{"paper_id":"1a4e71dc-9cfa-468c-812c-aa3179b5941f","body_text":"Identification of insertion sites for the integrative and conjugative element Tn916 in the Bacillus subtilis chromosome | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return\"[object Function]\"==o.call(a)}function e(a){return\"string\"==typeof a}function f(){}function g(a){return!a||\"loaded\"==a||\"complete\"==a||\"uninitialized\"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){(\"c\"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){\"img\"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),\"object\"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height=\"0\",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),\"img\"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||\"j\",e(a)?i(\"c\"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName(\"script\")[0],o={}.toString,p=[],q=0,r=\"MozAppearance\"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&\"[object Opera]\"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?\"object\":l?\"script\":\"img\",v=l?\"script\":u,w=Array.isArray||function(a){return\"[object Array]\"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split(\"!\"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split(\"=\"),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(\".\").pop().split(\"?\").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split(\"/\").pop().split(\"?\")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&\"css\"==i.url.split(\".\").pop().split(\"?\").shift()?\"c\":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Identification of insertion sites for the integrative and conjugative element Tn9 16 in the Bacillus subtilis chromosome Emily L. Bean , Janet L. Smith , View ORCID Profile Alan D. Grossman doi: https://doi.org/10.1101/2025.01.28.635231 Emily L. Bean Department of Biology, Massachusetts Institute of Technology, Cambridge , MA 02139 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Janet L. Smith Department of Biology, Massachusetts Institute of Technology, Cambridge , MA 02139 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Alan D. Grossman Department of Biology, Massachusetts Institute of Technology, Cambridge , MA 02139 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Alan D. Grossman For correspondence: adg{at}mit.edu Abstract Full Text Info/History Metrics Preview PDF Summary Integrative and conjugative elements (ICEs) are found in many bacterial species and are mediators of horizontal gene transfer. Tn 916 is an ICE found in several Gram-positive genera, including Enterococcus , Staphylococcus , Streptococcus , and Clostridum . In contrast to the many ICEs that preferentially integrate into a single site, Tn 916 can integrate into many sites in the host chromosome. The consensus integration motif for Tn 916 , based on analyses of approximately 200 independent insertions, is an approximately 16 bp AT-rich sequence. Here, we describe the identification and mapping of approximately 10 5 independent Tn 916 insertions in the Bacillus subtilis chromosome. The insertions were distributed between 1,554 chromosomal sites, and approximately 99% of the insertions were in 303 sites and 65% were in only ten sites. One region, between ykuC and ykyB ( kre ), was a ‘hotspot’ for integration with ∼22% of the insertions in that single location. In almost all of the top 99% of sites, Tn 916 was found with similar frequencies in both orientations relative to the chromosome and relative to the direction of transcription, with a few notable exceptions. Using the sequences of all insertion regions, we determined a consensus motif which is similar to that previously identified for Clostridium difficile . The insertion sites are largely AT-rich, and some sites overlap with regions bound by the nucleoid-associated protein Rok, a functional analog of H-NS of Gram-negative bacteria. Rok functions as a negative regulator of at least some horizontally acquired genes. We found that the presence or absence of Rok had little or no effect on insertion site specificity of Tn 916 . Introduction Integrative and conjugative elements (ICEs), also called conjugative transposons, are a type of self-transmissible mobile genetic element that facilitates horizontal gene transfer and contributes to bacterial evolution ( Wozniak and Waldor, 2010 ; Bellanger et al ., 2014 ; Johnson and Grossman, 2015 ; Delavat et al ., 2017 ). ICEs typically carry accessory (cargo) genes that benefit the host cell, including genes that confer antibiotic resistances, pathogenic or symbiotic determinants, or alternative metabolic pathways ( Frost et al ., 2005 ; Treangen and Rocha, 2011 ; Johnson and Grossman, 2015 ). Typically, when an ICE is integrated in a host genome, the ICE genes needed for conjugation are not expressed. Either stochastically, or upon some environmental stimulus, an ICE can excise from the chromosome and the genes needed for conjugation are expressed. The element DNA can then be nicked and unwound to generate ssDNA that can then be transferred through the element-encoded conjugation machinery, a Type IV secretion system (T4SS) into a recipient cell. Once in the recipient, the ICE DNA eventually integrates into the chromosome of the new host to generate a stable transconjugant (for reviews, see ( Wozniak and Waldor, 2010 ; Johnson and Grossman, 2015 )). Tn 916 was the first described ICE and was discovered because of its ability to transfer tetracycline resistance between isolates of Enterococcus faecalis ( Franke and Clewell, 1981a ; Franke and Clewell, 1981b ). Since its initial discovery, Tn 916 and Tn 916- like elements have been found in several Gram-positive host species, including E. faecalis , Clostridium difficile, Staphylococcus aureus, and Streptococcus pneumonia ( Fitzgerald and Clewell, 1985 ; Clewell et al ., 1985 ; Clewell and Flannagan, 1993 ; Roberts and Mullany, 2009 ; Roberts and Mullany, 2011 ; Santoro et al ., 2014 ; Sansevere and Robinson, 2017 ). Additionally, Tn 916 is functional and its biology has frequently been studied in B. subtilis (e.g. ( Ivins et al ., 1988 ; Scott et al ., 1988 ; Roberts et al ., 2003 ; Wright and Grossman, 2016 )). ICEs encode integrases (recombinases) that catalyze integration into and excision out of a host chromosome. Many ICEs have a preferred integration (attachment) site in the chromosome, often in a conserved and essential gene ( Burrus and Waldor, 2004 ). If the preferred site is absent, secondary attachment sites can be used ( Wang et al ., 2000a ; Wang et al ., 2006 ; Lee et al ., 2007 ; Menard and Grossman, 2013 ), analogous to temperate phages that can utilize secondary attachment sites (e.g. Shimada et al., 1972 ) and non-conjugative transposons, e.g., Tn7 (reviewed in ( Craig, 1991 )). Some ICEs, including those in the Tn 916 family, are promiscuous in target site selection and can integrate into many sites in a host chromosome ( Clewell et al ., 1988 ; Scott et al ., 1994b ; Cookson et al ., 2011a ; Mullany et al ., 2012 ). Tn 916 integrates into AT-rich regions in a host chromosome ( Clewell et al ., 1988 ; Scott et al ., 1994a ; Cookson et al ., 2011b ; Mullany et al ., 2012 ). To date, the most extensive characterization of Tn 916 integration site selection was completed in the context of C. difficile clinical isolates. Based on the sequences of approximately 200 independent Tn 916 insertions the consensus insertion motif was defined as the AT-rich sequence 5’-TTTTTA[AT][AT][AT][AT]AAAAA ( Mullany et al ., 2012 ). A similar site is used in Butyrivibrio proteoclasticus (Cookson et al., 2011). Here, we describe the sequence of sites of Tn 916 integration in the B. subtilis chromosome from ∼10 5 independent Tn 916 transconjugants. The ∼10 5 insertions were distributed between 1,554 chromosomal sites, with widely varying frequencies in each site. Ninety-nine percent of insertions were in 303 sites, 65% were in only ten