{"paper_id":"1b2e5f30-d44b-41c2-b345-4f8c84be9e17","body_text":"Abundance of single filamentous bacteria and expression of differentiated Th17 cells, cytokines IL-17A and IL-22, and retinoic acid receptor are significantly high in infants with abysmal oral rotavirus vaccine replication | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Abundance of single filamentous bacteria and expression of differentiated Th17 cells, cytokines IL-17A and IL-22, and retinoic acid receptor are significantly high in infants with abysmal oral rotavirus vaccine replication Rotondwa Bubuluma, Mapaseka Seheri, Cliff A. Magwira This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6320780/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Single filamentous bacteria (SFB) have been shown to prevent murine rotavirus (RV) and other mammalian enteric infections, independent of type I and II interferons, by promoting the adaptive and innate immunity through differentiation of intestinal Th17 cells, production of immunoglobulin A and retinoic acid receptor (RAR) signalling. Here, we assessed whether the abundance of the bacterium at the time of oral RV vaccination would impede the vaccine performance. Stool samples were collected from infants a week after RV vaccination to decide vaccine shedders (n = 20) and non-shedders (n = 20). The abundance of SFB and expression of cathepsin L (CTSL, a biomarker for differentiated Th17 cells), cytokines 17A and IL-22, and retinoic acid receptor (RAR) were assayed using quantitative PCR. Infants who did not shed the vaccine in stool samples had a significantly high abundance of SFB compared to vaccine shedders, p = 0.042, and the abundance correlated negatively with vaccine virus shedding load (R = − 0.69). The expression of CTSL was increased 3.5-fold in non-shedders compared to vaccine shedders, p = 0.035. Similarly, the expression of IL-17A and IL-22 was increased 8.5- and 12-fold, respectively, in non-shedders versus shedders. The expression of RAR was also increased 5.9-fold in non-shedders compared to vaccine shedders, p = 0.034. Infants possessing elevated abundance of SFB were less likely to shed the vaccine in stool samples (OR = 0.31, 95% CI = 0.102–0.962), p = 0.043. Our observations suggest that the abundance of SFB at the time of vaccination may impede the vaccine virus infection and therefore its performance in the study population. Immunology Single filamentous bacteria Th17 cells IL-17A retinoic acid receptor rotavirus vaccine shedding Figures Figure 1 Figure 2 Introduction Despite the availability of vaccines, rotavirus (RV) infections remain one of the principal causes of severe dehydrating diarrhoea in children under the age of five, particularly in Sub-Saharan Africa [ 1 ]. RV primarily infects small intestinal mature enterocytes that are surrounded by a diverse range of intestinal microbiota. Intestinal antiviral immunity is mediated by type I and II interferons (IFN) [ 2 , 3 ]. However, a recent study found mice that were resistant to RV infection, independent of type I and II IFN as well as IL-17 and IL-22 [ 4 ]. The mice’s resistance to RV infection was found to be mediated by segmented filamentous bacteria (SFB), which changed both RV and the ileum in a manner that prevented or cured RV infection [ 4 ], suggesting a new mechanism by which the gut bacteria contributes to antiviral immunity. SFB is a group of commensal, host-adapted bacteria that attach to the ileal epithelium of vertebrates and invertebrates. It has recently been shown to colonize humans in an age-dependent manner, with the majority of individuals colonized within the first three years of life [ 5 ]. Taxonomic classification has confirmed SFB as a unique member of Clostridiales [ 6 ], whose presence in the gut influences the generation of innate immunity and differentiation of acquired immunity that impacts the clearance of RV. SFB promotes the adaptive and innate immunity in mice through the differentiation and maturation of Th17 cells (a subset of CD4 + T cells) in the intestines and the production of immunoglobulin A (IgA) [ 7 ]). In addition, conventional mice colonized by SFB were reported to have increased intestinal retinoic acid (RA) levels and that impediment of murine RV infection by the bacterium was mediated by retinoic acid receptor (RAR) signalling [ 8 ]. Recently, Candidatus Arthromitus (a proposed candidate species of SFB) was reported to be present in higher proportions in higher-performing turkeys compared to their underperforming counterparts, suggesting that the abundance of SFB may play a role in establishing a healthy gut and protecting turkeys from pathogens, resulting in less morbidity and increased performance [ 9 ]. SFB has also been shown to impede acute enteric infections with Toxoplasma gondii [ 10 ] or Salmonella typhimurium [ 11 ] and enteropathogenic Escherichia coli in rabbits [ 12 ]. Here, we report the differential abundance of SFB in RV vaccinated infants who shed the vaccine in stool samples versus those who did not shed. We also report that the expression of differentiated Th17 cells as well as cytokine IL-17A and retinoic acid receptor (RAR) was consistent with the abundance of SFB, suggesting that the presence of SFB in high abundance could impede the oral RV vaccine take. Methodology Study design, participants and ethics This was a cross-sectional study involving the use of stool samples collected from a cohort of infants attending a routine Rotarix (GlaxoSmithKline Biologicals, Belgium) vaccination at a healthcare clinic in Brits, north of Pretoria, South Africa. Stool samples were collected at 6 weeks of age on the day of first dose of the vaccine and 7 weeks thereafter after written and informed consent from parents. Samples were collected from physically health infants that weighed at least 2 kilograms and not on antibiotic treatment 3 weeks prior to recruitment. Study infants were divided into two groups: vaccine shedders and non-shedders based on the shedding of the vaccine virus in stool samples. The study was approved by Sefako Makgatho Health Sciences University Research Ethics committee (SMUREC), clearance number SMUREC/M/240/2021: PG. Specimen collection and storage Stool samples were collected from infants’ nappies by scooping the stool material into sterile plastic containers and immediately frozen in a -20 degrees Celsius ( o C) freezer provided at the clinic. Frozen samples were then taken to the laboratory in cooler boxes packed with ice blocks where they were kept at -20 o C until further processing. Viral RNA isolation and detection of vaccine virus in stool samples Viral RNA was isolated from stool samples using QIAamp Fast RNA Stool Mini Kit (Qiagen, Hilden, Germany) as recommended by the manufacturer. The vaccine virus was detected in stool viral RNA samples by real-time RT-PCR using NSP2 primers (NSP2F: GAA CTT CCT TGA ATA TAA GAT CAC ACT GA, NSP2R: TTG AAG ACG TAA ATG CAT ACC AAT TC) and probe (NSP2-P: FAM-TCCAATAGATTGAAGTCAGTAACCCA-BHQ1) [ 13 ] and Luna Universal Probe One-Step RT-qPCR kit (New England BioLabs, Massachusetts, USA) as done elsewhere [ 14 ]. Primer design and optimization The SFB primers were designed from conserved regions identified in the 16S rRNA gene sequences of several C. arthomitus (SFB representative) retrieved from NCBI GenBank including one isolated from humans (KC135882), trout (AY007720), mouse (KX659137), chicken (X80834), rat (X872244), and fish (X77814) (see supplementary material). The sequences were aligned using the ClustalW tool within Mega ( https://www.ebi.ac.uk/Tools/msa/clustalo/ ). A set of primers were manually designed to fit the conserved regions of 16s rRNA in the aligned sequences while being as discriminative to other sequences as possible. The resulting two primers SFB 16S-F (GCAAGGATACAGGTGGTGCA) and SFB 16S-R (AGTTAACCTAGGCTGTCTC) were synthesized at Inqaba Biotec (Pretoria, South Africa) and optimized as previously described [ 15 ]. The primer sequences were checked for specificity using NCBI-Nucleotide blast ( https://blast.ncbi.nlm.nih.gov/Blast.cgi ) and by PCR against plasmid DNA inserted with 16S rRNA fragment from C. arthomitus and DNA from other non-SFB bacteria. Preparation plasmid DNA containing 16S rDNA sequence There is no SFB type strain that can be used as a positive control, so a 137bp PCR fragment obtained from amplification of a stool DNA sample with SFB primers and confirmed by sequencing was cloned using an NEB PCR Cloning kit (New England BioLabs, Massachusetts, USA) as instructed by the manufacturer (see supplementary material). Plasmid DNA was subsequently purified from the culture using the Qiagen plasmid miniprep kit (Qiagen, Hilden, Germany) following the manufacturer instructions. The concentration of the plasmid DNA was measured using a NanoDrop™ 2000 Spectrophotometer (ThermoFisher Scientific, Californian, USA). The purified plasmid DNA was stored at -20°C. PCR was performed to confirm successful cloning of the SFB 16s rDNA sequence using the SFB 16S F and SFB 16S R primers (this study) and GoTaq Hot Start Polymerase Kit (Promega, USA) according to the manufacturer’s instructions. The isolated bacterial fragment served as the template for PCR. Detection of SFB in stool genomic DNA samples Genomic DNA was isolated from stool samples using QIAamp Fast DNA