{"paper_id":"1a1b5d0a-9394-4e2a-b18e-e49a39df887b","body_text":"Reevaluating the Association Between\nEpstein-Barr Virus (EBV) and Breast Cancer in\nthe United States\nClarence C. Hu, MS 1, Devanish N. Kamtam, MBBS, MS 2, Juan J. Cardona, MD 3\nAffiliations\n1. Hotpot.ai, Palo Alto, California, USA.\n2. Division of Thoracic Surgery, Department of Cardiothoracic Surgery, Stanford University\nSchool of Medicine, Stanford, California, USA.\n3. Department of Neurosurgery, Stanford University School of Medicine, Stanford, California,\nUSA.\nCorresponding author: clarence@hotpot.ai.\nAuthor contributions: C.H. - Conceptualization, Methodology, Software, Formal analysis,\nWriting - Original draft preparation, Reviewing, Editing. D.N.K. - Writing - Original draft\npreparation, Reviewing, Editing. J.J.C. - Reviewing, Editing.\nAbstract\nThe World Health Organization estimates 9.9% of cancers are attributable to viruses. Notably,\nhuman papillomavirus causes roughly 90% of cervical cancers, while Epstein-Barr virus (EBV) is\nlinked to nearly 10% of gastric carcinomas. Regarding breast cancer, the association with EBV\nis inconclusive. While studies in some nations report an association, those in the United States\nlargely do not. We reviewed studies from 2003 to 2023 and identified seven that analyzed EBV\nassociation with breast cancer in American patients. We observed a potential risk of not\ninvestigating novel EBV variants. Detection protocols utilized only lymphoma-derived strains,\ndespite the current knowledge suggesting that genotype variation can influence pathogenic\npotential and cell tropism. Certain EBV strains, for instance, may preferentially infect epithelial\ncells and increase the risk of nasopharyngeal carcinoma (NPC) by up to 11 times. Stated simply,\nthe optimal EBV detection protocol for breast cancer cells may differ from lymphoma cells.\nReliance on lymphoma-derived strains assumes a level of sequence conservation among EBV\ngenomes. Mounting evidence demonstrates greater variation than previously believed,\nespecially in key coding and non-coding regions. Our analysis reveals that 5/7 (71%) studies\nused at least one assay sequence that did not exactly match more than 50% of EBV genomes\nin NCBI GenBank. Moreover, 98% of these GenBank entries became available after assay\nsequences were selected. Overall, it is possible the current understanding may be incomplete.\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nShould breast cancer mirror gastric carcinoma and exhibit EBV influence in certain subtypes,\nthese insights could enable targeted therapies and screening programs.\nKeywords: EBV; breast cancer; oncogenic virus.\nBackground\nViral Association With Cancer\nThe World Health Organization (WHO) estimates that 15.4% and 9.9% of all cancers are\nattributable to infectious organisms and viruses, respectively(1). An extensive study\ninvestigating the association between cancers and viruses using whole genome sequencing led\nby the Pan-Cancer Analysis of Whole Genomes (PCAWG) consortium identified 16% of the\ncases to be associated with viruses(2).\nCancers with established viral etiology or strong association with viruses include:\n● Cervical cancer(3,4)\n● Burkitt lymphoma (BL)(5)\n● Hodgkin lymphoma(6)\n● Gastric carcinoma(7)\n● Kaposi’s sarcoma(8)\n● Nasopharyngeal carcinoma (NPC)(9–11)\n● NK/T-cell lymphomas(6)\n● Head and neck squamous cell carcinoma (HNSCC)(12)\n● Hepatocellular carcinoma (HCC)(13)\nViral Mechanisms of Action in Cancer\nViruses may promote multiple stages of carcinogenesis, including initiation, progression, and\ntherapeutic resistance.\nViruses are known to influence key proteins, pathways, and chromosomal sites implicated in\ntumorigenesis, including:\n● MYC(14–17)\n● TP53(15,18,19)\n● PD-L1(20–25)\n● BRCA1(26,27)\n● EGFR(28,29)\n● CDK6(8,30)\n● STAT3(31)\n● MTHFD2(17)\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\n● MLL(32)\n● LARG(32)\n● PI3K-Akt(33)\n● JAK-STAT(34)\nIn addition, viruses may also induce MDR1 overexpression and reduce treatment efficacy with\nonly a few infected cells.(35)\nEBV Overview\nEBV is a double-stranded DNA virus from the Herpesviridae family that is formally classified as\nhuman gammaherpesvirus 4. It can be transmitted asymptomatically for weeks via common\nbody fluids like breast milk, saliva, and blood. EBV infects over 90% of individuals worldwide,\nusually asymptomatically. EBV infection typically occurs early in life as approximately 50% of\nchildren carry EBV by age 10 and 80% by age 18.