sites, and 22% were in a single (hotspot) site. In almost all of the top 99% of sites, Tn 916 was found with similar frequencies in both orientations relative to the direction of DNA replication and transcription (for insertions in open reading frames), with a few notable exceptions. Insertions were centered around an AT-rich consensus motif that is similar to that previously described for Tn 916 insertions in C. difficile ( Mullany et al ., 2012 ) and B. proteoclasticus (Cookson et al., 2011). We also determined the insertion site specificity of Tn 916 in cells missing the nucleoid associated protein Rok. Rok binds to AT-rich regions of the chromosome ( Smits and Grossman, 2010 ; Seid et al ., 2017 ) and is analogous to H-NS (reviewed in ( Grainger, 2016 ), found in many Gram-negative bacteria. We did not detect a global effect of rok on insertion site specificity of Tn 916 , especially at the more abundant insertion sites. Results and Discussion Rationale and overview We aimed to identify Tn 916 integration sites in the B. subtilis chromosome and to determine if the nucleoid binding protein Rok substantially altered the integration site preferences. Based on previous analyses of Tn 916 insertions in other organisms (e.g. Cookson et al., 2011; Mullany et al., 2012 ; Scott et al., 1994), we anticipated that insertions in B. subtilis would also be in AT-rich regions with a consensus similar (or identical) to that found in other species. These previous findings motivated our experiments to test the effects of Rok, a non-essential nucleoid-associated protein that preferentially binds AT-rich regions of the chromosome and can repress expression of some horizontally acquired genes ( Smits and Grossman, 2010 ; Seid et al ., 2017 ), analogous to the roles of H-NS in Gram-negative bacteria ( Dorman, 2007 ; Navarre et al ., 2007 ; Fang and Rimsky, 2008 ; Smits and Grossman, 2010 ; Seid et al ., 2017 ). We used high-throughput sequencing to identify Tn 916 insertion sites in the B. subtilis genome and determined if Rok had any major effects on utilization of these sites. Libraries of Tn 916 insertions We made libraries of approximately 10 5 independent Tn 916 insertions in both wild type and Δ rok B. subtilis cells. Briefly, a Tn 916 donor (host) strain (ELC43) containing a copy of Tn 916 integrated near the yufK start codon was crossed with two recipient strains that did not already contain a copy of Tn 916 ( rok+ strain ELC38 and Δ rok strain ELC42) and transconjugants that obtained Tn 916 were selected (Methods). The conjugation efficiencies using wild type and Δrok recipients were both ∼0.02% transconjugants per donor. Transconjugants from multiple matings were recovered from petri plates, pooled, and then grown in LB medium to stationary phase before harvesting genomic DNA to map Tn 916 insertion sites by high throughput sequencing. Identification of insertion sites We identified the Tn 916 insertion (integration) sites in transconjugants using a transposon-directed insertion sequencing method (TraDIS) ( Langridge et al ., 2009 ; Potter and Luo, 2010 ; Mullany et al ., 2012 ; Barquist et al ., 2016 ). Briefly, genomic DNA from the pooled transconjugants ( rok+ and Δrok , separately) was randomly sheared, adaptors were annealed to the ends of the fragments, and the junctions between the left end of Tn 916 (as drawn in Fig 1A ) and the chromosome were amplified by PCR. A Tn 916 -specific primer that hybridizes between orf24 and attL was used for sequencing ( Fig 1B , Methods). The relative number of sequence reads for a given site reflects the relative number of insertions in that site after growth of the cells, assuming that all other reactions are of equal efficiencies for each insertion. Approximately 87% of the sequence reads from each pool ( rok + and Δ rok ) mapped to the B. subtilis chromosome and five percent of the total reads were from the excised circular form of Tn 916 . Download figure Open in new tab Fig 1. Schematic of Tn 916 and identification of insertion sites. A. A generic insertion of Tn 916 (green) in the chromosome (blue) is shown, including attL , attR , and orf24 (the first open reading frame within Tn 916 ). DNA for sequencing was amplified from the left end of Tn 916 (as drawn) extending into the chromosome, as indicated below the insertion. B. Fragments that span the insertion site at the left end of Tn 916 were amplified from the library of transconjugants, resulting in fragments approximately 300 bp in length. Amplification was carried out using an adaptor (shown in white) for the chromosomal end together with a primer that anneals within Tn 916 (see Methods for details). The sequencing primer binds between attL and orf24 . Reads that map to the bottom DNA strand correspond to insertions in the orientation drawn in panel A; reads mapping to the top strand are in the opposite orientation, i.e. , with orf24 the right. C. Tn 916 insertions at yufK . Insertions occur in both orientations. Insertions with orf24 to the left had DNA sequence reads on the bottom strand and insertions with orf24 to the right had sequence reads on the top strand. Insertions were at multiple adjacent nucleotides and relative frequencies are indicated by the bar plots, with an asterisk indicating an insertion position used at a frequency too low to plot to scale. Insertions at any given genomic locus were often observed in both orientations and at multiple adjacent or nearby bases (e.g., Fig 1C ). Because these nearby insertions are associated with the same insertion motif, we grouped them together into insertion sites (see Methods). For wild-type cells, insertions occurred at a total of 5377 nucleotide positions and clustered into 1554 insertion sites (Methods; S1 Table). The frequency of insertions in different sites varied over a wide range in both rok + and Δ rok strains ( Fig 2 and S1 Table). Download figure Open in new tab Fig 2. Relative frequencies of Tn 916 insertions throughout the chromosome. The relative frequency of Tn 916 insertions along the chromosome with the origin of replication at the left end and the terminus region near the middle are presented. Insertions on the top strand are shown above the line and those on the bottom strand below the line. The linear depictions of the chromosome begin and end at the origin of replication and the red bar below (C) indicates the ter region. A, B ) Insertions from mating Tn 916 into wild type strain (ELC38). Data are the same in each panel, but the scale in (B) is different to accentuate insertions in sites used at a low frequency. The red arrow in (A) indicates the insertion hotspot between ykuC and ykyB that contains ∼22% of the total insertions. C ) Insertions from mating Tn 916 into the Δ rok strain (ELC42). Data are presented on the same scale as in B for comparison. We found that 99% of the Tn 916 insertions in wild type cells were in 303 sites (S1 Table). Of these 303 sites, 59% were outside of annotated open reading frames (intergenic), although only ∼12% of the genome is intergenic. Taking into account the frequency of insertions in each site, 75% of the insertions in these 303 sites were in intergenic regions. This bias is likely driven, in part, by the AT-rich nature of these regions (see below). A similar bias was observed for Tn 916 insertions in C. difficile ( Mullany et al ., 2012 ). The Tn 916 insertion site motif We defined a consensus sequence motif for insertion of Tn 916 in the B. subtilis chromosome using MEME ( Bailey and Elkan, 1994a ). We submitted 61-bp of DNA sequence surrounding the 303 most frequently used sites in wild type cells. The resulting consensus motif contained a palindromic region of T- and A-rich stretches separated by six base pairs that are AT-rich but less well conserved ( Fig 3A ). This motif has more sequence information, but is virtually the same as the consensus motif identified in other organisms (e.g. Cookson et al., 2011; Mullany