Stool Mini Kit (Qiagen, Hilden, German) according to the manufacturer’s instructions. SFB was detected in stool genomic DNA samples by qPCR using primers SFB 16S F and SFB 16S R (this study). Briefly, a 10 µL qPCR reaction mixture consisting of 2X Luna Universal qPCR master mix (New Lab Bio, England), 0.4 µM each of the forward and reverse primers, 3 µL of DNA template, and nuclease-free water. Amplification was performed in a Bio-Rad CFX96 Real-Time System (Bio-Rad Laboratories, Hercules, California) under the following conditions: 5 min of initial denaturation at 95 o C, 45 cycles of denaturation at 95 o C for 15 sec and extension at 58 o C for 30 sec, with a melt curve insertion (65 o C to 95 o C: Increment 0.5 o C for 0:05 s). A value of cycle threshold (Ct) < 40 was considered positive for the SFB. Isolation of total RNA and synthesis of cDNA Total RNA was isolated from stool samples using a NucleoSpin RNA kit (Macherey-Nagel, Duren, Germany) as instructed by the manufacturer with minor modifications [ 14 ] and converted to complementary DNA (cDNA) using a Tetro cDNA synthesis kit (Bioline Meridian Bioscience, United Kingdom). cDNA synthesis was performed in a GeneAmp PCR System 9700 (Applied Biosystems, Waltham, MA, USA) by first incubating the samples at 25°C for 10 min, followed by reverse transcription at 42°C for 30 min and incubation at 85°C for 5 min. The cDNA was stored frozen at -20°C. Expression assay for cathepsin L (CTSL) and IL-17A genes in stool mRNA samples The expression of cathepsin L (CTSL, a biomarker for differentiated Th17 cells), IL-17A, IL-22 and retinoic acid receptor (RAR) genes in stool cDNA samples was assessed by qPCR using the following primers: CTSLF- GTG GAC CAA GTG GAA GGC and CTSLR- CTC CAA AGG CGT TCA TGG [ 16 ]; IL-17AF- CTT CCC CCG GAC TGT GAT GGT CAA and IL-17AR- TCA TGT GGT AGT CCA CGT TCC CAT [ 17 ], IL-22F- CACGGAGTCAGTATGAGTGAG and IL-22R-CAAATGCAGGCATTTCTCAGAGA [ 18 ] and RARβ F: GCT TAA TCT GTG GAG ACC GCC AGG and RAR β : TGT GAG GCT TGC TGG GTC GT [ 19 ] as described previously [ 14 ](see supplementary material). Briefly, a 10 µL PCR reaction mixture was made up of 2X Luna qPCR kit (New England Biolabs, Massachusetts, USA), 0.25 µM each of the forward and reverse primers, 2 µl of the cDNA and nuclease free water. The amplification was performed in the Bio-Rad CFX96 Real-Time System (Bio-Rad Laboratories, Hercules, California) as follows: 2 min of initial denaturation at 95°C, 44 cycles of denaturation at 95°C for 10 sec and extension at 52°C for 30 sec, with a melt curve insertion (65 o C to 95 o C: Increment 0.5 o C for 0:05 s). The CTSL, IL-17A, IL-22 and RAR gene expressions were normalized with expression of glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) (GAPDHF- GAG TCA ACG GAT TTG GTC GT and GAPDHR- GAC AAG CTT CCC GTT CTC AG [ 20 ] as described elsewhere [ 21 ]. Statistical analysis Differences in demographics between vaccine shedders and non-shedders was determined by the χ2 test. Abundance of SFB was transformed into a log form and analysed with Graph Pad Prism 8.4.3 (GraphPad Software, San Diego, USA). Descriptive statistics were presented as median and interquartile range (IQR) and displayed as scatter plots. The difference in abundance of SFB between vaccine shedders and non-shedders was assessed by a non-parametric Mann-Whitney U paired test. Fold-change gene expression was calculated using delta Ct as described by Schmittgen and Livak [ 21 ]. An unpaired t-test was used to assess the difference in mean gene expression between the two study groups. The abundance of stool SFB was used as a continuous variable to test its association with rotavirus vaccine shedding using logistic regression and presented as odds ratios (OR) and 95% confidence interval (CI). In all analyses, a p -value ≤ 0.05 was considered statistically significant. Results Demographics A total of 71 infants who received the first dose of the Rotarix vaccine at week 6 were recruited and eligible for the study. Of these, 57.75% (41/71) were males while 42.25% (30/71) were females. Most of the infants (62.8%, 44/71) were exclusively breast fed, while 15.5% (11/71) were formula fed, and the rest had their feeding information not recorded. The majority of participants (76.1%, 54/71) were born naturally while 23.9% (17/71) were born via Caesarean section. There were no significant differences in demographics and other baseline characteristics between vaccine shedders and non-shedders (Table 2). Prevalence of SFB between vaccine shedders versus non-shedders A total of 71 infants, 37 vaccine shedders and 34 non-shedders, were assessed for the presence of SFB. Overall, 60.6 % (43/71) of all study infants were colonized by the bacteria at 7DPV. When stratified according to the vaccine virus shedding status, the bacterium was present in 67.6% (23/34) of non-shedders compared to vaccine shedders (54%, 20/37), p = 0.127 (Mid-P exact). Abundance of SFB in vaccine shedders versus non-shedders A total of 40 stool genome DNA samples, 20 from vaccine shedders and the rest from non-shedders, were assayed for the abundance of the bacterium at 7DPV. Infants who did not shed the vaccine in stool samples had a significantly higher count of SFB (median = 1.367) compared to vaccine shedders (median = 1.437), p = 0.047 (Figure 1a). When the abundance was stratified according to the feeding type, there was no significant difference between infants fed exclusively on breast milk and to those fed with both breastmilk and formula milk ( p = 0. 815) (Figure 1b). There were also no significant differences in SFB counts between infants born naturally versus those born through C-Section p = 0.749) (Figure 1c), and between male and female study infants ( p = 0.439) (Figure 1d). Expression of CTSL, IL-17A, IL-22 and RAR higher in non-shedders versus shedders We assessed whether the expression levels of CTSL, cytokines IL-17A and IL-22, as well as RAR in stool mRNA samples of the two study groups corresponded with the abundance of SFB at 7DPV. Consistent with the abundance, we observed the expression of CTSL in non-shedders was increased 3.5-fold compared to vaccine shedders, p = 0.035 (Figure 2a). Similarly, the expression of IL-17A was increased 8.5-fold in non-shedders compared to shedders (Figure 2b), while IL-22 expression increased 12-fold in non-shedders versus non-shedders (Figure 2c). We also compared the expression of RAR between the two study groups and observed that its expression corresponded with the abundance of SFB in stool samples, as it increased 5.9-fold in non-shedders compared to vaccine shedders, p = 0.034) (Figure 2d). Abundance of SFB in stool samples correlates with vaccine virus shedding load The abundance (Ct values) of SFB in stool samples was used as a continuous variable to measure its association with RV vaccine virus shedding load (Ct values) and vaccine shedding status (Yes or No). We found a moderate negative correlation between abundance of SFB and vaccine virus shedding load, (R = - 0.698). We also observed that possessing high abundance of SFB was an impediment to RV vaccine shedding (OR = 0.31, 95% CI = 0.102–0.962), p = 0.043 (Table 1). Potential compounding factors such as age, gender, feeding type and birth delivery were assessed for their contribution to the abundance of SFB and none of them contributed to the difference in abundance between the study groups. Discussion SFB have been shown to impede RV infection in mice by modulating the innate and adaptive immunity. We assessed whether a similar thing could be observed with oral live attenuated RV vaccination in infants. We first assessed the presence of the bacterium at 7DPV when RV vaccine shedding is at its peak and found that, overall, SFB was present in 60.9% of the infants. This is inconsistent with previous reports that observed that less than 25% of infants are colonized by SFB before the age of 6 months and the majority (75%) between the age of 7-12 months [12]. This inconsistency could be attributed to differences in environmental factors and geographical location [22, 23] as children in low to middle income countries are exposed to different dietary and environmental conditions that are known to shape the composition of gut bacteria and possibly including SFB in infants. When the shedding status of infants was considered, there was no significant difference in prevalence of the bacterium between vaccine shedders and non-shedders. However, non-shedders harboured significantly high counts of SFB compared to vaccine shedders, suggesting a possible role for the abundance, and not merely the presence, of the bacterium in impediment of the vaccine infection and replication. Indeed, both Pearson correlation and logistic regression analyses indicated a negative correlation between abundance of SFB and vaccine shedding load, and that infants with elevated counts of the bacterium were less likely to shed the vaccine in stool samples. SFB has been correlated with the production of SFB-specific IgA and non-specific total IgA in the mucosa of mice and infants [24], which possibly impacted the clearance of RV in non-shedding infants. We hypothesize that the elevated counts of SFB in non-shedders allowed the optimal priming of the intestinal immunity which facilitated the neutralisation of the live-attenuated RV