{"paper_id":"1c769a17-2e67-4aef-af27-8be39a4c4a35","body_text":"Long-term Impact of Early-Life Stress on Hippocampal Apoptotic Gene Expression in Mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Long-term Impact of Early-Life Stress on Hippocampal Apoptotic Gene Expression in Mice Aida Nurul Barokah, İhsan Kıvanç Gürsoy, Merve Hilal Dönmez, Juliette Fitremann, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6267468/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Early-life stress (ELS) such as maternal separation has been associated with neuronal apoptosis and impaired hippocampal function in rodent models. This study investigated the long-term effects of early-life unpredictable maternal separation (MS) and MS combined with unpredictable maternal stress (MSUS) from postnatal days 1 to 14 on the mRNA expression levels of the proapoptotic genes Bax , Tp53 and Casp3 , and the prosurvival gene Bcl2 in the hippocampus of mice ( in vivo ). Additionally, total RNA from the MSUS hippocampus was nucleofected at different concentrations into healthy mouse hippocampal cells, followed by 3D neuronal cell culture using N-heptyl-D-galactonamide (GalC7) hydrogels as scaffolds for hippocampal cell growth and apoptotic gene expression studies ( in vitro ). Quantitative real-time PCR was conducted to assess the expression of target genes, which were subsequently analyzed using the comparative Ct method (2 -ΔΔCt ). Bax mRNA expression was significantly lower in the MS group than in the control group, whereas both the MS and MSUS groups presented significant increases in Bcl2 mRNA expression. In addition, the expression ratio of Bcl2 / Bax was significantly greater in the MS and MSUS groups. No significant differences in Tp53 or Casp3 mRNA expression levels were detected between the groups. Although the in vitro mRNA expression levels were not significantly different, the mRNA expression ratio of Bcl2/Bax reached equilibrium as the concentration of total RNA nucleofected increased. Our results suggested that, in response to ELS, hippocampal cells adapt to prioritize survival over apoptosis. Apoptosis cell survival maternal deprivation 3D hippocampal cell culture nucleofection. Figures Figure 1 Figure 2 Figure 3 Introduction The early postnatal period is a critical time for neurodevelopment, particularly in the hippocampus. During this period, environmental factors can significantly impact brain development and potentially lead to long-lasting alterations in neural circuitry and behavior. One such environmental factor is early-life stress (ELS), which is associated with an increased risk for various neuropsychiatric disorders later in life [ 1 ]–[ 3 ]. Studies have shown that the hippocampus, a brain region critical for memory formation [ 4 ], [ 5 ], is influenced through various pathways under uncontrolled stress conditions [ 6 ]. Stress is known to impair memory performance, alter synaptic plasticity and neuronal firing patterns, and induce structural modifications in the hippocampus. These stress-induced alterations in the hippocampus have been associated with stress-related disorders, including posttraumatic stress disorder (PTSD) [ 6 ]. The hippocampus plays a crucial role in learning and memory, and early-life challenges that begin as early as pregnancy can have long-term effects by influencing neuronal apoptosis in the hippocampus, which in turn contributes to learning deficiencies in offspring [ 7 ]. In animal models, excessive exposure to glucocorticoids due to stress has been associated with hippocampal dysfunction and neuronal loss [ 8 ]. Studies in both humans and rodents have provided significant insights into how early-life stress and maternal separation affect hippocampal function, particularly apoptosis and neuronal proliferation. ELS, such as maternal separation, is linked to a reduction in mature neurons in the CA3 region of the hippocampus, affects cognitive functions and maternal behavior in adult female mice [ 9 ], and leads to epigenetic upregulation of corticotropin-releasing hormone in the hippocampus, which is associated with synaptic dysfunction and memory defects [ 10 ]. In addition, research suggests that early maternal and social deprivation can expand neural stem cell populations, increase neurogenesis in the hippocampus and amygdala, and reduce fear memory [ 11 ]. Research in animal models consistently demonstrates that early-life stressors, such as maternal separation, have detrimental effects on behaviors in adulthood [ 12 ], [ 13 ]. Studies have demonstrated that early MS can increase apoptosis in the hippocampal region of litters [ 14 ]–[ 16 ]. Therefore, the effects of postnatal two-week MS, which is a crucial period with some postnatal maturation characteristics [ 17 ], on the trends of apoptosis in five-week-old litters have not been reported before. To examine the potential long-term impacts of ELS on hippocampal gene expression, we focused on four genes involved in regulating apoptosis: Bax, Bcl2, Casp3 , and Tp53 . These genes play crucial roles in determining cell fate during neurodevelopment and in response to stress. Bax promotes apoptosis [ 18 ]–[ 20 ], whereas Bcl2 inhibits it [ 21 ]. Casp3 is a key executioner caspase in the apoptotic cascade [ 22 ], and Tp53 is a tumor suppressor gene that can induce apoptosis in response to cellular stress [ 23 ]. Using quantitative real-time PCR (qPCR), we analyzed the expression levels of these genes in the hippocampi of the mice at PND35, three weeks after the cessation of the stress paradigms. This time point allows us to assess the persistent effects of ELS on gene expression beyond the immediate stress response period. Additionally, we performed nucleofection procedures to explore how different RNA doses from MSUS affect apoptosis-related gene expression in healthy hippocampal cells cultured on N-heptyl-D-galactonamide (GalC7) hydrogels as a 3D cellular model. The GalC7 hydrogel was selected because it is composed of a single, pure molecule, which means that its composition is highly reproducible. The gels formed have low moduli, on the order of a few kPa, making them suitable for neuronal cell culture. Finally, the gel architecture is made up of quite wide and sparse fibers which enable the cells to grow partly embedded within the gel. The degree of cell adhesion is also low, encouraging cells to organize themselves in small clusters along the fibers, thus reproducing a 3D culture quite well [ 24 ], [ 25 ]. Previous studies have reported the microinjection of RNA to create mouse models for autism [ 26 ], [ 27 ]. Similarly, our approach involves nucleofecting RNA from the hippocampi of stressed mice into healthy cells to replicate the stress environment in vitro . This method allows us to explore how ELS-induced gene expression changes in vivo can be mimicked in a controlled, cellular model, providing further insights into the molecular mechanisms underlying stress-related disorders. Materials and methods Animals This study was conducted in accordance with the institutional guidelines for the care and use of laboratory animals. Ethical clearance was obtained from Ankara University Laboratory Animals and Research Laboratory (Ethics Committee Approval No: 2023-3-20). The eight-week-old BALB/c mice (n = 6 per group) were housed under a 12:12 h light/dark cycle (lights at 7 a.m. to 7 p.m.) with constant room temperature (22 ± 2°C) and humidity (45 ± 5%) in standard plastic mouse cages (22 cm × 38 cm × 15 cm). Food and tap water were available ad libitum . All the cages were subjected to weekly cage cleaning. The breeding procedures included housing one female and one male in the same cage. After the mating period, the males were removed, and the female mice remained alone throughout the gestation period. Maternal stress procedures This study included three groups of litter from related dams: control, unpredictable maternal separation (MS), and unpredictable maternal separation combined with unpredictable maternal stress (MSUS) groups. The maternal stress model was re-established following the same procedures described in our previous study [ 28 ]. Briefly, dams and litters were separated for 3 hours each day from postnatal day (PND) 1 to PND 14. Additionally, MSUS dams experienced unpredictable maternal stress in conjunction with the MS procedure. A total of 72 five-week-old litters, with 24 (12 female litters and 12 male litters) from each group, were used in the in vivo study. Additionally, five-week-old control male litters (n = 4) were used for the in vitro 3D hippocampal cell culture experiments. Tissue collection and Hippocampal Dissociation into Single Cells At PND35, the mice were sacrificed by cervical dislocation. The total brains were carefully removed, and the brain hemispheres were gently lifted toward the forebrain. The right and left hippocampi were carefully removed via fine forceps. The surgical instruments were cleaned with 75% ethanol between each transition to prevent cross-contamination. The hippocampal tissues were frozen in cryotubes in liquid nitrogen and stored at -80°C until RNA isolation. For in vitro 3D hippocampal cell culture, the hippocampi of control male mice were transferred to 15 mL Falcon tubes containing 5 mL of dissection solution and kept on ice until they were transported to the cell culture laboratory. The dissection solution was prepared before the tissue collection step by mixing 500 mL of Hank's balanced salt solution (HBSS), 5 mL of penicillin/streptomycin (Gibco, Life Technologies), 5 mL of 1 M MgCl 2 , 3.5 mL of 1 M HEPES (pH 7.3) (Lonza, Switzerland) and 5 mL of 200 mM L-glutamine (Gibco, Life Technologies) in a Falcon tube. The samples in the dissection mixture were centrifuged at 80 × g for 5 minutes, and the supernatant was carefully discarded. Subsequently, 1.5 mL of trypsin solution was added to the pellet, and the samples were incubated at 37°C for 10–20 minutes. After trypsinization, the samples were centrifuged at 80 × g for 5 minutes, and the supernatant was discarded. The pellet was washed twice with 5 mL of HBSS. After the second wash, 1.5 mL of prewarmed (37°C) medium was added to the pellet. All the tissue pieces were gently triturated 20–30 times via a fire-polished Pasteur pipette until a homogeneous suspension was achieved. This process was repeated for 1 minute with a fresh fire-polished Pasteur pipette. Cell counting and viability assessment Five milliliters of culture medium was added to the hippocampal cells, and the cells were counted using a TC20 cell counter (Bio-Rad, USA). The average hippocampal cell count was 5.91 × 10⁶ cells/mL. The counted cells were centrifuged at 80 × g for 10 minutes, and the supernatant was discarded. Cell viability was assessed under a microscope using 0.4% trypan blue solution (Gibco, Life Technologies) at a 1:1 ratio. Once cell viability was confirmed to be suitable, nucleofection was performed. Total RNA isolation from hippocampal tissue The collected hippocampal tissues were transferred into Eppendorf tubes containing 500 mL of NucleoGene Tri Reagent Lysis Reactive (NucleoGene, Türkiye). The tissues were disintegrated via an ultrasonic tissue homogenizer. Total RNA was isolated from hippocampal tissue (n = 72) via the phenol‒chloroform extraction method as described in the previous study [ 29 ]. The total RNA used for nucleofection was selected on the basis of the criteria of increased Bcl2 and decreased Bax expression, and was obtained from the hippocampus of a male litter in the MSUS group. Male mice were used to avoid the potential confounding effects of hormonal fluctuations associated with the estrous cycle in female mice. The total RNA was further purified via the High Pure RNA Isolation Kit (Roche, Germany) to eliminate any DNA-induced effects. The purity and concentration of the total RNA were measured with a NanoDrop 2000c (Thermo Fisher Scientific, USA). Preparation of the Hydrogel The GalC7 molecule was synthesized as previously described [ 24 ], and the GalC7 hydrogel was prepared for culture as described in our previous study [ 29 ] Briefly, for each sample, 9 mg of GalC7 powder was weighed and placed into a glass vial. Subsequently, 2 mL of nuclease-free water was added to the vial and the vial was slightly closed with a cap. The vial was then placed in a programmable oven preheated to 115°C to dissolve the GalC7 powder completely. Once dissolved, the hot solution is quickly transferred to culture plate wells. The culture plate was closed to prevent the gels from drying out, and the temperature is was allowed to decrease slowly until gelation occured. The gel prepared the day before was saturated with medium and incubated at 37°C in an incubator containing 5% CO 2 . Nucleofection and 3D cell culture using the GalC7 hydrogel Exogenous RNA (total RNA, RNAse-treated total RNA (mock) and 0.5, 1, and 2 ng/µL diluted from total RNA) was nucleofected into control male hippocampal