et al., 2012 ; Scott et al., 1994). Download figure Open in new tab Fig 3. The consensus Tn 916 insertion site motif. A ) The consensus sequence logo for the top 303 Tn 916 insertion sites in wild type cells. The consensus sequence is similar to that determined for Tn 916 insertions in other organisms (Cookson et al., 2011; Mullany et al., 2012 ) B) Tn 916 insertions in the hotspot between ykuC and ykyB ( kre ), where 22% of insertions occur. Insertions in the reverse (top strand) or forward (bottom strand) are indicated by bar plots, with additional insertion positions present at frequencies too low to plot to scale indicated by asterisks. A 17-bp perfect inverted repeat is indicated by the black arrows and gray highlighting. C) Sequence of the Tn 916 insertion hotspot in C. difficile strain CD37 ( Mullany et al ., 1991 ; Wang et al ., 2000) and in C. difficile strain 630 ( Mullany et al ., 2012 ). Shading and arrows indicate the 8 bp inverted repeat in the hotspot in CD630. Hotspots for Tn 916 insertions Remarkably, 65% of the independent Tn 916 insertions were in ten sites ( Table 1 ; Fig 2A ), and 22% were in a site between ykuC and ykyB ( kre ). This bias for insertions in the ykuC / ykyB site was not because the Tn 916 from donor strain had been integrated in this site. The strain used as a donor (ELC43) had a single copy of Tn 916 at the very 5’-end of yufK ( Wright and Grossman, 2016 )). Tn 916 integrated at this site in ∼3% of transconjugants. We suspect that the bias for insertions in the ykuC / ykyB site could be due to the presence of a 17 bp inverted repeat that flanks the nucleotides where insertions occur ( Fig 3B ), and none of the other insertion sites had a 17 bp inverted repeat. We have not tested experimentally the importance of this inverted repeat on insertion frequency. View this table: View inline View popup Download powerpoint Table 1. Top ten Tn 916 insertion sites in B. subtilis . The high frequency (∼22%) of Tn 916 insertions in a single site in the B. subtilis chromosome is intriguing when considered with the previously reported finding that Tn 916 has one highly preferred integration site in the C. difficile strain CD37 (eight independent integrations in this site, one transconjugant from each of eight different conjugation experiments), despite the presence of multiple potential integration sites in the chromosome ( Mullany et al ., 1991 ; Wang et al ., 2000). This hotspot is located downstream of buk2 and does not have an inverted repeat. In C. difficile strain 630 there are a range of insertion frequencies at various sites, with insertions occurring most frequently near the 3’ end of the mgtA coding sequence ( Mullany et al ., 2012 ). This insertion site is immediately flanked by a perfect 8 bp inverted repeat. Although this is much shorter than the 17 bp inverted repeat at the B. subtilis hotspot, it is consistent with the possibility that inverted repeats can increase insertion frequency. Overall, our results are consistent with those previously reported ( Mullany et al ., 1991 ; Wang et al ., 2000b ; Mullany et al ., 2012 ), and together indicate that insertion site specificity is determined by a combination of sequence and other factors that influence DNA conformation ( Mullany et al ., 1991 ; Wang et al ., 2000b ; Mullany et al ., 2012 ). Because the Tn 916 recombinase (Int) has a preference for DNA sites with a static bend (Lu and Churchward, 1995), the preferred sites in different organisms likely reflect that local DNA structure in combination with the sequence. Static bends are associated with polyA tracts ( Haran and Mohanty, 2009 ), which are a feature in the Tn 916 insertion motif, but additional sequence elements and DNA binding proteins may enhance the formation of static bends in these regions. In addition to reflecting preferences for specific DNA sequences and structures, the frequency at which insertions in each site are recovered is also influenced by the selective pressures on the insertion mutants during growth. The vast majority of genes are not expected to have a significant effect on fitness under the rich media growth conditions used here ( Kobayashi et al ., 2003 ; Johnson and Grossman, 2014 ; Peters et al ., 2016 ; Koo et al ., 2017 ), and the outgrowth used to prepare our library was likely not enough for small differences in fitness to have a large effect of the final population. Thus we believe that the bulk of the differences we observe in the frequencies of insertion in different regions are due to DNA site preferences and not effects of the insertions on fitness. Increased Tn 916 insertion frequency in the terminus region of the chromosome Four of the ten insertion sites that are utilized most frequently are in the ∼10% of the chromosome that comprises the terminus ( terC ) region of replication ( Fig 2A and 2B ). As a result, this region (indicated by a red bar in Fig 2 ) has a 3.8-fold higher insertion frequency compared the rest of the chromosome. The matings were done during mid- and late-exponential phase in rich medium, and on average, there are approximately four copies of the origin region for each copy of the terminus region in these growth conditions. This indicates that the inherent preference for the sites in the terC region may be stronger than the observed frequencies indicate. These high frequency sites are not coincident with the any of the nine ter sites where termination actually occurs. Nor are they coincident with the dif site which is in the ter region and is used by the site-specific recombinases CodV and RipX to resolve chromosome dimers that can form during replication ( Sciochetti et al ., 2001 ; Gogou et al ., 2021 ). The C. difficile strain R20291 may also have an elevated frequency of insertions in the ter region ( Mullany et al ., 2012 ), indicating that there might be a feature of this chromosomal region, separate from the ter and dif sites, that favors Tn 916 insertions. Orientation bias at insertion sites We analyzed the frequency of insertions on the forward versus reverse strand at each insertion site ( Fig 4 ). For the top 99% of insertion sites (303 sites; black dots in Fig 4 ), 97% had insertions in both orientations. The insertion sites that had a strong orientation bias (≥4-fold in one orientation) tended to have lower numbers of insertions. We suspect that in many cases, the apparent orientation bias is likely due to the relatively low frequency of insertions in these sites and is not an indication of the properties of the insertion site per se . In general the insertion frequency in each orientation at individual sites was similar, especially for more abundant insertion sites. However even among the 10 most abundant sites ( Table 1 ) there were some that had more than a two-fold bias in one orientation, indicating that there might be features of individual sites that drive asymmetric insertion frequencies. Download figure Open in new tab Fig 4. Orientation and frequency of insertions in each site. The frequency of insertions in each orientation in the reverse vs forward directions are plotted for all 1,554 insertion sites in wild type cells. The 303 most frequently used sites are shown in black and the rest are in gray. The solid red diagonal line indicates an equal number of insertions in each orientation. The dotted red lines indicate a 2- and 4-fold difference in abundance. The orientation of Tn 916 insertions was not strongly influenced by leading- vs lagging-strand DNA replication ( Fig 2 ). In the region from the origin of replication ( oriC ) going clockwise to the beginning of the terminus ( ter ) region, insertions were equally distributed between forward (leading strand) and reverse (lagging strand) orientation, and in the region from oriC going counterclockwise to the start of the ter region, 52% of insertions had orf24 oriented codirectionally with leading strand DNA synthesis ( Fig 2A and 2B ). The terC region