vaccine before infection, hence the non-shedding. An enhancement of immune response in the presence of SFB could also have been at play in a study that found an association between high abundance of SFB and health gut in flocks in USA [9] that protecting the birds against pathogens. Enteric infections by T. gondii or S. typhimurium [10] and E. coli [11] have been reported to impeded by SFB. Intriguingly, monocolonization of germ-free with SFB did not prevent C. rodentium infection, suggesting the significance of an intact microbiota in coordinating a full stash of coordinated immune responses following SFB colonization [25]. The fact that infants who were not colonized by SFB at the time of vaccination did not shed the vaccines also suggests that other factors could also be at play in influencing vaccine shedding. SFB induces the differentiation and maturation of Th17 cells [7]. Hence, we assessed whether the abundance of the bacterium corresponded with the expression of differentiated Th17 cells. The expression of CTSL gene has recently been identified as one of the biomarker for the differentiated Th17 cells [16]. Our study observed that the expression of CTSL was consistent with the abundance of SFB, and that infants who did not shed the vaccine had elevated levels of CTSL expression compared to vaccine shedders. This is consistent with findings of a study that showed the expression of Th17 pathway genes was induced in SFB-positive human infants [24]. Our observation suggests that the elevated expression of Th17 cells in our study could have been due to the increased abundance of the bacterium. Differentiated and mature Th17 cells produce signature IL-17A and other cytokines including IL-22 [7] Hence, we tested whether the expression of differentiated Th17 cells was consistent with expression of IL-17A and IL-22 in stool samples of the two study groups. Consistent with CTSL, the expression of both IL-17A and IL-22 was increased in non-shedders compared to vaccine shedders. IL-22 can be produced from different sources including innate lymphoid cells and neutrophils, and the difference in its expression between the two study groups in the current study could not be solely be attributed to differences in SFB abundance. Nonetheless, our observation is consistent with our previous finding in which IL-22 expression was high in infants harbouring high abundance of bacterial flagellin compared to those with lower abundance [26]. Interestingly, SFB flagellin, like the SFB itself, has been shown to induce the advent of Th17 cells that produce IL-17 and IL-22 (Th17 cells) in the small intestinal lamina propria [27]. RA is a fat-soluble metabolite derived from vitamin A and carotenes that modulates the immune system and plays a role during infections [28]. SFB colonization is said to generate RA, which activates the host’s RAR-signalling pathway [29]. Recently, SFB was reported to impede murine RV infection through RAR-mediated signalling [8]. Hence, we assessed whether the expression of RAR corresponded with the vaccine shedding status of infants. We observed an increased expression of RAR in infants who did not shed the vaccine in stool samples compared to those who shed the vaccine. A similar observation was reported during a murine Citrobacter rodentium infection in which the presence of SFB induced the RAR targets and prevent intestinal infection [25]. The interplay between commensal bacteria and human host is crucial for fighting off infections, but the bacterial-derived signal that mediate this association remain poorly describe. Our observation suggests that SFB can interact with the host immune system via RA to resist against the rotavirus infection, consistent with observations made in a murine study [8]. The study had limitations. We were unable to measure RA levels between the two study groups which could have validated the correlation between SFB and RAR induction . We were unable to measure the products of expression of CTSL, IL-17A, IL-22 genes to validate the findings as sometimes expression does not translate into gene products. In summary, we have shown that infants who did not shed the oral RV vaccine in stool samples contained significantly high counts of SFB compared to their vaccine shedding counterparts. In addition, the expression of differentiated Th17 cells and its signature cytokine IL-17A as well as IL-22 were all expressed significantly high in non-shedders versus shedders. Furthermore, the RAR signalling was also consistent with SFB abundance and was induced highly in non-shedders. Collectively, our findings suggest a possible role of SFB in poor RV vaccine take among some South African infants. Declarations Acknowledgement The study was supported by funding from the National Research Foundation (NRF) (B.R.), Sefako Makgatho Health Sciences University, # D134 (C.A.M.) and South African Medical Research Council, RDA (L.P.K.). Author contribution Author contributions: B.R. performed the laboratory procedures, initial data analysis and drafted the manuscript. C.A.M. conceptualized, performed gene expression assays, supervised, analysed data and revised the manuscript. M.L.S. sourced funds, reviewed and approved the manuscript. All authors have read and agreed to the published the manuscript. Conflict of interest The authors declare no conflict of interest References Troeger C, Khalil IA, Rao PC, Cao S, Blacker BF, Ahmed T et al (2018) Rotavirus vaccination and the global burden of rotavirus diarrhea among children younger than 5 years. JAMA Pediatr 172(10):958–965 Broquet AH, Hirata Y, McAllister CS, Kagnoff MF (2011) RIG-I/MDA5/MAVS are required to signal a protective IFN response in rotavirus infected intestinal epithelium. J Immun1ol 186:1618–1626. 10.4049/jimmunol.1002862 Ingle H, Peterson ST, Baldridge MT (2018) Distinct Effects of Type I and III Interferons on Enteric Viruses. Viruses 10(1):46. 10.3390/v10010046 Shi Z, Zou J, Zhang Z, Zhao X, Noriega J, Zhang B, Zhao C, Ingle H, Bittinger K, Mattei LM, Pruijssers AJ, Plemper RK, Nice TJ, Baldridge MT, Dermody TS, Chassaing B, Gewirtz AT (2019) Segmented Filamentous Bacteria Prevent and Cure Rotavirus Infection. Cell 179(3):644–658 Yin Y, Wang Y, Zhu L, Liu W, Liao N, Jiang M, Zhu B, Yu HD, Xiang C, Wang X (2013) Comparative analysis of the distribution of segmented filamentous bacteria in humans, mice, and chickens. ISME J 7(3):615–621 Pamp SJ, Harrington ED, Quake SR, Relman DA, Blainey PC (2012) Single-cell sequencing provides clues about the host interactions of segmented filamentous bacteria (SFB). Genome Res 22:1107–1119 Ivanov II, Atarashi K, Manel N, Brodie EL, Shima T, Karaoz U et al (2009) Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 139:485–498 Ngo VL, Shi Z, Jiang B, Gewirtz AT (2023) Segmented filamentous bacteria impede rotavirus infection via retinoic acid receptor- mediated signalling. Gut Microbes 15:1 Hedblom GA, Reiland HA, Sylte MJ, Johnson TJ, Baumler DJ (2018) Segmented Filamentous Bacteria Metabolism Meets Immunity. Front Microbiol. ; 29:1991 Edelblum KL, Sharon G, Singh G, Odenwald MA, Sailer A, Cao S et al (2017) The microbiome activates CD4 T-cell‐mediated immunity to compensate for increased intestinal permeability. Cell Mol Gastroenterol Hepatol 4:285–297 Garland CD, Lee A, Dickson MR (1982) Segmented filamentous bacteria in the rodent small intestine: Their colonization of growing animals and possible role in host resistance toSalmonella. Microb Ecol 8(2):181–190 Heczko U, Abe A, Finlay BB (2000) Segmented filamentous bacteria prevent colonization of enteropathogenic Escherichia coli O103 in rabbits. J Infect Dis 181:1027–1033 Gautam R, Esona MD, Mijatovic-Rustempasic S, Ian Tam K, Gentsch JR, Bowen MD (2014) Real-time RT-PCR assays to differentiate wild-type group A rotavirus strains from Rotarix® and RotaTeq® vaccine strains in faecal samples. Hum Vaccin Immunother 10(3):767–777 Kgosana LP, Seheri ML, Magwira CA (2024) Abundance of Selected Lipopolysaccharide-Rich Bacteria and Levels of Toll-like Receptor 4 and Interleukin 8 Expression Are Significantly Associated with Live Attenuated Rotavirus Vaccine Shedding among South Africans Infants. Vaccines. 12, 273 Green MR, Sambrook J Optimizing Primer and Probe Concentrations for Use in Real-Time Polymerase Chain Reaction (PCR) Assays. Cold Spring Harb Protoc. 2018;2018(10). Sałkowska A, Karaś K, Karwaciak I, Walczak-Drzewiecka A, Krawczyk M, Sobalska-Kwapis M, Dastych J, Ratajewski M (2020) Identification of Novel Molecular Markers of Human Th17 Cells. Cells 9(7):1611. 10.3390/cells9071611 Zonoobi E, Saeedfar K, Pourdowlat G, Masjedi MR, Behmanesh M (2018) The Study of IL-10 and IL-17A Genes Expression in Patients with Different Stages of Asthma: a Case-Control Study. Tanaffos 17(3):146–154 Rudloff I, Bachmann M, Pfeilschifter J, Mühl H (2012) Mechanisms of Rapid Induction of Interleukin-22 in Activated T Cells and Its Modulation by Cyclosporin A. J Biol Chem 287(7):4531–4543 Fragoso YD, Shearer KD, Sementilli A, de Carvalho LV, McCaffery PJ (2012) High expression of retinoic acid receptors and synthetic enzymes in the human hippocampus. Brain Struct Funct 217(2):473–483 Colantonio AD, Epeldegui M, Jesiak M, Jachimowski L, Blom B, Uittenbogaart CH (2011) IFN-α is constitutively expressed in the human thymus, but not in peripheral lymphoid organs. PLoS ONE 6(8):e24252 Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3(6):1101–1108 Lopetuso LR, Scaldaferri F, Petito V, Gasbarrini A (2013) Commensal Clostridia: leading players in the maintenance of gut homeostasis. Gut Pathogens 5:23. 