/sub\\u003e\\u0026nbsp;\\u003c/em\\u003e gene showed resistance to all \\u0026beta;-lactam including carbapenem antibiotics. Moreover , 51 isolates positive for \\u003cem\\u003ebla\\u003csub\\u003eIMP\\u003c/sub\\u003e\\u003c/em\\u003e\\u003csub\\u003e\\u0026nbsp;\\u003c/sub\\u003egene\\u003csub\\u003e\\u0026nbsp;\\u003c/sub\\u003ewere non-susceptible to all beta lactam expect 12 isolates, which were sensitive to meropenem. Out of 93 of the isolates carrying \\u003cem\\u003ebla\\u003csub\\u003eVIM\\u003c/sub\\u003e\\u003c/em\\u003e gene, 54 isolates were non-susceptible to imipenem. However, all these 93 isolates were sensitive to meropenem. Furthermore, all isolates with detectable \\u003cem\\u003ebla\\u003csub\\u003eCTX\\u0026minus;M\\u0026minus;1\\u0026nbsp;\\u003c/sub\\u003e\\u003c/em\\u003e, \\u003cem\\u003eBla\\u003csub\\u003eCMY\\u003c/sub\\u003e\\u003c/em\\u003e\\u003csub\\u003e,\\u0026nbsp;\\u003c/sub\\u003e and \\u003cem\\u003ebla\\u003csub\\u003eTEM\\u0026nbsp;\\u003c/sub\\u003e\\u003c/em\\u003e genes presented ESBL phenotype.\\u003c/p\\u003e\\n\\u003cp\\u003eFor aminoglycoside resistance and quinolones resistance, All 45 isolates with \\u003cem\\u003eaac\\u003c/em\\u003e(6\\u0026rsquo;)- Ib-cr gene were resistant to gentamicin, Tobramycin and ciprofloxacin. In addition, out of these 45 isolates, 43 isolates were non-susceptible to amikacin and 41 to levofloxacin.\\u003c/p\\u003e\\n\\u003cp\\u003eOut of 70 of the isolates positive for \\u003cem\\u003eqnrB\\u0026nbsp;\\u003c/em\\u003eand 67 isolates harboured \\u003cem\\u003equrS\\u0026nbsp;\\u003c/em\\u003ewere not suspectable to ciprofloxacin expect one isolate. In addition, 12 isolates out of both isolates with \\u003cem\\u003eqnrB or qnrs\\u0026nbsp;\\u003c/em\\u003ewere not susceptible for levofloxacin.\\u003cem\\u003e\\u0026nbsp;\\u003c/em\\u003e42 isolates positive for \\u003cem\\u003eant (4\\u0026prime;)-II\\u003c/em\\u003e gene showed resistance against gentamicin, tobramycin, expect one isolate, which was sensitive to amikacin. 41 isolates with APH(3\\u0026apos;\\u0026apos;)-Ib gene were found non-susceptible for aminoglycoside antibiotics tested expect one isolates susceptible to amikacin. 41 isolates with \\u003cem\\u003ermtC\\u003c/em\\u003e gene showed resistance to all aminoglycoside in this study expect isolate where suspectable for tobramycin. Furthermore, 58 isolates carrying \\u003cem\\u003ermtD\\u0026nbsp;\\u003c/em\\u003egenes showed resistance for all aminoglycosides expect 3 isolates sensitive for amikacin. Isolates carrying \\u003cem\\u003empha\\u003c/em\\u003e gene showed resistance against azithromycin macrolide antibiotic. Of 66 isolates carrying \\u003cem\\u003etext (x)\\u003c/em\\u003e, 62 were non susceptible to tetracycline and 42 to tigecycline. In addition, 68 isolates had \\u003cem\\u003etex(A)\\u0026nbsp;\\u003c/em\\u003egene, 45 isolates of them were not susceptible to tigecycline, and 66 to tetracycline. Moreover, out of 25 isolates had \\u003cem\\u003emcr-1\\u003c/em\\u003e, 24 isolates showed phenotypic resistance to colistin.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eDendrogram phylogenetic analysis\\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eDendrogram phylogenetic analysiswas constructed using antibiotics resistance profile and source of the isolates. The tree consists from 201 nodes and 101 tips sharing the original branch separated into as in figure 3: 1-A clade consists from 95 nodes and 48 tips and this group was divided to 3 subgroups\\u003cspan dir=\\\"RTL\\\"\\u003e\\u0026nbsp;\\u003c/span\\u003eA1- consists from 19 nodes and 10 tips that a closely related isolates although the ten isolates from different courses (urine, burn and wounds).\\u003c/p\\u003e\\n\\u003cp\\u003eA2- consist from 24 nodes and 12 tips with diverts isolates.\\u003c/p\\u003e\\n\\u003cp\\u003eA3 consist from 52 nodes and 26 tips would be consist as group of highly divergent isolates 2\\u003cspan dir=\\\"RTL\\\"\\u003e\\u0026nbsp;-\\u0026nbsp;\\u003c/span\\u003eB clade consist from 105 nodes and 53 tips,\\u003c/p\\u003e\\n\\u003cp\\u003eB1 consist from 44 nodes and 20 tips,the isolates in this glade are closely related in their resistance in spite of their huge diversity of sources (Blood ,wound ,catheter and urine .\\u003c/p\\u003e\\n\\u003cp\\u003eB2 consist from 61 nodes and 31 tips would be consistent with a group of highly divergent species A clade that shows short edge lengths contains species that diverged recently from a common ancestor. A clade that shows long edge lengths contains species that diverged a long time ago from a common ancestor.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003ePatients in the ICU are at a higher risk of developing bacterial infections due to various factors such as weak immune systems, prolonged hospital stays and invasive medical procedures [53][54]. Thus, these patients may require antibiotics and other treatments to manage these bacterial infections and prevent complications, which will help to improve their health.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cem\\u003eSerratia marcescens\\u003c/em\\u003e is the bacterium that able to survive on environmental surfaces and medical equipment, making it a common cause of healthcare-associated infections, especially in settings like the ICU[55][56]. In this study, 101 isolates of \\u003cem\\u003eS. marcescens\\u003c/em\\u003e were collected from ICU patients, which present a challenge in our hospitals . Many studies have reported the spread of these bacteria in ICU [57].\\u003c/p\\u003e\\n\\u003cp\\u003eMany factors assist in the risk of \\u003cem\\u003eS. marcescens\\u003c/em\\u003e infections in ICU patients include compromised immune systems, invasive procedures, prolonged hospital, and use of medical devices (such as catheters or ventilators). In general, multidrug resistant \\u003cem\\u003eS. marcescens\\u003c/em\\u003e isolates are collected from clinical settings. High levels of antibiotic resistance among \\u003cem\\u003eSerratia\\u003c/em\\u003e species belong to many activity of intrinsic, acquired, and adaptive resistance elements.\\u003c/p\\u003e\\n\\u003cp\\u003eIntrinsic resistance is known as naturally occurred in microorganism which affect the activity of antimicrobials \\u003cem\\u003ee.g.