{"paper_id":"1c469aac-e99c-48dd-aa1c-a528b3c6da45","body_text":"Suxiao jiuxin pill protects endothelial cells from oxidative stress-induced apoptosis via Nrf2/HO-1 pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Suxiao jiuxin pill protects endothelial cells from oxidative stress-induced apoptosis via Nrf2/HO-1 pathway Zhijuan Fan, Yaqiong Tian, Bojiang Liu, Meng Ning, Jin Wei, Lingfang Zeng, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4856576/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Abstract Background Reactive oxygen species (ROS) are implicated in the pathogenesis of cardiovascular diseases (CVDs). Suxiao Jiuxin Pill (SX), a traditional Chinese medicine, has emerged as a promising herbal remedy with demonstrated efficacy in ameliorating cardiovascular pathology and improving clinical outcomes. Although SX exhibits significant antioxidant activities, the underlying mechanism remains unclear. Methods We utilized a mouse endothelial cell line, C166, to investigate the role of SX in regulation of oxidative stress. Hydrogen peroxide (H2O2) was employed to induce cell apoptosis. Cells were sequentially treated with SX, specific inhibitors, and H2O2. RT-qPCR and Western blot analyses were performed to evaluate changes at the mRNA and protein levels, respectively. Results SX demonstrated protective effects against H2O2-induced apoptosis in endothelial cells (ECs). Both the mRNA and protein levels of heme oxygenase-1 (HO-1) increased in response to SX treatment. Importantly, the protective role of SX in ECs was abolished by the HO-1 inhibitor Zinc protoporphyrin IX (ZnPP). Treatment with actinomycin D and cycloheximide revealed that SX upregulated HO-1 expression via de novo synthesis, and Nrf2 was verified as the main mediator. Furthermore, degradation of Nrf2 by its specific inhibitor, brusatol, reversed the protective effects of SX on ECs under oxidative stress. Conclusion SX plays a crucial role in protecting ECs from oxidative stress-induced apoptosis through activation of the Nrf2/HO-1 pathway. The protective effect of SX is dependent on HO-1 function, and inhibition of either Nrf2 or HO-1 effectively blocks the protective effect of SX. Suxiao jiuxin pill oxidative stress Nrf2 HO-1 endothelial cell Figures Figure 1 Figure 2 Introduction Oxidative stress-induced endothelial dysfunction plays a pivotal role in the progression of cardiovascular disease (CVD). This condition, characterized by an imbalance between reactive oxygen species (ROS) production and antioxidant defense mechanisms, mediates vascular injury through several key mechanisms. These include impaired nitric oxide bioavailability, which is essential for vascular homeostasis, as well as enhanced vascular inflammation and increased endothelial permeability. Additionally, the oxidative modification of lipids, proteins, and nucleic acids within the arterial wall not only promotes the formation of atherosclerotic plaques but also exacerbates plaque instability, rendering them more susceptible to rupture. Such events precipitate acute cardiovascular incidents, including myocardial infarction and stroke. Traditional Chinese Medicine (TCM) has garnered increasing interest as a potential adjunctive approach in the management of CVD, offering unique insights and therapeutic strategies rooted in centuries-old wisdom. Among the myriad of TCM formulations, the Suxiao Jiuxin Pill (SX) stands out as a promising herbal remedy with demonstrated efficacy in ameliorating cardiovascular pathology and improving clinical outcomes[ 1 ]. Composed of Ligusticum chuanxiong Hort and Borneolum syntheticum , with main chemical constituents including phthalides, phenolic acids, alkaloids, and borneol, SX exerts multiple therapeutic effects on the cardiovascular system[ 2 ]. Notably, SX exhibits significant antioxidant activities, scavenging ROS and reducing oxidative stress-induced vascular damage, which plays a pivotal role in the pathogenesis of CVD[ 3 ]. Despite these promising effects, the precise mechanisms underlying the cardiovascular benefits of SX remain to be fully elucidated. Heme oxygenase-1 (HO-1), an antioxidant enzyme upregulated in response to oxidative stress, emerges as a pivotal regulator of endothelial function, exerting multifaceted protective effects against vascular injury and dysfunction[ 4 ]. This rate-limiting enzyme in heme catabolism converts heme into biliverdin, carbon monoxide (CO), and free iron, thereby conferring cytoprotective and anti-inflammatory properties. By maintaining redox balance and preserving endothelial cell integrity, HO-1 mitigates oxidative stress-induced endothelial dysfunction and vascular injury. Enhancing HO-1 expression and activity, whether through pharmacological agents or lifestyle interventions, holds significant promise for restoring endothelial function, attenuating vascular inflammation, and preventing cardiovascular complications. In this study, we demonstrate that SX protects endothelial cells (ECs) from hydrogen peroxide (H 2 O 2 )-induced oxidative stress through activation of the Nrf2/HO-1 pathway. Our findings reveal that the protective effects of SX are critically dependent on the functional activity of heme oxygenase-1 (HO-1). Specifically, the use of the HO-1 activity inhibitor zinc protoporphyrin IX (ZnPP) or the Nrf2 inhibitor brusatol effectively abolishes the cytoprotective effects conferred by SX. These results underscore the central role of the Nrf2/HO-1 axis in mediating the antioxidative and vascular protective properties of SX. Materials and Methods Materials All cell culture related reagents and media were purchased from ThermoFisher. Primary antibody: HO-1 (Abcam, ab189491, 32 kDa), Nrf2 (R&D systems, af3925, 68kD), GAPDH (Santa Cruz, sc-25778, 38 kDa), Bach1 (Santa Cruz, sc-365708, 140 kDa), C-Jun (Santa Cruz, sc-74543, 39kDa), p-c-Jun (Santa Cruz, sc-16312, 39kDa), HDAC3 (Abcam, ab32369, 49 kDa). Secondary antibody: Rabbit anti Mouse HRP (Agilent Dako, P026002-2), Rabbit anti Goat HRP (Agilent Dako, P044901-2), Swine anti Rabbit HRP (Agilent Dako, P021702-2). Preparation of SX SX was purchased from the Sixth Chinese Drugs Factory of Tianjin Zhongxin Pharmaceutical (China, Batch No. 617139). The SX quality control adhered to the specifications and test procedures as described in the Pharmacopoeia of the People’s Republic of China (Pharmacopoeia of the People’s Republic of China, Suxiao Jiuxin Pills, 2015). SX was dissolved in PBS at 100mg/ml as stock solution, and stored at 4ºC for later use within one week. Cell culture Mouse C166 cells (endothelial cell line, CRL-2581) were cultured in Dulbecco’s modified eagle media (DMEM; low glucose, Gibco) supplemented with 10% FBS (Gibco), L-glutamine (2mM, Gibco), penicillin (100U/mL) and streptomycin (100µg/mL), and passaged at ratio 1:4 every two days by 0.05% Trypsin-EDTA digestion. SX and H 2 O 2 treatment C166 cells at 70% confluence were subjected to overnight starvation in DMEM containing 0.5% FBS. Subsequently, the cells were treated with SX at specified concentrations for 1 hour, followed by exposure to 200 µM H 2 O 2 for an additional 4 hours for functional analyses or 24 hours for cell survival assessments. Inhibitors treatment Starved C166 cells were pretreated with 200 µg/mL SX for 1 hour, followed by a final concentration of 10 µM ZnPP (Santa Cruz, sc-200329), 1 µg/mL Actinomycin