cells using The Amaxa® 4D-Nucleofector® Protocol for Primary Mammalian Neurons (Lonza, Switzerland) Kit at the previously optimized DR-114 program, as indicated in the kit protocol. After nucleofection, the nucleocuvette was incubated for 10 minutes at room temperature. After incubation, the cells were resuspended in prewarmed medium and gently mixed by pipetting up and down 2–3 times. The nucleofected cells were cultured with GalC7 gel prepared in a 48-well plate. A total of 250 µL of DMEM containing 10% penicillin/streptomycin (Gibco, Life Technologies), and 1X B27 supplement (Gibco, Life Technologies) were added. The samples were incubated at 37°C with 5% CO2 for seven days. Four samples from each group were prepared: a control group without nucleofection; a mock-nucleofected group; 0.5, 1 and 2 ng/µL total RNA-nucleofected groups. These samples were cultured in GalC7 for a 7-day culture period. After 7 days, the medium was removed, and the samples were washed with PBS. The samples were lysed with 1 mL of NucleoGene Tri Reagent Lysis Reactive. Total RNA was extracted from 3D hippocampal cell culture using a phenol-chloroform method that was previously established [ 29 ]. cDNA synthesis and quantitative real-time PCR cDNA synthesis from total RNA was performed with the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, China). Each sample was adjusted to approximately 1 µg of total RNA. The reaction mixture for each sample consisted of 10 µL of 2x RT Mix, 2 µL of HiScript II Enzyme Mix, 1 µL of Oligo-(dT)23 VN (50 µM), 1 µL of random hexamers (50 ng/µL), 4 µL of total RNA, and 2 µL of nuclease-free water, yielding a total reaction volume of 20 µL. cDNA synthesis was carried out via T100 Thermal Cycler PCR (Bio-Rad, USA) with the following profile: 5 minutes at 25°C, 15 minutes at 50°C, and 2 minutes at 85°C. The resulting cDNA samples were diluted 1:5 with nuclease-free water. Quantitative real-time PCR was performed on a Rotor-Gene Q (Qiagen, Germany) with specific primers (Table 1 ) and 2x ChamQ Universal SYBR qPCR Master Mix (Vazyme, China). The reaction mixture consisted of 10 µL of 2x ChamQ Universal SYBR qPCR Master Mix, 0.8 µL of 10 µM forward and reverse primer mixture, 6.2 µL of nuclease-free water, and 3 µL of 1:5 diluted cDNA, totaling 20 µL per qPCR . The qPCR profile was as follows: 30 s at 95°C for initial denaturation, 10 s at 95°C for denaturation, and 30 s at 58°C for annealing and extension, followed by melting curve analysis. The cycle count was set to 45. Each sample was repeated at least twice. The results were analyzed via the delta‒delta‒Ct (2 –ΔΔCt ) method. The data were normalized to the reference gene Gapdh , and the mean values from the control group were used as the calibrator. Table 1 Sequences of the primers. Primer Sequence (5’-3’) Amplicon Length (bp) Gapdh Forward: CTCTCTGCTCCTCCCTGTTC Reverse: TACGGCCAAATCCGTTCACA 105 Bax Forward: TTTGCTACAGGGTTTCATCCA Reverse: ATATTGCTGTCCAGTTCATCTCC 147 Bcl2 Forward: CTGGGATGCCTTTGTGGAAC Reverse: TCAAACAGAGGTCGCATGCT 51 Casp3 Forward: CAGCACCTGGTTACTATTCCTG Reverse: TTCCTGTTAACGCGAGTGAG 130 Tp53 Forward: CAACAGCTCCTGCATGGGGGGC Reverse: AGGACAGGCACAAACACGAACC 121 Statistical Analyses Statistical analyses were conducted via GraphPad Prism 9.1.0 (GraphPad Software, USA). The distribution of the data was assessed through histograms, q-q plots, and Shapiro‒Wilk tests. The outliers were identified and removed via the ROUT method in GraphPad Prism (Q = 1%). Independent t tests or Mann‒Whitney U tests were used to compare data between two groups. For calculation of the Bcl2/Bax ratio, the relative quantification units of Bcl2 were divided by those of Bax for each sample. For comparisons involving three or more groups, the Kruskal‒Wallis H test was employed to assess the significance of the difference in accordance with the distribution of the data. Dunn’s test was used for post hoc analysis. The relationships between the data were evaluated via Spearman correlation. Statistical significance was considered at a p value of < 0.05. Results The mRNA expression levels of Bax, Bcl2, Casp3 , and Tp53 in hippocampal tissue are presented in Fig. 1 a-d. Prior to conducting the main analysis, including the Kruskal‒Wallis test, an independent t-test was performed to confirm the absence of significant differences between male and female offspring, allowing us to combine the data. Given that the data did not meet the assumption of a normal distribution, a nonparametric Kruskal‒Wallis test was performed. Our study revealed significant differences in the mean ranks of Bax mRNA expression among the groups ( H (2, n = 72) = 6.38, P = 0.04; Fig. 1 a). Dunn’s multiple comparison test revealed significant downregulation in the MS group compared with the control group ( P = 0.05). For Bcl2 , significant differences in mean ranks were observed ( H (2, n = 72) = 16.22, P = 0.0003; Fig. 1 b). Dunn’s multiple comparison test revealed significant upregulation in both the MS and MSUS groups compared with the control group ( P = 0.0005 and P = 0.0057, respectively). No significant differences were detected among the groups for either Casp3 ( H (2, n = 72) = 3.43, P > 0.05; Fig. 1 c) or Tp53 ( H (2, n = 72) = 5.50, P > 0.05; Fig. 1 d). Furthermore, our study revealed significant differences in the mean ranks of the Bcl2/Bax expression ratios among the groups (H (2, n = 72) = 20.16, P < 0.0001; Fig. 1 e). Dunn’s multiple comparison test revealed a significant increase in the Bcl2/Bax expression ratio in both the MS and MSUS groups compared with the control group (P = 0.0001 and P = 0.0010, respectively). Table 2 Spearman correlation coefficients between Bax, Bcl2, Casp3 and Tp53 mRNA expression in the hippocampus of litters within each experimental group. 1. Bax 2. Bcl2 3. Casp3 4. Tp53 Control 1. 1 2. -0.40 1 3. 0.24 0.01 1 4. 0.61** -0.43* 0.21 1 MS 1. 1 2. -0.18 1 3. 0.61** -0.10 1 4. 0.74**** -0.11 0.37 1 MSUS 1. 1 2. 0.07 1 3. 0.68*** 0.23 1 4. 0.65*** 0.04 0.58** 1 Note. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 Spearman’s rank correlation was performed to further explore the relationships between gene expression in the hippocampal tissue of the litters. As shown in Table 2 , in the control group, a significant positive correlation was observed between Bax and Tp53 expression ( r = 0.61, P = 0.002), whereas Bcl2 and Tp53 expression was significantly negatively correlated ( r =-0.43, P = 0.034). In the MS group, significant positive correlations were observed between Bax and Tp53 ( r = 0.74, P < 0.0001) and between Bax and Casp3 ( r = 0.61, P = 0.0015). In the MSUS group, significant positive correlations were detected between Bax and Tp53 ( r = 0.65, P = 0.0006), between Bax and Casp3 ( r = 0.68, P = 0.0003), and between Casp3 and Tp53 ( r = 0.58, P = 0.0027). Trypan blue staining confirmed that most cells remained viable postnucleofection (Fig. 2 a ) . Additionally, the development of hippocampal cells in GalC7 was monitored over time via an Olympus CKX41 inverted microscope at 20x magnification (Fig. 2 b-e ). Initially, the cells appeared sparsely distributed with minimal neurite outgrowth. Over time, increased cell clustering was observed, along with more prominent interactions between cells and the surrounding GalC7 fibers. In later stages, the cells appeared more densely distributed and organized within the hydrogel, suggesting progressive maturation within the 3D environment. The Bcl2/Bax expression ratios in 3D hippocampal cell culture samples from different groups (control, mock, 0.5, 1, and 2) are presented in Fig. 3 a. No significant differences were observed across groups (H (4, n = 20) = 3.77, P > 0.05). Notably, the Bcl2/Bax ratios in the control and mock groups were similar, which is important for ruling out potential effects of nucleofection on gene expression. Although no significant differences were found, the Bcl2/Bax ratio was lower in the nucleofected groups than in the control and mock groups. The highest variability in the Bcl2/Bax ratio was observed in the 0.5 group, suggesting a heterogeneous response at this concentration, whereas the variability decreased at higher concentrations. Furthermore, the mRNA expression levels of Casp3 in 3D hippocampal cell culture samples from different groups (control, mock, 0.5, 1, and 2) are presented in Fig. 3 b. No significant differences were observed across groups for Casp3 ( H (4, n = 20) = 7.91, P > 0.05). Discussion In this study, we investigated the long-term effects of PND1-14 postnatal unpredictable maternal separation (MS) and unpredictable maternal separation combined with unpredictable maternal stress (MSUS) on apoptosis-related gene expression in the hippocampus of five-week-old mice. While several studies have reported that maternal separation leads to increased apoptotic cell death in the hippocampi of rats and mice, notably at various time intervals [ 14 ]–[ 16 ], [ 30 ], our findings revealed that survival tends to be promoted instead of apoptotic pathways in the hippocampus. These findings are consistent with those of the study by Coccurello R. et al . (2014), who reported an increase in Bcl2 mRNA expression in the hippocampal region [ 31 ]. In our study, the expression of the Bcl2 mRNA was significantly greater in the MS and MSUS groups than in the control group ( P = 0.0005 and P = 0.0057, respectively). Compared with that in the control group, Bax was significantly downregulated in the MS group ( P = 0.05) but not in the MSUS group. However, MSUS Bax expression still consistently decreased, similar to MS. In the control correlation results, Bax and Bcl2 showed a nonsignificant moderate negative correlation (r= -0.40), reflecting their classical antagonistic role in regulating apoptosis. However, this correlation weakened in MS (r= -0.18) and disappeared in MSUS (r = 0.07), suggesting that their regulatory relationship is disrupted under MS and MSUS conditions. The upregulation of Bcl2 in MS and MSUS indicates the promotion of hippocampal neuronal survival while simultaneously suppressing apoptotic processes. Additionally, the significantly increased Bcl2/Bax ratios in the MS (P = 0.0001) and MSUS (P = 0.0010) groups compared with those in the control group further support a shift toward cell survival mechanisms. Previous studies have shown that ELS, such as low-level maternal care, increases vulnerability to hippocampal neuron loss via apoptosis in PND90 rats [ 32 ]. In humans, early-life adversity has been linked to a smaller hippocampus volume in male depressed in-patients [ 33 ]; this alteration may stem from the apoptotic pathway and contribute to severe neuropsychiatric outcomes. Moreover, early MS has been associated with long-term consequences [ 34 ]. Our findings suggest that hippocampal cells adapt to promote survival, counteract apoptosis and preserve neuronal integrity. This response may help mitigate the long-term impact of ELS and prevent more severe consequences later in life. Neuronal survival can be initiated through increased intracellular Ca²⁺, which activates prosurvival signal transduction pathways (the phosphoinositide 3-kinase (PI3K)/Akt pathway, the protein kinase C (PKC)/extracellular signal-regulated kinase (ERK) pathway [ 14 ], and the Ca 2+ /calmodulin pathway), which further inhibits the transcription of cell death-related genes and activates key transcription factors such as CREB and NF-κB. This leads to an increase in Bcl2 expression [ 35 ], [ 36 ] and an increase in the ratio of antiapoptotic to proapoptotic factors within the cell [ 37 ], possibly due to an increase in hippocampal IL-1β and TNF-α via those pathways, as reported in some short- and long-term maternal separation studies [ 38 ]. On the basis of our unpublished data, which revealed a decrease in the expression of Ca²⁺-permeable Gria2 in MS and MSUS, it is reasonable to hypothesize that Ca²⁺ influx may involve the upregulation of Bcl2 , further supporting neuronal survival. There were no significant differences in Casp3 expression among the groups. There was variability in expression, but there was no strong trend toward upregulation or downregulation. This result is consistent with the notion that the transcription of the prosurvival protein Bcl2 and the repression of the proapoptotic protein Bax likely prevent the activation of the subsequent caspase cascade, including the Casp3-dependent apoptotic cascade. Despite the lack of significant differences, Casp3 maintained strong positive correlations with Bax under MS (r = 0.61) and MSUS (r = 0.68) conditions. Tp53 expression did not significantly change; however, its significant strong correlation with Bax expression in MS (r = 0.74) and MSUS (r = 0.65) suggests that while survival conditions are maintained, there may not be complete suppression of apoptosis. In addition to our in vivo study, we evaluated how different RNA doses (0.5, 1, and 2 ng/µL) of MSUS affect apoptosis-related gene