\\u003c/em\\u003e, active efflux of toxic compounds and decreased membrane permeability. Acquired resistance refers to resistance occurred due to acquisition of antibiotic resistance genes commonly by gene mutation or plasmid horizontal gene transfer. Horizontal gene transfer is considered the most important mechanism causes multiple antibiotic resistances [10] [13]. Lastly, adaptive resistance, also called phenotypic resistance, is linked to expeditious transcriptome adjusting in response to stress conditions or environmental stimuli. One other hand, adaptive resistance is known as a non-inheritable phenotype, which can revert after the triggering signal removal. pH\\u003cem\\u003e,\\u003c/em\\u003e temperature, oxidative stress, and disinfectants exposure have been shown to be linked with gene regulation and higher bacterial survival in \\u003cem\\u003eS. marcescens \\u003c/em\\u003e [58][59].\\u003c/p\\u003e\\n\\u003cp\\u003eBacterial exposure to antibiotics is known to be the main factor for antibiotics resistances. However, a recent analysis of \\u003cem\\u003eS. marcescens\\u003c/em\\u003e isolates caused an outbreak in 1969 in Spanish neonatal ICU showed that these isolates carried disinfections and antibiotics resistance genes that were non commercialized by the time of their original isolation [60]. Furthermore, another study compared between strains collected during the 1940s and the beginning of the twenty-first century showed that resistance to different classes of antibiotics already existed in ancient \\u003cem\\u003eS. marcescens\\u003c/em\\u003e isolates [61] , which suggested additional factors unrelated to drug therapy assist in evolution of resistance genes. In 2018, analysis of 32 \\u003cem\\u003eSerratia\\u003c/em\\u003e spp. genomes conclude that strains isolated from environments represent an underestimated reservoir for antibiotic resistance determinants [10], which suggested these resistance genes are inherited [62].\\u003c/p\\u003e\\n\\u003cp\\u003eThus, clinical management of \\u003cem\\u003eS. marcescens\\u003c/em\\u003e infections present a big challenge because its intrinsic resistance to different classes of antibiotics such as ampicillin, cephalosporins, aminoglycoside macrolides, and peptides [12]. In our study, the isolates showed high resistance profile to many antibiotics used, which present a serious problem to patients in ICU.\\u003c/p\\u003e\\n\\u003cp\\u003eCefepime or carbapenems are commonly used to treat \\u003cem\\u003eS. marcescens\\u003c/em\\u003e infections [17][63]. Furthermore, aminoglycoside amikacin is found to be effective to treat these infections. However. an increasing resistance to gentamicin and tobramycin has been reported [64] [65]. In this study, high percentage of the isolates showed resistance to gentamicin and tobramycin in addition to more than half of the isolates were not suspectable to amikacin. Furthermore, most of the isolates were resistant to fluroquinolones (ciprofloxacin).\\u003c/p\\u003e\\n\\u003cp\\u003eThe extensive and misuse of \\u0026beta;-lactams led to the emergence of resistance against these antibiotics. Many mechanisms are responsible for this resistance including target site modification (mutation or expression of alternative PBPs), downregulation of porin which results in reduction in cell, efflux pump and modifying enzymes (\\u0026beta;- lactamase) [66]. \\u0026beta;- lactamase assists in enzyme-mediated resistance, which produced by both Gram-positive and Gram-negative bacteria. Furthermore, these enzymes are encoded chromosomally or on extrachromosomal elements, which degrade the \\u0026beta;-lactam ring . Extended-spectrum \\u0026beta;-lactamases (ESBLs) are a group of bacterial enzymes that can be rapidly transferred via plasmid exchange [67] causing resistance to a broad range of \\u0026beta;-lactams.\\u003c/p\\u003e\\n\\u003cp\\u003eTEM, SHV, CTX \\u0026beta;-lactamase genes presence in the bacteria results in \\u0026beta;- lactam resistance (penicillins and cephalosporins). Enterobacteriaceae members including \\u003cem\\u003eS. marcescens \\u003c/em\\u003epossess\\u003cem\\u003e bla\\u003csub\\u003eCTX-M \\u003c/sub\\u003eand bla\\u003csub\\u003eSHV\\u003c/sub\\u003e \\u003c/em\\u003eand these genes express classical class A \\u0026beta; - lactamases, which hydrolyze first generation penicillins and cephalosporins and encoded on plasmid [68] . In our study, both genes were found in most of the isolates beside \\u003cem\\u003ebla\\u003csub\\u003eTEM\\u003c/sub\\u003e\\u003c/em\\u003e \\u003cem\\u003e.\\u003c/em\\u003e Furthermore, the main cause of antibiotics resistance in \\u003cem\\u003eS. marcescens \\u003c/em\\u003eis the production of chromosomally encoded \\u0026beta;-lactamases, which involve extended-spectrum \\u0026beta;-lactamases, AmpC-type cephalosporinase, and carbapenemases. Carbapenemases are the most versatile family of \\u0026beta;-lactamases able to hydrolyze carbapenems and many other \\u0026beta;-lactams including penicillins, cephalosporins, and monobactams [69] . Generally, bacteria carrying the bla\\u003csub\\u003eKPC\\u003c/sub\\u003e and/or ESBLs genes usually possess other resistance genes, which confer resistance to several classes of antimicrobials [70][71]. Carbapenems are considered as main antibiotics used to treat \\u003cem\\u003eS. marcescens \\u003c/em\\u003e infections because these bacteria showed resistance to broad-spectrum cephalosporins [72].\\u003cem\\u003e \\u003c/em\\u003eHowever, Many studies have reported the emergence of carbapenem-resistant strains around the world, which are caused by production of Ambler class A (KPC and SME), loss of porins associated with AmpC overexpression or class B metallo-\\u0026beta;-lactamases (M\\u0026beta;Ls; IMP and VIM) [73][74]. In this study, the most of our isolates possessed \\u003cem\\u003ebla\\u003csub\\u003eIMP\\u003c/sub\\u003e, blaNDM\\u003csub\\u003e1,\\u003c/sub\\u003e blaVIM\\u003csub\\u003e1\\u003c/sub\\u003e \\u003c/em\\u003eand\\u003cem\\u003e bla\\u003csub\\u003eKPC\\u003c/sub\\u003e \\u003c/em\\u003eand were resistant to imipenem and meropenem.\\u003c/p\\u003e\\n\\u003cp\\u003ecarbapenem-resistant \\u003cem\\u003eS. marcescens\\u003c/em\\u003e isolates were shown in this study, which present as a serious concern in nosocomial environment\\u003cem\\u003e. \\u003c/em\\u003eIt was reported that \\u003cem\\u003eS. marcescens\\u003c/em\\u003e is intrinsically resistant to polymyxins [75], but in this study, only 25% of the isolates were resistance to colistin.