D (Sigma, A9415), 50 µg/mL cycloheximide (Sigma, 01810), or 100 nM brusatol (Sigma, SML1868) for 1 hour. Following this pretreatment, cells were exposed to 200 µM H 2 O 2 . DMSO was used as the control vehicle. Cell survival assessment C166 cells were seeded in 6-well plates at a density of 2×10 4 cells per well in 2 mL of medium and cultured until 70% confluence. Following the sequential addition of inhibitors and SX, cells were subjected to overnight starvation and subsequently treated with H 2 O 2 for 24 hours to induce apoptosis. After a brief wash with warm PBS, cells were fixed with 4% paraformaldehyde (PFA), and images were captured using a 200× inverted microscope for cell counting. Quantitative reverse transcription-PCR (qRT-PCR) RNA was extracted from cell pellets using the RNeasy Kit (Qiagen). The RNA concentration was measured with a Nanodrop spectrophotometer and adjusted to 150 ng/µL with RNase-free water. Reverse transcription was then performed using the QuantiTect RT Kit (Qiagen) with a random primer mix (New England Biolabs) and RNasin® Ribonuclease Inhibitor (Promega) according to the manufacturers' instructions. The resulting cDNA concentration was adjusted to 10 ng/µL (relative to RNA amount), and 1 µL of cDNA was used as a template for each PCR reaction. Quantitative PCR was conducted using qPCRBIO SyGreen Blue Mix (PCR Biosystems Ltd, PB20.16-05). The quality of the primer sets was verified by electrophoresis under the same conditions as the qPCR and by checking the melting curve in each run. The PCR reaction protocol was as follows: initial denaturation at 95°C for 2 minutes, followed by 40 cycles of denaturation at 95°C for 5 seconds and annealing/extension at 60°C for 30 seconds. The primers used were: Hmox1 (tgctagcctggtgcaagatac vs ggtgagggaactgtgtcagg), Gclc (aggacaaaccccaaccatccg vs aagagggactttgatgcgcc), Gclm (tttggaatgcaccatgtccc vs tactattgggttttacctgtgcc), Nqo1 (acaacggtcctttccagaataag vs cagaaacgcaggatgccact), Nfe2l2 (agatgaccatgagtcgcttgc vs ccagcgaggagatcgatgag) and β-actin (cacacctgggacgacatggag vs ttcatgaggtagtgagtctgg). Western blot (WB) Western blotting was performed following standard protocols. Briefly, proteins were resolved on self-prepared 10–12% Tris-SDS polyacrylamide gels using Tris-Glycine-SDS running buffer. Protein transfer was conducted with Tris-Glycine-Methanol transfer buffer in a Mini Blot Module (B1000, ThermoFisher) onto 0.2 µm PVDF membranes. The membranes were briefly washed in 0.1% TBST, blocked with 5% non-fat milk in TBST for 1 hour, washed again in TBST followed by distilled water, and then incubated with primary antibodies overnight at 4ºC. The following day, membranes were washed three times for 10 minutes each in TBST, incubated with secondary antibodies for 2 hours, and washed again three times in TBST. Protein bands were visualized using enhanced chemiluminescence (ECL) and X-ray film. Statistical analysis Data were characterized as mean ± standard error of the mean (SEM). All analyses were performed using GraphPad Prism 8 software, employing one-way or two-way analysis of variance (ANOVA) followed by Dunnett’s multiple comparison tests. Statistical significance was indicated by asterisks, with *: p < 0.05, **: p < 0.01, ***: p < 0.001, and ns: no significant difference. A p-value of less than 0.05 was considered statistically significant. Results and discussion SX protects ECs from H 2 O 2 -induced apoptosis by upregulating the expression of HO-1 The generation of ROS in ECs arises from various mechanisms and sources, prominently involving NADPH oxidase activation, mitochondrial dysfunction, xanthine oxidase activity, and uncoupled nitric oxide synthases. ROS, derived from molecular oxygen, result from redox reactions or electronic excitation processes. Among ROS, H 2 O 2 stands out as the principal redox metabolite[ 5 ], functioning as a signaling molecule at low concentrations while inducing oxidative damage to lipids, proteins, and DNA at higher concentrations, consequently leading to endothelial dysfunction and cell death. Suxiao Jiuxin Pill (SX) has been shown to enhance the activity of superoxide dismutase (SOD)[ 3 ], a critical endogenous source of H 2 O 2 [ 6 ]. Building upon this foundation, we aimed to investigate the impact of SX on H 2 O 2 -induced apoptosis in ECs. As expected, SX demonstrated a protective effect against oxidative stress-induced apoptosis in ECs, as evidenced by cell survival assessment following H 2 O 2 treatment (Fig. 1 A). Numerous signaling pathways play pivotal roles in regulating oxidative stress, with Nrf2/HO-1 among the most prominent. Upregulation of these pathways has been observed in various herbal medicine formulations, including Xueshuan Xinmaining tablet (XXT), Huoxue capsule (HXC), and Korean red ginseng (KRG)[ 7 ]. Notably, several key ingredients of SX, such as Z-ligustilide[ 8 ] and tetramethylpyrazine[ 9 ], have demonstrated cardiovascular protective effects by upregulating HO-1. Thus, it is plausible to investigate whether the protective role of SX is mediated through the upregulation of HO-1 under H 2 O 2 treatment. Remarkably, different concentrations of SX ranging from 0 to 200 µg/mL dose-dependently upregulate the expression of HO-1 at both the mRNA (Fig. 1 B) and protein levels (Fig. 1 C). HO-1 exerts potent anti-apoptotic effects by cleaving heme to release CO and activating p38 MAPK[ 10 ]. To ascertain whether the anti-apoptotic effect of SX is dependent on HO-1 activity, we examined the specific inhibition of HO-1 function using its inhibitor, zinc protoporphyrin IX (ZnPP). Indeed, ZnPP abrogated the ability of SX to preserve endothelial cell survival in H 2 O 2 -induced apoptosis (Fig. 1 D), indicating that the anti-apoptotic function of SX in oxidative stress relies on HO-1 activity. SX upregulates HO-1’s expression from de novo synthesis. The upregulation of a protein can occur through various mechanisms, including increasing mRNA levels by enhancing transcription or inhibiting degradation, and increasing protein levels through enhanced translation or promotion of post-translational modifications. To determine the regulatory mechanism involved, we employed actinomycin D to inhibit RNA synthesis by targeting DNA-dependent RNA polymerase, and cycloheximide to block protein synthesis by suppressing translation elongation. Prior to the addition of inhibitors and H₂O₂, treatment with SX resulted in enhanced expression of HO-1, consistent with previous findings. However, both actinomycin D and cycloheximide abolished the H₂O₂-induced further elevation of HO-1 at both mRNA (Fig. 2 A) and protein levels (Fig. 2 B), suggesting that SX-upregulated HO-1 was the result of de novo biosynthesis at both the transcription and translation stages. Interestingly, cycloheximide increased the basal level of Hmox-1 mRNA, possibly due to mRNA stabilization by ribosomes under conditions of translation inhibition. SX upregulates HO-1 via Nrf2 . A range of transcription factors have been implicated in the transcriptional regulation of Hmox1 . Notably, the most robust transcription factors in the presence of H 2 O 2 include Nrf2/Bach1 and the activator protein-1 (AP-1) family. These factors bind to three major areas approximately 0.5kb and 4kb upstream of the Hmox1 promoter region[ 11 ]. To identify the key mediator, we assessed the expression levels of these transcription