(36,37) While EBV infection classically\npresents as infectious mononucleosis (mono), it is also known to be causally associated with\nmultiple sclerosis.(38) EBV establishes lifelong persistence by tethering to host chromosomes\nand downregulating immune activity to escape immune surveillance.(39) While EBV\npredominantly colonizes B lymphocytes, it has also been detected in epithelial cells and T\nlymphocytes.\nEBV Association With Malignancies\nEBV is classified as a class 1 carcinogen and is strongly associated with several cancers,\nincluding Burkitt lymphoma, Hodgkin lymphoma, gastric carcinoma, NK/T-cell lymphomas, and\nNPC.(40)\nEBV Association With Breast Cancer\nThe association between EBV and breast cancer is inconclusive.\nStudies from China, India, southern Europe, and a few African nations have demonstrated a\nhigher prevalence of EBV in breast cancer samples than in normal breast tissue.(41–43)\nNotably, some studies report an association between EBV and triple-negative breast cancer\n(TNBC), an aggressive phenotype disproportionately affecting younger patients, with one study\nidentifying 36% prevalence of EBV in TNBC samples.(44,45) In the USA, however, studies have\nlargely demonstrated no association between EBV association and breast cancer.\nMoreover, mice models have also demonstrated that EBV infection of mammary epithelial cells\npromotes malignant transformation and initiates uncontrolled growth.(46)\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nEBV Life Cycle and Genome\nThe EBV genome consists of 170k-180k DNA base pairs, encoding over 80 proteins and 40\nnon-coding RNAs.(47)\nSimilar to other herpesviruses, EBV is characterized by a latent-lytic life cycle. During the lytic\nstage, the virus is extremely immunogenic, producing the broad array of gene products required\nfor viral replication and infection. Conversely, the latent stage expresses a sparse set of gene\nproducts and is typically undetectable to the immune system.\nEBV is believed to exist primarily in the latent stage, which comprises four sub-stages, or types,\nmarked by disparate protein and RNA expression: 0, I, II, and III.\nOnly three gene products, all of which are non-coding RNAs, are expressed in every latency\nsub-stage: EBV-encoded RNA 1 (EBER1), EBV-encoded RNA 2 (EBER2), and BamHI-A\nrightward transcript (BART). EBER1 and EBER2 are abundantly expressed during latency.\nAmong their many functions is the ability to suppress or confer resistance to the host immune\nresponse mediated by interferon (IFN)-α and T helper 1 (Th1) cells. EBERs bind to protein\nkinase R (PKR) and inhibit PKR phosphorylation in order to evade IFN-α-induced\napoptosis.(48,49)\nThe protein expressed in the most stages, Epstein-Barr virus nuclear antigen 1 (EBNA1), is\nsilent during type 0 latency.\nEBV genotypes are classified as type 1 or type 2 (type A or type B, respectively). Type 1 EBV\nstrains are prevalent worldwide, whereas type 2 strains are more common in tropical regions\nlike Papua New Guinea and sub-Saharan Africa.(50)\nIncomplete EBV Genome Understanding\nAlthough the oncogenic potential of EBV was discovered in 1964, the impact of its genomic\ndiversity on oncogenic profiling and clinical outcomes remains incompletely understood,\nparticularly when compared to the advanced typing systems used for human papillomavirus\n(HPV).(51–56)\nThese knowledge gaps stem from technical challenges and a historical shortage of data. A large\ngenome and many repetitive sequences make complete-genome sequencing for EBV costly\nand time-consuming. For comparison, the EBV genome is 170k-180k base pairs while HPV is\nabout 8k base pairs.(57)\nPrior to 2006, only four complete EBV genomes were available and only one of type 2 before\n2015.(58–61) Recent advances in technology, however, have augmented these numbers. As of\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nMay 2024, the National Center for Biotechnology Information (NCBI) GenBank lists 512\ncomplete EBV genomes, and 1,269 partial or nearly complete genomes.