10.1186/1757-4749-5-23 Thompson AL, Monteagudo-Mera A, Cadenas MB, Lampl ML, Azcarate-Peril MA (2015) Milk-and solid-feeding practices and daycare attendance are associated with differences in bacterial diversity, predominant communities, and metabolic and immune function of the infant gut microbiome. Front Cell Infect Microbiol 5:3 Chen B, Chen H, Shu X, Yin Y, Li J, Qin J, Chen L, Peng K, Xu F, Gu W, Zhao H, Jiang L, Li L, Song J, Elitsur Y, Yu HD, Jiang M, Wang X, Xiang C (2018) Presence of Segmented Filamentous Bacteria in Human Children and Its Potential Role in the Modulation of Human Gut Immunity. Front Microbiol 9:1403 Ivanov II, McKenzie BS, Zhou L, Tadokoro CE, Lepelley A, Lafaille JJ et al (2006) The orphan nuclear receptor RORγt directs the differentiation program of proinflammatory IL-17 + T helper cells. Cell 126:1121–1133 Haindongo NJ, Seheri LM, Magwira CA (2024) Significant abundance of viable flagellated bacteria and expression of flagellin-signaling Toll-Like Receptor 5 and Interlukin-22 in infants with poor oral Rotavirus vaccine take in South Africa. Authorea Oct 08 Wang Y, Yin Y, Chen X, Zhao Y, Wu Y, Li Y, Wang X, Chen H, Xiang C (2019) Induction of Intestinal Th17 Cells by Flagellins from Segmented Filamentous Bacteria. Front Immunol 10:2750. 10.3389/fimmu.2019.02750 Hall JA, Grainger JR, Spencer SP, Belkaid Y (2011) The role of retinoic acid in tolerance and immunity. Immunity 35:13–22 Woo V, Eshleman EM, Hashimoto-Hill S, Whitt J, Wu SE, Engleman L, Rice T, Karns R, Qualls JE, Haslam DB et al (2021) Commensal segmented filamentous bacteria-derived retinoic acid primes host defense to intestinal infection. Cell Host Microbe. ;29: 1744– 56 e5. Tables Table 1 to 2 are available in the Supplementary Files section. Supplementary Material Supplementary Material are not available with this version. Additional Declarations The authors declare no competing interests. Supplementary Files Table12.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-6320780\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Short Report\",\"associatedPublications\":[],\"authors\":[{\"id\":434846065,\"identity\":\"146366d7-97ce-4549-baae-8adfe444662b\",\"order_by\":0,\"name\":\"Rotondwa Bubuluma\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Sefako Makgatho Health Sciences University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Rotondwa\",\"middleName\":\"\",\"lastName\":\"Bubuluma\",\"suffix\":\"\"},{\"id\":434846066,\"identity\":\"4ac4901e-2f8a-41e7-97a2-081a5197838f\",\"order_by\":1,\"name\":\"Mapaseka Seheri\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Sefako Makgatho Health Sciences University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Mapaseka\",\"middleName\":\"\",\"lastName\":\"Seheri\",\"suffix\":\"\"},{\"id\":434846067,\"identity\":\"d9150a3c-3c09-4f68-866d-441530720708\",\"order_by\":2,\"name\":\"Cliff A. Magwira\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+0lEQVRIiWNgGAWjYDACdsaGDxVgFmMDA0MFMVqYGRtnnIFrOUOUFgbGGXCFjG1E6OBvZm5sOMCwTV4+Irntw895ddEGB5gffmD4Y4dTi8RhRpCW24YbbyQ2z+zddjh3wwE2YwkGnmScWgyYGdsff2C4zbhxdmIzA++2A0AtDGZAo5jxaQHbYg/Swvh3Th1QC/s3oHg9QS2J86UTm5l5G5iBWniAtiQcJuAXg9vJG+QfNjPLHDucO/MwT7FEwoHjOLXwt7c/bDhQcdt2fs/xx4xvaupy+463b/zw4U81Ti1Q5wHRARgH5PEEAhrAQL6BGFWjYBSMglEwIgEAYn5aQ1YjHzQAAAAASUVORK5CYII=\",\"orcid\":\"\",\"institution\":\"Sefako Makgatho Health Sciences University\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Cliff\",\"middleName\":\"A.\",\"lastName\":\"Magwira\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2025-03-27 12:57:03\",\"currentVersionCode\":1,\"declarations\":{\"humanSubjects\":true,\"vertebrateSubjects\":false,\"conflictsOfInterestStatement\":false,\"humanSubjectEthicalGuidelines\":true,\"humanSubjectConsent\":true,\"humanSubjectClinicalTrial\":false,\"humanSubjectCaseReport\":false,\"vertebrateSubjectEthicalGuidelines\":false},\"doi\":\"10.21203/rs.3.rs-6320780/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-6320780/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":79677322,\"identity\":\"8a143293-4bc6-44ed-b9a6-7332c5c08427\",\"added_by\":\"auto\",\"created_at\":\"2025-04-01 12:22:04\",\"extension\":\"jpg\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":103898,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eAbundance of SFB in (a) vaccine shedders versus non-shedders, (b) breastmilk versus breastmilk/formula milk fed study infants (c) naturally versus C-section born infants (d) male versus female infants.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure1.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6320780/v1/6a72352725f2a00fe9fdcd8b.jpg\"},{\"id\":79678652,\"identity\":\"cc267a55-bd55-4dbc-a15b-61fd095b9996\",\"added_by\":\"auto\",\"created_at\":\"2025-04-01 12:30:04\",\"extension\":\"jpg\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":99520,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003eExpression levels of (a) CTSL (biomarker of Th17 cell differentiation) (b) cytokine IL-17A (c) cytokine IL-22 and (d) retinoic acid receptor between RV vaccine shedders and non-shedders\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"Figure2.jpg\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6320780/v1/27e79e8ffc9cfa0c4b0bad9a.jpg\"},{\"id\":79679495,\"identity\":\"027a8611-4470-45b7-9a5f-769188908ffb\",\"added_by\":\"auto\",\"created_at\":\"2025-04-01 12:38:09\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":933300,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6320780/v1/dcd7a9d4-8fc5-45e7-b598-aac1963bcc5e.pdf\"},{\"id\":79677320,\"identity\":\"2a5e3326-2be5-4b7d-9e1e-972d759de49e\",\"added_by\":\"auto\",\"created_at\":\"2025-04-01 12:22:04\",\"extension\":\"docx\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":21666,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"Table12.docx\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-6320780/v1/20cd6030bf820925b6dd9934.docx\"}],\"financialInterests\":\"The authors declare no competing interests.\",\"formattedTitle\":\"\\u003cp\\u003e\\u003cstrong\\u003eAbundance of single filamentous bacteria and expression of differentiated Th17 cells, cytokines IL-17A and IL-22, and retinoic acid receptor are significantly high in infants with abysmal oral rotavirus vaccine replication\\u003c/strong\\u003e\\u003c/p\\u003e\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eDespite the availability of vaccines, rotavirus (RV) infections remain one of the principal causes of severe dehydrating diarrhoea in children under the age of five, particularly in Sub-Saharan Africa [\\u003cspan citationid=\\\"CR1\\\" class=\\\"CitationRef\\\"\\u003e1\\u003c/span\\u003e]. RV primarily infects small intestinal mature enterocytes that are surrounded by a diverse range of intestinal microbiota. Intestinal antiviral immunity is mediated by type I and II interferons (IFN) [\\u003cspan citationid=\\\"CR2\\\" class=\\\"CitationRef\\\"\\u003e2\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR3\\\" class=\\\"CitationRef\\\"\\u003e3\\u003c/span\\u003e]. However, a recent study found mice that were resistant to RV infection, independent of type I and II IFN as well as IL-17 and IL-22 [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e]. The mice\\u0026rsquo;s resistance to RV infection was found to be mediated by segmented filamentous bacteria (SFB), which changed both RV and the ileum in a manner that prevented or cured RV infection [\\u003cspan citationid=\\\"CR4\\\" class=\\\"CitationRef\\\"\\u003e4\\u003c/span\\u003e], suggesting a new mechanism by which the gut bacteria contributes to antiviral immunity.\\u003c/p\\u003e \\u003cp\\u003eSFB is a group of commensal, host-adapted bacteria that attach to the ileal epithelium of vertebrates and invertebrates. It has recently been shown to colonize humans in an age-dependent manner, with the majority of individuals colonized within the first three years of life [\\u003cspan citationid=\\\"CR5\\\" class=\\\"CitationRef\\\"\\u003e5\\u003c/span\\u003e]. Taxonomic classification has confirmed SFB as a unique member of Clostridiales [\\u003cspan citationid=\\\"CR6\\\" class=\\\"CitationRef\\\"\\u003e6\\u003c/span\\u003e], whose presence in the gut influences the generation of innate immunity and differentiation of acquired immunity that impacts the clearance of RV. SFB promotes the adaptive and innate immunity in mice through the differentiation and maturation of Th17 cells (a subset of CD4\\u0026thinsp;+\\u0026thinsp;T cells) in the intestines and the production of immunoglobulin A (IgA) [\\u003cspan citationid=\\\"CR7\\\" class=\\\"CitationRef\\\"\\u003e7\\u003c/span\\u003e]). In addition, conventional mice colonized by SFB were reported to have increased intestinal retinoic acid (RA) levels and that impediment of murine RV infection by the bacterium was mediated by retinoic acid receptor (RAR) signalling [\\u003cspan citationid=\\\"CR8\\\" class=\\\"CitationRef\\\"\\u003e8\\u003c/span\\u003e]. Recently, \\u003cem\\u003eCandidatus Arthromitus\\u003c/em\\u003e (a proposed candidate species of SFB) was reported to be present in higher proportions in higher-performing turkeys compared to their underperforming counterparts, suggesting that the abundance of SFB may play a role in establishing a healthy gut and protecting turkeys from pathogens, resulting in less morbidity and increased performance [\\u003cspan citationid=\\\"CR9\\\" class=\\\"CitationRef\\\"\\u003e9\\u003c/span\\u003e]. SFB has also been shown to impede acute enteric infections with \\u003cem\\u003eToxoplasma gondii\\u003c/em\\u003e [\\u003cspan citationid=\\\"CR10\\\" class=\\\"CitationRef\\\"\\u003e10\\u003c/span\\u003e] or \\u003cem\\u003eSalmonella typhimurium\\u003c/em\\u003e [\\u003cspan citationid=\\\"CR11\\\" class=\\\"CitationRef\\\"\\u003e11\\u003c/span\\u003e] and enteropathogenic \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e in rabbits [\\u003cspan citationid=\\\"CR12\\\" class=\\\"CitationRef\\\"\\u003e12\\u003c/span\\u003e]. Here, we report the differential abundance of SFB in RV vaccinated infants who shed the vaccine in stool samples versus those who did not shed. We also report that the expression of differentiated Th17 cells as well as cytokine IL-17A and retinoic acid receptor (RAR) was consistent with the abundance of SFB, suggesting that the presence of SFB in high abundance could impede the oral RV vaccine take.