factors using western blotting. Remarkably, the protein levels of Nrf2 (Fig. 2 C) were upregulated in the presence of SX. Under normal conditions, Nrf2 is ubiquitinated by the Keap1-Cul3 complex and degraded by the 26S proteasome, resulting in a short half-life of approximately 10–30 minutes. However, during oxidative stress, the interaction of reactive oxygen species (ROS) with cysteine sensors in Keap1 diminishes the activity of Keap1, allowing Nrf2 to dissociate from the Keap1-Cul3 complex and escape degradation. Subsequently, the increased Nrf2 is translocated into the nucleus[ 12 ] and activates the transcription of a series of antioxidant genes, including Hmox1 , as well as Nqo1 , Gclc , and Gclm (Fig. S1 ). Notably, no significant increase in the mRNA level of Nrf2 was observed, suggesting that the increase in Nrf2 was primarily due to internal translation initiation[ 13 ] and prevention from ubiquitination and degradation[ 12 ]. The protein level of BACH1 tends to increase in the presence of SX and H 2 O 2 , possibly due to upregulated HO-1-induced heme degradation. In addition to Nrf2, the amount of c-Jun, a member of the Jun family that forms the AP-1 early response transcription factor in combination with c-Fos, was also slightly upregulated. However, no obvious change was observed in the phosphorylation state of c-Jun, which typically initiates AP-1 activation[ 14 ]. To assess the role of Nrf2 in the upregulation of HO-1 by SX, we utilized the Nrf2-specific inhibitor, brusatol, known for enhancing Nrf2 ubiquitination and degradation[ 15 ]. Remarkably, brusatol completely abolished the SX-induced upregulation of HO-1 (Fig. 2 D). Consistent with the decreased expression of HO-1, the protective effect of SX on endothelial cells was also abolished (Fig. 2 E), indicating that SX protects ECs in a manner dependent on Nrf2-mediated upregulation of HO-1. Conclusion In conclusion, our study reveals that SX exerts a protective effect on endothelial cells against oxidative stress-induced apoptosis. Importantly, we demonstrate for the first time that this effect is dependent on the Nrf2/HO-1 pathway. Our findings indicate that inhibition of either Nrf2 or HO-1 can effectively reverse the protective effect of SX. These results highlight the significance of the Nrf2/HO-1 pathway in mediating the protective effects of SX against oxidative stress-induced endothelial cell apoptosis. Declarations Conflicts of Interest The authors have no conflicts of interest to declare. Ethics approval Not applicable Consent to participate All authors have agreed to take personal responsibility for their contributions. Consent for publication All authors have checked and approved the final version of manuscript before submission. Funding This project was supported by Tianjin Municipal Health Commission project grant KJ20151 (F.Z.), project grant 2017061 (Z.Y.), Tianjin key medical discipline construction (Specialty) project (TJYXZDXK-047A and TJYXZDXK-035A). Authors’ Contributions Z.F., Y.T., B.L., M.N., J.W., and Y.Z. contributed to experimental design, performance, and data analysis. L.Z., Y.Z., and M.Z. contributed to experimental design, data analysis and manuscript writing. Availability of data and material Not applicable Code availability Not applicable References Jia Y, Leung SW. The efficacy of Chinese herbal drugs for adults with angina pectoris: Bayesian network meta-analysis of 331 RCTs involving 36,467 individuals. J Ethnopharmacol. 2024;326:117925. 10.1016/j.jep.2024.117925 . Lei W, Ni J, Xia X, Jiang M, Bai G. Searching for synergistic calcium antagonists and novel therapeutic regimens for coronary heart disease therapy from a Traditional Chinese Medicine, Suxiao Jiuxin Pill. J Chromatogr B Analyt Technol Biomed Life Sci. 2018;1092:220–7. 10.1016/j.jchromb.2018.06.015 . Li CS, Qu ZQ, Wang SS, et al. Effects of suxiao jiuxin pill (see test) on oxidative stress and inflammatory response in rats with experimental atherosclerosis. J Tradit Chin Med. 2011;31(2):107–11. 10.1016/s0254-6272(11)60022-8 . Raghunandan S, Ramachandran S, Ke E, et al. Heme Oxygenase-1 at the Nexus of Endothelial Cell Fate Decision Under Oxidative Stress. Front Cell Dev Biol. 2021;9:702974. 10.3389/fcell.2021.702974 . Chance B, Sies H, Boveris A. Hydroperoxide metabolism in mammalian organs. Physiol Rev. 1979;59(3):527–605. 10.1152/physrev.1979.59.3.527 . Zhao RZ, Jiang S, Zhang L, Yu ZB. Mitochondrial electron transport chain, ROS generation and uncoupling (Review). Int J Mol Med. 2019;44(1):3–15. 10.3892/ijmm.2019.4188 . Zhang Q, Liu J, Duan H, et al. Activation of Nrf2/HO-1 signaling: An important molecular mechanism of herbal medicine in the treatment of atherosclerosis via the protection of vascular endothelial cells from oxidative stress. J Adv Res. 2021;34:43–63. 10.1016/j.jare.2021.06.023 . Choi ES, Yoon JJ, Han BH, et al. Ligustilide attenuates vascular inflammation and activates Nrf2/HO-1 induction and, NO synthesis in HUVECs. Phytomedicine. 2018;38:12–23. 10.1016/j.phymed.2017.09.022 . Zhang X, Hu H, Luo J, et al. A Novel Danshensu-Tetramethylpyrazine Conjugate DT-010 Provides Cardioprotection through the PGC-1alpha/Nrf2/HO-1 Pathway. Biol Pharm Bull. 2017;40(9):1490–8. 10.1248/bpb.b17-00313 . Brouard S, Otterbein LE, Anrather J, et al. Carbon monoxide generated by heme oxygenase 1 suppresses endothelial cell apoptosis. J Exp Med. 2000;192(7):1015–26. 10.1084/jem.192.7.1015 . Consoli V, Sorrenti V, Grosso S, Vanella L. Heme Oxygenase-1 Signaling and Redox Homeostasis in Physiopathological Conditions. Biomolecules. 2021;11(4). 10.3390/biom11040589 . Canning P, Sorrell FJ, Bullock AN. Structural basis of Keap1 interactions with Nrf2. Free Radic Biol Med. 2015;88(Pt B):101–7. 10.1016/j.freeradbiomed.2015.05.034 . Li W, Thakor N, Xu EY, et al. An internal ribosomal entry site mediates redox-sensitive translation of Nrf2. Nucleic Acids Res. 2010;38(3):778–88. 10.1093/nar/gkp1048 . Meng Q, Xia Y. c-Jun, at the crossroad of the signaling network. Protein Cell. 2011;2(11):889–98. 10.1007/s13238-011-1113-3 . Ren D, Villeneuve NF, Jiang T, et al. Brusatol enhances the efficacy of chemotherapy by inhibiting the Nrf2-mediated defense mechanism. Proc Natl Acad Sci U S A. 2011;108(4):1433–8. 10.1073/pnas.1014275108 . Supplementary Files Supplementalfigure.