expression in healthy hippocampal cells cultured on GalC7 hydrogels. Although statistical significance was not reached, several key observations provide insights into the potential of this in vitro model. The similarity in gene expression between the control and mock-nucleofected groups indicates that the nucleofection process itself does not induce apoptosis-related changes. Moreover, in the 3D hippocampal cell culture nucleofected with 0.5 ng/µL total RNA, the Bcl2/Bax ratio was lower than that in the control and mock-nucleofected groups; however, this decrease was not statistically significant. As the nucleofected total RNA concentration increased, the ratio approached the levels observed in the control and mock groups, with notably reduced variability. Neuronal cells, which are particularly challenging to culture in 3D, are expected to undergo prominent apoptosis. However, the upregulated Bcl2 transcript observed in the hippocampus of stressed mice may contribute to maintaining healthy hippocampal cells in a survival mode, potentially depending on the concentration of nucleofected RNA. Our 3D neuronal culture findings indicate that the microenvironment of stressed mice sustains adaptive processes in vitro , leading to a more stable survival response at higher RNA nucleofection concentrations. Our in vitro models shed light on the importance of concentration-dependent nucleofection for ELS-related apoptosis studies. Despite the limitations of this study, particularly the lack of detailed characterization of the total RNA extracted from the hippocampus of male mice in the MSUS group used for nucleofection, we confirmed that the RNA sample used for nucleofection was extracted from tissue exhibiting an in vivo expression profile of increased Bcl2 and decreased Bax levels, whereas the mRNA levels of Casp3 and Tp53 did not show comparable expression to those in the control group. Another limitation of this study is that neuronal markers were not assessed in 3D hippocampal culture. However, our previous study demonstrated that the mRNA expression levels of genes expressed by neurons increased when they were cultured with GalC7 [ 29 ]. Conclusion We concluded that unpredictable early-life MS and MSUS stress significantly affect the mRNA expression of prosurvival genes, leading to an increase in the latter, whereas the expression of proapoptotic genes decreases in the hippocampus of five-week-old BALB/c mice. These gene expression profiles are similar in both sexes, suggesting the existence of nonsex-driven mechanisms. The alterations observed may be an adaptive mechanism supporting neuronal survival in adolescents. If early-life maternal deprivation or MS leads to widespread apoptosis in the hippocampus — a region where neurogenesis continues into adulthood — the detrimental effects are likely to manifest as an increased susceptibility to neurodegenerative diseases. However, the brain possesses adaptive mechanisms to mitigate severe neuronal loss. In this study, the activation of survival pathways in hippocampal cells may reflect an adaptive response, protecting against major stress-induced damage. Statements and declarations Acknowledgments We are very grateful for the financial support from Ankara Yıldırım Beyazıt University Scientific Research Project Coordination Unit (AYBU BAP). We would also like to express our sincere appreciation for the molecular laboratory facilities provided by Ankara Yıldırım Beyazıt University (AYBU) Central Research Laboratory (AYBU Merlab) for this study. Funding This study received financial support from the Ankara Yıldırım Beyazıt University Scientific Research Project Coordination Unit (AYBU BAP) (No. TYL-2023-2484). Author contributions Funding acquisition was carried out by K.K.B and İ.K.G. The mouse model and wet-lab experiments were performed by K.K.B., A.N.B., İ.K.G and M.H.D. Figures and graphs were prepared by A.N.B. Statistical analyses were performed by A.N.B. Conceptualization and data interpretation were performed by K.K.B. and A.B. K.K.B., A.N.B, and J.F. prepared the manuscript. J.F. provided the GalC7. All the authors reviewed and approved the final version of the manuscript. Competing interests The authors declare that they have no competing interests. Data availability The datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request. References Pagliaccio D, Barch DM (2016) Early life adversity and risk for depression: Alterations in cortisol and brain structure and function as mediating mechanisms. In: Frodl T (ed) Systems neuroscience in depression. Elsevier Academic Press, pp 29-77. https://doi.org/10.1016/B978-0-12-802456-0.00002-9 Wenderski W, Maze I (2014) Epigenetic mechanisms of drug addiction vulnerability. In: Peedicayil J, Grayson DR, Avramopoulos D (ed) Epigenetics in Psychiatry. Elsevier Academic Press, pp 441-462. https://doi.org/10.1016/B978-0-12-417114-5.00021-8 Pariante CM, Nemeroff CB (2012) Unipolar depression. Handb Clin Neurol 106:239–249. https://doi.org/10.1016/B978-0-444-52002-9.00014-0 Hammoud K, Spittler N, Buch K, Hakimelahi R, Nguyen J, Lanfranchi M (2019) Camping out in the hippocampus: Imaging spectrum of etiologies that affect the hippocampi and tips for honing the differential diagnosis. Neurographics 9:37–54. https://doi.org/10.3174/ng.1800032 Costa V, Lugert S, Jagasia R (2015) Role of adult hippocampal neurogenesis in cognition in physiology and disease: Pharmacological targets and biomarkers. Handb Exp Pharmacol 228:99–155. https://doi.org/10.1007/978-3-319-16522-6_4 Kim EJ, Pellman B, Kim JJ (2015) Stress effects on the hippocampus: A critical review. Learn Mem 22:411–416, 2015. https://doi.org/10.1101/lm.037291.114 Kuang H, et al (2014) Hippocampal apoptosis involved in learning deficits in the offspring exposed to maternal high sucrose diets. J Nutr Biochem 25:985–990. https://doi.org/10.1016/J.JNUTBIO.2014.04.012 Lucassen PJ, et al (2001) Hippocampal apoptosis in major depression is a minor event and absent from subareas at risk for glucocorticoid overexposure. Am J Pathol 158:453–468. https://doi.org/10.1016/S0002-9440(10)63988-0 Reshetnikov VV, Kovner AV, Lepeshko AA, Pavlov KS, Grinkevich LN, Bondar NP (2020) Stress early in life leads to cognitive impairments, reduced numbers of CA3 neurons and altered maternal behavior in adult female mice. Genes Brain Behav 19:e12541. https://doi.org/10.1111/GBB.12541 Wang A, et al (2014) Epigenetic upregulation of corticotrophin-releasing hormone mediates postnatal maternal separation-induced memory deficiency. PLoS One 9:e94394. https://doi.org/10.1371/JOURNAL.PONE.0094394 Daun KA, Fuchigami T, Koyama N, Maruta N, Ikenaka K, Hitoshi S (2020) Early maternal and social deprivation expands neural stem cell population size and reduces hippocampus/amygdala-dependent fear memory. Front Neurosci 14:483850. https://doi.org/10.3389/FNINS.2020.00022/BIBTEX Gapp K, et al (2014) Early life stress in fathers improves behavioural flexibility in their offspring. Nat Commun 5:5466. https://doi.org/10.1038/ncomms6466 Weiss IC, Franklin TB, Vizi S, Mansuy IM (2011) Inheritable effect of unpredictable maternal separation on behavioral responses in mice. Front Behav Neurosci 5:1–12. https://doi.org/10.3389/fnbeh.2011.00003 Yang S, Li J, Han L, Zhu G (2017) Early maternal separation promotes apoptosis in dentate gyrus and alters neurological behaviors in adolescent rats. Int J Clin Exp Pathol 10:10812–10820. Bin Baek S, et al (2011) The phosphodiesterase type-5 inhibitor, tadalafil, improves depressive symptoms, ameliorates memory impairment, as well as suppresses apoptosis and enhances cell proliferation in the hippocampus of maternal-separated rat pups. Neurosci Lett 488:26–30. https://doi.org/10.1016/j.neulet.2010.10.074 Fabricius K, Wörtwein G, Pakkenberg B (2008) The impact of maternal separation on adult mouse behaviour and on the total neuron number in the mouse hippocampus. Brain Struct Funct 212:403–416. https://doi.org/10.1007/S00429-007-0169-6 Kudryashov IE, Onufriev MV, Kudryashova IV, Gulyaeva NV (2001) Periods of postnatal maturation of hippocampus: synaptic modifications and neuronal disconnection. Dev Brain Res 132:113–120. https://doi.org/10.1016/S0165-3806(01)00301-7 Brady HJM, Gil-Gómez G (1998) Molecules in focus bax. The pro-apoptotic Bcl-2 family member, bax. Int J Biochem Cell Biol 30:647–650. https://doi.org/10.1016/S1357-2725(98)00006-5 Dai Z, Lai JR (2019) Isolation of synthetic antibodies against BCL-2-Associated X Protein (BAX). Methods Mol Biol 1877:351–357. https://doi.org/10.1007/978-1-4939-8861-7_21 Wei MC, et al (2001) Proapoptotic BAX and BAK: a requisite gateway to mitochondrial dysfunction and death. Science 292:727–730. https://doi.org/10.1126/SCIENCE.1059108 Siddiqui WA, Ahad A, Ahsan H (2015) The mystery of BCL2 family: Bcl-2 proteins and apoptosis: an update. Arch Toxicol 89:289–317. https://doi.org/10.1007/S00204-014-1448-7 Porter AG, Jänicke RU (1999) Emerging roles of caspase-3 in apoptosis. Cell Death Differ 6:99–104. https://doi.org/10.1038/SJ.CDD.4400476 Pflaum J, Schlosser S, Müller M, Kim EL, Gutenberg J, Bourdon JC (2014) p53 family and cellular stress responses in cancer. Front Oncol 4:285. https://doi.org/10.3389/FONC.2014.00285 Chalard A, et al (2018) Simple synthetic molecular hydrogels from self-assembling alkylgalactonamides as scaffold for 3D neuronal cell growth. ACS Appl Mater Interfaces 10:17004–17017. https://doi.org/10.1021/acsami.8b01365 Kasmi N, et al (2025) The potential of carbohydrate supramolecular hydrogels for long-term 3D culture of primary fibroblasts. J Mater Chem B. https://doi.org/10.1039/d4tb02658f Ozkul Y, et al (2020) A heritable profile of six miRNAs in autistic patients and mouse models. Sci Reports 10:1–14. https://doi.org/10.1038/s41598-020-65847-8 Sukranli ZY, et al (2024) Trans species RNA activity: Sperm RNA of the father of an autistic child programs glial cells and behavioral disorders in mice. Biomolecules 14. https://doi.org/10.3390/BIOM14020201 Bayram KK, Barokah AN, Dönmez MH, Işıktan ŞN, Bayram A (2024) Unravelling the maternal stress-induced orchestrations : Fndc5 gene expression dynamics across duodenum , stomach , and whole blood in offspring. Acta Medica 55:153–161. https://doi.org/10.32552/2024.ActaMedica.1003 Bayram KK, et al (2021) Gene expression of mouse hippocampal stem cells grown in a galactose-derived molecular gel compared to in vivo and neurospheres. Processes 9:716. https://doi.org/10.3390/pr9040716 Lee HJ, et al (2001) Fluoxetine enhances cell proliferation and prevents apoptosis in dentate gyrus of maternally separated rats. Mol Psychiatry 6:610. https://doi.org/10.1038/SJ.MP.4000954 Coccurello R, et al (2014) Brief maternal separation affects brain α1-adrenoceptors and apoptotic signaling in adult mice. Prog Neuro-Psychopharmacology Biol Psychiatry 48:161–169. https://doi.org/10.1016/j.pnpbp.2013.10.004 Weaver ICG, Grant RJ, Meaney MJ (2002) Maternal behavior regulates long-term hippocampal expression of BAX and apoptosis in the offspring. J Neurochem 82:998–1002. https://doi.org/10.1046/J.1471-4159.2002.01054.X Colle R, et al (2017) Early life adversity is associated with a smaller hippocampus in male but not female depressed in-patients: A case-control study. BMC Psychiatry 17:1–9. https://doi.org/10.1186/s12888-017-1233-2 Zhang Y, Wang S, Hei M (2024) Maternal separation as early-life stress: Mechanisms of neuropsychiatric disorders and inspiration for neonatal care. Brain Res Bull 217:111058. https://doi.org/10.1016/J.BRAINRESBULL.2024.111058 Catz SD, Johnson JL (2001) Transcriptional regulation of bcl-2 by nuclear factor kappa B and its significance in prostate cancer. Oncogene 20:7342–7351. https://doi.org/10.1038/SJ.ONC.1204926 Wang CY, Guttridge DC, Mayo MW, Baldwin JAS (1999) NF-κB Induces Expression of the Bcl-2 Homologue A1/Bfl-1 To Preferentially Suppress Chemotherapy-Induced Apoptosis. Mol Cell Biol 19:5923., https://doi.org/10.1128/MCB.19.9.5923 Blanquie O, Kilb W, Sinning A, Luhmann HJ (2017) Homeostatic interplay between electrical activity and neuronal apoptosis in the developing neocortex. Neuroscience 358:190–200. https://doi.org/10.1016/J.NEUROSCIENCE.2017.06.030 Dutcher EG, et al (2020) Early-life stress and inflammation: A systematic review of a key experimental approach in rodents. Brain Neurosci Adv 4:239821282097804. https://doi.org/10.1177/2398212820978049 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6267468\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Research Article\",\"associatedPublications\":[],\"authors\":[{\"id\":432822979,\"identity\":\"95eeb7d2-1619-4442-83df-bd69965a898a\",\"order_by\":0,\"name\":\"Aida Nurul Barokah\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Ankara Yıldırım Beyazıt University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Aida\",\"middleName\":\"Nurul\",\"lastName\":\"Barokah\",\"suffix\":\"\"},{\"id\":432822980,\"identity\":\"838dd921-a4ca-4924-8a93-df5bba653511\",\"order_by\":1,\"name\":\"İhsan