\\u003c/p\\u003e\"},{\"header\":\"Methodology\",\"content\":\"\\u003cdiv id=\\\"Sec3\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStudy design, participants and ethics\\u003c/h2\\u003e \\u003cp\\u003eThis was a cross-sectional study involving the use of stool samples collected from a cohort of infants attending a routine Rotarix (GlaxoSmithKline Biologicals, Belgium) vaccination at a healthcare clinic in Brits, north of Pretoria, South Africa. Stool samples were collected at 6 weeks of age on the day of first dose of the vaccine and 7 weeks thereafter after written and informed consent from parents. Samples were collected from physically health infants that weighed at least 2 kilograms and not on antibiotic treatment 3 weeks prior to recruitment. Study infants were divided into two groups: vaccine shedders and non-shedders based on the shedding of the vaccine virus in stool samples. The study was approved by Sefako Makgatho Health Sciences University Research Ethics committee (SMUREC), clearance number SMUREC/M/240/2021: PG.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eSpecimen collection and storage\\u003c/h3\\u003e\\n\\u003cp\\u003eStool samples were collected from infants\\u0026rsquo; nappies by scooping the stool material into sterile plastic containers and immediately frozen in a -20 degrees Celsius (\\u003csup\\u003eo\\u003c/sup\\u003eC) freezer provided at the clinic. Frozen samples were then taken to the laboratory in cooler boxes packed with ice blocks where they were kept at -20 \\u003csup\\u003eo\\u003c/sup\\u003eC until further processing.\\u003c/p\\u003e\\n\\u003ch3\\u003eViral RNA isolation and detection of vaccine virus in stool samples\\u003c/h3\\u003e\\n\\u003cp\\u003eViral RNA was isolated from stool samples using QIAamp Fast RNA Stool Mini Kit (Qiagen, Hilden, Germany) as recommended by the manufacturer. The vaccine virus was detected in stool viral RNA samples by real-time RT-PCR using NSP2 primers (NSP2F: GAA CTT CCT TGA ATA TAA GAT CAC ACT GA, NSP2R: TTG AAG ACG TAA ATG CAT ACC AAT TC) and probe (NSP2-P: FAM-TCCAATAGATTGAAGTCAGTAACCCA-BHQ1) [\\u003cspan citationid=\\\"CR13\\\" class=\\\"CitationRef\\\"\\u003e13\\u003c/span\\u003e] and Luna Universal Probe One-Step RT-qPCR kit (New England BioLabs, Massachusetts, USA) as done elsewhere [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e].\\u003c/p\\u003e\\n\\u003ch3\\u003ePrimer design and optimization\\u003c/h3\\u003e\\n\\u003cp\\u003eThe SFB primers were designed from conserved regions identified in the 16S rRNA gene sequences of several \\u003cem\\u003eC. arthomitus\\u003c/em\\u003e (SFB representative) retrieved from NCBI GenBank including one isolated from humans (KC135882), trout (AY007720), mouse (KX659137), chicken (X80834), rat (X872244), and fish (X77814) (see supplementary material). The sequences were aligned using the ClustalW tool within Mega (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://www.ebi.ac.uk/Tools/msa/clustalo/\\u003c/span\\u003e\\u003cspan address=\\\"https://www.ebi.ac.uk/Tools/msa/clustalo/\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e). A set of primers were manually designed to fit the conserved regions of 16s rRNA in the aligned sequences while being as discriminative to other sequences as possible. The resulting two primers SFB 16S-F (GCAAGGATACAGGTGGTGCA) and SFB 16S-R (AGTTAACCTAGGCTGTCTC) were synthesized at Inqaba Biotec (Pretoria, South Africa) and optimized as previously described [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e]. The primer sequences were checked for specificity using NCBI-Nucleotide blast (\\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003ehttps://blast.ncbi.nlm.nih.gov/Blast.cgi\\u003c/span\\u003e\\u003cspan address=\\\"https://blast.ncbi.nlm.nih.gov/Blast.cgi\\\" targettype=\\\"URL\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e) and by PCR against plasmid DNA inserted with 16S rRNA fragment from \\u003cem\\u003eC. arthomitus\\u003c/em\\u003e and DNA from other non-SFB bacteria.\\u003c/p\\u003e\\n\\u003ch3\\u003ePreparation plasmid DNA containing 16S rDNA sequence\\u003c/h3\\u003e\\n\\u003cp\\u003eThere is no SFB type strain that can be used as a positive control, so a 137bp PCR fragment obtained from amplification of a stool DNA sample with SFB primers and confirmed by sequencing was cloned using an NEB PCR Cloning kit (New England BioLabs, Massachusetts, USA) as instructed by the manufacturer (see supplementary material). Plasmid DNA was subsequently purified from the culture using the Qiagen plasmid miniprep kit (Qiagen, Hilden, Germany) following the manufacturer instructions. The concentration of the plasmid DNA was measured using a NanoDrop\\u0026trade; 2000 Spectrophotometer (ThermoFisher Scientific, Californian, USA). The purified plasmid DNA was stored at -20\\u0026deg;C. PCR was performed to confirm successful cloning of the SFB 16s rDNA sequence using the SFB 16S F and SFB 16S R primers (this study) and GoTaq Hot Start Polymerase Kit (Promega, USA) according to the manufacturer\\u0026rsquo;s instructions. The isolated bacterial fragment served as the template for PCR.\\u003c/p\\u003e \\u003cdiv id=\\\"Sec8\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eDetection of SFB in stool genomic DNA samples\\u003c/h2\\u003e \\u003cp\\u003eGenomic DNA was isolated from stool samples using QIAamp Fast DNA Stool Mini Kit (Qiagen, Hilden, German) according to the manufacturer\\u0026rsquo;s instructions. SFB was detected in stool genomic DNA samples by qPCR using primers SFB 16S F and SFB 16S R (this study). Briefly, a 10 \\u0026micro;L qPCR reaction mixture consisting of 2X Luna Universal qPCR master mix (New Lab Bio, England), 0.4 \\u0026micro;M each of the forward and reverse primers, 3 \\u0026micro;L of DNA template, and nuclease-free water. Amplification was performed in a Bio-Rad CFX96 Real-Time System (Bio-Rad Laboratories, Hercules, California) under the following conditions: 5 min of initial denaturation at 95\\u003csup\\u003eo\\u003c/sup\\u003eC, 45 cycles of denaturation at 95\\u003csup\\u003eo\\u003c/sup\\u003eC for 15 sec and extension at 58\\u003csup\\u003eo\\u003c/sup\\u003eC for 30 sec, with a melt curve insertion (65\\u003csup\\u003eo\\u003c/sup\\u003eC to 95\\u003csup\\u003eo\\u003c/sup\\u003eC: Increment 0.5\\u003csup\\u003eo\\u003c/sup\\u003eC for 0:05 s). A value of cycle threshold (Ct)\\u0026thinsp;\\u0026lt;\\u0026thinsp;40 was considered positive for the SFB.\\u003c/p\\u003e \\u003c/div\\u003e\\n\\u003ch3\\u003eIsolation of total RNA and synthesis of cDNA\\u003c/h3\\u003e\\n\\u003cp\\u003eTotal RNA was isolated from stool samples using a NucleoSpin RNA kit (Macherey-Nagel, Duren, Germany) as instructed by the manufacturer with minor modifications [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e] and converted to complementary DNA (cDNA) using a Tetro cDNA synthesis kit (Bioline Meridian Bioscience, United Kingdom). cDNA synthesis was performed in a GeneAmp PCR System 9700 (Applied Biosystems, Waltham, MA, USA) by first incubating the samples at 25\\u0026deg;C for 10 min, followed by reverse transcription at 42\\u0026deg;C for 30 min and incubation at 85\\u0026deg;C for 5 min. The cDNA was stored frozen at -20\\u0026deg;C.