was not included in this analysis because leading vs. lagging strand synthesis across this region is not clearly demarked. Orientation of insertions relative to host transcription To determine if there was a systematic orientation bias related to host transcription, we analyzed the orientation of Tn 916 insertions in open reading frames. Of the top 303 insertion sites (99% of insertions), 124 were in an open reading frame (S1 Table). We found that 56% of the insertions in these 124 sites were oriented such that orf24 was codirectional with the host ORF. Based on these results, we conclude that there appears to be no strong systematic bias for insertion orientation in transcribed portions of the chromosome. Despite the absence of systematic bias, there appeared to be an orientation bias of more than four-fold in nine sites in open reading frames with an insertion frequency of at least 0.1% ( Fig 5 , Table 2 ). Three of the sites had a higher frequency of insertions with orf24 codirectional with transcription of the host orf , and six sites had a higher frequency of insertions in the opposite orientation. These biases could be due to random fluctuations or might reflect inherent differences in DNA structure that influences integration into these sites. Download figure Open in new tab Fig. 5. Insertion orientation in sites within ORFs. Of the top 303 insertion sites, 124 are within orfs . The frequencies of Tn 916 insertions in each of these sites with orf24 codirectional (x-axis) or antisense (y-axis) to transcription of the host gene are plotted. The solid red diagonal line indicates an equal number of insertions in each orientation. The dotted red lines indicate a 2- and 4-fold difference in abundance. The filled red circles indicate sites that had ≥4-fold strand bias and an insertion frequency of ≥0.1%. These are also listed in Table 2 . View this table: View inline View popup Download powerpoint Table 2. Insertion sites in open reading frames with at least 4-fold orientation bias There might also be selective pressures against insertions in a particular orientation that are driven by transcription, but that are specific to a given locus. For example, if the host gene is regulated by an antiterminator between the promoter and insertion site, there might be read-through of the terminator at the left end of Tn 916 , which would cause a competitive disadvantage due to expression of genes involved in unwinding and rolling circle replication ( Wirachman and Grossman, 2024 ). In addition, transcription from promoters at the right end of Tn 916 (P orf7 , P xis , P int ) that are directed into the chromosome might cause expression of regions downstream of the insertion site (with int distal to the host promoter) or antisense transcription of regions upstream the insertion site (with int proximal to the host promoter). If such transcription is deleterious, it would be gene/insertion specific. Evaluation of Rok effects on insertion site selection Rok is a nucleoid-associated protein that binds AT-rich sequences ( Smits and Grossman, 2010 ; Seid et al ., 2017 ) and could potentially affect the ability of Tn 916 to integrate into specific sites. We compared the frequencies of Tn 916 insertions in all sites in a rok null mutant vs. wild type ( rok + ), and also specifically analyzed insertions in sites that are in known Rok binding regions ( Seid et al ., 2017 ). In general, there were similar insertion frequencies in most sites in rok + and Δrok strains ( Fig 6 ), especially in sites with higher insertion frequencies. Thirteen of the insertion sites were in known Rok binding regions ( Fig 6 , red circles). A few of these had different insertion frequencies in Δ rok and rok + cells, but no consistent pattern was observed as to whether there was a higher insertion frequency in Δ rok or rok + cells. Since the sites that had larger difference in the two strains were sites used at a relatively low frequency, they have a higher chance of differing due to random fluctuation. Based on these analyses, we conclude that Rok does not substantially or systematically affect the insertion site utilization of Tn 916 . We have not determined if Rok affects excision of Tn 916 from the chromosome. If there are any effects on excision, we suspect that they would occur at a small number of sites. Download figure Open in new tab Fig 6. Comparison of insertion frequencies in wild type and Δ rok strains. The frequency of insertions in each of the top 99% of sites in the Δ rok mutant (302 sites) are plotted versus the frequency in wild type cells (303 site). Filled red circles indicate Rok binding regions previously reported ( Seid et al ., 2016 ). The solid diagonal line indicates an equal number of insertions in each strain. The dotted lines indicate a 4-fold difference in insertion frequency. The location of the four Rok binding sites that have >4-fold difference in insertion frequency in between the two strains is indicated with the gene names. Conclusions and perspectives Overall, we identified >1900 unique Tn 916 insertion sites in the B. subtilis chromosome. We did not observe a systematic influence of Rok on integration site selection. Despite the relatively large number of independent insertions analyzed, the insertion sites were not saturated. It could prove interesting to evaluate the integration site distribution after removing the high-frequency insertion site from the chromosome (between ykuC and ykyB ), and perhaps others, to favor the insertion into the lower-frequency sites. Additionally, the utility of Tn 916 as a potential mutagen has been previously explored and the limitations noted ( Ivins et al ., 1988 ; Lin and Johnson, 1991 ; Awad and Rood, 1997 ; Mullany et al ., 2012 ). The preference exhibited in target site selection in C. difficile and B. subtilis indicates that Tn 916 insertion sites lack the desired randomness and diversity of target sites for random transposon mutagenesis across the chromosome. One of the most interesting aspects of Tn 916 integration is the presence of integration ‘hotspots’ in different organisms. The sequence of the hotspot in one organism is different from that in another (e.g., B. subtilis vs C. difficile ), even though the same recombinase catalyzes the reaction and the consensus integration site is virtually the same in each organism. Consistent with other analyses, our findings indicate that there are likely multiple factors that contribute to the use of one site preferentially over others, perhaps including genome location and organization, local topology, and surrounding sequences. Materials and Methods Growth conditions Bacillus subtilis cells were grown in LB medium for strain constructions and experiments. The antibiotics tetracycline (12.5 μg/ml) and spectinomycin (100 μg/ml) were used as indicated. Growth was monitor by optical density at 600 nm (OD 600 ). Strains and alleles The B. subtilis strains used were all derived from JMA222 ( trpC2, pheA1 , ICE Bs1 0 ), a derivative of JH642 ( Perego et al ., 1988 ; Smith et al ., 2014 ) that is cured of ICE Bs1 ( Auchtung et al ., 2005b ). ELC38 (Δ comK :: spc ), ELC42 (Δ rok Δ comK :: spc ), and ELC43 { att ( yufKL )::Tn 916 Δ comK :: mls } were made by natural transformation ( Harwood and Cutting, 1990 ) and are described in more detail below. The comK mutants were used to prevent cells from acquiring DNA by transformation rather than conjugation during mating assays. Additionally, loss of comK suppresses the growth defect of rok mutants ( Hoa et al ., 2002 ). The Tn 916 donor strain (ELC43) is derived from CMJ253 ( Johnson and Grossman, 2014 ) and contains a single copy of Tn 916 inserted at the beginning of yufK . CMJ253 was generated by natural transformation of JMA222 with genomic DNA from BS49 ( Haraldsen and Sonenshein, 2003 ; Johnson and Grossman, 2014 ; Browne et al ., 2015 ; Wright and Grossman, 2016 ) and selecting for tetracycline resistance, indicating