Kıvanç Gürsoy\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Ankara Yıldırım Beyazıt University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"İhsan\",\"middleName\":\"Kıvanç\",\"lastName\":\"Gürsoy\",\"suffix\":\"\"},{\"id\":432822981,\"identity\":\"df5afb70-bf59-47f3-9da9-a69079d04adf\",\"order_by\":2,\"name\":\"Merve Hilal Dönmez\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Technical University of Berlin\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Merve\",\"middleName\":\"Hilal\",\"lastName\":\"Dönmez\",\"suffix\":\"\"},{\"id\":432822982,\"identity\":\"61db4a79-cc1f-40f0-a1b0-847a43f2163a\",\"order_by\":3,\"name\":\"Juliette Fitremann\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Université de Toulouse, CNRS UMR 5623\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Juliette\",\"middleName\":\"\",\"lastName\":\"Fitremann\",\"suffix\":\"\"},{\"id\":432822983,\"identity\":\"fba36841-14d8-45ab-9c51-379dc1d8e31a\",\"order_by\":4,\"name\":\"Arslan Bayram\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"GENTAN Genetic Diseases Evaluation Centre\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Arslan\",\"middleName\":\"\",\"lastName\":\"Bayram\",\"suffix\":\"\"},{\"id\":432822984,\"identity\":\"f3b8c655-50eb-43e3-8d44-dd883609d945\",\"order_by\":5,\"name\":\"Keziban Korkmaz Bayram\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABKUlEQVRIiWNgGAWjYBACCQY2IHkAxOSBiPAzgIUYGBuI1iLZANfCTKQWgwMEtEg2sCU+rjizTV6+gffgZ949dtHGx8+YPeZhsJHdcID/2AcsWqQZ2A4bnrlx27CxgS9ZmudZcu62MznmxjwMacYbDjAzz8CiRY6BvU2y4cNtxmYGHgNpngPMudsO5JhJ8zAcTgRpweYwmBb7NgYe4988B+pzN/e/AWn5j1ML0GHHJBtu3E7sYeABqjxwOHeDBNiWAzi1SDazJRs2nLmdPIOZL81yzoHjuTNuPCs3nGOQbDzzMLMxNi0Sx9sMHzYcu207v7338I03B6pz+/uTtz14U2En23e88THWUGZGYjBBoobDABg7yFJ4AOMPMMX+gAi1o2AUjIJRMIIAAKI2Yz4+tx/fAAAAAElFTkSuQmCC\",\"orcid\":\"\",\"institution\":\"Ankara Yıldırım Beyazıt University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Keziban\",\"middleName\":\"Korkmaz\",\"lastName\":\"Bayram\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-03-20 08:08:13\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-6267468/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6267468/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":79649972,\"identity\":\"14cf0491-a899-4f6f-9c98-e3def89e1808\",\"added_by\":\"auto\",\"created_at\":\"2025-04-01 07:42:30\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":182459,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eViolin plots showing the relative mRNA expression of \\u003cem\\u003eBax \\u003c/em\\u003e(a), \\u003cem\\u003eBcl2 \\u003c/em\\u003e(b), \\u003cem\\u003eCasp3 \\u003c/em\\u003e(c), and \\u003cem\\u003eTp53\\u003c/em\\u003e (d) and the \\u003cem\\u003eBcl2/Bax\\u003c/em\\u003e expression ratio (e) in the hippocampus of litters subjected to early-life maternal separation stress. The y-axis represents relative mRNA expression, and the x-axis represents the control (n=24), MS (n=24), and MSUS (n=24) groups. Each plot includes individual data points, the first quartile (Q1), the third quartile (Q3), and the median. The descriptive statistics (mean ± SD, median, Q1, and Q3) for each gene are as follows: \\u003cem\\u003eBax\\u003c/em\\u003e: control (1.12 ± 0.46, 1.20, 0.82, and 1.55), MS (0.74 ± 0.77, 0.45, 0.14, and 1.22), and MSUS (0.86 ± 0.79, 0.64, 0.20, and 1.63); \\u003cem\\u003eBcl2\\u003c/em\\u003e: control(1.13 ± 0.49, 1.11, 0.64, and 1.50), MS (6.58 ± 6.86, 3.26, 1.50, and 10.85), and MSUS (4.94 ± 4.64, 2.92, 0.96, and 8.75); \\u003cem\\u003eCasp3\\u003c/em\\u003e: control (1.12 ± 0.52, 1.06, 0.67, and 1.52), MS (0.95 ± 1.07, 0.55, 0.04, and 2.09), and MSUS (1.49 ± 1.40, 1.06, 0.40, and 2.49); \\u003cem\\u003eTp53\\u003c/em\\u003e: control (1.03 ± 0.23, 1.06, 0.89, and 1.20), MS (1.27 ± 0.70, 1.16, 0.79, and 1.81), and MSUS (1.45 ± 0.70, 1.44, 0.88, and 1.75); and\\u003cem\\u003e Bcl2/Bax\\u003c/em\\u003e: control (0.01 ± 0.41, 0.02, -0.07, and 0.19), MS (1.11 ± 1.10, 0.89, 0.16, and 1.98), and MSUS (1.03 ± 1.39, 0.56, 0.30, and 1.56)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6267468/v1/6b345f713ee354d7ce82d474.png\"},{\"id\":79648955,\"identity\":\"38cbf651-69f9-4055-a9ba-51ab8dba98f3\",\"added_by\":\"auto\",\"created_at\":\"2025-04-01 07:34:30\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":681186,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eViability and development of hippocampal cells in 3D GalC7 hydrogels. (a) Trypan blue staining revealed mostly viable cells postnucleofection. (b-e) Hippocampal cells within the GalC7 hydrogels on Day 1 (b), Day 3 (c), Day 5 (d), and Day 7 (e), as captured via an Olympus CKX41 inverted microscope at 20x magnification\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6267468/v1/89426b6acdedf15c80970d45.png\"},{\"id\":79648959,\"identity\":\"72d16875-8bfe-424a-a80b-a83019062bff\",\"added_by\":\"auto\",\"created_at\":\"2025-04-01 07:34:30\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":53979,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eViolin plot showing the \\u003cem\\u003eBcl2/Bax\\u003c/em\\u003e expression ratio in 3D cultured hippocampal cells (a) and the relative mRNA expression of \\u003cem\\u003eCasp3 \\u003c/em\\u003e(b) in 3D cultured hippocampal cells. The y-axis represents relative mRNA expression, and the x-axis represents the control (n=4), mock (n=4), 0.5 (n=4), 1 (n=4), and 2 (n=4)groups. Each plot includes individual data points, the first quartile (Q1), the third quartile (Q3), and the median. The descriptive statistics (mean ± SD, median, Q1, and Q3) for each group are as follows: \\u003cem\\u003eBcl2/Bax\\u003c/em\\u003e: control (1.78 ± 1.21, 2.09, 0.51, and 2.74), mock (2.16 ± 0.81, 2.34, 1.31, and 2.82), 0.5 (1.15 ± 2.18, 0.08, 0.04, and 3.34), 1 (1.57 ± 1.69, 1.10, 0.25, and 3.34), and 2 (1.09 ± 0.54, 1.21, 0.52, and 1.54); \\u003cem\\u003eCasp3\\u003c/em\\u003e: control (1.14 ± 0.74, 0.83, 0.69, and 1.89), mock (0.69 ± 0.49, 0.70, 0.23, and 1.14), 0.5 (0.17 ± 0.13, 0.16, 0.05, and 0.30), 1 (0.91 ± 0.30, 0.86, 0.66, and 1.20), and 2 (0.81 ± 1.39, 0.16, 0.04, and 2.23)\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6267468/v1/428f57bf6245a9e6c9e32e4b.png\"},{\"id\":79986634,\"identity\":\"75ce9e07-1fd5-49ba-8612-ca8b34bf59bc\",\"added_by\":\"auto\",\"created_at\":\"2025-04-06 08:16:37\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":1705776,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6267468/v1/23f171c8-6cfc-4f08-94ce-8c6e68e9e2d5.pdf\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"Long-term Impact of Early-Life Stress on Hippocampal Apoptotic Gene Expression in Mice\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eThe early postnatal period is a critical time for neurodevelopment, particularly in the hippocampus. During this period, environmental factors can significantly impact brain development and potentially lead to long-lasting alterations in neural circuitry and behavior. One such environmental factor is early-life stress (ELS), which is associated with an increased risk for various neuropsychiatric disorders later in life [\\u003cspan additionalcitationids=\\\"CR2\\\" citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]\\u0026ndash;[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. Studies have shown that the hippocampus, a brain region critical for memory formation [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e], is influenced through various pathways under uncontrolled stress conditions [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. Stress is known to impair memory performance, alter synaptic plasticity and neuronal firing patterns, and induce structural modifications in the hippocampus. These stress-induced alterations in the hippocampus have been associated with stress-related disorders, including posttraumatic stress disorder (PTSD) [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. The hippocampus plays a crucial role in learning and memory, and early-life challenges that begin as early as pregnancy can have long-term effects by influencing neuronal apoptosis in the hippocampus, which in turn contributes to learning deficiencies in offspring [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. In animal models, excessive exposure to glucocorticoids due to stress has been associated with hippocampal dysfunction and neuronal loss [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. Studies in both humans and rodents have provided significant insights into how early-life stress and maternal separation affect hippocampal function, particularly apoptosis and neuronal proliferation. ELS, such as maternal separation, is linked to a reduction in mature neurons in the CA3 region of the hippocampus, affects cognitive functions and maternal behavior in adult female mice [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e], and leads to epigenetic upregulation of corticotropin-releasing hormone in the hippocampus, which is associated with synaptic dysfunction and memory defects [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. In addition, research suggests that early maternal and social deprivation can expand neural stem cell populations, increase neurogenesis in the hippocampus and amygdala, and reduce fear memory [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. Research in animal models consistently demonstrates that early-life stressors, such as maternal separation, have detrimental effects on behaviors in adulthood [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e]. Studies have demonstrated that early MS can increase apoptosis in the hippocampal region of litters [\\u003cspan additionalcitationids=\\\"CR15\\\" citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]\\u0026ndash;[\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]. Therefore, the effects of postnatal two-week MS, which is a crucial period with some postnatal maturation characteristics [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e], on the trends of apoptosis in five-week-old litters have not been reported before.\\u003c/p\\u003e \\u003cp\\u003eTo examine the potential long-term impacts of ELS on hippocampal gene expression, we focused on four genes involved in regulating apoptosis: \\u003cem\\u003eBax, Bcl2, Casp3\\u003c/em\\u003e, and \\u003cem\\u003eTp53\\u003c/em\\u003e. These genes play crucial roles in determining cell fate during neurodevelopment and in response to stress. \\u003cem\\u003eBax\\u003c/em\\u003e promotes apoptosis [\\u003cspan additionalcitationids=\\\"CR19\\\" citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e]\\u0026ndash;[\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e], whereas \\u003cem\\u003eBcl2\\u003c/em\\u003e inhibits it [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. \\u003cem\\u003eCasp3\\u003c/em\\u003e is a key executioner caspase in the apoptotic cascade [\\u003cspan citationid=\\\"CR22\\\" class=\\\"CitationRef\\\"\\u003e22\\u003c/span\\u003e], and \\u003cem\\u003eTp53\\u003c/em\\u003e is a tumor suppressor gene that can induce apoptosis in response to cellular stress [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e]. Using quantitative real-time PCR (qPCR), we analyzed the expression levels of these genes in the hippocampi of the mice at PND35, three weeks after the cessation of the stress paradigms. This time point allows us to assess the persistent effects of ELS on gene expression beyond the immediate stress response period. Additionally, we performed nucleofection procedures to explore how different RNA doses from MSUS affect apoptosis-related gene expression in healthy hippocampal cells cultured on N-heptyl-D-galactonamide (GalC7) hydrogels as a 3D cellular model. The GalC7 hydrogel was selected because it is composed of a single, pure molecule, which means that its composition is highly reproducible. The gels formed have low moduli, on the order of a few kPa, making them suitable for neuronal cell culture. Finally, the gel architecture is made up of quite wide and sparse fibers which enable the cells to grow partly embedded within the gel. The degree of cell adhesion is also low, encouraging cells to organize themselves in small clusters along the fibers, thus reproducing a 3D culture quite well [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR25\\\" class=\\\"CitationRef\\\"\\u003e25\\u003c/span\\u003e]. Previous studies have reported the microinjection of RNA to create mouse models for autism [\\u003cspan citationid=\\\"CR26\\\" class=\\\"CitationRef\\\"\\u003e26\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. Similarly, our approach involves nucleofecting RNA from the hippocampi of stressed mice into healthy cells to replicate the stress environment \\u003cem\\u003ein vitro\\u003c/em\\u003e. This method allows us to explore how ELS-induced gene expression changes \\u003cem\\u003ein vivo\\u003c/em\\u003e can be mimicked in a controlled, cellular model, providing further insights into the molecular mechanisms underlying stress-related disorders.