\\u003c/p\\u003e\\n\\u003ch3\\u003eExpression assay for cathepsin L (CTSL) and IL-17A genes in stool mRNA samples\\u003c/h3\\u003e\\n\\u003cp\\u003eThe expression of cathepsin L (CTSL, a biomarker for differentiated Th17 cells), IL-17A, IL-22 and retinoic acid receptor (RAR) genes in stool cDNA samples was assessed by qPCR using the following primers: CTSLF- GTG GAC CAA GTG GAA GGC and CTSLR- CTC CAA AGG CGT TCA TGG [\\u003cspan citationid=\\\"CR16\\\" class=\\\"CitationRef\\\"\\u003e16\\u003c/span\\u003e]; IL-17AF- CTT CCC CCG GAC TGT GAT GGT CAA and IL-17AR- TCA TGT GGT AGT CCA CGT TCC CAT [\\u003cspan citationid=\\\"CR17\\\" class=\\\"CitationRef\\\"\\u003e17\\u003c/span\\u003e], IL-22F- CACGGAGTCAGTATGAGTGAG and IL-22R-CAAATGCAGGCATTTCTCAGAGA [\\u003cspan citationid=\\\"CR18\\\" class=\\\"CitationRef\\\"\\u003e18\\u003c/span\\u003e] and RARβ F: GCT TAA TCT GTG GAG ACC GCC AGG and RAR β : TGT GAG GCT TGC TGG GTC GT [\\u003cspan citationid=\\\"CR19\\\" class=\\\"CitationRef\\\"\\u003e19\\u003c/span\\u003e] as described previously [\\u003cspan citationid=\\\"CR14\\\" class=\\\"CitationRef\\\"\\u003e14\\u003c/span\\u003e](see supplementary material). Briefly, a 10 \\u0026micro;L PCR reaction mixture was made up of 2X Luna qPCR kit (New England Biolabs, Massachusetts, USA), 0.25 \\u0026micro;M each of the forward and reverse primers, 2 \\u0026micro;l of the cDNA and nuclease free water. The amplification was performed in the Bio-Rad CFX96 Real-Time System (Bio-Rad Laboratories, Hercules, California) as follows: 2 min of initial denaturation at 95\\u0026deg;C, 44 cycles of denaturation at 95\\u0026deg;C for 10 sec and extension at 52\\u0026deg;C for 30 sec, with a melt curve insertion (65\\u003csup\\u003eo\\u003c/sup\\u003eC to 95\\u003csup\\u003eo\\u003c/sup\\u003eC: Increment 0.5\\u003csup\\u003eo\\u003c/sup\\u003eC for 0:05 s). The CTSL, IL-17A, IL-22 and RAR gene expressions were normalized with expression of glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) (GAPDHF- GAG TCA ACG GAT TTG GTC GT and GAPDHR- GAC AAG CTT CCC GTT CTC AG [\\u003cspan citationid=\\\"CR20\\\" class=\\\"CitationRef\\\"\\u003e20\\u003c/span\\u003e] as described elsewhere [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e].\\u003c/p\\u003e \\u003cdiv id=\\\"Sec11\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003eStatistical analysis\\u003c/h2\\u003e \\u003cp\\u003eDifferences in demographics between vaccine shedders and non-shedders was determined by the χ2 test. Abundance of SFB was transformed into a log form and analysed with Graph Pad Prism 8.4.3 (GraphPad Software, San Diego, USA). Descriptive statistics were presented as median and interquartile range (IQR) and displayed as scatter plots. The difference in abundance of SFB between vaccine shedders and non-shedders was assessed by a non-parametric Mann-Whitney U paired test. Fold-change gene expression was calculated using delta Ct as described by Schmittgen and Livak [\\u003cspan citationid=\\\"CR21\\\" class=\\\"CitationRef\\\"\\u003e21\\u003c/span\\u003e]. An unpaired t-test was used to assess the difference in mean gene expression between the two study groups. The abundance of stool SFB was used as a continuous variable to test its association with rotavirus vaccine shedding using logistic regression and presented as odds ratios (OR) and 95% confidence interval (CI). In all analyses, a \\u003cem\\u003ep\\u003c/em\\u003e-value\\u0026thinsp;\\u0026le;\\u0026thinsp;0.05 was considered statistically significant.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eDemographics \\u0026nbsp;\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eA total of 71 infants who received the first dose of the Rotarix vaccine at week 6 were recruited and eligible for the study. Of these, 57.75% (41/71) were males while 42.25% (30/71) were females. Most of the infants (62.8%, 44/71) were exclusively breast fed, while 15.5% (11/71) were formula fed, and the rest had their feeding information not recorded. The majority of participants (76.1%, 54/71) were born naturally while 23.9% (17/71) were born via Caesarean section. There were no significant differences in demographics and other baseline characteristics between vaccine shedders and non-shedders (Table 2).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003ePrevalence of SFB between vaccine shedders versus non-shedders\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eA total of 71 infants, 37 vaccine shedders and 34 non-shedders, were assessed for the presence of SFB. Overall, 60.6 % (43/71) of all study infants were colonized by the bacteria at 7DPV. When stratified according to the vaccine virus shedding status, the bacterium was present in 67.6% (23/34) of non-shedders compared to vaccine shedders (54%, 20/37), \\u003cem\\u003ep\\u003c/em\\u003e = 0.127 (Mid-P exact).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAbundance of SFB in vaccine shedders versus non-shedders\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eA total of 40 stool genome DNA samples, 20 from vaccine shedders and the rest from non-shedders, were assayed for the abundance of the bacterium at 7DPV. Infants who did not shed the vaccine in stool samples had a significantly higher count of SFB (median = 1.367) compared to vaccine shedders (median = 1.437), \\u003cem\\u003ep\\u003c/em\\u003e = 0.047 (Figure 1a). \\u0026nbsp;When the abundance was stratified according to the feeding type, there was no significant difference between infants fed exclusively on breast milk and to those fed with both breastmilk and formula milk (\\u003cem\\u003ep\\u003c/em\\u003e = 0. 815) (Figure 1b). There were also no significant differences in SFB counts between infants born naturally versus those born through C-Section \\u003cem\\u003ep\\u003c/em\\u003e = 0.749) (Figure 1c), and between male and female study infants (\\u003cem\\u003ep\\u003c/em\\u003e = 0.439) (Figure 1d).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eExpression of CTSL, IL-17A, IL-22 and RAR higher in non-shedders versus shedders\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eWe assessed whether the expression levels of CTSL, cytokines IL-17A and IL-22, as well as RAR in stool mRNA samples of the two study groups corresponded with the abundance of SFB at 7DPV. Consistent with the abundance, we observed the expression of CTSL in non-shedders was increased 3.5-fold compared to vaccine shedders, \\u003cem\\u003ep\\u003c/em\\u003e = 0.035 (Figure 2a). Similarly, the expression of IL-17A was increased 8.5-fold in non-shedders compared to shedders (Figure 2b), while IL-22 expression increased 12-fold in non-shedders versus non-shedders (Figure 2c). We also compared the expression of RAR between the two study groups and observed that its expression corresponded with the abundance of SFB in stool samples, as it increased 5.9-fold in non-shedders compared to vaccine shedders, \\u003cem\\u003ep\\u003c/em\\u003e = 0.034) (Figure 2d).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAbundance of SFB in stool samples correlates with vaccine virus shedding load\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe abundance (Ct values) of SFB in stool samples was used as a continuous variable to measure its association with RV vaccine virus shedding load (Ct values) and vaccine shedding status (Yes or No). \\u0026nbsp;We found a moderate negative correlation between abundance of SFB and vaccine virus shedding load, (R = - 0.698). We also observed that possessing high abundance of SFB was an impediment to RV vaccine shedding (OR = 0.31, 95% CI = 0.102\\u0026ndash;0.962), \\u003cem\\u003ep\\u003c/em\\u003e = 0.043 (Table 1). Potential compounding factors such as age, gender, feeding type and birth delivery were assessed for their contribution to the abundance of SFB and none of them contributed to the difference in abundance between the study groups. \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u0026nbsp;\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cp\\u003eSFB have been shown to impede RV infection in mice by modulating the innate and adaptive immunity. We assessed whether a similar thing could be observed with oral live attenuated RV vaccination in infants. We first assessed the presence of the bacterium at 7DPV when RV vaccine shedding is at its peak and found that, overall, SFB was present in 60.9% of the infants. This is inconsistent with previous reports that observed that less than 25% of infants are colonized by SFB before the age of 6 months and the majority (75%) between the age of 7-12 months [12]. This inconsistency could be attributed to differences in environmental factors and geographical location [22, 23] as children in low to middle income countries are exposed to different dietary and environmental conditions that are known to shape the composition of gut bacteria and possibly including SFB in infants.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eWhen the shedding status of infants was considered, there was no significant difference in prevalence of the bacterium between vaccine shedders and non-shedders. However, non-shedders harboured significantly high counts of SFB compared to vaccine shedders, suggesting a possible role for the abundance, and not merely the presence, of the bacterium in impediment of the vaccine infection and replication. \\u0026nbsp;Indeed, both Pearson correlation and logistic regression analyses indicated a negative correlation between abundance of SFB and vaccine shedding load, and that infants with elevated counts of the bacterium were less likely to shed the vaccine in stool samples. SFB has been correlated with the production of SFB-specific IgA and non-specific total IgA in the mucosa of mice and infants [24], which possibly impacted the clearance of RV in non-shedding infants. We hypothesize that the elevated counts of SFB in non-shedders allowed the optimal priming of the intestinal immunity which facilitated the neutralisation of the live-attenuated RV vaccine before infection, hence the non-shedding. An enhancement of immune response in the presence of SFB could also have been at play in a study that found an association between high abundance of SFB and health gut in flocks in USA [9] that protecting the birds against pathogens. Enteric infections by \\u003cem\\u003eT. gondii\\u003c/em\\u003e or \\u003cem\\u003eS. typhimurium\\u003c/em\\u003e [10] and \\u003cem\\u003eE. coli\\u003c/em\\u003e [11] have been reported to impeded by SFB. Intriguingly, monocolonization of germ-free with SFB did not prevent \\u003cem\\u003eC. rodentium\\u003c/em\\u003e infection, suggesting the significance of an intact microbiota in coordinating a full stash of coordinated immune responses following SFB colonization [25]. The fact that infants who were not colonized by SFB at the time of vaccination did not shed the vaccines also suggests that other factors could also be at play in influencing vaccine shedding.