\nEmerging Non-coding and Coding Genomic Variability\nWhile variations in a few genes and non-coding regions have been documented, many regions\nof the EBV genome remain understudied. Several studies have attempted to correlate genetic\nvariations with disease prevalence, but encountered challenges due to the lack of\nsequence-specific clinicopathological data. Furthermore, recombination events among distinct\nEBV strains may introduce confounding factors that are difficult to disentangle.(59,60)\nThe recent increase in genomic data has revealed more pronounced diversity in coding and\nnon-coding regions than previously believed. Notably, commonly used detection targets belong\nto regions with emerging variability, including EBER1, EBER2, EBNA1, BART , BZLF1, and\nLMP1.(52,56,62–64,64–69) Palser et al. (2015) have also reported that the single nucleotide\npolymorphism (SNP) density varies substantially across all known open reading frames and\nnotably, is highest in latency-associated genes.(59)\nGenomic Variability Impacts Pathogenic Potential and Cell\nTropism\nDNA viruses such as HPV and EBV, although more stable than RNA viruses, nonetheless\nundergo mutations that may alter pathogenic potential and cell tropism.\nPathogenic Potential\nThe vast majority of HPV genotypes are non-tumorigenic. Among over 150 HPV genotypes,\nonly seven drive approximately 90% of cervical cancer cases while two alone, HPV 16 and HPV\n18, account for 70%.(70)\nEBV subtypes may also exhibit similar differences in oncogenic potential between different\nsubtypes. Type 1 and type 2 EBV strains initiate cellular transformation and proliferation with\nvarying degrees of efficiency and consequently also report different malignancy\nrates.(65,71–73) Xu et al. (2019) observed an 11-fold increase in the risk of NPC progression\ndue to EBV isolates with a specific variant in the BALF2 gene, namely BALF2_CCT .(74)\nOther studies also demonstrate the impact of small genomic variations on lytic replication,\nprogression, and etiopathogenesis of NPC and other cancers.(53,75–79) Even SNPs may\nenhance oncogenic potential, illustrated by a single nucleotide substitution amplifying lytic\nreactivation.(80) Besides pathogenic potential, SNPs may also correlate with geographical\ndifferences. Patients with NPC in Japan demonstrated a unique EBV subtype with single\nnucleotide variations that varied from the ones prevalent in NPC-endemic regions like southern\nChina.(66) Importantly, the pathogenicity of a strain may correlate with cell infectivity and\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nspecificity. The M81 strain, isolated from a patient with NPC, preferentially infects epithelial cells\nand demonstrates a higher incidence of NPC.(78)\nEBER polymorphisms strongly associate with high-risk variants of NPC and appear more often\nin type 1 strains.(62,63) Different EBER subtypes also correspond to different rates of leukemia\nand myelodysplastic syndrome (MDS).(52) Different EBV strains may rely on different genes for\npathogenesis. For instance, the EBER2 mechanism, which accelerates cell division by\nupregulating UCH-L1 deubiquitinase and indirectly overexpressing cyclin B1 and Aurora kinase\nB, is more crucial for cellular transformation in the M81 strain than in others. Different cell types\nmay also exhibit different levels of EBER2 dependent proliferation as Li et al. (2021)\ndemonstrated with B cells and epithelial cells. Significantly, EBER2 may be indispensable for\nBurkitt lymphoma pathogenesis since every oncogene except EBNA1 typically remains\nsilent.(80) All told, these polymorphisms are noteworthy because detection protocols may rely\non dated EBER gene sequences, despite indications of greater heterogeneity than previously\nunderstood.\nCell Tropism\nCell/tissue tropism reflects the ability of a pathogen to selectively infect specific organs or a\ngroup of organs.(81)\nHPV genotypes show distinct cell tropism, preferentially infecting squamous and glandular\nepithelium.\nEBV primarily infects B cells and epithelial cells, and less frequently NK cells and T cells.(82)\nDifferent EBV strains may exhibit enhanced tropism for epithelial cells over B cells or vice versa.\nEpithelial-tropism of EBV, and glandular tropism in particular, remains under-explored and\nincompletely understood.(51,78)\nEBV Reference Genomes and Cell Lines\nThe NCBI lists two official reference genomes for EBV: B95-8 for type I and AG876 for type\nII.