\\u003c/p\\u003e\"},{\"header\":\"Materials and methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eAnimals\\u003c/h2\\u003e \\u003cp\\u003e This study was conducted in accordance with the institutional guidelines for the care and use of laboratory animals. Ethical clearance was obtained from Ankara University Laboratory Animals and Research Laboratory (Ethics Committee Approval No: 2023-3-20). The eight-week-old \\u003cem\\u003eBALB/c\\u003c/em\\u003e mice (n\\u0026thinsp;=\\u0026thinsp;6 per group) were housed under a 12:12 h light/dark cycle (lights at 7 a.m. to 7 p.m.) with constant room temperature (22\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;2\\u0026deg;C) and humidity (45\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;5%) in standard plastic mouse cages (22 cm \\u0026times; 38 cm \\u0026times; 15 cm). Food and tap water were available \\u003cem\\u003ead libitum\\u003c/em\\u003e. All the cages were subjected to weekly cage cleaning. The breeding procedures included housing one female and one male in the same cage. After the mating period, the males were removed, and the female mice remained alone throughout the gestation period.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eMaternal stress procedures\\u003c/h3\\u003e\\n\\u003cp\\u003eThis study included three groups of litter from related dams: control, unpredictable maternal separation (MS), and unpredictable maternal separation combined with unpredictable maternal stress (MSUS) groups. The maternal stress model was re-established following the same procedures described in our previous study [\\u003cspan citationid=\\\"CR28\\\" class=\\\"CitationRef\\\"\\u003e28\\u003c/span\\u003e]. Briefly, dams and litters were separated for 3 hours each day from postnatal day (PND) 1 to PND 14. Additionally, MSUS dams experienced unpredictable maternal stress in conjunction with the MS procedure. A total of 72 five-week-old litters, with 24 (12 female litters and 12 male litters) from each group, were used in the \\u003cem\\u003ein vivo\\u003c/em\\u003e study. Additionally, five-week-old control male litters (n\\u0026thinsp;=\\u0026thinsp;4) were used for the \\u003cem\\u003ein vitro\\u003c/em\\u003e 3D hippocampal cell culture experiments.\\u003c/p\\u003e\\n\\u003ch3\\u003eTissue collection and Hippocampal Dissociation into Single Cells\\u003c/h3\\u003e\\n\\u003cp\\u003eAt PND35, the mice were sacrificed by cervical dislocation. The total brains were carefully removed, and the brain hemispheres were gently lifted toward the forebrain. The right and left hippocampi were carefully removed via fine forceps. The surgical instruments were cleaned with 75% ethanol between each transition to prevent cross-contamination. The hippocampal tissues were frozen in cryotubes in liquid nitrogen and stored at -80\\u0026deg;C until RNA isolation. For \\u003cem\\u003ein vitro\\u003c/em\\u003e 3D hippocampal cell culture, the hippocampi of control male mice were transferred to 15 mL Falcon tubes containing 5 mL of dissection solution and kept on ice until they were transported to the cell culture laboratory. The dissection solution was prepared before the tissue collection step by mixing 500 mL of Hank's balanced salt solution (HBSS), 5 mL of penicillin/streptomycin (Gibco, Life Technologies), 5 mL of 1 M MgCl\\u003csub\\u003e2\\u003c/sub\\u003e, 3.5 mL of 1 M HEPES (pH 7.3) (Lonza, Switzerland) and 5 mL of 200 mM L-glutamine (Gibco, Life Technologies) in a Falcon tube. The samples in the dissection mixture were centrifuged at 80 \\u0026times; \\u003cem\\u003eg\\u003c/em\\u003e for 5 minutes, and the supernatant was carefully discarded. Subsequently, 1.5 mL of trypsin solution was added to the pellet, and the samples were incubated at 37\\u0026deg;C for 10\\u0026ndash;20 minutes. After trypsinization, the samples were centrifuged at 80 \\u0026times; \\u003cem\\u003eg\\u003c/em\\u003e for 5 minutes, and the supernatant was discarded. The pellet was washed twice with 5 mL of HBSS. After the second wash, 1.5 mL of prewarmed (37\\u0026deg;C) medium was added to the pellet. All the tissue pieces were gently triturated 20\\u0026ndash;30 times via a fire-polished Pasteur pipette until a homogeneous suspension was achieved. This process was repeated for 1 minute with a fresh fire-polished Pasteur pipette.\\u003c/p\\u003e\\n\\u003ch3\\u003eCell counting and viability assessment\\u003c/h3\\u003e\\n\\u003cp\\u003eFive milliliters of culture medium was added to the hippocampal cells, and the cells were counted using a TC20 cell counter (Bio-Rad, USA). The average hippocampal cell count was 5.91 \\u0026times; 10⁶ cells/mL. The counted cells were centrifuged at 80 \\u0026times; \\u003cem\\u003eg\\u003c/em\\u003e for 10 minutes, and the supernatant was discarded. Cell viability was assessed under a microscope using 0.4% trypan blue solution (Gibco, Life Technologies) at a 1:1 ratio. Once cell viability was confirmed to be suitable, nucleofection was performed.\\u003c/p\\u003e\\n\\u003ch3\\u003eTotal RNA isolation from hippocampal tissue\\u003c/h3\\u003e\\n\\u003cp\\u003eThe collected hippocampal tissues were transferred into Eppendorf tubes containing 500 mL of NucleoGene Tri Reagent Lysis Reactive (NucleoGene, T\\u0026uuml;rkiye). The tissues were disintegrated via an ultrasonic tissue homogenizer. Total RNA was isolated from hippocampal tissue (n\\u0026thinsp;=\\u0026thinsp;72) via the phenol‒chloroform extraction method as described in the previous study [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e]. The total RNA used for nucleofection was selected on the basis of the criteria of increased \\u003cem\\u003eBcl2\\u003c/em\\u003e and decreased \\u003cem\\u003eBax\\u003c/em\\u003e expression, and was obtained from the hippocampus of a male litter in the MSUS group. Male mice were used to avoid the potential confounding effects of hormonal fluctuations associated with the estrous cycle in female mice. The total RNA was further purified via the High Pure RNA Isolation Kit (Roche, Germany) to eliminate any DNA-induced effects. The purity and concentration of the total RNA were measured with a NanoDrop 2000c (Thermo Fisher Scientific, USA).\\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePreparation of the Hydrogel\\u003c/h2\\u003e \\u003cp\\u003eThe GalC7 molecule was synthesized as previously described [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e], and the GalC7 hydrogel was prepared for culture as described in our previous study [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e] Briefly, for each sample, 9 mg of GalC7 powder was weighed and placed into a glass vial. Subsequently, 2 mL of nuclease-free water was added to the vial and the vial was slightly closed with a cap. The vial was then placed in a programmable oven preheated to 115\\u0026deg;C to dissolve the GalC7 powder completely. Once dissolved, the hot solution is quickly transferred to culture plate wells. The culture plate was closed to prevent the gels from drying out, and the temperature is was allowed to decrease slowly until gelation occured. The gel prepared the day before was saturated with medium and incubated at 37\\u0026deg;C in an incubator containing 5% CO\\u003csub\\u003e2\\u003c/sub\\u003e.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eNucleofection and 3D cell culture using the GalC7 hydrogel\\u003c/h3\\u003e\\n\\u003cp\\u003eExogenous RNA (total RNA, RNAse-treated total RNA (mock) and 0.5, 1, and 2 ng/\\u0026micro;L diluted from total RNA) was nucleofected into control male hippocampal cells using The Amaxa\\u0026reg; 4D-Nucleofector\\u0026reg; Protocol for Primary Mammalian Neurons (Lonza, Switzerland) Kit at the previously optimized DR-114 program, as indicated in the kit protocol. After nucleofection, the nucleocuvette was incubated for 10 minutes at room temperature. After incubation, the cells were resuspended in prewarmed medium and gently mixed by pipetting up and down 2\\u0026ndash;3 times. The nucleofected cells were cultured with GalC7 gel prepared in a 48-well plate. A total of 250 \\u0026micro;L of DMEM containing 10% penicillin/streptomycin (Gibco, Life Technologies), and 1X B27 supplement (Gibco, Life Technologies) were added. The samples were incubated at 37\\u0026deg;C with 5% CO2 for seven days. Four samples from each group were prepared: a control group without nucleofection; a mock-nucleofected group; 0.5, 1 and 2 ng/\\u0026micro;L total RNA-nucleofected groups. These samples were cultured in GalC7 for a 7-day culture period. After 7 days, the medium was removed, and the samples were washed with PBS. The samples were lysed with 1 mL of NucleoGene Tri Reagent Lysis Reactive. Total RNA was extracted from 3D hippocampal cell culture using a phenol-chloroform method that was previously established [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e].\\u003c/p\\u003e\\n\\u003ch3\\u003ecDNA synthesis and quantitative real-time PCR\\u003c/h3\\u003e\\n\\u003cp\\u003ecDNA synthesis from total RNA was performed with the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, China). Each sample was adjusted to approximately 1 \\u0026micro;g of total RNA. The reaction mixture for each sample consisted of 10 \\u0026micro;L of 2x RT Mix, 2 \\u0026micro;L of HiScript II Enzyme Mix, 1 \\u0026micro;L of Oligo-(dT)23 VN (50 \\u0026micro;M), 1 \\u0026micro;L of random hexamers (50 ng/\\u0026micro;L), 4 \\u0026micro;L of total RNA, and 2 \\u0026micro;L of nuclease-free water, yielding a total reaction volume of 20 \\u0026micro;L. cDNA synthesis was carried out via T100 Thermal Cycler PCR (Bio-Rad, USA) with the following profile: 5 minutes at 25\\u0026deg;C, 15 minutes at 50\\u0026deg;C, and 2 minutes at 85\\u0026deg;C. The resulting cDNA samples were diluted 1:5 with nuclease-free water.\\u003c/p\\u003e \\u003cp\\u003eQuantitative real-time PCR was performed on a Rotor-Gene Q (Qiagen, Germany) with specific primers (Table\\u0026nbsp;\\u003cspan refid=\\\"Tab1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003e) and 2x ChamQ Universal SYBR qPCR Master Mix (Vazyme, China). The reaction mixture consisted of 10 \\u0026micro;L of 2x ChamQ Universal SYBR qPCR Master Mix, 0.8 \\u0026micro;L of 10 \\u0026micro;M forward and reverse primer mixture, 6.2 \\u0026micro;L of nuclease-free water, and 3 \\u0026micro;L of 1:5 diluted cDNA, totaling 20 \\u0026micro;L per qPCR\\u003c/p\\u003e \\u003cp\\u003e. The qPCR profile was as follows: 30 s at 95\\u0026deg;C for initial denaturation, 10 s at 95\\u0026deg;C for denaturation, and 30 s at 58\\u0026deg;C for annealing and extension, followed by melting curve analysis. The cycle count was set to 45. Each sample was repeated at least twice. The results were analyzed via the delta‒delta‒Ct (2\\u003csup\\u003e\\u0026ndash;ΔΔCt\\u003c/sup\\u003e) method. The data were normalized to the reference gene \\u003cem\\u003eGapdh\\u003c/em\\u003e, and the mean values from the control group were used as the calibrator.\\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab1\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 1\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eSequences of the primers.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"3\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"char\\\" char=\\\".\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003ePrimer\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eSequence (5\\u0026rsquo;-3\\u0026rsquo;)\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003eAmplicon Length (bp)\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eGapdh\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: CTCTCTGCTCCTCCCTGTTC\\u003c/p\\u003e \\u003cp\\u003eReverse: TACGGCCAAATCCGTTCACA\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e105\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eBax\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: TTTGCTACAGGGTTTCATCCA\\u003c/p\\u003e \\u003cp\\u003eReverse: ATATTGCTGTCCAGTTCATCTCC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e147\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eBcl2\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: CTGGGATGCCTTTGTGGAAC\\u003c/p\\u003e \\u003cp\\u003eReverse: TCAAACAGAGGTCGCATGCT\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e51\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eCasp3\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: CAGCACCTGGTTACTATTCCTG\\u003c/p\\u003e \\u003cp\\u003eReverse: TTCCTGTTAACGCGAGTGAG\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e130\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\"\\u003e \\u003cp\\u003e\\u003cem\\u003eTp53\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003eForward: CAACAGCTCCTGCATGGGGGGC\\u003c/p\\u003e \\u003cp\\u003eReverse: AGGACAGGCACAAACACGAACC\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"char\\\" char=\\\".