\\u003c/p\\u003e\\n\\u003cp\\u003eSFB induces the differentiation and maturation of Th17 cells [7]. Hence, we assessed whether the abundance of the bacterium corresponded with the expression of differentiated Th17 cells. The expression of CTSL gene has recently been identified as one of the biomarker for the differentiated Th17 cells [16]. Our study observed that the expression of CTSL was consistent with the abundance of SFB, and that infants who did not shed the vaccine had elevated levels of CTSL expression compared to vaccine shedders. This is consistent with findings of a study that showed the expression of Th17 pathway genes was induced in SFB-positive human infants [24]. Our observation suggests that the elevated expression of Th17 cells in our study could have been due to the increased abundance of the bacterium.\\u003c/p\\u003e\\n\\u003cp\\u003eDifferentiated and mature Th17 cells produce signature IL-17A and other cytokines including IL-22 [7] Hence, we tested whether the expression of differentiated Th17 cells was consistent with expression of IL-17A and IL-22 in stool samples of the two study groups. Consistent with CTSL, the expression of both IL-17A and IL-22 was increased in non-shedders compared to vaccine shedders. IL-22 can be produced from different sources including innate lymphoid cells and neutrophils, and the difference in its expression between the two study groups in the current study could not be solely be attributed to differences in SFB abundance. Nonetheless, our observation is consistent with our previous finding in which IL-22 expression was high in infants harbouring high abundance of bacterial flagellin compared to those with lower abundance [26]. Interestingly, SFB flagellin, like the SFB itself, has been shown to induce the advent of Th17 cells that produce IL-17 and IL-22 (Th17 cells) in the small intestinal lamina propria [27].\\u003c/p\\u003e\\n\\u003cp\\u003eRA is a fat-soluble metabolite derived from vitamin A and carotenes that modulates the immune system and plays a role during infections [28]. SFB colonization is said to generate RA, which activates the host\\u0026rsquo;s RAR-signalling pathway [29]. Recently, SFB was reported to impede murine RV infection through RAR-mediated signalling [8]. Hence, we assessed whether the expression of RAR corresponded with the vaccine shedding status of infants. We observed an increased expression of RAR in infants who did not shed the vaccine in stool samples compared to those who shed the vaccine. A similar observation was reported during a murine \\u003cem\\u003eCitrobacter rodentium\\u003c/em\\u003e infection in which the presence of SFB induced the RAR targets and prevent intestinal infection [25]. The interplay between commensal bacteria and human host is crucial for fighting off infections, but the bacterial-derived signal that mediate this association remain poorly describe. Our observation suggests that SFB can interact with the host immune system via RA to resist against the rotavirus infection, consistent with observations made in a murine study [8].\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eThe study had limitations. We were unable to measure RA levels between the two study groups which could have validated the correlation between SFB and RAR induction\\u003cstrong\\u003e.\\u0026nbsp;\\u003c/strong\\u003eWe were unable to measure the products of expression of CTSL, IL-17A, IL-22 genes to validate the findings as sometimes expression does not translate into gene products. \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eIn summary, we have shown that infants who did not shed the oral RV vaccine in stool samples contained significantly high counts of SFB compared to their vaccine shedding counterparts. In addition, the expression of differentiated Th17 cells and its signature cytokine IL-17A as well as IL-22 were all expressed significantly high in non-shedders versus shedders. Furthermore, the RAR signalling was also consistent with SFB abundance and was induced highly in non-shedders. Collectively, our findings suggest a possible role of SFB in poor RV vaccine take among some South African infants.\\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAcknowledgement\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe study was supported by funding from the National Research Foundation (NRF) (B.R.), Sefako Makgatho Health Sciences University, # D134 (C.A.M.) and South African Medical Research Council, RDA (L.P.K.).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eAuthor contribution\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAuthor contributions: B.R. performed the laboratory procedures, initial data analysis and drafted the manuscript. C.A.M. conceptualized, performed gene expression assays, supervised, analysed data and revised the manuscript. M.L.S. sourced funds, reviewed and approved the manuscript. All authors have read and agreed to the published the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflict of interest\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe authors declare no conflict of interest\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\u003cli\\u003e\\u003cspan\\u003eTroeger C, Khalil IA, Rao PC, Cao S, Blacker BF, Ahmed T et al (2018) Rotavirus vaccination and the global burden of rotavirus diarrhea among children younger than 5 years. JAMA Pediatr 172(10):958\\u0026ndash;965\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eBroquet AH, Hirata Y, McAllister CS, Kagnoff MF (2011) RIG-I/MDA5/MAVS are required to signal a protective IFN response in rotavirus infected intestinal epithelium. J Immun1ol 186:1618\\u0026ndash;1626. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.4049/jimmunol.1002862\\u003c/span\\u003e\\u003cspan address=\\\"10.4049/jimmunol.1002862\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eIngle H, Peterson ST, Baldridge MT (2018) Distinct Effects of Type I and III Interferons on Enteric Viruses. Viruses 10(1):46. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3390/v10010046\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/v10010046\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eShi Z, Zou J, Zhang Z, Zhao X, Noriega J, Zhang B, Zhao C, Ingle H, Bittinger K, Mattei LM, Pruijssers AJ, Plemper RK, Nice TJ, Baldridge MT, Dermody TS, Chassaing B, Gewirtz AT (2019) Segmented Filamentous Bacteria Prevent and Cure Rotavirus Infection. Cell 179(3):644\\u0026ndash;658\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eYin Y, Wang Y, Zhu L, Liu W, Liao N, Jiang M, Zhu B, Yu HD, Xiang C, Wang X (2013) Comparative analysis of the distribution of segmented filamentous bacteria in humans, mice, and chickens. ISME J 7(3):615\\u0026ndash;621\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003ePamp SJ, Harrington ED, Quake SR, Relman DA, Blainey PC (2012) Single-cell sequencing provides clues about the host interactions of segmented filamentous bacteria (SFB). Genome Res 22:1107\\u0026ndash;1119\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eIvanov II, Atarashi K, Manel N, Brodie EL, Shima T, Karaoz U et al (2009) Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 139:485\\u0026ndash;498\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eNgo VL, Shi Z, Jiang B, Gewirtz AT (2023) Segmented filamentous bacteria impede rotavirus infection via retinoic acid receptor- mediated signalling. Gut Microbes 15:1\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHedblom GA, Reiland HA, Sylte MJ, Johnson TJ, Baumler DJ (2018) Segmented Filamentous Bacteria Metabolism Meets Immunity. Front Microbiol. ; 29:1991\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eEdelblum KL, Sharon G, Singh G, Odenwald MA, Sailer A, Cao S et al (2017) The microbiome activates CD4 T-cell‐mediated immunity to compensate for increased intestinal permeability. Cell Mol Gastroenterol Hepatol 4:285\\u0026ndash;297\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGarland CD, Lee A, Dickson MR (1982) Segmented filamentous bacteria in the rodent small intestine: Their colonization of growing animals and possible role in host resistance toSalmonella. Microb Ecol 8(2):181\\u0026ndash;190\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHeczko U, Abe A, Finlay BB (2000) Segmented filamentous bacteria prevent colonization of enteropathogenic \\u003cem\\u003eEscherichia coli\\u003c/em\\u003e O103 in rabbits. J Infect Dis 181:1027\\u0026ndash;1033\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGautam R, Esona MD, Mijatovic-Rustempasic S, Ian Tam K, Gentsch JR, Bowen MD (2014) Real-time RT-PCR assays to differentiate wild-type group A rotavirus strains from Rotarix\\u0026reg; and RotaTeq\\u0026reg; vaccine strains in faecal samples. Hum Vaccin Immunother 10(3):767\\u0026ndash;777\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eKgosana LP, Seheri ML, Magwira CA (2024) Abundance of Selected Lipopolysaccharide-Rich Bacteria and Levels of Toll-like Receptor 4 and Interleukin 8 Expression Are Significantly Associated with Live Attenuated Rotavirus Vaccine Shedding among South Africans Infants. Vaccines. 