(83–85) The Raji strain, another widely used reference genome, was isolated from the Raji\ncell line.(59,86,87) Two common EBV cell lines are Raji and Namalwa.\nWhile the B95-8 strain was isolated from monkey lymphocytes infected with EBV from a patient\nwith infectious mononucleosis, the AG876 strain was isolated from patients in Africa with Burkitt\nlymphoma.(88–92) The Raji strain originated from an 11-year-old male with Burkitt\nlymphoma.(86)\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nThe Raji and Namalwa cell lines were also isolated from patients in Africa with Burkitt\nlymphoma.(86,89–92)\nThe first complete EBV genome derived from a patient with carcinoma, GD1 (GenBank\naccession AY961628), was published in 2006 but derived from saliva donated by a male\nCantonese patient in China with NPC and not derived from carcinoma cells.\nPotential EBV Detection Challenges in Adenocarcinomas\nHPV and EBV oncogenic models suggest that viral detection in adenocarcinomas may require\nprotocols accounting for low copy numbers, single nucleotide mismatches, and strain\nmultiplicity. Moreover, Arbach et al. (2006) concluded that EBV genomes may distribute\nunevenly in breast tumors, with one area containing high copy numbers while another yields low\ncopy numbers.(35) While the data does not claim these factors are unique to adenocarcinomas,\nit does suggest the need for higher specificity and sensitivity. Studies found that viral DNA in\nglandular cells may present in low copy numbers and trigger false negatives even with single\nnucleotide mismatches.(78,93,94) Furthermore, individuals may carry multiple EBV strains,\nwhich may suggest that isolates derived from saliva and non-tumor cells may not represent\nisolates in tumor cells.(58,95) This underscores the need to restrict reference strains to those\ncollected from cancer cells, avoiding strains such as GD1 that are isolated from saliva and\nnon-tumor cells.\nRNA Integrity Number (RIN)\nRNA Integrity Number (RIN) measures RNA integrity and ranges from 1 to 10. Scores of 1\nindicate completely degraded RNA while 10 indicates intact RNA. Although a RIN of 5 is\ngenerally acceptable for routine use, scores of 8 or higher are recommended for the most\nsensitive applications.(96,97) Low RIN values may compromise accuracy and reflect poor tissue\nquality or management.\nGiven the importance of accurate detection protocols, sequence specificity, and biomolecule\nintegrity in determining the association between EBV and breast cancer, our study aimed to\nreevaluate the methodologies and findings of prior research from American studies conducted in\nthe past 20 years. We sought to identify potential biases and gaps in the current understanding\nof this association and their implications on the reported association between EBV and breast\ncancer.\nMaterials and Methods\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nLiterature Search Methodology\nWe searched PubMed for studies spanning the last 20 years due to significant advancements in\nEpstein-Barr virus (EBV) research and availability of novel EBV genomic data over this time\nperiod.\nExcluded Included\nWebsite: https://pubmed.ncbi.nlm.nih.gov\nSearch term: (EBV) AND (breast cancer) 409\nExcluding studies before 27 November 2003 (older than 20 years) 118 291\nExcluding studies not in English 9 282\nExcluding non-human studies 47 235\nExcluding studies without the word \"breast\" or \"EBV\" in the abstract\nor title 48 187\nAfter screening titles and abstracts 187\nExcluding non-US studies based on title 37 150\nAfter screening for US studies based on title 150\nExcluding non-US studies from abstract/methods:\n- excluded if abstract/methods explicitly stated that results were\nbased on non-US samples 21 129\nExcluding studies not focused on:\n- detection of EBV in breast cancer, or\n- mechanism of EBV in breast cancer risk and progression 95 34\nAfter screening for EBV detection in breast tumors from US\npatients 34\nExcluding reviews, comments, meta-analyses, book chapters, case\nreports 15 19\nAfter screening for original research 19\nExcluding studies not conducting EBV detection or without direct\naccess to breast tumors from US patients 12 7\nAfter detailed screening for EBV detection studies with direct 7\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\naccess to breast tumors from US patients\nFinal list 7\nReference Genome Analysis\nGiven that not all studies published their reference genomes, we analyzed the complete EBV\ngenomes available prior to certain designated study publication years, 2006 and 2012, in an\neffort to determine whether EBV strains derived from adenocarcinoma cells were used.