\\u003c/p\\u003e\\n\\u003cp\\u003eIn addition, fluoroquinolones resistance occurs by modification off target sites DNA gyrase and topoisomerase IV or by plasmid-mediated quinolone resistance (PMQR) determinant \\u003cem\\u003eqnr, qepA, aac(6\\u0026rsquo;)-Ib-cr, and oqxAB\\u003c/em\\u003e . Furthermore, the aac(6\\u0026apos;)-Ib gene encodes aminoglycoside-modifying enzymes and confers resistance to tobramycin, kanamycin, and amikacin, which is the most prevalent gene. The aac(6\\u0026apos;)-Ib-cr variant gene can induce resistance against aminoglycoside and fluoroquinolone simultaneously. In our study, isolates with \\u003cem\\u003eaac\\u003c/em\\u003e(6\\u0026rsquo;)- Ib-cr were resistant for both fluoroquinolone and/or aminoglycoside antibiotics as were found in many other studies [76][77]. In addition to beta lactam, Quinolones are widely used to treat many infections, which are synthetic antibiotics used against Gram-negative bacteria such as \\u003cem\\u003eEnterobacteriaceae \\u003c/em\\u003e[78]. Fluoroquinolones have broad-spectrum intrinsic activity greater than quinolones. It was reported that \\u003cem\\u003eQnr\\u003c/em\\u003e genes are often coexisted on the same resistance plasmids as extended spectrum \\u0026beta;-lactamase , which explain the co-resistance to \\u0026beta;-lactams and fluoroquinolones [79]. In present study, all \\u003cem\\u003eqnrs\\u003c/em\\u003e-positive isolates produced \\u003cem\\u003eCTX-M1\\u003c/em\\u003e, VIM, \\u003cem\\u003eSHV\\u003c/em\\u003e and \\u003cem\\u003eTEM as in appendix 1 \\u003c/em\\u003e. Previous study was found disruption of the \\u003cem\\u003eompA\\u003c/em\\u003e gene caused to decrease MICs of chloramphenicol, aztreonam, and nalidixic acid [80],which indicates the role of this gene in antibiotic resistance. Furthermore, Integrons have an essential role in the spread of \\u003cem\\u003eantibiotic\\u003c/em\\u003e resistance, especially in Gram-negative bacteria, 39% from the isolates in current study had the \\u003cem\\u003eint1\\u003c/em\\u003e gene. Furthermore, resistance phenotype-genotypic correlation and dendrogram phylogenetic analysis were performed for the isolates. In this study showed \\u003cem\\u003eS. marcescens \\u003c/em\\u003ein ICU associated with the high frequency of resistance genes and correlated with resistance phenotype for the antibiotics tested , while dendrogram phylogenetic analysis showed most of the isolates were closely related in their resistance in spite of their huge diversity of sources.\\u003c/p\\u003e\\n\\u003cp\\u003eMany studies have shown the spread of highly resistance bacteria in Iraqi hospitals [81][82][83][84][85].Form this study, it shows the emergence of highly resistance \\u003cem\\u003eS. marcescens\\u003c/em\\u003e in Iraqi patients from ICU, which can present a higher risk for effective treatment and control the spread of these isolates. Thus, finding alternative therapy need to be considered like phage therapy, Furthermore, our study has many limitations like size samples and should collect many samples from different hospitals cross Iraq. In addition, plasmid isolation should be considered to get actual distribution of resistance genes between chromosomes and plasmids.\\u003c/p\\u003e\"},{\"header\":\"Conclusion \",\"content\":\"\\u003cp\\u003eThe spread of highly resistance bacterial isolates around the world presents a serious and urgent issue especially in ICU.\\u003cem\\u003e\\u0026nbsp;S. marcescens\\u003c/em\\u003e isolates have showed a high resistance to antimicrobial agents, which were effective to treat infections caused by these isolates. The emergence of KPC\\u003cem\\u003e\\u0026nbsp;S. marcescens\\u0026nbsp;\\u003c/em\\u003ehas been reported, which need an effective\\u0026nbsp;plan to control infections prevent dissemination of these bacteria. Thus, in our study showed the emergence of highly resistant\\u003cem\\u003e\\u0026nbsp;S. marcescens\\u003c/em\\u003e in ICU, which present a serious concern in nosocomial environments. Further research is warranted to explore novel treatment options and strategies to mitigate the impact of antimicrobial resistance on patient outcomes.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eEthical approval: \\u003c/strong\\u003eThe ethics committee of Mustansiriyah university/ college of science/ biology department and Ministry of Health of Iraq approved this work.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contributions: \\u003c/strong\\u003eAll authors contributed equally in writing\\u0026mdash;original draft preparation, all authors have read and agreed to the published version of the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding: \\u003c/strong\\u003eThis research received no external funding.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments:\\u003c/strong\\u003e The authors would like to thank Mustansiriyah University (https://uomustansiriyah.edu.iq/ ) / Baghdad, Iraq for its support to complete this work.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflicts of Interest:\\u003c/strong\\u003e The authors declare no conflict of interest\\u003cstrong\\u003e.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent to Participate (Ethics)\\u003c/strong\\u003e: the Ethics Committee of the Mustansiriyah University approved and oversaw this study.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConsent to Publish (Ethics)\\u003c/strong\\u003e\\u003cstrong\\u003e: \\u003c/strong\\u003eAll authors agree to publish this work\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eInformed consent:\\u003c/strong\\u003e Not applicable.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eResearch involving human and animals participants: \\u003c/strong\\u003eNot applicable\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eC. Merlino, \\u0026lsquo;BARTOLOMEO BIZIO\\u0026rsquo;S LETTER TO THE MOST EMINENT PRIEST, ANGELO BELLANI, CONCERNING THE PHENOMENON OF THE RED-COLORED POLENTAa\\u0026rsquo;, \\u003cem\\u003eJournal of Bacteriology\\u003c/em\\u003e, vol. 9, no. 6, pp. 527\\u0026ndash;543, 1924.\\u003c/li\\u003e\\n\\u003cli\\u003eJ. MILLS and D. DREW, \\u0026lsquo;Serratia marcescens endocarditis: a regional illness associated with intravenous drug abuse\\u0026rsquo;, \\u003cem\\u003eAnnals of internal medicine\\u003c/em\\u003e, vol. 84, no. 1, pp. 29\\u0026ndash;35, 1976.\\u003c/li\\u003e\\n\\u003cli\\u003eR. N. Jones, \\u0026lsquo;Microbial etiologies of hospital-acquired bacterial pneumonia and ventilator-associated bacterial pneumonia\\u0026rsquo;, \\u003cem\\u003eClinical infectious diseases\\u003c/em\\u003e, vol. 51, no. Supplement_1, pp. S81\\u0026ndash;S87, 2010.\\u003c/li\\u003e\\n\\u003cli\\u003eA. Khanna, M. KhAnnA, and A. AggArWAl, \\u0026lsquo;Serratia marcescens-a rare opportunistic nosocomial pathogen and measures to limit its spread in hospitalized patients\\u0026rsquo;, \\u003cem\\u003eJournal of clinical and diagnostic research: JCDR\\u003c/em\\u003e, vol. 7, no. 2, p. 243, 2013.