12, 273\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eGreen MR, Sambrook J Optimizing Primer and Probe Concentrations for Use in Real-Time Polymerase Chain Reaction (PCR) Assays. Cold Spring Harb Protoc. 2018;2018(10).\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSałkowska A, Karaś K, Karwaciak I, Walczak-Drzewiecka A, Krawczyk M, Sobalska-Kwapis M, Dastych J, Ratajewski M (2020) Identification of Novel Molecular Markers of Human Th17 Cells. Cells 9(7):1611. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3390/cells9071611\\u003c/span\\u003e\\u003cspan address=\\\"10.3390/cells9071611\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eZonoobi E, Saeedfar K, Pourdowlat G, Masjedi MR, Behmanesh M (2018) The Study of IL-10 and IL-17A Genes Expression in Patients with Different Stages of Asthma: a Case-Control Study. Tanaffos 17(3):146\\u0026ndash;154\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eRudloff I, Bachmann M, Pfeilschifter J, M\\u0026uuml;hl H (2012) Mechanisms of Rapid Induction of Interleukin-22 in Activated T Cells and Its Modulation by Cyclosporin A. J Biol Chem 287(7):4531\\u0026ndash;4543\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eFragoso YD, Shearer KD, Sementilli A, de Carvalho LV, McCaffery PJ (2012) High expression of retinoic acid receptors and synthetic enzymes in the human hippocampus. Brain Struct Funct 217(2):473\\u0026ndash;483\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eColantonio AD, Epeldegui M, Jesiak M, Jachimowski L, Blom B, Uittenbogaart CH (2011) IFN-α is constitutively expressed in the human thymus, but not in peripheral lymphoid organs. PLoS ONE 6(8):e24252\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eSchmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3(6):1101\\u0026ndash;1108\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eLopetuso LR, Scaldaferri F, Petito V, Gasbarrini A (2013) Commensal Clostridia: leading players in the maintenance of gut homeostasis. Gut Pathogens 5:23. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.1186/1757-4749-5-23\\u003c/span\\u003e\\u003cspan address=\\\"10.1186/1757-4749-5-23\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eThompson AL, Monteagudo-Mera A, Cadenas MB, Lampl ML, Azcarate-Peril MA (2015) Milk-and solid-feeding practices and daycare attendance are associated with differences in bacterial diversity, predominant communities, and metabolic and immune function of the infant gut microbiome. Front Cell Infect Microbiol 5:3\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eChen B, Chen H, Shu X, Yin Y, Li J, Qin J, Chen L, Peng K, Xu F, Gu W, Zhao H, Jiang L, Li L, Song J, Elitsur Y, Yu HD, Jiang M, Wang X, Xiang C (2018) Presence of Segmented Filamentous Bacteria in Human Children and Its Potential Role in the Modulation of Human Gut Immunity. Front Microbiol 9:1403\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eIvanov II, McKenzie BS, Zhou L, Tadokoro CE, Lepelley A, Lafaille JJ et al (2006) The orphan nuclear receptor RORγt directs the differentiation program of proinflammatory IL-17\\u0026thinsp;+\\u0026thinsp;T helper cells. Cell 126:1121\\u0026ndash;1133\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHaindongo NJ, Seheri LM, Magwira CA (2024) Significant abundance of viable flagellated bacteria and expression of flagellin-signaling Toll-Like Receptor 5 and Interlukin-22 in infants with poor oral Rotavirus vaccine take in South Africa. Authorea Oct 08\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWang Y, Yin Y, Chen X, Zhao Y, Wu Y, Li Y, Wang X, Chen H, Xiang C (2019) Induction of Intestinal Th17 Cells by Flagellins from Segmented Filamentous Bacteria. Front Immunol 10:2750. \\u003cspan class=\\\"ExternalRef\\\"\\u003e\\u003cspan class=\\\"RefSource\\\"\\u003e10.3389/fimmu.2019.02750\\u003c/span\\u003e\\u003cspan address=\\\"10.3389/fimmu.2019.02750\\\" targettype=\\\"DOI\\\" class=\\\"RefTarget\\\"\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eHall JA, Grainger JR, Spencer SP, Belkaid Y (2011) The role of retinoic acid in tolerance and immunity. Immunity 35:13\\u0026ndash;22\\u003c/span\\u003e\\u003c/li\\u003e \\u003cli\\u003e\\u003cspan\\u003eWoo V, Eshleman EM, Hashimoto-Hill S, Whitt J, Wu SE, Engleman L, Rice T, Karns R, Qualls JE, Haslam DB et al (2021) Commensal segmented filamentous bacteria-derived retinoic acid primes host defense to intestinal infection. Cell Host Microbe. ;29: 1744\\u0026ndash; 56 e5.\\u003c/span\\u003e\\u003c/li\\u003e\\u003c/ol\\u003e\"},{\"header\":\"Tables\",\"content\":\"\\u003cp\\u003eTable 1 to 2 are available in the Supplementary Files section.\\u003c/p\\u003e\"},{\"header\":\"Supplementary Material\",\"content\":\"\\u003cp\\u003eSupplementary Material are not available with this version.\\u003c/p\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[{\"identity\":\"9d4b0c08-0a24-4647-9f5a-cd10c37f2861\",\"identifier\":\"10.13039/501100001322\",\"name\":\"South African Medical Research Council\",\"awardNumber\":\"RDA\",\"order_by\":0},{\"identity\":\"ef364c26-bfb5-4bb2-be4b-4b1c7d948481\",\"identifier\":\"10.13039/501100001321\",\"name\":\"National Research Foundation\",\"awardNumber\":\"NA\",\"order_by\":1}],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":true,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"Sefako Makgatho Health Sciences University\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Single filamentous bacteria, Th17 cells, IL-17A, retinoic acid receptor, rotavirus vaccine, shedding\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-6320780/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-6320780/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eSingle filamentous bacteria (SFB) have been shown to prevent murine rotavirus (RV) and other mammalian enteric infections, independent of type I and II interferons, by promoting the adaptive and innate immunity through differentiation of intestinal Th17 cells, production of immunoglobulin A and retinoic acid receptor (RAR) signalling. Here, we assessed whether the abundance of the bacterium at the time of oral RV vaccination would impede the vaccine performance. Stool samples were collected from infants a week after RV vaccination to decide vaccine shedders (n\\u0026thinsp;=\\u0026thinsp;20) and non-shedders (n\\u0026thinsp;=\\u0026thinsp;20). The abundance of SFB and expression of cathepsin L (CTSL, a biomarker for differentiated Th17 cells), cytokines 17A and IL-22, and retinoic acid receptor (RAR) were assayed using quantitative PCR. Infants who did not shed the vaccine in stool samples had a significantly high abundance of SFB compared to vaccine shedders, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.042, and the abundance correlated negatively with vaccine virus shedding load (R\\u0026thinsp;=\\u0026thinsp;\\u0026minus;\\u0026thinsp;0.69). The expression of CTSL was increased 3.5-fold in non-shedders compared to vaccine shedders, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.035. Similarly, the expression of IL-17A and IL-22 was increased 8.5- and 12-fold, respectively, in non-shedders versus shedders. The expression of RAR was also increased 5.9-fold in non-shedders compared to vaccine shedders, \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.034. Infants possessing elevated abundance of SFB were less likely to shed the vaccine in stool samples (OR\\u0026thinsp;=\\u0026thinsp;0.31, 95% CI\\u0026thinsp;=\\u0026thinsp;0.102\\u0026ndash;0.962), \\u003cem\\u003ep\\u003c/em\\u003e\\u0026thinsp;=\\u0026thinsp;0.043. Our observations suggest that the abundance of SFB at the time of vaccination may impede the vaccine virus infection and therefore its performance in the study population.\\u003c/p\\u003e\",\"manuscriptTitle\":\"Abundance of single filamentous bacteria and expression of differentiated Th17 cells, cytokines IL-17A and IL-22, and retinoic acid receptor are significantly high in infants with abysmal oral rotavirus vaccine replication\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2025-04-01 12:21:59\",\"doi\":\"10.21203/rs.3.rs-6320780/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"eef40bcf-2812-4883-9388-0ef4fb199c97\",\"owner\":[],\"postedDate\":\"April 1st, 2025\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[{\"id\":46395876,\"name\":\"Immunology\"}],\"tags\":[],\"updatedAt\":\"2025-04-01T12:21:59+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2025-04-01 12:21:59\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-6320780\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-6320780\",\"identity\":\"rs-6320780\",\"version\":[\"v1\"]},\"buildId\":\"XKTyCvWXoU3ODBz1xrDgd\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}