\nPre-2006 EBV Genomes\nBecause 5/7 (71%) studies were published before 2006 or used EBV sequences from a study\npublished before 2006, we first identified and analyzed the complete EBV genomes available\nbefore 2006. For this purpose, we queried NCBI GenBank for viral genomic DNA related to EBV\n(taxonomy ID 10376), published between 1970 and 2006, of reasonable length for complete\nEBV genomes, and excluded entries labeled with terms indicating non-complete genomes.\nT o reproduce our results:\n1. Visit https://www.ncbi.nlm.nih.gov/nuccore\n2. Use this search query:\ntxid10376[Organism:noexp] AND (viruses[filter] AND biomol_genomic[PROP] AND\nddbj_embl_genbank[filter] AND (\"150000\"[SLEN] : \"500000\"[SLEN])) AND (\"1970/01/01\"[PDAT]\n: \"2006/01/01\"[PDAT]) NOT (\"partial genome\"[Title] OR \"nearly complete genome\"[Title])\nPre-2012 EBV Genomes\nBecause one study was published during or after 2006 but before 2012, we also identified and\nanalyzed the complete EBV genomes available before 2012. For this purpose, we used the\nsame query for pre-2006 EBV genomes but updated the date filters.\nT o reproduce our results:\n1. Visit https://www.ncbi.nlm.nih.gov/nuccore\n2. Use this search query:\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\ntxid10376[Organism:noexp] AND (viruses[filter] AND biomol_genomic[PROP] AND\nddbj_embl_genbank[filter] AND (\"150000\"[SLEN] : \"500000\"[SLEN])) AND (\"1970/01/01\"[PDAT]\n: \"2012/01/01\"[PDAT]) NOT (\"partial genome\"[Title] OR \"nearly complete genome\"[Title])\nSequence Analysis\nThe analysis focused on identifying and reporting the number of complete EBV genomes that\nshowed exact matches to the sequences utilized in each study. This was achieved by\ncomparing the complete genome sequences in the dataset against the reference sequences\nfrom the studies.\nT o accomplish this, we searched for EBV Genomes available in 2024 as outlined below and\ndownloaded all the complete genomes in FASTA format.\nNext, we compiled the EBV sequences used in each study’s detection protocol.\nOne issue was that some studies did not label sequence orientation. T o avoid overstating\nmismatches and to adopt the same algorithm for all studies, we analyzed both the original\nsequence from the study and its reverse complement.\nWe executed the algorithm below:\n1. For a given study sequence, remove white space and label the sequence, “Original.”\n2. Generate the reverse complement of “Original” and label this sequence, “RC.”\n3. For “Original,” identify the number of EBV genomes with exact matches.\n4. Repeat step 3 for “RC.”\n5. For each “Original” and “RC” pair, report the higher number of exact matches.\n6. Repeat for all sequences.\nPython version 3.12.5 and Biopython version 1.81 were used.\nCode is available at https://github.com/HotpotBio.\n2024 EBV Genomes\nT o identify complete EBV genomes available in 2024, we used the same query for pre-2012\nEBV genomes but removed the date filters.\nT o reproduce our results:\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\n1. Visit https://www.ncbi.nlm.nih.gov/nuccore.\n2. Use this search query:\ntxid10376[Organism:noexp] AND (viruses[filter] AND biomol_genomic[PROP] AND\nddbj_embl_genbank[filter] AND (\"150000\"[SLEN] : \"500000\"[SLEN])) NOT (\"partial genome\"[Title] OR\n\"nearly complete genome\"[Title])\nResults\nDetection Protocols\n0/7 (0%) studies utilized sequences of EBV strains extracted from adenocarcinoma cells.\n7/7 (100%) studies employed either the Raji or Namalwa cell line as positive controls. Both are\nderived from EBV-associated Burkitt lymphoma in African patients.\n6/7 (86%) of studies either used the B95-8 strain as the reference genome, were published\nbefore 2006, or reused sequences from a pre-2006 study. Because the first EBV genome\nderived from a patient with carcinoma, the GD1 strain, was released in 2006, prior studies\nnecessarily featured lymphoma-derived strains. The one study published after GD1 did not\nreport its reference genome but selected Raji for its positive control. Even if this study used\nGD1, the reference genome would represent an isolate extracted from saliva and not cancer\ncells, much less adenocarcinoma cells.