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-4856576\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Short Report\",\"associatedPublications\":[],\"authors\":[{\"id\":342085317,\"identity\":\"8eac764a-efca-4201-b298-78605fdd2fdc\",\"order_by\":0,\"name\":\"Zhijuan Fan\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tianjin Third Central Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zhijuan\",\"middleName\":\"\",\"lastName\":\"Fan\",\"suffix\":\"\"},{\"id\":342085318,\"identity\":\"47dc5f65-93db-4561-8873-c1b1c486f0c8\",\"order_by\":1,\"name\":\"Yaqiong Tian\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tianjin Third Central Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Yaqiong\",\"middleName\":\"\",\"lastName\":\"Tian\",\"suffix\":\"\"},{\"id\":342085319,\"identity\":\"e140c904-1315-4550-8113-7790aa724a4f\",\"order_by\":2,\"name\":\"Bojiang Liu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tianjin Third Central Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Bojiang\",\"middleName\":\"\",\"lastName\":\"Liu\",\"suffix\":\"\"},{\"id\":342085320,\"identity\":\"6b1cf5f5-ad42-495f-beef-a2020d31de65\",\"order_by\":3,\"name\":\"Meng Ning\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tianjin Third Central Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Meng\",\"middleName\":\"\",\"lastName\":\"Ning\",\"suffix\":\"\"},{\"id\":342085321,\"identity\":\"6de34ff8-4ec5-4734-b9cb-2608416a3e4b\",\"order_by\":4,\"name\":\"Jin Wei\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Tianjin Third Central Hospital\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Jin\",\"middleName\":\"\",\"lastName\":\"Wei\",\"suffix\":\"\"},{\"id\":342085322,\"identity\":\"38bf026e-0efd-42d2-af8d-20d8e94f86e4\",\"order_by\":5,\"name\":\"Lingfang Zeng\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"King's College London Cardiovascular Division: King's College London School of Cardiovascular and Metabolic Medicine \\u0026 Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lingfang\",\"middleName\":\"\",\"lastName\":\"Zeng\",\"suffix\":\"\"},{\"id\":342085323,\"identity\":\"b2b09755-c51c-4b1f-8f6b-84ea57a665fd\",\"order_by\":6,\"name\":\"yue zhao\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4klEQVRIie3RvQrCMBSG4U8CnYKucdJLONJV8VYaAk71B1ycpODgUnDtpLdQ6Q1UCrrUvaMiOAsuHY06uKW6OeRdAiFPOCGAzfansRLw9JIBk/dGNcGLOAqg3wh3vyNUqJRNMB81luGdSkKrEXCXzGTgsQjOVOTHRIaETpRy1zMTn8DBZVAMk0wPVov1hKmZjG+aCLkp/MuT9L8gPhgHybjwmdJEPolxsGZ+pV1Entzme7cTklBR5kyNz68f1Pl0m83l+rC4iHLW7a2Wi0SYSFuPneJzq6j+yFZQccBms9lseAD7JkRC5rdSYwAAAABJRU5ErkJggg==\",\"orcid\":\"https://orcid.org/0000-0002-6818-2352\",\"institution\":\"King's College London School of Cardiovascular and Metabolic Medicine \\u0026 Sciences\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"yue\",\"middleName\":\"\",\"lastName\":\"zhao\",\"suffix\":\"\"},{\"id\":342085324,\"identity\":\"88bf9033-313d-4369-aeb1-34038dc896e3\",\"order_by\":7,\"name\":\"Min Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"King's College London Cardiovascular Division: King's College London School of Cardiovascular and Metabolic Medicine \\u0026 Sciences\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Min\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-08-04 11:23:09\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-4856576/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-4856576/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":64608080,\"identity\":\"e89048b2-b20b-49df-ba8d-d74ac1d233be\",\"added_by\":\"auto\",\"created_at\":\"2024-09-16 13:21:38\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1490158,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSX protects ECs from H\\u003c/strong\\u003e\\u003csub\\u003e\\u003cstrong\\u003e2\\u003c/strong\\u003e\\u003c/sub\\u003e\\u003cstrong\\u003eO\\u003c/strong\\u003e\\u003csub\\u003e\\u003cstrong\\u003e2\\u003c/strong\\u003e\\u003c/sub\\u003e\\u003cstrong\\u003e-induced apoptosis via activation of HO-1.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e(A\\u003c/strong\\u003e) Mouse C166 ECs were subjected to 200µg/ml SX for 2 hours, followed by 200µM H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e treatment for another 24 hours. Representative cell images (left) and quantification (right) were shown. scale bar: 50µm. n=6. \\u003cstrong\\u003e(B\\u0026amp;C)\\u003c/strong\\u003e Overnight starved ECs were subjected to 0, 50, 100 and 200µg/ml SX treatment for 4 hours, followed by qRT-PCR analysis of \\u003cem\\u003eHmox1\\u003c/em\\u003e \\u003cstrong\\u003e(B)\\u003c/strong\\u003e and WB of HO-1 \\u003cstrong\\u003e(C)\\u003c/strong\\u003e. The fold of induction was defined as the ratio of HO-1 to GAPDH comparing with 0 SX group. n=3. \\u003cstrong\\u003e(D)\\u003c/strong\\u003e ECs were subjected to 200µg/ml SX for 1 hours, followed by the addition of 10 µM ZnPP for another 1 hour, and then treated with 200µM H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e for 24 hours. Representative cell images (left) and quantification (right) were shown. scale bar: 50µm. n=6. Data presented were representative images or mean ± SEM using one-way or two-way ANOVA with GraphPad Prism 8 multiple comparison test.\\u0026nbsp; *: p\\u0026lt;0.05, **: p\\u0026lt;0.01, ***: p\\u0026lt;0.001.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4856576/v1/62a586df6d1713e31c0109bd.jpg\"},{\"id\":64608082,\"identity\":\"c558cf3a-1e71-438a-b0bf-9b33385ee1f8\",\"added_by\":\"auto\",\"created_at\":\"2024-09-16 13:21:38\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1573888,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eSX upregulates HO-1 via Nrf2.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e(A\\u0026amp;B)\\u003c/strong\\u003e ECs were subjected to 200µg/ml SX for 1 hour, followed by the addition of 1 µg/mL Actinomycin D, or 50 µg/mL cycloheximide for another 1 hour, and then treated with 200µM H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e for 4 hours, followed by qRT-PCR analysis of \\u003cem\\u003eHmox1\\u003c/em\\u003e \\u003cstrong\\u003e(A)\\u003c/strong\\u003e and WB of HO-1 \\u003cstrong\\u003e(B)\\u003c/strong\\u003e. The fold of induction was defined as the ratio of HO-1 to GAPDH comparing with Null H\\u003csub\\u003e2\\u003c/sub\\u003eO group. n=4. \\u003cstrong\\u003e(C)\\u003c/strong\\u003e ECs were treated with 200µg/ml SX for 2 hours, then subjected to 200µM H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e treatment for another 4 hours, followed by WB analysis. The fold of induction was defined as the ratio of target genes to \\u003cem\\u003eGapdh\\u003c/em\\u003e comparing with Null H\\u003csub\\u003e2\\u003c/sub\\u003eO group. n=3. \\u003cstrong\\u003e(D\\u0026amp;E)\\u003c/strong\\u003e ECs were subjected to 200µg/ml SX for 1 hours, followed by the addition of 100 nM brusatol for another 1 hour, and then treated with 200µM H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e for 4 hours with WB analysis \\u003cstrong\\u003e(D)\\u003c/strong\\u003e or 24 hours with cell number counting \\u003cstrong\\u003e(E)\\u003c/strong\\u003e. DMSO was used as a solvent control. n=6. Data presented were representative images or mean ± SEM using two-way ANOVA with GraphPad Prism 8 multiple comparison test.\\u0026nbsp; *: p\\u0026lt;0.05, **: p\\u0026lt;0.01, ***: p\\u0026lt;0.001, ns: no significant difference.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4856576/v1/541176d5d0b3693132d8b4c9.jpg\"},{\"id\":65028733,\"identity\":\"140c8d70-7ee9-4f80-905c-5fe0789951b4\",\"added_by\":\"auto\",\"created_at\":\"2024-09-22 19:32:30\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":3558020,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4856576/v1/aa2a830f-fb1e-4499-9a3c-783eae034b1d.pdf\"},{\"id\":64608079,\"identity\":\"26b9c112-754e-44ef-aa41-3d1b2f558eee\",\"added_by\":\"auto\",\"created_at\":\"2024-09-16 13:21:38\",\"extension\":\"pdf\",\"order_by\":6,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":44000,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Supplementalfigure.