Tn 916 acquisition. The comK :: mls allele in ELS43 is a deletion-insertion that was generated by replacing most of the comK open reading frame (from 47 bp upstream of comK to 19 bp upstream of its stop codon) with the resistance cassette from pDG795 (macrolide–lincosamide–streptogramin (MLS)). The cassette was combined with up- and downstream homology arms via isothermal assembly ( Gibson et al ., 2009 ). The Δ comK :: spc allele in ELC38 and ELC42 was previously described ( Luttinger et al ., 1996 ; Auchtung et al ., 2005a ). The Δrok allele in ELC42 is an unmarked deletion of rok (from 1 bp upstream of rok to 11 bp upstream of its stop codon). First, rok was replaced with a chloramphenicol resistance cassette ( cat ) flanked by lox sites. cat was then removed from the chromosome by Cre-mediated recombination between the lox sites. cre was introduced by transforming cells with pDR244, a temperature-sensitive plasmid that expresses Cre, leaving an unmarked deletion with a small scar ( Meisner et al ., 2013 ; Johnson and Grossman, 2014 ). The plasmid was cured by growth at non-permissive temperature. Generation of Tn 916 insertion libraries and mating assays Libraries of Tn 916 insertions were made in both wild type (ELC38) and Δ rok (ELC42) B. subtilis strains. Briefly, the Tn 916 donor strain (ELC43; has Tn 916 at the beginning of the yufK ORF) and recipients were grown in LB medium to mid- or late-exponential phase (OD 600 of 0.5 and 1, respectively), then mixed at a 1:1 ratio (4 total OD 600 units of cells) and applied to a nitrocellulose filter. Filters were placed on a 1.5% agar plate with 1x Spizizen’s salts ( Harwood and Cutting, 1990 ) for 3 h at 37°C. Cells were harvested off the filters and plated onto 1.5% agar plates containing tetracycline and spectinomycin to select for transconjugants to be used for insertion sequence analysis. Transconjugants from multiple matings were recovered from petri plates, pooled, and then grown in LB medium to stationary phase before harvesting genomic DNA to map Tn 916 insertion sites by high throughput sequencing. In total we isolated approximately 10 5 independent transconjugants in each of rok + and Δrok strains. Conjugation efficiency (transconjugants per donor) is defined as the number of transconjugant CFUs obtained after mating per donor CFUs added to the mating mixture x 100%. Harvesting transconjugant gDNA Transconjugant colonies were resuspended from tetracycline/spectinomycin agar plates and used to inoculate a culture of LB medium containing 100 μg/ml spectinomycin (to prevent growth of donors). Tetracycline was excluded during growth so as not to stimulate Tn 916 excision from original integration sites ( Su et al ., 1992 ; Showsh and Andrews, 1992 ; Manganelli et al ., 1995 ; Celli and Trieu-Cuot, 1998 ; Wright and Grossman, 2016 ). Theoretically, any residual recipient cells that did not receive a copy of Tn 916 could also grow in the absence of tetracycline, but these should not contribute to our Tn 916 -specific sequencing. Cells were grown to stationary phase (OD 600 ∼2-3) before harvesting by centrifugation. gDNA was prepared using a Qiagen 100 G tip purification kit. The isolated gDNA had an oriC/terC ratio of ∼1, determined as previously described ( Anderson et al ., 2022 ), indicating that the measured frequencies of insertions in each site was not artificially affected by copy number variation due to ongoing DNA replication. DNA sequencing In general, the Tra nsposon- D irected I nsertion S ite (TraDIS) sequencing pipeline was followed to prepare DNA for sequencing ( Langridge et al ., 2009 ; Potter and Luo, 2010 ; Mullany et al ., 2012 ; Barquist et al ., 2016 ). This strategy uses PCR to enrich for Tn 916 -chromosome junctions from randomly sheared gDNA. Approximately 5 μg of gDNA from each library was sheared into ∼300bp fragments with a Covaris ultrasonicator. Sample sizes were confirmed by gel electrophoresis. Ampure SPRI cleanups were routinely used between each step of DNA preparation. The NEBNext End Repair kit was used for blunt-end repair, followed by the NEBNext dA-tailing kit. A unique adapter (termed “splinkerette”) was generated to aid in the enrichment of transposon-chromosome junctions via PCR ( Potter and Luo, 2010 ; Barquist et al ., 2016 ). One strand of this adapter forms a stable hairpin to which a primer cannot anneal during PCR. Instead, a Tn 916 -specific primer must be used for the first round of amplification. In this way, there should be an enrichment of PCR products containing a Tn 916 -chromosome junction rather than chromosomal DNA alone. The so-called “splinkerette” DNA adapter was prepared by annealing oligonucleotides oELC97 (5’- P*CCACTAGTGT CGACACCAGT CTCTAATTTT TTTTTTCAAA AAAA; P* indicates that the 5’ end of the primer is phosphorylated) and oELC98 (5’- CGAAGAGTAA CCGTTGCTAG GAGAGACCGT GGCTGAATGA GACTGGTGTCGACACTAGTGG*T; *T indicates that the final T residue is attached by a phosphorothioate bond). Oligonucleotides were diluted to 200 μM in 1mM tris-HCl pH 8.5 and mixed in equal volumes before placing in a 98°C heat block for 2 minutes, then cooled to room temperature for annealing to occur. T4 DNA ligase (NEB) was used to anneal the adapter to the dA-tailed DNA fragments. Adapter-ligated DNA was PCR-amplified (19 cycles) with the Tn 916 -specific P5 primer oELC99 (5’- AATGATACGG CGACCACCGA GATCTACAC T GAGTGGTTTTGACCTTGATA AAGTGTGATA AGTCCAGTTT TTATGCG ) where the underlined portion anneals within Tn 916 , and the indexed TraDIS P7 primer oELC100.X (5’- CAAGCAGAAG ACGGCATACG AGATXXXXXX CGAAGAGTAA CCGTTGCTAG GAGAGACCG) where XXXXXX is a barcode sequenced used to identify each library after pooling for sequencing. oELC101.X is unable to bind to its target sequence until after the first round of amplification performed by oELC99. The resulting DNA was pooled and sequenced on a MiSeq (Illumina) to produce 47 bp reads spanning the Tn 916 -chromsome junction using custom sequencing primer oELC101.2 (5’ - TGAGTGGTTT TGACCTTGAT AAAGTGTGAT AAGTCCAGTT TTTATGCGGA TAACTAGATT TTT). oELC102 (5’ - CCACGGTCTC TCCTAGCAAC GGTTACTCTT CG) was used to sequence the attached barcode. The first 10 cycles were run “dark” because the transposon-specific sequencing primer oELC101.2 anneals 10 bp from the end of Tn 916 , resulting in what would be a mono-template across all samples. Analyses of DNA sequence reads Mapping reads to the chromosome In general, the “Bio::TraDIS pipeline” was followed for sequence analysis ( Barquist et al ., 2016 ). As described above, data were not collected for the first 10 rounds of sequencing because that portion is within Tn 916 and would result in identical reads from all PCR products. The sequence reads thus begin with the coupling sequence (6 bp variable sequence at the left end of Tn 916 that is derived from the donor) and therefore may not match the host target sequence ( Caparon and Scott, 1989 ; Rudy and Scott, 1994 ; Scott et al ., 1994a ). We followed the approach of Mullany et al . (2012) and removed the first 10 bp of each sequencing read prior to mapping to eliminate potential mismatches with the recipient. Reads were mapped to the AG174 (JH642) genome sequence ( Smith et al ., 2014 ). The Tn 916 host strains sequenced contained some engineered differences compared to AG174. Both sequenced strains are ICE Bs1 -cured and Δ comK :: spc , so these regions lack insertions because they were not present in our experiments. The rok allele differed in the two sequenced strains, but no insertions in rok were seen in the rok + strain (ELC38), so this did not create any false positive decreases in Tn916 insertion frequency in ELS42, the Δ rok strain. The “bacteria_tradis” pipeline ( Barquist et al ., 2016 ) was used to map reads, allowing up to 2 mismatches. Approximately 87% of reads in each condition mapped to the chromosome (∼1.5 million for each pool), and ∼5% of reads mapped to the circularized form of