\nCollectively, this data demonstrates that none of the studies included carcinoma-derived strains,\nmuch less adenocarcinoma-derived strains.\nStudy Authors,\nYear\nPublished\nReference\nGenome\nPositive\nControl\nPublished Before 1st\nCarcinoma-Derived\nGenome?\nAbsence of the Epstein-Barr virus\ngenome in breast cancer-derived\ncell line(98)\nSpeck P . et al,\n2003\n- Namalwa Yes\nLytic viral replication as a\ncontributor to the detection of\nEpstein-Barr virus in breast\ncancer(99)\nHuang J.,\n2003\nB95-8, Raji Namalwa Yes\nReal-time PCR measures\nEpstein-Barr Virus DNA in\nThorne L.,\n2005\n- Namalwa,\nRaji\nYes\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\narchival breast\nadenocarcinomas(100)\nLack of association between EBV\nand breast carcinoma(101)\nPerrijoue J.,\n2005\n- Raji Yes\nAnalysis of Epstein-Barr virus\nreservoirs in paired blood and\nbreast cancer primary biopsy\nspecimens by real time\nPCR(102)\nPerkins S.,\n2006\nB95-8 Namalwa,\nDaudi\n-\nEpstein-Barr virus is seldom\nfound in mammary epithelium of\nbreast cancer tissue using in situ\nmolecular methods(103)\nBaltzell K.,\n2012\n- Raji No\nVariation in risk and outcomes of\nEpstein-Barr virus-associated\nbreast cancer by epidemiologic\ncharacteristics and virus\ndetection strategies: an\nexploratory study(104)\nGlaser S.,\n2017\n- Namalwa Yes*\nTable 1: Summary of reference genomes and positive controls. False negative results are\nmore likely without suitable reference genomes and positive controls. EBV and HPV data\nsuggests that utilizing adenocarcinoma-derived strains would mitigate the risk of false negatives\nwhen detecting EBV in breast cancer cells. However, all studies either used the B95-8 or Raji\nstrain as reference genomes; the Namalwa, Raji, or Daudi cell lines as positive controls; or\nsequences available before the first carcinoma genome was published in 2006. This necessarily\nmeans no studies used adenocarcinoma-derived strains.\n- This indicates that the data was not available or not possible to deduce.\n* This study reused sequences from a 2005 study, so we considered the publication date as\nequivalent to pre-2006 within the context of reference genomes.(100)\nSequence Analysis\n7/7 (100%) studies were published before 2012 or used sequences from a study published\nbefore 2012. Only ten complete EBV genomes were available before 2012, representing 2% of\nthe 512 complete EBV genomes available in 2024. This means the detection assay sequences\nin these studies were selected before 98% of the NCBI GenBank entries became available.\n5/7 (71%) studies were either published before 2006 or used sequences from a study published\nbefore 2006. Only four complete EBV genomes were available before 2006, representing less\nthan 1% of the genomes available in 2024.\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\n5/7 (71%) studies used at least one sequence that did not exactly match more than 50% of EBV\ngenomes. Notably, every study contained at least one sequence that did not exactly match more\nthan 25% of EBV genomes.\nTable 2 lists the assay sequence for each study with the most number of EBV genomes that did\nnot exactly match. See Supplementary Table 1 for full results of this analysis.\nStudy T arget Oligonucleotide Sequence Genomes\nWithout Exact\nMatches\nAbsence of the Epstein-Barr\nvirus genome in breast\ncancer-derived cell lines(98)\nLMP2 -\nPS004\nCTTCTGTACGCTAGTATCAGGAGC 285\n(56%)\nLytic viral replication as a\ncontributor to the detection of\nEpstein-Barr virus in breast\ncancer(99)\nLMP1 -\nL1\nCTGAGATCTATGGAACACGACCTTGAG 512\n(100%)\nReal-time PCR measures\nEpstein-Barr Virus DNA in\narchival breast\nadenocarcinomas(100)\nEBNA1 -\nProbe\nAGGGAGACACATCTGGACCAGAAGGC 421\n(82%)\nLack of association between\nEBV and breast\ncarcinoma(101)\nBALF 5 -\nForward\nPrimer\nCGGAAGCCCTCTGGACTTC 276\n(54%)\nAnalysis of Epstein-Barr virus\nreservoirs in paired blood and\nbreast cancer primary biopsy\nspecimens by real time\nPCR(102)\nBAMHIW\n- Forward\nPrimer\nCCCAACACTCCACCACACC 130\n(25%)\nEpstein-Barr virus is seldom\nfound in mammary epithelium\nof breast cancer tissue using\nin situ molecular\nmethods(103)\nBamH1\nW - 2\nACGTAAACGCGCTGGACTG 129\n(25%)\nVariation in risk and outcomes\nof Epstein-Barr\nvirus-associated breast cancer\nby epidemiologic\ncharacteristics and virus\ndetection strategies: an\nexploratory study(104)\n* * *\nTable 2: Summary of Genome Exact Match Analysis. 