\\u003c/li\\u003e\\n\\u003cli\\u003eS. Uduman \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;An outbreak of Serratia marcescens infection in a special-care baby unit of a community hospital in United Arab Emirates: the importance of the air conditioner duct as a nosocomial reservoir\\u0026rsquo;, \\u003cem\\u003eJournal of Hospital Infection\\u003c/em\\u003e, vol. 52, no. 3, pp. 175\\u0026ndash;180, 2002.\\u003c/li\\u003e\\n\\u003cli\\u003eA. Dess\\u0026igrave;, M. Puddu, M. Testa, M. Marcialis, M. Pintus, and V. Fanos, \\u0026lsquo;Serratia marcescens infections and outbreaks in neonatal intensive care units\\u0026rsquo;, \\u003cem\\u003eJournal of Chemotherapy\\u003c/em\\u003e, vol. 21, no. 5, pp. 493\\u0026ndash;499, 2009.\\u003c/li\\u003e\\n\\u003cli\\u003eR. Zivkovic Zaric \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Antimicrobial Treatment of Serratia marcescens Invasive Infections: Systematic Review\\u0026rsquo;, \\u003cem\\u003eAntibiotics\\u003c/em\\u003e, vol. 12, no. 2, p. 367, 2023.\\u003c/li\\u003e\\n\\u003cli\\u003eI. Stock, T. Grueger, and B. Wiedemann, \\u0026lsquo;Natural antibiotic susceptibility of strains of Serratia marcescens and the S. liquefaciens complex: S. liquefaciens sensu stricto, S. proteamaculans and S. grimesii\\u0026rsquo;, \\u003cem\\u003eInternational journal of antimicrobial agents\\u003c/em\\u003e, vol. 22, no. 1, pp. 35\\u0026ndash;47, 2003.\\u003c/li\\u003e\\n\\u003cli\\u003eY.-Y. Liu \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study\\u0026rsquo;, \\u003cem\\u003eThe Lancet infectious diseases\\u003c/em\\u003e, vol. 16, no. 2, pp. 161\\u0026ndash;168, 2016.\\u003c/li\\u003e\\n\\u003cli\\u003eL. Sandner-Miranda, P. Vinuesa, A. Cravioto, and R. Morales-Espinosa, \\u0026lsquo;The genomic basis of intrinsic and acquired antibiotic resistance in the genus Serratia\\u0026rsquo;, \\u003cem\\u003eFrontiers in Microbiology\\u003c/em\\u003e, vol. 9, p. 828, 2018.\\u003c/li\\u003e\\n\\u003cli\\u003eR. L. Ferreira \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Characterization of KPC-Producing Serratia marcescens in an Intensive Care Unit of a Brazilian Tertiary Hospital\\u0026rsquo;, \\u003cem\\u003eFrontiers in Microbiology\\u003c/em\\u003e, vol. 11, 2020, [Online]. Available: https://www.frontiersin.org/articles/10.3389/fmicb.2020.00956\\u003c/li\\u003e\\n\\u003cli\\u003eF. Tavares-Carreon, K. De Anda-Mora, I. C. Rojas-Barrera, and A. Andrade, \\u0026lsquo;Serratia marcescens antibiotic resistance mechanisms of an opportunistic pathogen: A literature review\\u0026rsquo;, \\u003cem\\u003ePeerJ\\u003c/em\\u003e, vol. 11, p. e14399, 2023.\\u003c/li\\u003e\\n\\u003cli\\u003eC. von Wintersdorff, J. Penders, J. van Niekerk, N. Mills, S. Majumder, and L. van Alphen, \\u0026lsquo;Dissemination of Antimicrobial Resistance in Microbial Ecosystems through Horizontal Gene Transfer. Front Microbiol. 2016 Feb 19; 7\\u0026rsquo;, 2016.\\u003c/li\\u003e\\n\\u003cli\\u003eA. Hejazi and F. R. Falkiner, \\u0026lsquo;Serratia marcescens\\u0026rsquo;, \\u003cem\\u003eJournal of medical microbiology\\u003c/em\\u003e, vol. 46, no. 11, pp. 903\\u0026ndash;912, 1997.\\u003c/li\\u003e\\n\\u003cli\\u003eK. E. da Silva \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Three challenging cases of infections by multidrug-resistant Serratia marcescens in patients admitted to intensive care units\\u0026rsquo;, \\u003cem\\u003eBrazilian Journal of Microbiology\\u003c/em\\u003e, vol. 52, no. 3, pp. 1341\\u0026ndash;1345, Sep. 2021, doi: 10.1007/s42770-021-00477-4.\\u003c/li\\u003e\\n\\u003cli\\u003eF. Tavares-Carreon, K. De Anda-Mora, I. C. Rojas-Barrera, and A. Andrade, \\u0026lsquo;Serratia marcescens antibiotic resistance mechanisms of an opportunistic pathogen: A literature review\\u0026rsquo;, \\u003cem\\u003ePeerJ\\u003c/em\\u003e, vol. 11, p. e14399, 2023.\\u003c/li\\u003e\\n\\u003cli\\u003eM. J. Siedner \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Cefepime vs other antibacterial agents for the treatment of Enterobacter species bacteremia\\u0026rsquo;, \\u003cem\\u003eClinical infectious diseases\\u003c/em\\u003e, vol. 58, no. 11, pp. 1554\\u0026ndash;1563, 2014.\\u003c/li\\u003e\\n\\u003cli\\u003eN. M. Elsherbiny, I. M. Ali, K. M. Hassanein, and M. T. Ahmed, \\u0026lsquo;Extended-spectrum \\u0026beta;-lactamase (ESBL)-producing Serratia marcescens causing healthcare-associated infections in Assiut University Hospitals, Egypt.\\u0026rsquo;, \\u003cem\\u003eJournal of Global Antimicrobial Resistance\\u003c/em\\u003e, vol. 13, pp. 96\\u0026ndash;97, 2018.\\u003c/li\\u003e\\n\\u003cli\\u003eH. Phan \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Illumina short-read and MinION long-read WGS to characterize the molecular epidemiology of an NDM-1 Serratia marcescens outbreak in Romania\\u0026rsquo;, \\u003cem\\u003eJournal of Antimicrobial Chemotherapy\\u003c/em\\u003e, vol. 73, no. 3, pp. 672\\u0026ndash;679, 2018.\\u003c/li\\u003e\\n\\u003cli\\u003eE. F. Firmo \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Association of blaNDM-1 with blaKPC-2 and aminoglycoside-modifying enzyme genes among Klebsiella pneumoniae, Proteus mirabilis and Serratia marcescens clinical isolates in Brazil\\u0026rsquo;, \\u003cem\\u003eJournal of Global Antimicrobial Resistance\\u003c/em\\u003e, vol. 21, pp. 255\\u0026ndash;261, 2020.\\u003c/li\\u003e\\n\\u003cli\\u003eT. Bes \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Bloodstream Infections caused by Klebsiella pneumoniae and Serratia marcescens isolates co-harboring NDM-1 and KPC-2\\u0026rsquo;, \\u003cem\\u003eAnnals of clinical microbiology and antimicrobials\\u003c/em\\u003e, vol. 20, no. 1, pp. 1\\u0026ndash;8, 2021.\\u003c/li\\u003e\\n\\u003cli\\u003eP. D. Tamma \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Prevalence of bla CTX-M genes in Gram-negative bloodstream isolates across 66 hospitals in the United States\\u0026rsquo;, \\u003cem\\u003eJournal of clinical microbiology\\u003c/em\\u003e, vol. 59, no. 6, pp. 10\\u0026ndash;1128, 2021.\\u003c/li\\u003e\\n\\u003cli\\u003eS. Loqman, N. Soraa, S. M. Diene, and J.-M. Rolain, \\u0026lsquo;Dissemination of carbapenemases (OXA-48, NDM and VIM) producing enterobacteriaceae isolated from the Mohamed VI university hospital in marrakech, Morocco\\u0026rsquo;, \\u003cem\\u003eAntibiotics\\u003c/em\\u003e, vol. 10, no. 5, p. 492, 2021.\\u003c/li\\u003e\\n\\u003cli\\u003eJ. Jia \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Genomic characterization of two carbapenem-resistant Serratia marcescens isolates causing bacteremia: Emergence of KPC-2-encoding IncR plasmids\\u0026rsquo;, \\u003cem\\u003eFrontiers in Cellular and Infection Microbiology\\u003c/em\\u003e, vol. 13, p. 1075255, 2023.