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-4856576/v1/0a6a0bbd4a970470d9cfb154.pdf\"}],\"financialInterests\":\"\",\"formattedTitle\":\"Suxiao jiuxin pill protects endothelial cells from oxidative stress-induced apoptosis via Nrf2/HO-1 pathway\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eOxidative stress-induced endothelial dysfunction plays a pivotal role in the progression of cardiovascular disease (CVD). This condition, characterized by an imbalance between reactive oxygen species (ROS) production and antioxidant defense mechanisms, mediates vascular injury through several key mechanisms. These include impaired nitric oxide bioavailability, which is essential for vascular homeostasis, as well as enhanced vascular inflammation and increased endothelial permeability. Additionally, the oxidative modification of lipids, proteins, and nucleic acids within the arterial wall not only promotes the formation of atherosclerotic plaques but also exacerbates plaque instability, rendering them more susceptible to rupture. Such events precipitate acute cardiovascular incidents, including myocardial infarction and stroke.\\u003c/p\\u003e \\u003cp\\u003eTraditional Chinese Medicine (TCM) has garnered increasing interest as a potential adjunctive approach in the management of CVD, offering unique insights and therapeutic strategies rooted in centuries-old wisdom. Among the myriad of TCM formulations, the Suxiao Jiuxin Pill (SX) stands out as a promising herbal remedy with demonstrated efficacy in ameliorating cardiovascular pathology and improving clinical outcomes[\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. Composed of \\u003cem\\u003eLigusticum chuanxiong\\u003c/em\\u003e Hort and \\u003cem\\u003eBorneolum syntheticum\\u003c/em\\u003e, with main chemical constituents including phthalides, phenolic acids, alkaloids, and borneol, SX exerts multiple therapeutic effects on the cardiovascular system[\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e]. Notably, SX exhibits significant antioxidant activities, scavenging ROS and reducing oxidative stress-induced vascular damage, which plays a pivotal role in the pathogenesis of CVD[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. Despite these promising effects, the precise mechanisms underlying the cardiovascular benefits of SX remain to be fully elucidated.\\u003c/p\\u003e \\u003cp\\u003eHeme oxygenase-1 (HO-1), an antioxidant enzyme upregulated in response to oxidative stress, emerges as a pivotal regulator of endothelial function, exerting multifaceted protective effects against vascular injury and dysfunction[\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. This rate-limiting enzyme in heme catabolism converts heme into biliverdin, carbon monoxide (CO), and free iron, thereby conferring cytoprotective and anti-inflammatory properties. By maintaining redox balance and preserving endothelial cell integrity, HO-1 mitigates oxidative stress-induced endothelial dysfunction and vascular injury. Enhancing HO-1 expression and activity, whether through pharmacological agents or lifestyle interventions, holds significant promise for restoring endothelial function, attenuating vascular inflammation, and preventing cardiovascular complications.\\u003c/p\\u003e \\u003cp\\u003eIn this study, we demonstrate that SX protects endothelial cells (ECs) from hydrogen peroxide (H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e)-induced oxidative stress through activation of the Nrf2/HO-1 pathway. Our findings reveal that the protective effects of SX are critically dependent on the functional activity of heme oxygenase-1 (HO-1). Specifically, the use of the HO-1 activity inhibitor zinc protoporphyrin IX (ZnPP) or the Nrf2 inhibitor brusatol effectively abolishes the cytoprotective effects conferred by SX. These results underscore the central role of the Nrf2/HO-1 axis in mediating the antioxidative and vascular protective properties of SX.\\u003c/p\\u003e\"},{\"header\":\"Materials and Methods\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eMaterials\\u003c/h2\\u003e \\u003cp\\u003eAll cell culture related reagents and media were purchased from ThermoFisher. Primary antibody: HO-1 (Abcam, ab189491, 32 kDa), Nrf2 (R\\u0026amp;D systems, af3925, 68kD), GAPDH (Santa Cruz, sc-25778, 38 kDa), Bach1 (Santa Cruz, sc-365708, 140 kDa), C-Jun (Santa Cruz, sc-74543, 39kDa), p-c-Jun (Santa Cruz, sc-16312, 39kDa), HDAC3 (Abcam, ab32369, 49 kDa). Secondary antibody: Rabbit anti Mouse HRP (Agilent Dako, P026002-2), Rabbit anti Goat HRP (Agilent Dako, P044901-2), Swine anti Rabbit HRP (Agilent Dako, P021702-2).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec4\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003ePreparation of SX\\u003c/h2\\u003e \\u003cp\\u003eSX was purchased from the Sixth Chinese Drugs Factory of Tianjin Zhongxin Pharmaceutical (China, Batch No. 617139). The SX quality control adhered to the specifications and test procedures as described in the Pharmacopoeia of the People\\u0026rsquo;s Republic of China (Pharmacopoeia of the People\\u0026rsquo;s Republic of China, Suxiao Jiuxin Pills, 2015). SX was dissolved in PBS at 100mg/ml as stock solution, and stored at 4\\u0026ordm;C for later use within one week.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec5\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell culture\\u003c/h2\\u003e \\u003cp\\u003eMouse C166 cells (endothelial cell line, CRL-2581) were cultured in Dulbecco\\u0026rsquo;s modified eagle media (DMEM; low glucose, Gibco) supplemented with 10% FBS (Gibco), L-glutamine (2mM, Gibco), penicillin (100U/mL) and streptomycin (100\\u0026micro;g/mL), and passaged at ratio 1:4 every two days by 0.05% Trypsin-EDTA digestion.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec6\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSX and H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e treatment\\u003c/h2\\u003e \\u003cp\\u003eC166 cells at 70% confluence were subjected to overnight starvation in DMEM containing 0.5% FBS. Subsequently, the cells were treated with SX at specified concentrations for 1 hour, followed by exposure to 200 \\u0026micro;M H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e for an additional 4 hours for functional analyses or 24 hours for cell survival assessments.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec7\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eInhibitors treatment\\u003c/h2\\u003e \\u003cp\\u003eStarved C166 cells were pretreated with 200 \\u0026micro;g/mL SX for 1 hour, followed by a final concentration of 10 \\u0026micro;M ZnPP (Santa Cruz, sc-200329), 1 \\u0026micro;g/mL Actinomycin D (Sigma, A9415), 50 \\u0026micro;g/mL cycloheximide (Sigma, 01810), or 100 nM brusatol (Sigma, SML1868) for 1 hour. Following this pretreatment, cells were exposed to 200 \\u0026micro;M H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e. DMSO was used as the control vehicle.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eCell survival assessment\\u003c/h2\\u003e \\u003cp\\u003eC166 cells were seeded in 6-well plates at a density of 2\\u0026times;10\\u003csup\\u003e4\\u003c/sup\\u003e cells per well in 2 mL of medium and cultured until 70% confluence. Following the sequential addition of inhibitors and SX, cells were subjected to overnight starvation and subsequently treated with H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e for 24 hours to induce apoptosis. After a brief wash with warm PBS, cells were fixed with 4% paraformaldehyde (PFA), and images were captured using a 200\\u0026times; inverted microscope for cell counting.