\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e121\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical Analyses\\u003c/h2\\u003e \\u003cp\\u003eStatistical analyses were conducted via GraphPad Prism 9.1.0 (GraphPad Software, USA). The distribution of the data was assessed through histograms, q-q plots, and Shapiro‒Wilk tests. The outliers were identified and removed via the ROUT method in GraphPad Prism (Q\\u0026thinsp;=\\u0026thinsp;1%). Independent t tests or Mann‒Whitney U tests were used to compare data between two groups. For calculation of the \\u003cem\\u003eBcl2/Bax\\u003c/em\\u003e ratio, the relative quantification units of \\u003cem\\u003eBcl2\\u003c/em\\u003e were divided by those of \\u003cem\\u003eBax\\u003c/em\\u003e for each sample. For comparisons involving three or more groups, the Kruskal‒Wallis H test was employed to assess the significance of the difference in accordance with the distribution of the data. Dunn\\u0026rsquo;s test was used for post hoc analysis. The relationships between the data were evaluated via Spearman correlation. Statistical significance was considered at a p value of \\u0026lt;\\u0026thinsp;0.05.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003eThe mRNA expression levels of \\u003cem\\u003eBax, Bcl2, Casp3\\u003c/em\\u003e, and \\u003cem\\u003eTp53\\u003c/em\\u003e in hippocampal tissue are presented in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea-d. Prior to conducting the main analysis, including the Kruskal‒Wallis test, an independent t-test was performed to confirm the absence of significant differences between male and female offspring, allowing us to combine the data. Given that the data did not meet the assumption of a normal distribution, a nonparametric Kruskal‒Wallis test was performed. Our study revealed significant differences in the mean ranks of \\u003cem\\u003eBax\\u003c/em\\u003e mRNA expression among the groups (\\u003cem\\u003eH\\u003c/em\\u003e (2, n\\u0026thinsp;=\\u0026thinsp;72)\\u0026thinsp;=\\u0026thinsp;6.38, \\u003cem\\u003eP\\u0026thinsp;=\\u003c/em\\u003e\\u0026thinsp;0.04; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ea). Dunn\\u0026rsquo;s multiple comparison test revealed significant downregulation in the MS group compared with the control group (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.05). For \\u003cem\\u003eBcl2\\u003c/em\\u003e, significant differences in mean ranks were observed (\\u003cem\\u003eH\\u003c/em\\u003e (2, n\\u0026thinsp;=\\u0026thinsp;72)\\u0026thinsp;=\\u0026thinsp;16.22, \\u003cem\\u003eP\\u0026thinsp;=\\u003c/em\\u003e\\u0026thinsp;0.0003; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eb). Dunn\\u0026rsquo;s multiple comparison test revealed significant upregulation in both the MS and MSUS groups compared with the control group (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0005 and \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0057, respectively). No significant differences were detected among the groups for either \\u003cem\\u003eCasp3\\u003c/em\\u003e (\\u003cem\\u003eH\\u003c/em\\u003e (2, n\\u0026thinsp;=\\u0026thinsp;72)\\u0026thinsp;=\\u0026thinsp;3.43, \\u003cem\\u003eP\\u0026thinsp;\\u0026gt;\\u003c/em\\u003e\\u0026thinsp;0.05; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ec) or \\u003cem\\u003eTp53\\u003c/em\\u003e (\\u003cem\\u003eH\\u003c/em\\u003e (2, n\\u0026thinsp;=\\u0026thinsp;72)\\u0026thinsp;=\\u0026thinsp;5.50, \\u003cem\\u003eP\\u0026thinsp;\\u0026gt;\\u003c/em\\u003e\\u0026thinsp;0.05; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ed). Furthermore, our study revealed significant differences in the mean ranks of the \\u003cem\\u003eBcl2/Bax\\u003c/em\\u003e expression ratios among the groups (H (2, n\\u0026thinsp;=\\u0026thinsp;72)\\u0026thinsp;=\\u0026thinsp;20.16, P\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001; Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003ee). Dunn\\u0026rsquo;s multiple comparison test revealed a significant increase in the \\u003cem\\u003eBcl2/Bax\\u003c/em\\u003e expression ratio in both the MS and MSUS groups compared with the control group (P\\u0026thinsp;=\\u0026thinsp;0.0001 and P\\u0026thinsp;=\\u0026thinsp;0.0010, respectively).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cdiv class=\\\"gridtable\\\"\\u003e\\u003ctable float=\\\"Yes\\\" id=\\\"Tab2\\\" border=\\\"1\\\"\\u003e \\u003ccaption language=\\\"En\\\"\\u003e \\u003cdiv class=\\\"CaptionNumber\\\"\\u003eTable 2\\u003c/div\\u003e \\u003cdiv class=\\\"CaptionContent\\\"\\u003e \\u003cp\\u003eSpearman correlation coefficients between Bax, Bcl2, Casp3 and Tp53 mRNA expression in the hippocampus of litters within each experimental group.\\u003c/p\\u003e \\u003c/div\\u003e \\u003c/caption\\u003e \\u003ccolgroup cols=\\\"6\\\"\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c1\\\" colnum=\\\"1\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c2\\\" colnum=\\\"2\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c3\\\" colnum=\\\"3\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c4\\\" colnum=\\\"4\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c5\\\" colnum=\\\"5\\\"\\u003e\\u003c/div\\u003e \\u003cdiv align=\\\"left\\\" class=\\\"colspec\\\" colname=\\\"c6\\\" colnum=\\\"6\\\"\\u003e\\u003c/div\\u003e \\u003cthead\\u003e \\u003ctr\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c1\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c2\\\"\\u003e\\u0026nbsp;\\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1. \\u003cem\\u003eBax\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e2. \\u003cem\\u003eBcl2\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e3. \\u003cem\\u003eCasp3\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003cth align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e4. \\u003cem\\u003eTp53\\u003c/em\\u003e\\u003c/p\\u003e \\u003c/th\\u003e \\u003c/tr\\u003e \\u003c/thead\\u003e \\u003ctbody\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"3\\\" rowspan=\\\"4\\\"\\u003e \\u003cp\\u003eControl\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e1.\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e2.\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.40\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e3.\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.24\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.01\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e4.\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e0.61**\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e-0.43*\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.21\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"3\\\" rowspan=\\\"4\\\"\\u003e \\u003cp\\u003eMS\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e1.\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e2.\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e-0.18\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e3.\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e0.61**\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-0.10\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e4.\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e0.74****\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e-0.11\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e0.37\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c1\\\" morerows=\\\"3\\\" rowspan=\\\"4\\\"\\u003e \\u003cp\\u003eMSUS\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e1.\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e2.\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e0.07\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e3.\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e0.68***\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.23\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e\\u0026nbsp;\\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c2\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e4.\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c3\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e0.65***\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c4\\\"\\u003e \\u003cp\\u003e0.04\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c5\\\"\\u003e \\u003cp\\u003e\\u003cb\\u003e0.58**\\u003c/b\\u003e\\u003c/p\\u003e \\u003c/td\\u003e \\u003ctd align=\\\"left\\\" colname=\\\"c6\\\"\\u003e \\u003cp\\u003e1\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003ctr\\u003e \\u003ctd align=\\\"left\\\" colspan=\\\"6\\\" nameend=\\\"c6\\\" namest=\\\"c1\\\"\\u003e \\u003cp\\u003eNote. *\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, **\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, ***\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, ****\\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.0001\\u003c/p\\u003e \\u003c/td\\u003e \\u003c/tr\\u003e \\u003c/tbody\\u003e \\u003c/colgroup\\u003e \\u003c/table\\u003e\\u003c/div\\u003e \\u003c/p\\u003e \\u003cp\\u003eSpearman\\u0026rsquo;s rank correlation was performed to further explore the relationships between gene expression in the hippocampal tissue of the litters. As shown in Table\\u0026nbsp;\\u003cspan refid=\\\"Tab2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003e, in the control group, a significant positive correlation was observed between \\u003cem\\u003eBax\\u003c/em\\u003e and \\u003cem\\u003eTp53\\u003c/em\\u003e expression (\\u003cem\\u003er\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.61, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.002), whereas \\u003cem\\u003eBcl2\\u003c/em\\u003e and \\u003cem\\u003eTp53\\u003c/em\\u003e expression was significantly negatively correlated (\\u003cem\\u003er\\u003c/em\\u003e=-0.43, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.034). In the MS group, significant positive correlations were observed between \\u003cem\\u003eBax\\u003c/em\\u003e and \\u003cem\\u003eTp53\\u003c/em\\u003e (\\u003cem\\u003er\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.74, \\u003cem\\u003eP\\u0026thinsp;\\u0026lt;\\u003c/em\\u003e\\u0026thinsp;0.0001) and between \\u003cem\\u003eBax\\u003c/em\\u003e and \\u003cem\\u003eCasp3\\u003c/em\\u003e (\\u003cem\\u003er\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.61, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0015). In the MSUS group, significant positive correlations were detected between \\u003cem\\u003eBax\\u003c/em\\u003e and \\u003cem\\u003eTp53\\u003c/em\\u003e (\\u003cem\\u003er\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.65, \\u003cem\\u003eP\\u0026thinsp;=\\u003c/em\\u003e\\u0026thinsp;0.0006), between \\u003cem\\u003eBax\\u003c/em\\u003e and \\u003cem\\u003eCasp3\\u003c/em\\u003e (\\u003cem\\u003er\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.68, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0003), and between \\u003cem\\u003eCasp3\\u003c/em\\u003e and \\u003cem\\u003eTp53\\u003c/em\\u003e (\\u003cem\\u003er\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.58, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0027).\\u003c/p\\u003e \\u003cp\\u003eTrypan blue staining confirmed that most cells remained viable postnucleofection (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003ea\\u003cb\\u003e)\\u003c/b\\u003e. Additionally, the development of hippocampal cells in GalC7 was monitored over time via an Olympus CKX41 inverted microscope at 20x magnification (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eb-e\\u003cb\\u003e).\\u003c/b\\u003e Initially, the cells appeared sparsely distributed with minimal neurite outgrowth. Over time, increased cell clustering was observed, along with more prominent interactions between cells and the surrounding GalC7 fibers. In later stages, the cells appeared more densely distributed and organized within the hydrogel, suggesting progressive maturation within the 3D environment.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe \\u003cem\\u003eBcl2/Bax\\u003c/em\\u003e expression ratios in 3D hippocampal cell culture samples from different groups (control, mock, 0.5, 1, and 2) are presented in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003ea. No significant differences were observed across groups (H (4, n\\u0026thinsp;=\\u0026thinsp;20)\\u0026thinsp;=\\u0026thinsp;3.77, P\\u0026thinsp;\\u0026gt;\\u0026thinsp;0.05). Notably, the \\u003cem\\u003eBcl2/Bax\\u003c/em\\u003e ratios in the control and mock groups were similar, which is important for ruling out potential effects of nucleofection on gene expression. Although no significant differences were found, the \\u003cem\\u003eBcl2/Bax\\u003c/em\\u003e ratio was lower in the nucleofected groups than in the control and mock groups. The highest variability in the \\u003cem\\u003eBcl2/Bax\\u003c/em\\u003e ratio was observed in the 0.5 group, suggesting a heterogeneous response at this concentration, whereas the variability decreased at higher concentrations.