5/7 (71%) studies used at least one\nsequence that did not exactly match more than 50% of EBV genomes. Notably, every study\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\ncontained at least one sequence that did not exactly match more than 25% of EBV genomes.\nThese sequences may be less widely conserved than believed and potentially suboptimal for\ndetecting novel variants. Percentages are based on the 512 complete genomes available in\nMay 2024 in NCBI GenBank. This table highlights the sequence for each study with the most\nnumber of EBV genomes that did not exactly match. See Supplementary Table 1 for full results\nof the genome-sequence analysis.\n* This study reused sequences from a 2005 study.(100)\nBiomolecule Integrity\n0/7 (0%) of studies reported RIN values despite 5/7 (71%) of studies targeting non-coding RNA\nin their detection protocols.\nDiscussion\nThis study aimed to reevaluate the association between EBV and breast cancer by analyzing\nthe methodologies and findings of previous research in the context of current genomic data and\nadvanced detection techniques. The results suggest limitations in prior detection protocols. Our\nanalysis highlights several issues, including the potential for false negatives due to reliance on\nlymphoma-derived strains, overestimating sequence conservation of detection assay\nsequences, and inadequate addressing of biomolecule integrity, all of which raise concerns\nabout the current understanding of EBV's role in breast cancer.\nLymphoma-biased Detection Protocols\nFalse negative results in detection assays are more likely without appropriate reference\ngenomes and positive controls.\nAll the selected studies relied on the B95-8 and Raji strains, Namalwa, Raji, and Daudi cell\nlines, or non-carcinoma-derived sequences. This indicates that every one of their detection\nprotocols exclusively relied on lymphoma-derived strains that may not be representative of the\nstrains infective toward breast cancer cells. Given that breast cancers are predominantly\nadenocarcinomas, utilizing strains extracted from adenocarcinoma cells as reference genomes\nand positive controls would potentially mitigate the risk of false negatives.\nThere is insufficient evidence to justify the use of lymphoma-derived strains in these detection\nprotocols. In fact, the current knowledge on EBV and HPV challenges this assumption since\ndifferent genotypes vary in their pathogenic potential and cell tropism. Notably, only about 5% of\nHPV genotypes are carcinogenic and a certain EBV strain, namely BALF2_CCT , has\ndemonstrated a 11-times greater risk of NPC due partially to preferential infection of epithelial\ncells. In fact, even within adenocarcinoma cells it has been demonstrated that the presence of\nEBV depends on the grade of differentiation, as EBV-detection rates were 8.3% for\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nwell-differentiated, 47.2% for moderately differentiated, and 27.6% for poorly differentiated lung\nadenocarcinomas.(105)\nMoreover, the cellular origin of these strains were not only non-glandular and non-epithelial, but\nin fact non-oncogenic in some cases. The concurrent presence of multiple EBV strains within\nthe same individual suggests that the EBV isolates in cancer cells may differ from those in the\nnon-cancer cells. This underscores the need to restrict reference strains of detection assays to\nthose derived from tumor cells, avoiding ones obtained from saliva and non-tumor cells such as\nGD1.\nEven when utilizing reference genomes and positive controls derived from adenocarcinoma\ncells, appropriate measures to consider divergent mutations may be necessary to detect novel\nvariants specific to breast glandular cells.\nUnvalidated Sequence Conservation\nKim et al. (2017) observed that “strain variation exists in the EBV genome … such that primers\nfor PCR amplification should target highly conserved sequences in the genome to enable\nreliable quantification of EBV DNA across different EBV strains/isolates/regional variants.”(106)\nHowever, the selected studies may have potentially overestimated sequence conservation.