\\u003c/li\\u003e\\n\\u003cli\\u003eN. Bolourchi \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Comprehensive pan-genomic, resistome and virulome analysis of clinical OXA-48 producing carbapenem-resistant Serratia marcescens strains\\u0026rsquo;, \\u003cem\\u003eGene\\u003c/em\\u003e, vol. 822, p. 146355, 2022.\\u003c/li\\u003e\\n\\u003cli\\u003eM. Miao \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Genetic diversity of carbapenem-resistant Enterobacteriaceae (CRE) clinical isolates from a tertiary hospital in Eastern China\\u0026rsquo;, \\u003cem\\u003eFrontiers in Microbiology\\u003c/em\\u003e, vol. 9, p. 3341, 2019.\\u003c/li\\u003e\\n\\u003cli\\u003eJ. C. Cai, H. W. Zhou, R. Zhang, and G.-X. Chen, \\u0026lsquo;Emergence of Serratia marcescens, Klebsiella pneumoniae, and Escherichia coli isolates possessing the plasmid-mediated carbapenem-hydrolyzing \\u0026beta;-lactamase KPC-2 in intensive care units of a Chinese hospital\\u0026rsquo;, \\u003cem\\u003eAntimicrobial agents and chemotherapy\\u003c/em\\u003e, vol. 52, no. 6, pp. 2014\\u0026ndash;2018, 2008.\\u003c/li\\u003e\\n\\u003cli\\u003eH. E. Sidjabat \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Interspecies spread of Klebsiella pneumoniae carbapenemase gene in a single patient\\u0026rsquo;, \\u003cem\\u003eClinical infectious diseases\\u003c/em\\u003e, vol. 49, no. 11, pp. 1736\\u0026ndash;1738, 2009.\\u003c/li\\u003e\\n\\u003cli\\u003eA. Tsakris \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;In vivo acquisition of a plasmid-mediated bla KPC-2 gene among clonal isolates of Serratia marcescens\\u0026rsquo;, \\u003cem\\u003eJournal of clinical microbiology\\u003c/em\\u003e, vol. 48, no. 7, pp. 2546\\u0026ndash;2549, 2010.\\u003c/li\\u003e\\n\\u003cli\\u003eR. Zhang, H. W. Zhou, J. C. Cai, and G.-X. Chen, \\u0026lsquo;Plasmid-mediated carbapenem-hydrolysing \\u0026beta;-lactamase KPC-2 in carbapenem-resistant Serratia marcescens isolates from Hangzhou, China\\u0026rsquo;, \\u003cem\\u003eJournal of Antimicrobial Chemotherapy\\u003c/em\\u003e, vol. 59, no. 3, pp. 574\\u0026ndash;576, Mar. 2007, doi: 10.1093/jac/dkl541.\\u003c/li\\u003e\\n\\u003cli\\u003eR. L. Ferreira \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Characterization of KPC-Producing Serratia marcescens in an Intensive Care Unit of a Brazilian Tertiary Hospital\\u0026rsquo;, \\u003cem\\u003eFrontiers in Microbiology\\u003c/em\\u003e, vol. 11, 2020, doi: 10.3389/fmicb.2020.00956.\\u003c/li\\u003e\\n\\u003cli\\u003eA. A. Dashti, M. M. Jadaon, A. M. Abdulsamad, and H. M. Dashti, \\u0026lsquo;Heat treatment of bacteria: a simple method of DNA extraction for molecular techniques\\u0026rsquo;, \\u003cem\\u003eKuwait Med J\\u003c/em\\u003e, vol. 41, no. 2, pp. 117\\u0026ndash;122, 2009.\\u003c/li\\u003e\\n\\u003cli\\u003eA. Iwaya \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Rapid and quantitative detection of blood Serratia marcescens by a real-time PCR assay: Its clinical application and evaluation in a mouse infection model\\u0026rsquo;, \\u003cem\\u003eFEMS Microbiology Letters\\u003c/em\\u003e, vol. 248, no. 2, pp. 163\\u0026ndash;170, Jul. 2005, doi: 10.1016/j.femsle.2005.05.041.\\u003c/li\\u003e\\n\\u003cli\\u003eF. Abbaszadeh \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Genetic characterization of extensive drug resistant Acinetobacter baumannii: an appalling impediment\\u0026rsquo;, \\u003cem\\u003eFM\\u003c/em\\u003e, vol. 63, no. 5, pp. 726\\u0026ndash;737, Oct. 2021, doi: 10.3897/folmed.63.e56566.\\u003c/li\\u003e\\n\\u003cli\\u003eM. F. Mushi, S. E. Mshana, C. Imirzalioglu, and F. Bwanga, \\u0026lsquo;Carbapenemase Genes among Multidrug Resistant Gram Negative Clinical Isolates from a Tertiary Hospital in Mwanza, Tanzania\\u0026rsquo;, \\u003cem\\u003eBioMed Research International\\u003c/em\\u003e, vol. 2014, p. 303104, Feb. 2014, doi: 10.1155/2014/303104.\\u003c/li\\u003e\\n\\u003cli\\u003eS. S. AL_Jubori, I. M. AL_kadmy, and Z. JassimAl_Ani, \\u0026lsquo;Emergence of multidrug resistance (MDR) Acinetobacterbaumannii isolated from Iraqi hospitals\\u0026rsquo;, \\u003cem\\u003eAdvances in Environmental Biology\\u003c/em\\u003e, vol. 10, no. 5, pp. 265\\u0026ndash;276, 2016.\\u003c/li\\u003e\\n\\u003cli\\u003eH. Yigit \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Novel carbapenem-hydrolyzing \\u0026beta;-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae\\u0026rsquo;, \\u003cem\\u003eAntimicrobial agents and chemotherapy\\u003c/em\\u003e, vol. 45, no. 4, pp. 1151\\u0026ndash;1161, 2001.\\u003c/li\\u003e\\n\\u003cli\\u003eX. Zhou \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Effect of sublethal concentrations of ceftriaxone on antibiotic susceptibility of multiple antibiotic-resistant Salmonella strains\\u0026rsquo;, \\u003cem\\u003eFEMS Microbiology Letters\\u003c/em\\u003e, vol. 366, no. 2, p. fny283, Jan. 2019, doi: 10.1093/femsle/fny283.\\u003c/li\\u003e\\n\\u003cli\\u003eR. Ramazanzadeh, \\u0026lsquo;Etiologic agents and extended-spectrum beta-lactamase production in urinary tract infections in Sanandaj, Iran\\u0026rsquo;, \\u003cem\\u003eEastern Journal of Medicine\\u003c/em\\u003e, vol. 15, no. 2, p. 57, 2010.\\u003c/li\\u003e\\n\\u003cli\\u003eS. Ohana \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Spread of a Klebsiella pneumoniae strain producing a plasmid-mediated ACC-1 AmpC \\u0026beta;-lactamase in a teaching hospital admitting disabled patients\\u0026rsquo;, \\u003cem\\u003eAntimicrobial agents and chemotherapy\\u003c/em\\u003e, vol. 49, no. 5, pp. 2095\\u0026ndash;2097, 2005.\\u003c/li\\u003e\\n\\u003cli\\u003eS. M. Shakir \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Exceptional prevalence of blaNDM-1 gene producing Enterobacter cloacae ssp. dissolvens isolated from hospitals in Baghdad\\u0026rsquo;, \\u003cem\\u003eReviews and Research in Medical Microbiology\\u003c/em\\u003e, pp. 10\\u0026ndash;1097, 2024.\\u003c/li\\u003e\\n\\u003cli\\u003eH. B. Kim, C. H. Park, C. J. Kim, E.-C. Kim, G. A. Jacoby, and D. C. Hooper, \\u0026lsquo;Prevalence of plasmid-mediated quinolone resistance determinants over a 9-year period\\u0026rsquo;, \\u003cem\\u003eAntimicrobial agents and chemotherapy\\u003c/em\\u003e, vol. 53, no. 2, pp. 639\\u0026ndash;645, 2009.\\u003c/li\\u003e\\n\\u003cli\\u003eA. FarajzadehSheikh, H. Veisi, M. Shahin, M. Getso, and A. Farahani, \\u0026lsquo;Frequency of quinolone resistance genes among extended-spectrum \\u0026beta;-lactamase (ESBL)-producing Escherichia coli strains isolated from urinary tract infections\\u0026rsquo;, \\u003cem\\u003eTropical Medicine and Health\\u003c/em\\u003e, vol. 47, no. 1, p. 19, Mar. 2019, doi: 10.1186/s41182-019-0147-8.