\\u003c/p\\u003e \\u003cp\\u003eFurthermore, the mRNA expression levels of \\u003cem\\u003eCasp3\\u003c/em\\u003e in 3D hippocampal cell culture samples from different groups (control, mock, 0.5, 1, and 2) are presented in Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig3\\\" class=\\\"InternalRef\\\"\\u003e3\\u003c/span\\u003eb. No significant differences were observed across groups for \\u003cem\\u003eCasp3\\u003c/em\\u003e (\\u003cem\\u003eH\\u003c/em\\u003e (4, n\\u0026thinsp;=\\u0026thinsp;20)\\u0026thinsp;=\\u0026thinsp;7.91, \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;\\u0026gt;\\u0026thinsp;0.05).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eIn this study, we investigated the long-term effects of PND1-14 postnatal unpredictable maternal separation (MS) and unpredictable maternal separation combined with unpredictable maternal stress (MSUS) on apoptosis-related gene expression in the hippocampus of five-week-old mice. While several studies have reported that maternal separation leads to increased apoptotic cell death in the hippocampi of rats and mice, notably at various time intervals [\\u003cspan additionalcitationids=\\\"CR15\\\" citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e]\\u0026ndash;[\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR30\\\" class=\\\"CitationRef\\\"\\u003e30\\u003c/span\\u003e], our findings revealed that survival tends to be promoted instead of apoptotic pathways in the hippocampus. These findings are consistent with those of the study by Coccurello R. \\u003cem\\u003eet al\\u003c/em\\u003e. (2014), who reported an increase in \\u003cem\\u003eBcl2\\u003c/em\\u003e mRNA expression in the hippocampal region [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. In our study, the expression of the \\u003cem\\u003eBcl2\\u003c/em\\u003e mRNA was significantly greater in the MS and MSUS groups than in the control group (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0005 and \\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.0057, respectively). Compared with that in the control group, \\u003cem\\u003eBax\\u003c/em\\u003e was significantly downregulated in the MS group (\\u003cem\\u003eP\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.05) but not in the MSUS group. However, MSUS \\u003cem\\u003eBax\\u003c/em\\u003e expression still consistently decreased, similar to MS. In the control correlation results, \\u003cem\\u003eBax\\u003c/em\\u003e and \\u003cem\\u003eBcl2\\u003c/em\\u003e showed a nonsignificant moderate negative correlation (r= -0.40), reflecting their classical antagonistic role in regulating apoptosis. However, this correlation weakened in MS (r= -0.18) and disappeared in MSUS (r\\u0026thinsp;=\\u0026thinsp;0.07), suggesting that their regulatory relationship is disrupted under MS and MSUS conditions. The upregulation of \\u003cem\\u003eBcl2\\u003c/em\\u003e in MS and MSUS indicates the promotion of hippocampal neuronal survival while simultaneously suppressing apoptotic processes. Additionally, the significantly increased \\u003cem\\u003eBcl2/Bax\\u003c/em\\u003e ratios in the MS (P\\u0026thinsp;=\\u0026thinsp;0.0001) and MSUS (P\\u0026thinsp;=\\u0026thinsp;0.0010) groups compared with those in the control group further support a shift toward cell survival mechanisms. Previous studies have shown that ELS, such as low-level maternal care, increases vulnerability to hippocampal neuron loss via apoptosis in PND90 rats [\\u003cspan citationid=\\\"CR32\\\" class=\\\"CitationRef\\\"\\u003e32\\u003c/span\\u003e]. In humans, early-life adversity has been linked to a smaller hippocampus volume in male depressed in-patients [\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]; this alteration may stem from the apoptotic pathway and contribute to severe neuropsychiatric outcomes. Moreover, early MS has been associated with long-term consequences [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. Our findings suggest that hippocampal cells adapt to promote survival, counteract apoptosis and preserve neuronal integrity. This response may help mitigate the long-term impact of ELS and prevent more severe consequences later in life. Neuronal survival can be initiated through increased intracellular Ca\\u0026sup2;⁺, which activates prosurvival signal transduction pathways (the phosphoinositide 3-kinase (PI3K)/Akt pathway, the protein kinase C (PKC)/extracellular signal-regulated kinase (ERK) pathway [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e], and the Ca\\u003csup\\u003e2+\\u003c/sup\\u003e/calmodulin pathway), which further inhibits the transcription of cell death-related genes and activates key transcription factors such as CREB and NF-κB. This leads to an increase in \\u003cem\\u003eBcl2\\u003c/em\\u003e expression [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e], [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e] and an increase in the ratio of antiapoptotic to proapoptotic factors within the cell [\\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e], possibly due to an increase in hippocampal IL-1β and TNF-α via those pathways, as reported in some short- and long-term maternal separation studies [\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]. On the basis of our unpublished data, which revealed a decrease in the expression of Ca\\u0026sup2;⁺-permeable \\u003cem\\u003eGria2\\u003c/em\\u003e in MS and MSUS, it is reasonable to hypothesize that Ca\\u0026sup2;⁺ influx may involve the upregulation of \\u003cem\\u003eBcl2\\u003c/em\\u003e, further supporting neuronal survival.\\u003c/p\\u003e \\u003cp\\u003eThere were no significant differences in \\u003cem\\u003eCasp3\\u003c/em\\u003e expression among the groups. There was variability in expression, but there was no strong trend toward upregulation or downregulation. This result is consistent with the notion that the transcription of the prosurvival protein \\u003cem\\u003eBcl2\\u003c/em\\u003e and the repression of the proapoptotic protein \\u003cem\\u003eBax\\u003c/em\\u003e likely prevent the activation of the subsequent caspase cascade, including the Casp3-dependent apoptotic cascade. Despite the lack of significant differences, \\u003cem\\u003eCasp3\\u003c/em\\u003e maintained strong positive correlations with \\u003cem\\u003eBax\\u003c/em\\u003e under MS (r\\u0026thinsp;=\\u0026thinsp;0.61) and MSUS (r\\u0026thinsp;=\\u0026thinsp;0.68) conditions. \\u003cem\\u003eTp53\\u003c/em\\u003e expression did not significantly change; however, its significant strong correlation with \\u003cem\\u003eBax\\u003c/em\\u003e expression in MS (r\\u0026thinsp;=\\u0026thinsp;0.74) and MSUS (r\\u0026thinsp;=\\u0026thinsp;0.65) suggests that while survival conditions are maintained, there may not be complete suppression of apoptosis.\\u003c/p\\u003e \\u003cp\\u003eIn addition to our \\u003cem\\u003ein vivo\\u003c/em\\u003e study, we evaluated how different RNA doses (0.5, 1, and 2 ng/\\u0026micro;L) of MSUS affect apoptosis-related gene expression in healthy hippocampal cells cultured on GalC7 hydrogels. Although statistical significance was not reached, several key observations provide insights into the potential of this \\u003cem\\u003ein vitro\\u003c/em\\u003e model. The similarity in gene expression between the control and mock-nucleofected groups indicates that the nucleofection process itself does not induce apoptosis-related changes. Moreover, in the 3D hippocampal cell culture nucleofected with 0.5 ng/\\u0026micro;L total RNA, the \\u003cem\\u003eBcl2/Bax\\u003c/em\\u003e ratio was lower than that in the control and mock-nucleofected groups; however, this decrease was not statistically significant. As the nucleofected total RNA concentration increased, the ratio approached the levels observed in the control and mock groups, with notably reduced variability. Neuronal cells, which are particularly challenging to culture in 3D, are expected to undergo prominent apoptosis. However, the upregulated \\u003cem\\u003eBcl2\\u003c/em\\u003e transcript observed in the hippocampus of stressed mice may contribute to maintaining healthy hippocampal cells in a survival mode, potentially depending on the concentration of nucleofected RNA. Our 3D neuronal culture findings indicate that the microenvironment of stressed mice sustains adaptive processes \\u003cem\\u003ein vitro\\u003c/em\\u003e, leading to a more stable survival response at higher RNA nucleofection concentrations. Our \\u003cem\\u003ein vitro\\u003c/em\\u003e models shed light on the importance of concentration-dependent nucleofection for ELS-related apoptosis studies. Despite the limitations of this study, particularly the lack of detailed characterization of the total RNA extracted from the hippocampus of male mice in the MSUS group used for nucleofection, we confirmed that the RNA sample used for nucleofection was extracted from tissue exhibiting an \\u003cem\\u003ein vivo\\u003c/em\\u003e expression profile of increased \\u003cem\\u003eBcl2\\u003c/em\\u003e and decreased \\u003cem\\u003eBax\\u003c/em\\u003e levels, whereas the mRNA levels of \\u003cem\\u003eCasp3\\u003c/em\\u003e and \\u003cem\\u003eTp53\\u003c/em\\u003e did not show comparable expression to those in the control group. Another limitation of this study is that neuronal markers were not assessed in 3D hippocampal culture. However, our previous study demonstrated that the mRNA expression levels of genes expressed by neurons increased when they were cultured with GalC7 [\\u003cspan citationid=\\\"CR29\\\" class=\\\"CitationRef\\\"\\u003e29\\u003c/span\\u003e].\\u003c/p\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eWe concluded that unpredictable early-life MS and MSUS stress significantly affect the mRNA expression of prosurvival genes, leading to an increase in the latter, whereas the expression of proapoptotic genes decreases in the hippocampus of five-week-old \\u003cem\\u003eBALB/c\\u003c/em\\u003e mice. These gene expression profiles are similar in both sexes, suggesting the existence of nonsex-driven mechanisms. The alterations observed may be an adaptive mechanism supporting neuronal survival in adolescents. If early-life maternal deprivation or MS leads to widespread apoptosis in the hippocampus \\u0026mdash; a region where neurogenesis continues into adulthood \\u0026mdash; the detrimental effects are likely to manifest as an increased susceptibility to neurodegenerative diseases. However, the brain possesses adaptive mechanisms to mitigate severe neuronal loss. In this study, the activation of survival pathways in hippocampal cells may reflect an adaptive response, protecting against major stress-induced damage.\\u003c/p\\u003e\"},{\"header\":\"Statements and declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgments\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe are very grateful for the financial support from Ankara Yıldırım Beyazıt University Scientific Research Project Coordination Unit (AYBU BAP). We would also like to express our sincere appreciation for the molecular laboratory facilities provided by Ankara Yıldırım Beyazıt University (AYBU) Central Research Laboratory (AYBU Merlab) for this study.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThis study received financial support from the Ankara Yıldırım Beyazıt University Scientific Research Project Coordination Unit (AYBU BAP) (No. TYL-2023-2484).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contributions\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eFunding acquisition was carried out by K.K.B and İ.K.G. The mouse model and wet-lab experiments were performed by K.K.B., A.N.B., İ.K.G and M.H.D. Figures and graphs were prepared by A.N.B. Statistical analyses were performed by A.N.B. Conceptualization and data interpretation were performed by K.K.B. and A.B. K.K.B., A.N.B, and J.F. prepared the manuscript. J.F. provided the GalC7. All the authors reviewed and approved the final version of the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eCompeting interests\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare that they have no competing interests.