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec9\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eQuantitative reverse transcription-PCR (qRT-PCR)\\u003c/h2\\u003e \\u003cp\\u003eRNA was extracted from cell pellets using the RNeasy Kit (Qiagen). The RNA concentration was measured with a Nanodrop spectrophotometer and adjusted to 150 ng/\\u0026micro;L with RNase-free water. Reverse transcription was then performed using the QuantiTect RT Kit (Qiagen) with a random primer mix (New England Biolabs) and RNasin\\u0026reg; Ribonuclease Inhibitor (Promega) according to the manufacturers' instructions. The resulting cDNA concentration was adjusted to 10 ng/\\u0026micro;L (relative to RNA amount), and 1 \\u0026micro;L of cDNA was used as a template for each PCR reaction. Quantitative PCR was conducted using qPCRBIO SyGreen Blue Mix (PCR Biosystems Ltd, PB20.16-05). The quality of the primer sets was verified by electrophoresis under the same conditions as the qPCR and by checking the melting curve in each run. The PCR reaction protocol was as follows: initial denaturation at 95\\u0026deg;C for 2 minutes, followed by 40 cycles of denaturation at 95\\u0026deg;C for 5 seconds and annealing/extension at 60\\u0026deg;C for 30 seconds.\\u003c/p\\u003e \\u003cp\\u003eThe primers used were: \\u003cem\\u003eHmox1\\u003c/em\\u003e (tgctagcctggtgcaagatac vs ggtgagggaactgtgtcagg), \\u003cem\\u003eGclc\\u003c/em\\u003e (aggacaaaccccaaccatccg vs aagagggactttgatgcgcc), \\u003cem\\u003eGclm\\u003c/em\\u003e (tttggaatgcaccatgtccc vs tactattgggttttacctgtgcc), \\u003cem\\u003eNqo1\\u003c/em\\u003e(acaacggtcctttccagaataag vs cagaaacgcaggatgccact), \\u003cem\\u003eNfe2l2\\u003c/em\\u003e (agatgaccatgagtcgcttgc vs ccagcgaggagatcgatgag) and \\u003cem\\u003eβ-actin\\u003c/em\\u003e (cacacctgggacgacatggag vs ttcatgaggtagtgagtctgg).\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec10\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eWestern blot (WB)\\u003c/h2\\u003e \\u003cp\\u003eWestern blotting was performed following standard protocols. Briefly, proteins were resolved on self-prepared 10\\u0026ndash;12% Tris-SDS polyacrylamide gels using Tris-Glycine-SDS running buffer. Protein transfer was conducted with Tris-Glycine-Methanol transfer buffer in a Mini Blot Module (B1000, ThermoFisher) onto 0.2 \\u0026micro;m PVDF membranes. The membranes were briefly washed in 0.1% TBST, blocked with 5% non-fat milk in TBST for 1 hour, washed again in TBST followed by distilled water, and then incubated with primary antibodies overnight at 4\\u0026ordm;C. The following day, membranes were washed three times for 10 minutes each in TBST, incubated with secondary antibodies for 2 hours, and washed again three times in TBST. Protein bands were visualized using enhanced chemiluminescence (ECL) and X-ray film.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eData were characterized as mean\\u0026thinsp;\\u0026plusmn;\\u0026thinsp;standard error of the mean (SEM). All analyses were performed using GraphPad Prism 8 software, employing one-way or two-way analysis of variance (ANOVA) followed by Dunnett\\u0026rsquo;s multiple comparison tests. Statistical significance was indicated by asterisks, with *: p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.05, **: p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.01, ***: p\\u0026thinsp;\\u0026lt;\\u0026thinsp;0.001, and ns: no significant difference. A p-value of less than 0.05 was considered statistically significant.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results and discussion\",\"content\":\"\\u003cdiv id=\\\"Sec13\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eSX protects ECs from H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e-induced apoptosis by upregulating the expression of HO-1\\u003c/h2\\u003e \\u003cp\\u003eThe generation of ROS in ECs arises from various mechanisms and sources, prominently involving NADPH oxidase activation, mitochondrial dysfunction, xanthine oxidase activity, and uncoupled nitric oxide synthases. ROS, derived from molecular oxygen, result from redox reactions or electronic excitation processes. Among ROS, H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e stands out as the principal redox metabolite[\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e], functioning as a signaling molecule at low concentrations while inducing oxidative damage to lipids, proteins, and DNA at higher concentrations, consequently leading to endothelial dysfunction and cell death. Suxiao Jiuxin Pill (SX) has been shown to enhance the activity of superoxide dismutase (SOD)[\\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e], a critical endogenous source of H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e[\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e]. Building upon this foundation, we aimed to investigate the impact of SX on H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e-induced apoptosis in ECs. As expected, SX demonstrated a protective effect against oxidative stress-induced apoptosis in ECs, as evidenced by cell survival assessment following H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e treatment (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eA).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003eNumerous signaling pathways play pivotal roles in regulating oxidative stress, with Nrf2/HO-1 among the most prominent. Upregulation of these pathways has been observed in various herbal medicine formulations, including Xueshuan Xinmaining tablet (XXT), Huoxue capsule (HXC), and Korean red ginseng (KRG)[\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]. Notably, several key ingredients of SX, such as Z-ligustilide[\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e] and tetramethylpyrazine[\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e], have demonstrated cardiovascular protective effects by upregulating HO-1. Thus, it is plausible to investigate whether the protective role of SX is mediated through the upregulation of HO-1 under H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e treatment. Remarkably, different concentrations of SX ranging from 0 to 200 \\u0026micro;g/mL dose-dependently upregulate the expression of HO-1 at both the mRNA (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eB) and protein levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eC). HO-1 exerts potent anti-apoptotic effects by cleaving heme to release CO and activating p38 MAPK[\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e]. To ascertain whether the anti-apoptotic effect of SX is dependent on HO-1 activity, we examined the specific inhibition of HO-1 function using its inhibitor, zinc protoporphyrin IX (ZnPP). Indeed, ZnPP abrogated the ability of SX to preserve endothelial cell survival in H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e-induced apoptosis (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig1\\\" class=\\\"InternalRef\\\"\\u003e1\\u003c/span\\u003eD), indicating that the anti-apoptotic function of SX in oxidative stress relies on HO-1 activity.\\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eSX upregulates HO-1\\u0026rsquo;s expression from de novo synthesis.