\\u003c/li\\u003e\\n\\u003cli\\u003eA. Robicsek, J. Strahilevitz, D. Sahm, G. Jacoby, and D. Hooper, \\u0026lsquo;qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States\\u0026rsquo;, \\u003cem\\u003eAntimicrobial agents and chemotherapy\\u003c/em\\u003e, vol. 50, no. 8, pp. 2872\\u0026ndash;2874, 2006.\\u003c/li\\u003e\\n\\u003cli\\u003eK. Ji \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Harnessing efficient multiplex PCR methods to detect the expanding Tet (X) family of tigecycline resistance genes\\u0026rsquo;, \\u003cem\\u003eVirulence\\u003c/em\\u003e, vol. 11, no. 1, pp. 49\\u0026ndash;56, 2020.\\u003c/li\\u003e\\n\\u003cli\\u003eL. Wang \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Novel plasmid-mediated tet (X5) gene conferring resistance to tigecycline, eravacycline, and omadacycline in a clinical Acinetobacter baumannii isolate\\u0026rsquo;, \\u003cem\\u003eAntimicrobial agents and chemotherapy\\u003c/em\\u003e, vol. 64, no. 1, pp. 10\\u0026ndash;1128, 2019.\\u003c/li\\u003e\\n\\u003cli\\u003eC. Loras \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Prevalence, detection and characterisation of fosfomycin-resistant Escherichia coli strains carrying fosA genes in Community of Madrid, Spain\\u0026rsquo;, \\u003cem\\u003eJournal of Global Antimicrobial Resistance\\u003c/em\\u003e, vol. 25, pp. 137\\u0026ndash;141, 2021.\\u003c/li\\u003e\\n\\u003cli\\u003eP. Behruznia \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Decreased Susceptibility of Shigella Isolates to Azithromycin in Children in Tehran, Iran\\u0026rsquo;, \\u003cem\\u003eCanadian Journal of Infectious Diseases and Medical Microbiology\\u003c/em\\u003e, vol. 2022, 2022.\\u003c/li\\u003e\\n\\u003cli\\u003eL. Huang \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Type B Chloramphenicol Acetyltransferases Are Responsible for Chloramphenicol Resistance in Riemerella anatipestifer, China\\u0026rsquo;, \\u003cem\\u003eFrontiers in Microbiology\\u003c/em\\u003e, vol. 8, 2017, [Online]. Available: https://www.frontiersin.org/articles/10.3389/fmicb.2017.00297\\u003c/li\\u003e\\n\\u003cli\\u003eF. Eftekhar, F. Altayar, and H. Khidaei, \\u0026lsquo;Plasmid-mediated class 1 and 2 integron carriage in drug-resistant nosocomial isolates of Acinetobacter baumannii\\u0026rsquo;, \\u003cem\\u003eArchives of Clinical Infectious Diseases\\u003c/em\\u003e, vol. 13, no. 1, 2018.\\u003c/li\\u003e\\n\\u003cli\\u003eI. M. Al-Kadmy, S. A. Ibrahim, N. Al-Saryi, S. N. Aziz, A. Besinis, and H. F. Hetta, \\u0026lsquo;Prevalence of genes involved in colistin resistance in Acinetobacter baumannii: first report from Iraq\\u0026rsquo;, \\u003cem\\u003eMicrobial Drug Resistance\\u003c/em\\u003e, vol. 26, no. 6, pp. 616\\u0026ndash;622, 2020.\\u003c/li\\u003e\\n\\u003cli\\u003eA. Amjad, I. A. Mirza, S. Abbasi, U. Farwa, N. Malik, and F. Zia, \\u0026lsquo;Modified Hodge test: A simple and effective test for detection of carbapenemase production\\u0026rsquo;, \\u003cem\\u003eIranian journal of microbiology\\u003c/em\\u003e, vol. 3, no. 4, p. 189, 2011.\\u003c/li\\u003e\\n\\u003cli\\u003eK. Blot, N. Hammami, S. Blot, D. Vogelaers, and M.-L. Lambert, \\u0026lsquo;Increasing burden of Escherichia coli, Klebsiella pneumoniae, and Enterococcus faecium in hospital-acquired bloodstream infections (2000\\u0026ndash;2014): a national dynamic cohort study\\u0026rsquo;, \\u003cem\\u003eInfection Control \\u0026amp; Hospital Epidemiology\\u003c/em\\u003e, vol. 40, no. 6, pp. 705\\u0026ndash;709, 2019.\\u003c/li\\u003e\\n\\u003cli\\u003eS. Blot \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Healthcare-associated infections in adult intensive care unit patients: Changes in epidemiology, diagnosis, prevention and contributions of new technologies\\u0026rsquo;, \\u003cem\\u003eIntensive and Critical Care Nursing\\u003c/em\\u003e, vol. 70, p. 103227, 2022.\\u003c/li\\u003e\\n\\u003cli\\u003eS. Uduman \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;An outbreak of Serratia marcescens infection in a special-care baby unit of a community hospital in United Arab Emirates: the importance of the air conditioner duct as a nosocomial reservoir\\u0026rsquo;, \\u003cem\\u003eJournal of Hospital Infection\\u003c/em\\u003e, vol. 52, no. 3, pp. 175\\u0026ndash;180, 2002.\\u003c/li\\u003e\\n\\u003cli\\u003eA. Dess\\u0026igrave;, M. Puddu, M. Testa, M. Marcialis, M. Pintus, and V. Fanos, \\u0026lsquo;Serratia marcescens infections and outbreaks in neonatal intensive care units\\u0026rsquo;, \\u003cem\\u003eJournal of Chemotherapy\\u003c/em\\u003e, vol. 21, no. 5, pp. 493\\u0026ndash;499, 2009.\\u003c/li\\u003e\\n\\u003cli\\u003eR. Amarsy, G. P. de Ponfilly, H. Benmansour, H. Jacquier, E. Cambau, and B. M\\u0026eacute;garbane, \\u0026lsquo;Serratia marcescens outbreak in the intensive care unit during the COVID-19 pandemic: A paradoxical risk?\\u0026rsquo;, \\u003cem\\u003eMedecine et maladies infectieuses\\u003c/em\\u003e, vol. 50, no. 8, pp. 750\\u0026ndash;751, 2020.\\u003c/li\\u003e\\n\\u003cli\\u003eJ. de Ondarza, \\u0026lsquo;Ozone sensitivity and catalase activity in pigmented and non-pigmented strains of Serratia marcescens\\u0026rsquo;, \\u003cem\\u003eThe Open Microbiology Journal\\u003c/em\\u003e, vol. 11, p. 12, 2017.\\u003c/li\\u003e\\n\\u003cli\\u003eS. Begic and E. A. Worobec, \\u0026lsquo;The role of the Serratia marcescens SdeAB multidrug efflux pump and TolC homologue in fluoroquinolone resistance studied via gene-knockout mutagenesis\\u0026rsquo;, \\u003cem\\u003eMicrobiology\\u003c/em\\u003e, vol. 154, no. 2, pp. 454\\u0026ndash;461, 2008.\\u003c/li\\u003e\\n\\u003cli\\u003eC. Saralegui \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Genomics of Serratia marcescens Isolates Causing Outbreaks in the Same Pediatric Unit 47 Years Apart: Position in an Updated Phylogeny of the Species\\u0026rsquo;, \\u003cem\\u003eFrontiers in Microbiology\\u003c/em\\u003e, vol. 11, 2020, doi: 10.3389/fmicb.2020.00451.\\u003c/li\\u003e\\n\\u003cli\\u003eE. Fust\\u0026eacute;, G. J. Galisteo, L. Jover, T. Vinuesa, T. G. Villa, and M. Vi\\u0026ntilde;as, \\u0026lsquo;Comparison of antibiotic susceptibility of old and current Serratia\\u0026rsquo;, \\u003cem\\u003eFuture Microbiology\\u003c/em\\u003e, vol. 7, no. 6, pp. 781\\u0026ndash;786, 2012.\\u003c/li\\u003e\\n\\u003cli\\u003eE. Fust\\u0026eacute;, G. J. Galisteo, L. Jover, T. Vinuesa, T. G. Villa, and M. Vi\\u0026ntilde;as, \\u0026lsquo;Comparison of antibiotic susceptibility of old and current Serratia\\u0026rsquo;, \\u003cem\\u003eFuture Microbiology\\u003c/em\\u003e, vol. 7, no. 6, pp. 781\\u0026ndash;786, 2012.