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eData availability\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003ePagliaccio D, Barch DM (2016) Early life adversity and risk for depression: Alterations in cortisol and brain structure and function as mediating mechanisms. In: Frodl T (ed) Systems neuroscience in depression. Elsevier Academic Press, pp 29-77. https://doi.org/10.1016/B978-0-12-802456-0.00002-9\\u003c/li\\u003e\\n\\u003cli\\u003eWenderski W, Maze I (2014) Epigenetic mechanisms of drug addiction vulnerability. In: Peedicayil J, Grayson DR, Avramopoulos D (ed) Epigenetics in Psychiatry. Elsevier Academic Press, pp 441-462. https://doi.org/10.1016/B978-0-12-417114-5.00021-8\\u003c/li\\u003e\\n\\u003cli\\u003ePariante CM, Nemeroff CB (2012) Unipolar depression. Handb Clin Neurol 106:239\\u0026ndash;249. https://doi.org/10.1016/B978-0-444-52002-9.00014-0\\u003c/li\\u003e\\n\\u003cli\\u003eHammoud K, Spittler N, Buch K, Hakimelahi R, Nguyen J, Lanfranchi M (2019) Camping out in the hippocampus: Imaging spectrum of etiologies that affect the hippocampi and tips for honing the differential diagnosis. Neurographics 9:37\\u0026ndash;54. https://doi.org/10.3174/ng.1800032\\u003c/li\\u003e\\n\\u003cli\\u003eCosta V, Lugert S, Jagasia R (2015) Role of adult hippocampal neurogenesis in cognition in physiology and disease: Pharmacological targets and biomarkers. Handb Exp Pharmacol 228:99\\u0026ndash;155. https://doi.org/10.1007/978-3-319-16522-6_4\\u003c/li\\u003e\\n\\u003cli\\u003eKim EJ, Pellman B, Kim JJ (2015) Stress effects on the hippocampus: A critical review. Learn Mem 22:411\\u0026ndash;416, 2015. https://doi.org/10.1101/lm.037291.114\\u003c/li\\u003e\\n\\u003cli\\u003eKuang H, \\u003cem\\u003eet al \\u003c/em\\u003e(2014) Hippocampal apoptosis involved in learning deficits in the offspring exposed to maternal high sucrose diets. J Nutr Biochem 25:985\\u0026ndash;990. https://doi.org/10.1016/J.JNUTBIO.2014.04.012\\u003c/li\\u003e\\n\\u003cli\\u003eLucassen PJ, \\u003cem\\u003eet al\\u003c/em\\u003e (2001) Hippocampal apoptosis in major depression is a minor event and absent from subareas at risk for glucocorticoid overexposure. Am J Pathol 158:453\\u0026ndash;468. https://doi.org/10.1016/S0002-9440(10)63988-0\\u003c/li\\u003e\\n\\u003cli\\u003eReshetnikov VV, Kovner AV, Lepeshko AA, Pavlov KS, Grinkevich LN, Bondar NP (2020) Stress early in life leads to cognitive impairments, reduced numbers of CA3 neurons and altered maternal behavior in adult female mice. Genes Brain Behav 19:e12541. https://doi.org/10.1111/GBB.12541\\u003c/li\\u003e\\n\\u003cli\\u003eWang A, \\u003cem\\u003eet al \\u003c/em\\u003e(2014) Epigenetic upregulation of corticotrophin-releasing hormone mediates postnatal maternal separation-induced memory deficiency. PLoS One 9:e94394. https://doi.org/10.1371/JOURNAL.PONE.0094394\\u003c/li\\u003e\\n\\u003cli\\u003eDaun KA, Fuchigami T, Koyama N, Maruta N, Ikenaka K, Hitoshi S (2020) Early maternal and social deprivation expands neural stem cell population size and reduces hippocampus/amygdala-dependent fear memory. Front Neurosci 14:483850. https://doi.org/10.3389/FNINS.2020.00022/BIBTEX\\u003c/li\\u003e\\n\\u003cli\\u003eGapp K, \\u003cem\\u003eet al \\u003c/em\\u003e(2014) Early life stress in fathers improves behavioural flexibility in their offspring. Nat Commun 5:5466. https://doi.org/10.1038/ncomms6466\\u003c/li\\u003e\\n\\u003cli\\u003eWeiss IC, Franklin TB, Vizi S, Mansuy IM (2011) Inheritable effect of unpredictable maternal separation on behavioral responses in mice. Front Behav Neurosci 5:1\\u0026ndash;12. https://doi.org/10.3389/fnbeh.2011.00003\\u003c/li\\u003e\\n\\u003cli\\u003eYang S, Li J, Han L, Zhu G (2017) Early maternal separation promotes apoptosis in dentate gyrus and alters neurological behaviors in adolescent rats. Int J Clin Exp Pathol 10:10812\\u0026ndash;10820.\\u003c/li\\u003e\\n\\u003cli\\u003eBin Baek S, \\u003cem\\u003eet al \\u003c/em\\u003e(2011) The phosphodiesterase type-5 inhibitor, tadalafil, improves depressive symptoms, ameliorates memory impairment, as well as suppresses apoptosis and enhances cell proliferation in the hippocampus of maternal-separated rat pups. Neurosci Lett 488:26\\u0026ndash;30. https://doi.org/10.1016/j.neulet.2010.10.074\\u003c/li\\u003e\\n\\u003cli\\u003eFabricius K, W\\u0026ouml;rtwein G, Pakkenberg B (2008) The impact of maternal separation on adult mouse behaviour and on the total neuron number in the mouse hippocampus. Brain Struct Funct 212:403\\u0026ndash;416. https://doi.org/10.1007/S00429-007-0169-6\\u003c/li\\u003e\\n\\u003cli\\u003eKudryashov IE, Onufriev MV, Kudryashova IV, Gulyaeva NV (2001) Periods of postnatal maturation of hippocampus: synaptic modifications and neuronal disconnection. Dev Brain Res 132:113\\u0026ndash;120. https://doi.org/10.1016/S0165-3806(01)00301-7\\u003c/li\\u003e\\n\\u003cli\\u003eBrady HJM, Gil-G\\u0026oacute;mez G (1998) Molecules in focus bax. The pro-apoptotic Bcl-2 family member, bax. Int J Biochem Cell Biol 30:647\\u0026ndash;650. https://doi.org/10.1016/S1357-2725(98)00006-5\\u003c/li\\u003e\\n\\u003cli\\u003eDai Z, Lai JR (2019) Isolation of synthetic antibodies against BCL-2-Associated X Protein (BAX). Methods Mol Biol\\u003cem\\u003e \\u003c/em\\u003e1877:351\\u0026ndash;357. https://doi.org/10.1007/978-1-4939-8861-7_21\\u003c/li\\u003e\\n\\u003cli\\u003eWei MC, \\u003cem\\u003eet al \\u003c/em\\u003e(2001) Proapoptotic BAX and BAK: a requisite gateway to mitochondrial dysfunction and death. Science 292:727\\u0026ndash;730. https://doi.org/10.1126/SCIENCE.1059108\\u003c/li\\u003e\\n\\u003cli\\u003eSiddiqui WA, Ahad A, Ahsan H (2015) The mystery of BCL2 family: Bcl-2 proteins and apoptosis: an update. Arch Toxicol 89:289\\u0026ndash;317. https://doi.org/10.1007/S00204-014-1448-7\\u003c/li\\u003e\\n\\u003cli\\u003ePorter AG, J\\u0026auml;nicke RU (1999) Emerging roles of caspase-3 in apoptosis. Cell Death Differ\\u003cem\\u003e \\u003c/em\\u003e6:99\\u0026ndash;104. https://doi.org/10.1038/SJ.CDD.4400476\\u003c/li\\u003e\\n\\u003cli\\u003ePflaum J, Schlosser S, M\\u0026uuml;ller M, Kim EL, Gutenberg J, Bourdon JC (2014) p53 family and cellular stress responses in cancer. Front Oncol 4:285. https://doi.org/10.3389/FONC.2014.00285\\u003c/li\\u003e\\n\\u003cli\\u003eChalard A, \\u003cem\\u003eet al \\u003c/em\\u003e(2018) Simple synthetic molecular hydrogels from self-assembling alkylgalactonamides as scaffold for 3D neuronal cell growth. ACS Appl Mater Interfaces 10:17004\\u0026ndash;17017. https://doi.org/10.1021/acsami.8b01365\\u003c/li\\u003e\\n\\u003cli\\u003eKasmi N, \\u003cem\\u003eet al \\u003c/em\\u003e(2025) The potential of carbohydrate supramolecular hydrogels for long-term 3D culture of primary fibroblasts. J Mater Chem B. https://doi.org/10.1039/d4tb02658f\\u003c/li\\u003e\\n\\u003cli\\u003eOzkul Y, \\u003cem\\u003eet al \\u003c/em\\u003e(2020) A heritable profile of six miRNAs in autistic patients and mouse models. Sci Reports\\u003cem\\u003e \\u003c/em\\u003e10:1\\u0026ndash;14. https://doi.org/10.1038/s41598-020-65847-8\\u003c/li\\u003e\\n\\u003cli\\u003eSukranli ZY, \\u003cem\\u003eet al \\u003c/em\\u003e(2024) Trans species RNA activity: Sperm RNA of the father of an autistic child programs glial cells and behavioral disorders in mice. Biomolecules 14. https://doi.org/10.3390/BIOM14020201\\u003c/li\\u003e\\n\\u003cli\\u003eBayram KK, Barokah AN, D\\u0026ouml;nmez MH, Işıktan ŞN, Bayram A (2024) Unravelling the maternal stress-induced orchestrations : Fndc5 gene expression dynamics across duodenum , stomach , and whole blood in offspring. Acta Medica 55:153\\u0026ndash;161. https://doi.org/10.32552/2024.ActaMedica.1003\\u003c/li\\u003e\\n\\u003cli\\u003eBayram KK, \\u003cem\\u003eet al \\u003c/em\\u003e(2021) Gene expression of mouse hippocampal stem cells grown in a galactose-derived molecular gel compared to in vivo and neurospheres. Processes 9:716. https://doi.org/10.3390/pr9040716\\u003c/li\\u003e\\n\\u003cli\\u003eLee HJ, \\u003cem\\u003eet al \\u003c/em\\u003e(2001) Fluoxetine enhances cell proliferation and prevents apoptosis in dentate gyrus of maternally separated rats. Mol Psychiatry 6:610. https://doi.org/10.1038/SJ.MP.4000954\\u003c/li\\u003e\\n\\u003cli\\u003eCoccurello R, \\u003cem\\u003eet al \\u003c/em\\u003e(2014) Brief maternal separation affects brain \\u0026alpha;1-adrenoceptors and apoptotic signaling in adult mice. Prog Neuro-Psychopharmacology Biol Psychiatry 48:161\\u0026ndash;169. https://doi.org/10.1016/j.pnpbp.2013.10.004\\u003c/li\\u003e\\n\\u003cli\\u003eWeaver ICG, Grant RJ, Meaney MJ (2002) Maternal behavior regulates long-term hippocampal expression of BAX and apoptosis in the offspring. J Neurochem 82:998\\u0026ndash;1002. https://doi.org/10.1046/J.1471-4159.2002.01054.X\\u003c/li\\u003e\\n\\u003cli\\u003eColle R, \\u003cem\\u003eet al \\u003c/em\\u003e(2017) Early life adversity is associated with a smaller hippocampus in male but not female depressed in-patients: A case-control study. BMC Psychiatry 17:1\\u0026ndash;9. https://doi.org/10.1186/s12888-017-1233-2\\u003c/li\\u003e\\n\\u003cli\\u003eZhang Y, Wang S, Hei M (2024) Maternal separation as early-life stress: Mechanisms of neuropsychiatric disorders and inspiration for neonatal care. Brain Res Bull\\u003cem\\u003e \\u003c/em\\u003e217:111058. https://doi.org/10.1016/J.BRAINRESBULL.2024.111058\\u003c/li\\u003e\\n\\u003cli\\u003eCatz SD, Johnson JL (2001) Transcriptional regulation of bcl-2 by nuclear factor kappa B and its significance in prostate cancer. Oncogene 20:7342\\u0026ndash;7351. https://doi.org/10.1038/SJ.ONC.1204926\\u003c/li\\u003e\\n\\u003cli\\u003eWang CY, Guttridge DC, Mayo MW, Baldwin JAS (1999) NF-\\u0026kappa;B Induces Expression of the Bcl-2 Homologue A1/Bfl-1 To Preferentially Suppress Chemotherapy-Induced Apoptosis. Mol Cell Biol 19:5923., https://doi.org/10.1128/MCB.19.9.5923\\u003c/li\\u003e\\n\\u003cli\\u003eBlanquie O, Kilb W, Sinning A, Luhmann HJ (2017) Homeostatic interplay between electrical activity and neuronal apoptosis in the developing neocortex. Neuroscience 358:190\\u0026ndash;200. https://doi.org/10.1016/J.NEUROSCIENCE.2017.06.030\\u003c/li\\u003e\\n\\u003cli\\u003eDutcher EG, et al (2020) Early-life stress and inflammation: A systematic review of a key experimental approach in rodents. Brain Neurosci Adv 4:239821282097804. https://doi.org/10.1177/2398212820978049\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Apoptosis, cell survival, maternal deprivation, 3D hippocampal cell culture, nucleofection.\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6267468/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6267468/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eEarly-life stress (ELS) such as maternal separation has been associated with neuronal apoptosis and impaired hippocampal function in rodent models. This study investigated the long-term effects of early-life unpredictable maternal separation (MS) and MS combined with unpredictable maternal stress (MSUS) from postnatal days 1 to 14 on the mRNA expression levels of the proapoptotic genes \\u003cem\\u003eBax\\u003c/em\\u003e, \\u003cem\\u003eTp53\\u003c/em\\u003e and \\u003cem\\u003eCasp3\\u003c/em\\u003e, and the prosurvival gene \\u003cem\\u003eBcl2\\u003c/em\\u003e in the hippocampus of mice (\\u003cem\\u003ein vivo\\u003c/em\\u003e). Additionally, total RNA from the MSUS hippocampus was nucleofected at different concentrations into healthy mouse hippocampal cells, followed by 3D neuronal cell culture using N-heptyl-D-galactonamide (GalC7) hydrogels as scaffolds for hippocampal cell growth and apoptotic gene expression studies (\\u003cem\\u003ein vitro\\u003c/em\\u003e).\\u003cstrong\\u003e \\u003c/strong\\u003eQuantitative real-time PCR was conducted to assess the expression of target genes, which were subsequently analyzed using the comparative Ct method (2\\u003csup\\u003e-ΔΔCt\\u003c/sup\\u003e).\\u003cstrong\\u003e \\u003c/strong\\u003e\\u003cem\\u003eBax\\u003c/em\\u003e mRNA expression was significantly lower in the MS group than in the control group, whereas both the MS and MSUS groups presented significant increases in \\u003cem\\u003eBcl2 \\u003c/em\\u003emRNA expression. In addition, the expression ratio of \\u003cem\\u003eBcl2\\u003c/em\\u003e/\\u003cem\\u003eBax\\u003c/em\\u003e was significantly greater in the MS and MSUS groups. No significant differences in \\u003cem\\u003eTp53\\u003c/em\\u003e or \\u003cem\\u003eCasp3\\u003c/em\\u003e mRNA expression levels were detected between the groups. Although the \\u003cem\\u003ein vitro \\u003c/em\\u003emRNA expression levels were not significantly different, the mRNA expression ratio of \\u003cem\\u003eBcl2/Bax\\u003c/em\\u003e reached equilibrium as the concentration of total RNA nucleofected increased.\\u003cstrong\\u003e \\u003c/strong\\u003eOur results suggested that, in response to ELS, hippocampal cells adapt to prioritize survival over apoptosis.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Long-term Impact of Early-Life Stress on Hippocampal Apoptotic Gene Expression in Mice\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-04-01 07:34:26\",\"doi\":\"10.21203/rs.3.rs-6267468/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"05557293-0d53-4140-81b6-3e162776b7fd\",\"owner\":[],\"postedDate\":\"April 1st, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2025-05-14T14:23:06+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-04-01 07:34:26\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6267468\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6267468\",\"identity\":\"rs-6267468\",\"version\":[\"v1\"]},\"buildId\":\"8U1c8b4HqxoKbykW_rLl7\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}