Tn 916 . For the combined data from both wild type and Δ rok strains, insertions were observed at a total of 6977 nucleotide positions. Clustering reads into insertion sites The 6977 nucleotide positions where reads mapped tended to formed clusters at discrete insertion motifs ( Fig 1C ). We often observed 1) reads mapping to both the top and bottom strand of the chromosome, which reflects insertions at that locus in both orientations, and 2) insertions at multiple closely spaced bases on the same strand, which is presumably because that the polyA and polyT arms of the insertion motif allow for some slippage in how the integrase binds. We used custom R scripts to cluster reads that were associated with the same insertion site. We combined reads from the wild-type and Δ rok samples for this. At insertion sites that had Tn 916 inserted in both orientations, reads on the bottom strand mapped about 14 nucleotides to the left of reads that mapped to the top strand. This apparent 14 bp 3’ overhang is consistent with a 6 bp 5’ overhang when the mapped positions of the reads are corrected for the 10 bp that was removed from the 5’ end prior to mapping to the chromosome. We did a first-pass assignment of reads into clusters by assigning any read that was more than 14 bp downstream of the previous read, regardless of strand, as a new insertion site, and then ran several diagnostics on this set. We found that for insertion sites that had insertions at more than one position on a strand, these insertions typically spanned 2-5 bps. Using these metrics we identified five chromosomal regions that contained closely spaced but distinct insertion sites that were not correctly processed in our automated approach, and resolved those manually, leading to a final set of 1944 insertions site. The frequency at which these 1944 insertions sites occur varied over six logs, from 2.9 x 10 -7 (corresponding to sites with just one read) to 0.22 for the site between the ykyB and ykuC ORFs. The relative frequency of a Tn 916 insertion in each identified site was estimated by the proportion of sequence reads mapping to that site, but it is not possible to accurately estimate insertion frequencies for sites with very few sequence reads. Although these low abundance insertion sites were not analyzed in detail, they are included in the full data set of insertions (Supplemental Table 1). Annotation of insertion sites We used the center of the insertion site to determine 1) the gene(s) which the insertion site was within or between, 2) whether the insertion site is within a Rok binding region as reported by ( Seid et al ., 2016 ), and 3) the DNA sequence surrounding the insertion site. For insertion sites with reads on both strands, we assigned the center as the midpoint between the position with the most reads on top strand and the position with the most reads on the bottom strand. For insertion sites with reads on only one strand, the center was determined by adding or subtracting seven ( i.e. half the average distance between reads mapping to the top or bottom strand) from the position with the most inserts, depending on whether the reads were mapped to the bottom or top strand, respectively. Binding motif and inverted repeats Binding motifs were determined using MEME version 5.5.6 ( Bailey and Elkan, 1994b ), which was run online at meme-suite.org . For the general insertion site motif ( Fig 3A ), we used 61 bp centered on the insertion site from the top 303 insertion sites. The sequences were unweighted, and both strands were searched, allowing for zero or one hit to be found per sequence. A first-order background set from ( Zhang et al ., 2013 ) was used. To search for inverted repeats, we scanned 61 bp sequences centered on the insertion sites using an online version of Inverted Repeat Finder ( Warburton et al ., 2004 ). The default settings were used, except we reduced the minimum score to 20. Data availability Data are available in dataset GSE286917 at NCBI Gene Expression Omnibus database (GEO, http://www.ncbi.nlm.nih.gov/geo ). Acknowledgements We thank Stuart Levine and the MIT BioMicro Center for technical assistance and high throughput DNA sequencing. Research reported here is based upon work supported, in part, by the National Institute of General Medical Sciences of the National Institutes of Health under award numbers R01 GM050895, R35 GM122538, and R35 GM148343 to ADG. Any opinions, findings, and conclusions or recommendations expressed in this report are those of the authors and do not necessarily reflect the views of the National Institutes of Health. Footnotes ↵ # co-first authors References ↵ Anderson , M.E. , Smith , J.L. , and Grossman , A.D . ( 2022 ) Multiple mechanisms for overcoming lethal over-initiation of DNA replication . Mol Microbiol 118 : 426 – 442 . OpenUrl CrossRef PubMed ↵ Auchtung , J.M. , Lee , C.A. , Monson , R.E. , Lehman , A.P. , and Grossman , A.D . ( 2005a ) Regulation of a Bacillus subtilis mobile genetic element by intercellular signaling and the global DNA damage response . Proc Natl Acad Sci U S A 102 : 12554 – 12559 . OpenUrl Abstract / FREE Full Text ↵ Auchtung , J.M. , Lee , C.A. , Monson , R.E. , Lehman , A.P. , and Grossman , A.D . ( 2005b ) Regulation of a Bacillus subtilis mobile genetic element by intercellular signaling and the global DNA damage response . Proc Natl Acad Sci U S A 102 : 12554 – 12559 . OpenUrl Abstract / FREE Full Text ↵ Awad , M.M. , and Rood , J.I . ( 1997 ) Isolation of α-toxin, θ-toxin and κ-toxin mutants of Clostridium perfringens by Tn 916 mutagenesis . Microb Pathog 22 : 275 – 284 . OpenUrl CrossRef PubMed ↵ Bailey , T.L. , and Elkan , C . ( 1994a ) Fitting a mixture model by expectation maximization to discover motifs in biopolymers . Proc Int Conf Intell Syst Mol Biol 2 : 28 – 36 . OpenUrl PubMed ↵ Bailey , T.L. , and Elkan , C . ( 1994b ) Fitting a mixture model by expectation maximization to discover motifs in biopolymers . Proc Int Conf Intell Syst Mol Biol 2 : 28 – 36 . OpenUrl PubMed ↵ Barquist , L. , Mayho , M. , Cummins , C. , Cain , A.K. , Boinett , C.J. , Page , A.J. , et al. ( 2016 ) The TraDIS toolkit: sequencing and analysis for dense transposon mutant libraries . Bioinformatics 32 : 1109 – 1111 . OpenUrl CrossRef PubMed ↵ Bellanger , X. , Payot , S. , Leblond-Bourget , N. , and Guédon , G . ( 2014 ) Conjugative and mobilizable genomic islands in bacteria: evolution and diversity . FEMS Microbiol Rev 38 : 720 – 760 . OpenUrl CrossRef PubMed ↵ Browne , H.P. , Anvar , S.Y. , Frank , J. , Lawley , T.D. , Roberts , A.P. , and Smits , W.K . ( 2015 ) Complete genome sequence of BS49 and draft genome sequence of BS34A, Bacillus subtilis strains carrying Tn 916 . FEMS Microbiol Lett 362 : 1 – 4 . OpenUrl CrossRef PubMed ↵ Burrus , V. , and Waldor , M.K . ( 2004 ) Shaping bacterial genomes with integrative and conjugative elements . Res Microbiol 155 : 376 – 386 . OpenUrl CrossRef PubMed Web of Science ↵ Caparon , M.G. , and Scott , J.R . ( 1989 ) Excision and insertion of the conjugative transposon Tn916 involves a novel recombination mechanism . Cell 59 : 1027 – 1034 . OpenUrl CrossRef PubMed Web of Science ↵ Celli , J. , and Trieu-Cuot , P. ( 1998 ) Circularization of Tn 916 is required for expression of the transposon-encoded transfer functions: characterization of long tetracycline-inducible transcripts reading through the attachment site . Mol Microbiol 28 : 103 – 117 . OpenUrl CrossRef PubMed Web of Science ↵ Clewell , D.B. , An , F.Y. , White , B.A. , and Gawron-Burke , C . ( 1985 ) Streptococcus faecalis sex pheromone (cAM373) also produced by Staphylococcus aureus and identification of a conjugative transposon (Tn 918 ) . J Bacteriol 162 : 1212 – 1220 . OpenUrl Abstract / FREE Full Text ↵ Clewell , D.B. , and Flannagan , S.E. ( 1993 ) The Conjugative Transposons of Gram-Positive Bacteria . In Bacterial Conjugation . Clewell , D.B. (ed.). Springer US , Boston, MA . pp. 