\\u003c/li\\u003e\\n\\u003cli\\u003eP. D. Tamma \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;The use of cefepime for treating AmpC \\u0026beta;-lactamase\\u0026ndash;producing Enterobacteriaceae\\u0026rsquo;, \\u003cem\\u003eClinical infectious diseases\\u003c/em\\u003e, vol. 57, no. 6, pp. 781\\u0026ndash;788, 2013.\\u003c/li\\u003e\\n\\u003cli\\u003eR. Zivkovic Zaric \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Antimicrobial Treatment of Serratia marcescens Invasive Infections: Systematic Review\\u0026rsquo;, \\u003cem\\u003eAntibiotics\\u003c/em\\u003e, vol. 12, no. 2, p. 367, 2023.\\u003c/li\\u003e\\n\\u003cli\\u003eH. S. Sader, D. J. Farrell, R. K. Flamm, and R. N. Jones, \\u0026lsquo;Antimicrobial susceptibility of Gram-negative organisms isolated from patients hospitalized in intensive care units in United States and European hospitals (2009\\u0026ndash;2011)\\u0026rsquo;, \\u003cem\\u003eDiagnostic microbiology and infectious disease\\u003c/em\\u003e, vol. 78, no. 4, pp. 443\\u0026ndash;448, 2014.\\u003c/li\\u003e\\n\\u003cli\\u003eM. G\\u0026ouml;tte, A. Berghuis, G. Matlashewski, M. A. Wainberg, and D. Sheppard, \\u003cem\\u003eHandbook of antimicrobial resistance\\u003c/em\\u003e. Springer, 2017.\\u003c/li\\u003e\\n\\u003cli\\u003eD. Rawat and D. Nair, \\u0026lsquo;Extended-spectrum \\u0026beta;-lactamases in Gram Negative Bacteria\\u0026rsquo;, \\u003cem\\u003eJournal of global infectious diseases\\u003c/em\\u003e, vol. 2, no. 3, p. 263, 2010.\\u003c/li\\u003e\\n\\u003cli\\u003eK. Bush and G. A. Jacoby, \\u0026lsquo;Updated functional classification of \\u0026beta;-lactamases\\u0026rsquo;, \\u003cem\\u003eAntimicrobial agents and chemotherapy\\u003c/em\\u003e, vol. 54, no. 3, pp. 969\\u0026ndash;976, 2010.\\u003c/li\\u003e\\n\\u003cli\\u003eJ. H. Jeon \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Structural basis for carbapenem-hydrolyzing mechanisms of carbapenemases conferring antibiotic resistance\\u0026rsquo;, \\u003cem\\u003eInternational journal of molecular sciences\\u003c/em\\u003e, vol. 16, no. 5, pp. 9654\\u0026ndash;9692, 2015.\\u003c/li\\u003e\\n\\u003cli\\u003eP. C. S. Ribeiro \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Phenotypic and molecular detection of the bla KPC gene in clinical isolates from inpatients at hospitals in S\\u0026atilde;o Luis, MA, Brazil\\u0026rsquo;, \\u003cem\\u003eBMC Infectious Diseases\\u003c/em\\u003e, vol. 16, pp. 1\\u0026ndash;16, 2016.\\u003c/li\\u003e\\n\\u003cli\\u003eX. Cao, X. Xu, Z. Zhang, H. Shen, J. Chen, and K. Zhang, \\u0026lsquo;Molecular characterization of clinical multidrug-resistant Klebsiella pneumoniae isolates\\u0026rsquo;, \\u003cem\\u003eAnnals of clinical microbiology and antimicrobials\\u003c/em\\u003e, vol. 13, no. 1, pp. 1\\u0026ndash;5, 2014.\\u003c/li\\u003e\\n\\u003cli\\u003eA. Mizrahi \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Infections caused by naturally AmpC-producing Enterobacteriaceae: Can we use third-generation cephalosporins? A narrative review\\u0026rsquo;, \\u003cem\\u003eInternational journal of antimicrobial agents\\u003c/em\\u003e, vol. 55, no. 2, p. 105834, 2020.\\u003c/li\\u003e\\n\\u003cli\\u003eF. Senchyna \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Diversity of resistance mechanisms in carbapenem-resistant Enterobacteriaceae at a health care system in Northern California, from 2013 to 2016\\u0026rsquo;, \\u003cem\\u003eDiagnostic microbiology and infectious disease\\u003c/em\\u003e, vol. 93, no. 3, pp. 250\\u0026ndash;257, 2019.\\u003c/li\\u003e\\n\\u003cli\\u003eN. Alizadeh \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Evaluation of resistance mechanisms in carbapenem-resistant Enterobacteriaceae\\u0026rsquo;, \\u003cem\\u003eInfection and Drug Resistance\\u003c/em\\u003e, pp. 1377\\u0026ndash;1385, 2020.\\u003c/li\\u003e\\n\\u003cli\\u003eL. Sandner-Miranda, P. Vinuesa, A. Cravioto, and R. Morales-Espinosa, \\u0026lsquo;The Genomic Basis of Intrinsic and Acquired Antibiotic Resistance in the Genus Serratia\\u0026rsquo;, \\u003cem\\u003eFrontiers in Microbiology\\u003c/em\\u003e, vol. 9, 2018, [Online]. Available: https://www.frontiersin.org/articles/10.3389/fmicb.2018.00828\\u003c/li\\u003e\\n\\u003cli\\u003eH. B. Kim, C. H. Park, C. J. Kim, E.-C. Kim, G. A. Jacoby, and D. C. Hooper, \\u0026lsquo;Prevalence of plasmid-mediated quinolone resistance determinants over a 9-year period\\u0026rsquo;, \\u003cem\\u003eAntimicrobial agents and chemotherapy\\u003c/em\\u003e, vol. 53, no. 2, pp. 639\\u0026ndash;645, 2009.\\u003c/li\\u003e\\n\\u003cli\\u003eN. H. Kim \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Prevalence of plasmid-mediated quinolone resistance genes and ciprofloxacin resistance in pediatric bloodstream isolates of Enterobacteriaceae over a 9-year period\\u0026rsquo;, \\u003cem\\u003eJapanese Journal of Infectious Diseases\\u003c/em\\u003e, vol. 66, no. 2, pp. 151\\u0026ndash;154, 2013.\\u003c/li\\u003e\\n\\u003cli\\u003eG. A. Jacoby, J. Strahilevitz, and D. C. Hooper, \\u0026lsquo;Plasmid‐mediated quinolone resistance\\u0026rsquo;, \\u003cem\\u003ePlasmids: Biology and Impact in Biotechnology and Discovery\\u003c/em\\u003e, pp. 475\\u0026ndash;503, 2015.\\u003c/li\\u003e\\n\\u003cli\\u003eF. D. Salah \\u003cem\\u003eet al.\\u003c/em\\u003e, \\u0026lsquo;Distribution of quinolone resistance gene (qnr) in ESBL-producing Escherichia coli and Klebsiella spp. in Lom\\u0026eacute;, Togo\\u0026rsquo;, \\u003cem\\u003eAntimicrobial Resistance \\u0026amp; Infection Control\\u003c/em\\u003e, vol. 8, pp. 1\\u0026ndash;8, 2019.\\u003c/li\\u003e\\n\\u003cli\\u003eY. Smani, A. F\\u0026agrave;brega, I. Roca, V. S\\u0026aacute;nchez-Encinales, J. Vila, and J. Pach\\u0026oacute;n, \\u0026lsquo;Role of OmpA in the multidrug resistance phenotype of Acinetobacter baumannii\\u0026rsquo;, \\u003cem\\u003eAntimicrobial agents and chemotherapy\\u003c/em\\u003e, vol. 58, no. 3, pp. 1806\\u0026ndash;1808, 2014.\\u003c/li\\u003e\\n\\u003cli\\u003eS. Ibrahim, N. Al-Saryi, I. M. Al-Kadmy, and S. N. Aziz, \\u0026lsquo;Multidrug-resistant Acinetobacter baumannii as an emerging concern in hospitals\\u0026rsquo;, \\u003cem\\u003eMolecular biology reports\\u003c/em\\u003e, vol. 48, no. 10, pp. 6987\\u0026ndash;6998, 2021.\\u003c/li\\u003e\\n\\u003cli\\u003eS. S. Khazaal, I. M. Al-Kadmy, and S. N. Aziz, \\u0026lsquo;Mechanism of pathogenesis in multidrug resistant Acinetobacter baumannii isolated from intensive care unit\\u0026rsquo;, \\u003cem\\u003eGene Reports\\u003c/em\\u003e, vol. 18, p. 100557, 2020.