\\u003c/b\\u003e \\u003c/p\\u003e \\u003cp\\u003eThe upregulation of a protein can occur through various mechanisms, including increasing mRNA levels by enhancing transcription or inhibiting degradation, and increasing protein levels through enhanced translation or promotion of post-translational modifications. To determine the regulatory mechanism involved, we employed actinomycin D to inhibit RNA synthesis by targeting DNA-dependent RNA polymerase, and cycloheximide to block protein synthesis by suppressing translation elongation. Prior to the addition of inhibitors and H₂O₂, treatment with SX resulted in enhanced expression of HO-1, consistent with previous findings. However, both actinomycin D and cycloheximide abolished the H₂O₂-induced further elevation of HO-1 at both mRNA (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eA) and protein levels (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eB), suggesting that SX-upregulated HO-1 was the result of \\u003cem\\u003ede novo\\u003c/em\\u003e biosynthesis at both the transcription and translation stages. Interestingly, cycloheximide increased the basal level of \\u003cem\\u003eHmox-1\\u003c/em\\u003e mRNA, possibly due to mRNA stabilization by ribosomes under conditions of translation inhibition.\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e \\u003cp\\u003e \\u003cb\\u003eSX upregulates HO-1 via Nrf2\\u003c/b\\u003e.\\u003c/p\\u003e \\u003cp\\u003eA range of transcription factors have been implicated in the transcriptional regulation of \\u003cem\\u003eHmox1\\u003c/em\\u003e. Notably, the most robust transcription factors in the presence of H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e include Nrf2/Bach1 and the activator protein-1 (AP-1) family. These factors bind to three major areas approximately 0.5kb and 4kb upstream of the \\u003cem\\u003eHmox1\\u003c/em\\u003e promoter region[\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e]. To identify the key mediator, we assessed the expression levels of these transcription factors using western blotting. Remarkably, the protein levels of Nrf2 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eC) were upregulated in the presence of SX. Under normal conditions, Nrf2 is ubiquitinated by the Keap1-Cul3 complex and degraded by the 26S proteasome, resulting in a short half-life of approximately 10\\u0026ndash;30 minutes. However, during oxidative stress, the interaction of reactive oxygen species (ROS) with cysteine sensors in Keap1 diminishes the activity of Keap1, allowing Nrf2 to dissociate from the Keap1-Cul3 complex and escape degradation. Subsequently, the increased Nrf2 is translocated into the nucleus[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e] and activates the transcription of a series of antioxidant genes, including \\u003cem\\u003eHmox1\\u003c/em\\u003e, as well as \\u003cem\\u003eNqo1\\u003c/em\\u003e, \\u003cem\\u003eGclc\\u003c/em\\u003e, and \\u003cem\\u003eGclm\\u003c/em\\u003e (Fig. \\u003cspan refid=\\\"MOESM1\\\" class=\\\"InternalRef\\\"\\u003eS1\\u003c/span\\u003e). Notably, no significant increase in the mRNA level of Nrf2 was observed, suggesting that the increase in Nrf2 was primarily due to internal translation initiation[\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e] and prevention from ubiquitination and degradation[\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. The protein level of BACH1 tends to increase in the presence of SX and H\\u003csub\\u003e2\\u003c/sub\\u003eO\\u003csub\\u003e2\\u003c/sub\\u003e, possibly due to upregulated HO-1-induced heme degradation. In addition to Nrf2, the amount of c-Jun, a member of the Jun family that forms the AP-1 early response transcription factor in combination with c-Fos, was also slightly upregulated. However, no obvious change was observed in the phosphorylation state of c-Jun, which typically initiates AP-1 activation[\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cp\\u003eTo assess the role of Nrf2 in the upregulation of HO-1 by SX, we utilized the Nrf2-specific inhibitor, brusatol, known for enhancing Nrf2 ubiquitination and degradation[\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. Remarkably, brusatol completely abolished the SX-induced upregulation of HO-1 (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eD). Consistent with the decreased expression of HO-1, the protective effect of SX on endothelial cells was also abolished (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig2\\\" class=\\\"InternalRef\\\"\\u003e2\\u003c/span\\u003eE), indicating that SX protects ECs in a manner dependent on Nrf2-mediated upregulation of HO-1.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eIn conclusion, our study reveals that SX exerts a protective effect on endothelial cells against oxidative stress-induced apoptosis. Importantly, we demonstrate for the first time that this effect is dependent on the Nrf2/HO-1 pathway. Our findings indicate that inhibition of either Nrf2 or HO-1 can effectively reverse the protective effect of SX. These results highlight the significance of the Nrf2/HO-1 pathway in mediating the protective effects of SX against oxidative stress-induced endothelial cell apoptosis.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\" \\u003ch2\\u003eConflicts of Interest\\u003c/h2\\u003e \\u003cp\\u003eThe authors have no conflicts of interest to declare.\\u003c/p\\u003e \\u003ch2\\u003eEthics approval\\u003c/h2\\u003e \\u003cp\\u003eNot applicable\\u003c/p\\u003e \\u003ch2\\u003eConsent to participate\\u003c/strong\\u003e \\u003cp\\u003eAll authors have agreed to take personal responsibility for their contributions.\\u003c/p\\u003e \\u003ch2\\u003eConsent for publication\\u003c/strong\\u003e \\u003cp\\u003eAll authors have checked and approved the final version of manuscript before submission.\\u003c/p\\u003e\\u003ch2\\u003eFunding\\u003c/h2\\u003e \\u003cp\\u003eThis project was supported by Tianjin Municipal Health Commission project grant KJ20151 (F.Z.), project grant 2017061 (Z.Y.), Tianjin key medical discipline construction (Specialty) project (TJYXZDXK-047A and TJYXZDXK-035A).\\u003c/p\\u003e\\u003ch2\\u003eAuthors\\u0026rsquo; Contributions\\u003c/h2\\u003e \\u003cp\\u003eZ.F., Y.T., B.L., M.N., J.W., and Y.Z. contributed to experimental design, performance, and data analysis. L.Z., Y.Z., and M.Z. contributed to experimental design, data analysis and manuscript writing.\\u003c/p\\u003e\\u003ch2\\u003eAvailability of data and material\\u003c/h2\\u003e \\u003cp\\u003eNot applicable\\u003c/p\\u003e\\u003ch2\\u003eCode availability\\u003c/h2\\u003e \\u003cp\\u003eNot applicable\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eJia Y, Leung SW. The efficacy of Chinese herbal drugs for adults with angina pectoris: Bayesian network meta-analysis of 331 RCTs involving 36,467 individuals. J Ethnopharmacol. 2024;326:117925. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.jep.2024.117925\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jep.2024.117925\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLei W, Ni J, Xia X, Jiang M, Bai G. Searching for synergistic calcium antagonists and novel therapeutic regimens for coronary heart disease therapy from a Traditional Chinese Medicine, Suxiao Jiuxin Pill. J Chromatogr B Analyt Technol Biomed Life Sci. 2018;1092:220\\u0026ndash;7. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.jchromb.2018.06.015\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jchromb.2018.06.015\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi CS, Qu ZQ, Wang SS, et al. Effects of suxiao jiuxin pill (see test) on oxidative stress and inflammatory response in rats with experimental atherosclerosis. J Tradit Chin Med. 2011;31(2):107\\u0026ndash;11. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/s0254-6272(11)60022-8\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/s0254-6272(11)60022-8\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRaghunandan S, Ramachandran S, Ke E, et al. Heme Oxygenase-1 at the Nexus of Endothelial Cell Fate Decision Under Oxidative Stress. Front Cell Dev Biol. 2021;9:702974. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fcell.2021.702974\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fcell.2021.702974\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChance B, Sies H, Boveris A. Hydroperoxide metabolism in mammalian organs. Physiol Rev. 1979;59(3):527\\u0026ndash;605. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1152/physrev.1979.59.3.527\\u003c/span\\u003e\\u003cspan address=\\\"10.1152/physrev.1979.59.3.527\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhao RZ, Jiang S, Zhang L, Yu ZB. Mitochondrial electron transport chain, ROS generation and uncoupling (Review). Int J Mol Med. 2019;44(1):3\\u0026ndash;15. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3892/ijmm.2019.4188\\u003c/span\\u003e\\u003cspan address=\\\"10.3892/ijmm.2019.4188\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang Q, Liu J, Duan H, et al. Activation of Nrf2/HO-1 signaling: An important molecular mechanism of herbal medicine in the treatment of atherosclerosis via the protection of vascular endothelial cells from oxidative stress. J Adv Res. 2021;34:43\\u0026ndash;63. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.jare.2021.06.023\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.jare.2021.06.023\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChoi ES, Yoon JJ, Han BH, et al. Ligustilide attenuates vascular inflammation and activates Nrf2/HO-1 induction and, NO synthesis in HUVECs. Phytomedicine. 2018;38:12\\u0026ndash;23. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.phymed.2017.09.022\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.phymed.2017.09.022\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZhang X, Hu H, Luo J, et al. A Novel Danshensu-Tetramethylpyrazine Conjugate DT-010 Provides Cardioprotection through the PGC-1alpha/Nrf2/HO-1 Pathway. Biol Pharm Bull. 2017;40(9):1490\\u0026ndash;8. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1248/bpb.b17-00313\\u003c/span\\u003e\\u003cspan address=\\\"10.1248/bpb.b17-00313\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBrouard S, Otterbein LE, Anrather J, et al. Carbon monoxide generated by heme oxygenase 1 suppresses endothelial cell apoptosis. J Exp Med. 2000;192(7):1015\\u0026ndash;26. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1084/jem.192.7.1015\\u003c/span\\u003e\\u003cspan address=\\\"10.1084/jem.192.7.1015\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eConsoli V, Sorrenti V, Grosso S, Vanella L. Heme Oxygenase-1 Signaling and Redox Homeostasis in Physiopathological Conditions. Biomolecules. 2021;11(4). \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3390/biom11040589\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/biom11040589\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eCanning P, Sorrell FJ, Bullock AN. Structural basis of Keap1 interactions with Nrf2. Free Radic Biol Med. 2015;88(Pt B):101\\u0026ndash;7. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1016/j.freeradbiomed.2015.05.034\\u003c/span\\u003e\\u003cspan address=\\\"10.1016/j.freeradbiomed.2015.05.034\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLi W, Thakor N, Xu EY, et al. An internal ribosomal entry site mediates redox-sensitive translation of Nrf2. Nucleic Acids Res. 2010;38(3):778\\u0026ndash;88. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1093/nar/gkp1048\\u003c/span\\u003e\\u003cspan address=\\\"10.1093/nar/gkp1048\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eMeng Q, Xia Y. c-Jun, at the crossroad of the signaling network. Protein Cell. 2011;2(11):889\\u0026ndash;98. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1007/s13238-011-1113-3\\u003c/span\\u003e\\u003cspan address=\\\"10.1007/s13238-011-1113-3\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRen D, Villeneuve NF, Jiang T, et al. Brusatol enhances the efficacy of chemotherapy by inhibiting the Nrf2-mediated defense mechanism. Proc Natl Acad Sci U S A. 2011;108(4):1433\\u0026ndash;8. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1073/pnas.1014275108\\u003c/span\\u003e\\u003cspan address=\\\"10.1073/pnas.1014275108\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Suxiao jiuxin pill, oxidative stress, Nrf2, HO-1, endothelial cell\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-4856576/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-4856576/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"Abstract\\n\\n\\n\\nBackground\\n\\nReactive oxygen species (ROS) are implicated in the pathogenesis of cardiovascular diseases (CVDs). Suxiao Jiuxin Pill (SX), a traditional Chinese medicine, has emerged as a promising herbal remedy with demonstrated efficacy in ameliorating cardiovascular pathology and improving clinical outcomes. Although SX exhibits significant antioxidant activities, the underlying mechanism remains unclear.\\n\\nMethods\\n\\nWe utilized a mouse endothelial cell line, C166, to investigate the role of SX in regulation of oxidative stress. Hydrogen peroxide (H2O2) was employed to induce cell apoptosis. Cells were sequentially treated with SX, specific inhibitors, and H2O2. RT-qPCR and Western blot analyses were performed to evaluate changes at the mRNA and protein levels, respectively.\\n\\nResults\\n\\nSX demonstrated protective effects against H2O2-induced apoptosis in endothelial cells (ECs). Both the mRNA and protein levels of heme oxygenase-1 (HO-1) increased in response to SX treatment. Importantly, the protective role of SX in ECs was abolished by the HO-1 inhibitor Zinc protoporphyrin IX (ZnPP). Treatment with actinomycin D and cycloheximide revealed that SX upregulated HO-1 expression via de novo synthesis, and Nrf2 was verified as the main mediator. Furthermore, degradation of Nrf2 by its specific inhibitor, brusatol, reversed the protective effects of SX on ECs under oxidative stress.\\n\\nConclusion\\n\\nSX plays a crucial role in protecting ECs from oxidative stress-induced apoptosis through activation of the Nrf2/HO-1 pathway. The protective effect of SX is dependent on HO-1 function, and inhibition of either Nrf2 or HO-1 effectively blocks the protective effect of SX.\",\"manuscriptTitle\":\"Suxiao jiuxin pill protects endothelial cells from oxidative stress-induced apoptosis via Nrf2/HO-1 pathway\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-09-16 13:21:33\",\"doi\":\"10.21203/rs.3.rs-4856576/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"5f4cc5f8-085f-46b4-9f62-be08ec2f31ff\",\"owner\":[],\"postedDate\":\"September 16th, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-09-22T19:24:23+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-09-16 13:21:33\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-4856576\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-4856576\",\"identity\":\"rs-4856576\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}