369 – 393 . ↵ Clewell , D.B. , Flannagan , S.E. , Ike , Y. , Jones , J.M. , and Gawron-Burke , C . ( 1988 ) Sequence analysis of termini of conjugative transposon Tn 916 . J Bacteriol 170 : 3046 – 3052 . OpenUrl Abstract / FREE Full Text ↵ Cookson , A.L. , Noel , S. , Hussein , H. , Perry , R. , Sang , C. , Moon , C.D. , et al. ( 2011a ) Transposition of Tn 916 in the four replicons of the Butyrivibrio proteoclasticus B316(T) genome . FEMS Microbiol Lett 316 : 144 – 151 . OpenUrl CrossRef PubMed Web of Science ↵ Cookson , A.L. , Noel , S. , Hussein , H. , Perry , R. , Sang , C. , Moon , C.D. , et al. ( 2011b ) Transposition of Tn916 in the four replicons of the Butyrivibrio proteoclasticus B316T genome . FEMS Microbiol Lett 316 : 144 – 151 . OpenUrl CrossRef PubMed Web of Science ↵ Craig , N.L . ( 1991 ) Tn7: a target site-specific transposon . Mol Microbiol 5 : 2569 – 2573 . OpenUrl CrossRef PubMed Web of Science ↵ Delavat , F. , Miyazaki , R. , Carraro , N. , Pradervand , N. , Meer , V.D. , and Roelof , J . ( 2017 ) The hidden life of integrative and conjugative elements . FEMS Microbiol Rev 41 : 512 – 537 . OpenUrl CrossRef PubMed ↵ Dorman , C.J . ( 2007 ) H-NS, the genome sentinel . Nat Rev Microbiol 5 : 157 – 161 . OpenUrl CrossRef PubMed ↵ Fang , F.C. , and Rimsky , S . ( 2008 ) New insights into transcriptional regulation by H-NS . Curr Opin Microbiol 11 : 113 – 120 . OpenUrl CrossRef PubMed Web of Science ↵ Fitzgerald , G.F. , and Clewell , D.B . ( 1985 ) A conjugative transposon (Tn 919 ) in Streptococcus sanguis . Infect Immun 47 : 415 – 420 . OpenUrl Abstract / FREE Full Text ↵ Franke , A.E. , and Clewell , D.B . ( 1981a ) Evidence for a chromosome-borne resistance transposon (Tn 916 ) in Streptococcus faecalis that is capable of “conjugal” transfer in the absence of a conjugative plasmid . J Bacteriol 145 : 494 – 502 . OpenUrl Abstract / FREE Full Text ↵ Franke , A.E. , and Clewell , D.B . ( 1981b ) Evidence for Conjugal Transfer of a Streptococcus faecalis Transposon (Tn 916 ) from a Chromosomal Site in the Absence of Plasmid DNA . Cold Spring Harb Symp Quant Biol 45 : 77 – 80 . OpenUrl Abstract / FREE Full Text ↵ Frost , L.S. , Leplae , R. , Summers , A.O. , and Toussaint , A . ( 2005 ) Mobile genetic elements: the agents of open source evolution . Nat Rev Microbiol 3 : 722 – 732 . OpenUrl CrossRef PubMed Web of Science ↵ Gibson , D.G. , Young , L. , Chuang , R.-Y. , Venter , J.C. , Hutchison , C.A. , and Smith , H.O . ( 2009 ) Enzymatic assembly of DNA molecules up to several hundred kilobases . Nat Methods 6 : 343 – 345 . OpenUrl CrossRef PubMed Web of Science ↵ Gogou , C. , Japaridze , A. , and Dekker , C . ( 2021 ) Mechanisms for Chromosome Segregation in Bacteria . Front Microbiol 12 : 685687 . OpenUrl CrossRef PubMed ↵ Grainger , D.C . ( 2016 ) Structure and function of bacterial H-NS protein . Biochem Soc Trans 44 : 1561 – 1569 . OpenUrl Abstract / FREE Full Text ↵ Haraldsen , J.D. , and Sonenshein , A.L . ( 2003 ) Efficient sporulation in Clostridium difficile requires disruption of the σK gene . Mol Microbiol 48 : 811 – 821 . OpenUrl CrossRef PubMed ↵ Haran , T.E. , and Mohanty , U . ( 2009 ) The unique structure of A-tracts and intrinsic DNA bending . Q Rev Biophys 42 : 41 – 81 . OpenUrl CrossRef PubMed Web of Science ↵ Harwood , C.R. , and Cutting , S.M . ( 1990 ) Molecular biological methods for Bacillus . John Wiley & Sons , Chichester, United Kingdom . ↵ Hoa , T.T. , Tortosa , P. , Albano , M. , and Dubnau , D . ( 2002 ) Rok (YkuW) regulates genetic competence in Bacillus subtilis by directly repressing comK . Mol Microbiol 43 : 15 – 26 . OpenUrl CrossRef PubMed Web of Science ↵ Ivins , B.E. , Welkos , S.L. , Knudson , G.B. , and Leblanc , D.J . ( 1988 ) Transposon Tn 916 mutagenesis in Bacillus anthracis . Infect Immun 56 : 176 – 181 . OpenUrl Abstract / FREE Full Text ↵ Johnson , C.M. , and Grossman , A.D . ( 2014 ) Identification of host genes that affect acquisition of an integrative and conjugative element in Bacillus subtilis . Mol Microbiol 93 : 1284 – 1301 . OpenUrl CrossRef PubMed ↵ Johnson , C.M. , and Grossman , A.D . ( 2015 ) Integrative and Conjugative Elements (ICEs): What They Do and How They Work . Annu Rev Genet 49 : 577 – 601 . OpenUrl CrossRef PubMed ↵ Kobayashi , K. , Ehrlich , S.D. , Albertini , A. , Amati , G. , Andersen , K.K. , Arnaud , M. , et al. ( 2003 ) Essential Bacillus subtilis genes . Proc Natl Acad Sci U S A 100 : 4678 – 4683 . OpenUrl Abstract / FREE Full Text ↵ Koo , B.-M. , Kritikos , G. , Farelli , J.D. , Todor , H. , Tong , K. , Kimsey , H. , et al. ( 2017 ) Construction and analysis of two genome-scale deletion libraries for Bacillus subtilis . Cell Syst 4 : 291 – 305 .e7. OpenUrl CrossRef PubMed ↵ Langridge , G.C. , Phan , M.-D. , Turner , D.J. , Perkins , T.T. , Parts , L. , Haase , J. , et al. ( 2009 ) Simultaneous assay of every Salmonella Typhi gene using one million transposon mutants . Genome Res 19 : 2308 – 2316 . OpenUrl Abstract / FREE Full Text ↵ Lee , C.A. , Auchtung , J.M. , Monson , R.E. , and Grossman , A.D . ( 2007 ) Identification and characterization of int (integrase), xis (excisionase) and chromosomal attachment sites of the integrative and conjugative element ICEBs1 of Bacillus subtilis . Mol Microbiol 66 : 1356 – 1369 . OpenUrl CrossRef PubMed ↵ Lin , W.J. , and Johnson , E.A . ( 1991 ) Transposon Tn 916 mutagenesis in Clostridium botulinum . Appl Environ Microbiol 57 : 2946 – 2950 . OpenUrl Abstract / FREE Full Text ↵ Luttinger , A. , Hahn , J. , and Dubnau , D . ( 1996 ) Polynucleotide phosphorylase is necessary for competence development in Bacillus subtilis . Mol Microbiol 19 : 343 – 356 . OpenUrl CrossRef PubMed Web of Science ↵ Manganelli , R. , Romano , L. , Ricci , S. , Zazzi , M. , and Pozzi , G . ( 1995 ) Dosage of Tn 916 Circular Intermediates in Enterococcus faecalis . Plasmid 34 : 48 – 57 . OpenUrl CrossRef PubMed Web of Science ↵ Meisner , J. , Llopis , P.M. , Sham , L.-T. , Garner , E. , Bernhardt , T.G. , and Rudner , D.Z . ( 2013 ) FtsEX is required for CwlO peptidoglycan hydrolase activity during cell wall elongation in Bacillus subtilis . Mol Microbiol 89 : 1069 – 1083 . OpenUrl CrossRef PubMed ↵ Menard , K.L. , and Grossman , A.D . ( 2013 ) Selective pressures to maintain attachment site specificity of integrative and conjugative elements . PLoS Genet 9 : e1003623 . OpenUrl CrossRef PubMed ↵ Mullany , P. , Wilks , M. , and Tabaqchali , S . ( 1991 ) Transfer of Tn 916 and Tn 916 ΔE into Clostridium difficile : demonstration of a hot-spot for these elements in the C. difficile genome . FEMS Microbiol Lett 63 : 191 – 194 . OpenUrl PubMed ↵ Mullany , P. , Williams , R. , Langridge , G.C. , Turner , D.J. , Whalan , R. , Clayton , C. , et al. ( 2012 ) Behavior and Target Site Selection of Conjugative Transposon Tn 916 in Two Different Strains of Toxigenic Clostridium difficile . Appl Environ Microbiol 78 : 2147 – 2153 . OpenUrl Abstract / FREE Full Text ↵ Navarre , W.W. , McClelland , M. , Libby , S.J. , and Fang , F.C . ( 2007 ) Silencing of xenogeneic DNA by H-NS—facilitation of lateral gene transfer in bacteria by a defense system that recognizes foreign DNA . Genes Dev 21 : 1456 – 1471 . OpenUrl Abstract / FREE Full Text ↵ Perego , M. , Spiegelman , G.B. , and Hoch , J.A . ( 1988 ) Structure of the gene for the transition state regulator, abrB : regulator synthesis is controlled by the spo0A sporulation gene in Bacillus subtilis . Mol Microbiol 2 : 689 – 699 . OpenUrl CrossRef PubMed Web of Science ↵ Peters , J.M. , Colavin , A. , Shi , H. , Czarny , T.L. , Larson , M.H. , Wong , S. , et al. ( 2016 ) A Comprehensive, CRISPR-based Functional Analysis of Essential Genes in Bacteria . Cell 165 : 1493 – 1506 . OpenUrl CrossRef PubMed ↵ Potter , C.J. , and Luo , L . ( 2010 ) Splinkerette PCR for Mapping Transposable Elements in Drosophila . PLOS ONE 5 : e10168 . OpenUrl CrossRef PubMed ↵ Roberts , A.P. , Hennequin , C. , Elmore , M. , Collignon , A. , Karjalainen , T. , Minton , N. , and Mullany , P . ( 2003 ) Development of an integrative vector for the expression of antisense RNA in Clostridium difficile . J Microbiol Methods 55 : 617 – 624 . OpenUrl CrossRef PubMed Web of Science ↵ Roberts , A.P. , and Mullany , P . ( 2009 ) A modular master on the move: the Tn 916 family of mobile genetic elements . Trends Microbiol 17 : 251 – 258 . OpenUrl CrossRef PubMed Web of Science ↵ Roberts , A.P. , and Mullany , P . ( 2011 ) Tn 916 -like genetic elements: a diverse group of modular mobile elements conferring antibiotic resistance . FEMS Microbiol Rev 35 : 856 – 871 . OpenUrl CrossRef PubMed Web of Science ↵ Rudy , C.K. , and Scott , J.R . ( 1994 ) Length of the coupling sequence of Tn916 . J Bacteriol 176 : 3386 – 3388 . OpenUrl Abstract / FREE Full Text ↵ Sansevere , E.A. , and Robinson , D.A . ( 2017 ) Staphylococci on ICE: Overlooked agents of horizontal gene transfer . Mob Genet Elem 7 : 1 – 10 . OpenUrl CrossRef ↵ Santoro , F. , Vianna , M.E. , and Roberts , A.P . ( 2014 ) Variation on a theme; an overview of the Tn916/Tn1545 family of mobile genetic elements in the oral and nasopharyngeal streptococci . Front Microbiol 5 : 535 . OpenUrl CrossRef PubMed ↵ Sciochetti , S.A. , Piggot , P.J. , and Blakely , G.W . ( 2001 ) Identification and Characterization of thedif Site from Bacillus subtilis . J Bacteriol 183 : 1058 – 1068 . OpenUrl Abstract / FREE Full Text ↵ Scott , J.R. , Bringel , F. , Marra , D. , Alstine , G. , and Rudy , C.K . ( 1994a ) Conjugative transposition of Tn916: preferred targets and evidence for conjugative transfer of a single strand and for a double-stranded circular intermediate . Mol Microbiol 11 : 1099 – 1108 . OpenUrl CrossRef PubMed Web of Science ↵ Scott , J.R. , Bringel , F. , Marra , D. , Alstine , G.V. , and Rudy , C.K . ( 1994b ) Conjugative transposition of Tn 916 : preferred targets and evidence for conjugative transfer of a single strand and for a double-stranded circular intermediate . Mol Microbiol 11 : 1099 – 1108 . OpenUrl CrossRef PubMed Web of Science ↵ Scott , J.R. , Kirchman , P.A. , and Caparon , M.G . ( 1988 ) An intermediate in transposition of the conjugative transposon Tn 916 . Proc Natl Acad Sci U S A 85 : 4809 – 4813 . OpenUrl Abstract / FREE Full Text ↵ Seid , C.A. , Smith , J.L. , and Grossman , A.D . ( 2016 ) Genetic and biochemical interactions between the bacterial replication initiator DnaA and the nucleoid-associated protein Rok in Bacillus subtilis . Mol Microbiol 103 : 798 – 817 . OpenUrl ↵ Seid , C.A. , Smith , J.L. , and Grossman , A.D . ( 2017 ) Genetic and biochemical interactions between the bacterial replication initiator DnaA and the nucleoid-associated protein Rok in Bacillus subtilis . Mol Microbiol 103 : 798 – 817 . OpenUrl CrossRef PubMed ↵ Shimada , K. , Weisberg , R.A. , and Gottesman , M.E . ( 1972 ) Prophage lambda at unusual chromosomal locations . J Mol Biol 63 : 483 – 503 . OpenUrl CrossRef PubMed Web of Science ↵ Showsh , S.A. , and Andrews , R.E . ( 1992 ) Tetracycline enhances Tn 916 -mediated conjugal transfer . Plasmid 28 : 213 – 224 . OpenUrl CrossRef PubMed Web of Science ↵ Smith , J.L. , Goldberg , J.M. , and Grossman , A.D . ( 2014 ) Complete Genome Sequences of Bacillus subtilis subsp. subtilis Laboratory Strains JH642 (AG174) and AG1839 . Genome Announc 2 . ↵ Smits , W.K. , and Grossman , A.D . ( 2010 ) The Transcriptional Regulator Rok Binds A+T-Rich DNA and Is Involved in Repression of a Mobile Genetic Element in Bacillus subtilis . PLOS Genet 6 : e1001207 . OpenUrl CrossRef PubMed ↵ Su , Y.A. , He , P. , and Clewell , D.B . ( 1992 ) Characterization of the tet (M) determinant of Tn 916 : evidence for regulation by transcription attenuation . Antimicrob Agents Chemother 36 : 769 – 778 . OpenUrl Abstract / FREE Full Text ↵ Treangen , T.J. , and Rocha , E.P.C . ( 2011 ) Horizontal Transfer, Not Duplication, Drives the Expansion of Protein Families in Prokaryotes . PLoS Genet 7 : e1001284 . OpenUrl CrossRef PubMed ↵ Wang , H. , Roberts , A.P. , Lyras , D. , Rood , J.I. , Wilks , M. , and Mullany , P . ( 2000a ) Characterization of the Ends and Target Sites of the Novel Conjugative Transposon Tn 5397 from Clostridium difficile : Excision and Circularization Is Mediated by the Large Resolvase, TndX . J Bacteriol 182 : 3775 – 3783 . OpenUrl Abstract / FREE Full Text ↵ Wang , H. , Roberts , A.P. , and Mullany , P . ( 2000b ) DNA sequence of the insertional hot spot of Tn 916 in the Clostridium difficile genome and discovery of a Tn 916 -like element in an environmental isolate integrated in the same hot spot . FEMS Microbiol Lett 192 : 15 – 20 . OpenUrl CrossRef PubMed ↵ Wang , H. , Smith , M.C.M. , and Mullany , P . ( 2006 ) The Conjugative Transposon Tn 5397 Has a Strong Preference for Integration into Its Clostridium difficile Target Site . J Bacteriol 188 : 4871 – 4878 . OpenUrl Abstract / FREE Full Text ↵ Warburton , P.E. , Giordano , J. , Cheung , F. , Gelfand , Y. , and Benson , G . ( 2004 ) Inverted Repeat Structure of the Human Genome: The X-Chromosome Contains a Preponderance of Large, Highly Homologous Inverted Repeats That Contain Testes Genes . Genome Res 14 : 1861 – 1869 . OpenUrl Abstract / FREE Full Text Williams , K.P . ( 2002 ) Integration sites for genetic elements in prokaryotic tRNA and tmRNA genes: sublocation preference of integrase subfamilies . Nucleic Acids Res 30 : 866 – 875 . OpenUrl CrossRef PubMed Web of Science ↵ Wirachman , E.S. , and Grossman , A.D . ( 2024 ) Transcription termination and antitermination are critical for the fitness and function of the integrative and conjugative element Tn916 . PLOS Genet 20 : e1011417 . OpenUrl CrossRef PubMed ↵ Wozniak , R.A.F. , and Waldor , M.K . ( 2010 ) Integrative and conjugative elements: mosaic mobile genetic elements enabling dynamic lateral gene flow . Nat Rev Microbiol 8 : 552 – 563 . OpenUrl CrossRef PubMed Web of Science ↵ Wright , L.D. , and Grossman , A.D . ( 2016 ) Autonomous Replication of the Conjugative Transposon Tn 916 . J Bacteriol 198 : 3355 – 3366 . OpenUrl Abstract / FREE Full Text ↵ Zhang , H. , Li , P. , Zhong , H.-S. , and Zhang , S.-H . ( 2013 ) Conservation vs. variation of dinucleotide frequencies across bacterial and archaeal genomes: evolutionary implications . Front Microbiol 4 : 269 . OpenUrl PubMed View the discussion thread. Back to top Previous Next Posted January 28, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Identification of insertion sites for the integrative and conjugative element Tn916 in the Bacillus subtilis chromosome Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Identification of insertion sites for the integrative and conjugative element Tn9 16 in the Bacillus subtilis chromosome Emily L. Bean , Janet L. Smith , Alan D. Grossman bioRxiv 2025.01.28.635231; doi: https://doi.org/10.1101/2025.01.28.635231 Share This Article: Copy Citation Tools Identification of insertion sites for the integrative and conjugative element Tn9 16 in the Bacillus subtilis chromosome Emily L. Bean , Janet L. Smith , Alan D. Grossman bioRxiv 2025.01.28.635231; doi: https://doi.org/10.1101/2025.01.28.635231 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Microbiology Subject Areas All Articles Animal Behavior and Cognition (7622) Biochemistry (17648) Bioengineering (13868) Bioinformatics (41876) Biophysics (21422) Cancer Biology (18552) Cell Biology (25458) Clinical Trials (138) Developmental Biology (13364) Ecology (19866) Epidemiology (2067) Evolutionary Biology (24290) Genetics (15589) Genomics (22475) Immunology (17711) Microbiology (40325) Molecular Biology (17144) Neuroscience (88469) Paleontology (666) Pathology (2826) Pharmacology and Toxicology (4815) Physiology (7635) Plant Biology (15113) Scientific Communication and Education (2044) Synthetic Biology (4286) Systems Biology (9814) Zoology (2268)","source_license":"CC-BY-4.0","license_restricted":false}