\\u003c/li\\u003e\\n\\u003cli\\u003eI. M. M. Alansary and N. A. Al-Saryi, \\u0026lsquo;Detection of biofilm formation in classical and hypervirulent Klebsiella pneumoniae\\u0026rsquo;, \\u003cem\\u003eAl-Mustansiriyah Journal of Science\\u003c/em\\u003e, vol. 33, no. 5, pp. 65\\u0026ndash;71, 2022.\\u003c/li\\u003e\\n\\u003cli\\u003eE. A. Muhsin, L. A. Said, and S. S. Al-Jubori, \\u0026lsquo;Correlation of type 1 and type 3 Fimbrial genes with the type of specimen and the antibiotic resistance profile of clinically isolated Klebsiella pneumoniae in Baghdad\\u0026rsquo;, \\u003cem\\u003eAl-Mustansiriyah Journal of Science\\u003c/em\\u003e, vol. 33, no. 3, pp. 1\\u0026ndash;11, 2022.\\u003c/li\\u003e\\n\\u003cli\\u003eA. A. Abdulhussein and B. O. Abdulsattar, \\u0026lsquo;Identification and Characterization of a Bacteriophage with Lytic Activity against Multidrug Resistant E. coli\\u0026rsquo;, \\u003cem\\u003eAl-Mustansiriyah Journal of Science\\u003c/em\\u003e, vol. 34, no. 1, pp. 24\\u0026ndash;31, 2023.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Serratia marcescens, ICU, antibiotics resistance, β-lactamase\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4055474/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4055474/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003e\\u003cem\\u003eSerratia marcescens\\u003c/em\\u003e has gained attention as an emerging pathogen worldwide, which causes infections and outbreaks in immune comprised individuals and patients in Intensive Care Units (ICUs). Antibiotics resistance has been shown to be increased worldwide, which limit the treatment options especially for patients in ICUs. In this study, 101 isolates of \\u003cem\\u003eSerratia marcescens \\u003c/em\\u003ewere collected from ICUs and identified by biochemical and molecular methods. The antibiotic susceptibility test showed that these isolates were resistant to most antibiotics tested as the following:\\u0026nbsp;100% to Ampicillin, 93% to Ampicillin/Sulbactam, 69.3%\\u0026nbsp;to Ampicillin/ Clavulanic acid,\\u0026nbsp;97% to Cefepime, 90.09% to Amoxicillin/ Clavulanic acid, 81.1% to Gentamycin, 77.2% to Tobramycin, 72.2% to Ciprofloxacin, 72.2% to\\u0026nbsp;Tetracycline, 63.3% to Cefotaxime, 61.38% to Ceftriaxone, 52.4% to Amikacin, 49.5% to Imipenem, 38.6%\\u0026nbsp;to Meropenem, 45.5% to Levofloxacin, 38.6% to Tigecycline, 57.4 to\\u0026nbsp;Piperacillin, 43.56% to and\\u0026nbsp;24.7%\\u0026nbsp;to Colistin. Furthermore, PCR was used to detect antibiotics resistance genes for \\u003cem\\u003eS. marcescens\\u003c/em\\u003e isolates. 100% of the isolates had \\u003cem\\u003ebla\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003eCTX-M \\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003eand\\u0026nbsp;bla\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003eSHV\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e ,\\u003c/em\\u003e 98%\\u0026nbsp;had \\u003cem\\u003ebla\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003eCMY\\u003c/em\\u003e\\u003c/sub\\u003e, 92% \\u003cem\\u003ebla\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003eTEM\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e \\u003c/em\\u003egenes. In addition, 69.3% of the isolates were positive for \\u003cem\\u003eqnrB\\u003c/em\\u003e and 66.3% for \\u003cem\\u003equrS\\u003c/em\\u003e.\\u003cem\\u003e aac(6')-Ib-cr \\u003c/em\\u003egene\\u0026nbsp;was found in 44.5%, \\u003cem\\u003eant(4’)IIb\\u003c/em\\u003e\\u0026nbsp;in 41.5%, \\u003cem\\u003eaph(3'')Ib\\u003c/em\\u003e in 40.5%, \\u003cem\\u003ermtC\\u003c/em\\u003e in 42.5% , and \\u003cem\\u003ermtD\\u003c/em\\u003e in 57.4% of the tested isolates. Furthermore, \\u003cem\\u003etet(A)\\u003c/em\\u003e, \\u003cem\\u003etet(X)\\u003c/em\\u003e, \\u003cem\\u003efasA\\u003c/em\\u003e, \\u003cem\\u003empha, ompA, cat\\u003c/em\\u003e, \\u003cem\\u003emcr1\\u003c/em\\u003e and \\u003cem\\u003eInt1\\u003c/em\\u003egenes were found in 67.3%, 65.3%, 40.5%, 40.5%, 43.5%, 53.4%, 24.7% and 39.6% of the isolates, respectively. \\u0026nbsp;Phenotypic and genotypic detection for carbapenemase was carried out by Hodge test and PCR. The results showed that 23.7% of the isolates were positive for Hodge test. For PCR detection, 51 isolates were positive for \\u003cem\\u003ebla\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003eIMP\\u003c/em\\u003e\\u003c/sub\\u003e,\\u003csub\\u003e\\u003cem\\u003e \\u003c/em\\u003e\\u003c/sub\\u003e44 isolates for \\u003cem\\u003ebla\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003eKPC\\u003c/em\\u003e\\u003c/sub\\u003e\\u003cem\\u003e, \\u003c/em\\u003e91 isolates\\u003cem\\u003e \\u003c/em\\u003efor\\u003cem\\u003e bla\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003eVIM\\u003c/em\\u003e\\u003c/sub\\u003e, and 14 isolates for \\u003cem\\u003ebla\\u003c/em\\u003e\\u003csub\\u003e\\u003cem\\u003eNDM1,\\u003c/em\\u003e\\u003c/sub\\u003e respectively. In addition, resistance phenotype-genotypic correlation and dendrogram phylogenetic analysis were performed for the isolates. This study showed \\u003cem\\u003eS. marcescens \\u003c/em\\u003ein ICU associated with the high frequency of resistance genes, which shows the importance to eliminate the spread of these isolates and an urgent control protocol is needed. In \\u003cstrong\\u003econclusion\\u003c/strong\\u003e, this study highlights the concerning levels of antimicrobial resistance among S. marcescens isolates from ICU patients in Baghdad City. The findings underscore the urgent need for enhanced infection control measures, antimicrobial stewardship programs, and surveillance strategies to combat the spread of multidrug-resistant pathogens in healthcare settings. Further research is warranted to explore novel treatment options and strategies to mitigate the impact of antimicrobial resistance on patient outcomes.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Emerging Threat: Highly Resistant Serratia marcescens in Iraqi ICU Patients\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-03-14 20:06:18\",\"doi\":\"10.21203/rs.3.rs-4055474/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"6f916d70-5858-4dc5-8483-c300736df0b2\",\"owner\":[],\"postedDate\":\"March 14th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-05-03T12:28:34+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-03-14 20:06:18\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4055474\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4055474\",\"identity\":\"rs-4055474\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}