\nAssumptions about EBV sequence conservation merit revalidation given the mounting literature\ndemonstrating greater genomic variation than previously believed, particularly in key coding and\nnon-coding regions. Our analysis reinforces this trend, reporting that 5/7 (71%) studies used at\nleast one assay sequence that did not exactly match more than 50% of EBV genomes.\nMoreover, 98% of these GenBank entries became available after assay sequences were\nselected. Because every study targeted multiple sequences, mismatches in one sequence does\nnot invalidate the detection protocol. However, it highlights the need to verify sequence\nconservation and ensure that protocols reflect the latest genomic data to minimize the risk of\noverlooking strains potentially tropic to breast cancer cells.\nMoreover, while one mismatch is acceptable under the right conditions, the current knowledge\non oncoviruses indicates that detecting viruses in adenocarcinomas may require greater\nsensitivity and specificity. Giannella et al. report that viral DNA may present in lower copy\nnumbers in glandular cells compared to squamous cells and that even single mismatches may\ntrigger false negatives. While this has been demonstrated only in HPV, it may also apply to EBV\nassociated-carcinomas and underscores the need to use the most conserved sequences.(107)\nFurthermore, one mismatch may lead to lower-reported copies of EBV, which could\nunderestimate the viral load.\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nUnverified Biomolecule Integrity\nWhile the gold standard for EBV detection entails EBER in-situ hybridization (EBER-ISH), low\nRIN scores may compromise the accuracy of such RNA-based assays. Given the higher\nsusceptibility of RNA for degradation due to its single-stranded nature and ubiquitous presence\nof RNases, ensuring high-quality RNA is paramount. RNA degradation not only reduces the\nnumber of EBER molecules but may also impair probe specificity by fragmenting RNA and\naltering secondary structures.\n5/7 (71%) of studies targeted non-coding RNA, but none of them validated biomolecule quality\nin tissue samples. While some of these studies used GAPDH detection as a surrogate for RNA\nintegrity, RIN scores are a more accurate method of determining RNA integrity. And without\nadequate validation of biomolecule integrity, it is difficult to determine if the negative results\nstemmed from sample degradation or absence of EBV.\nConclusion\nIn conclusion, we observed a potential risk of failing to detect novel EBV strains in breast tumors\nbased on multiple considerations: lymphoma-biased detection protocols, unvalidated sequence\nconservation, and unverified biomarker quality. This implies that the current understanding of\nassociation between EBV and breast cancer may remain not only incomplete but possibly\nincorrect.\nGiven the complex heterogeneity of breast cancer with diverse molecular and histological\nsubtypes such as BRCA1, BRCA2, and TNBC, EBV association with all subtypes is improbable.\nNonetheless, should breast cancer mirror gastric carcinoma and reveal viral influence in certain\nsubtypes at certain stages -- initiation, progression, or therapeutic-resistance -- these insights\ncould enable targeted therapies and screening programs. Therefore, we urge renewed\ninvestigations into the association between EBV and breast cancer based on gold standard\ndetection protocols that account for novel strains and breast glandular tropism.\nLimitations\nFirstly, it is likely that EBV does not influence breast cancer pathogenesis or therapeutic\nresponse in American patients. Even if an association is found, the complex heterogeneity of\nbreast cancer with diverse molecular and histological subtypes such as BRCA1, BRCA2, and\nTNBC suggests that any association may be limited in scope. Moreover, the relationship may be\nnon-causative or immaterial to pathogenesis.\nSecondly, reports of EBV association with breast cancer may stem from false positive results\ndue to materials contaminated with EBV, cross-reaction with other markers, or inappropriate\ndetection methods.\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nThirdly, it is possible that pre-2006 or pre-2012 genome sequences from lymphoma-derived\nstrains are suitable for detecting oncogenic variants in breast adenocarcinomas. Moreover, HPV\nand EBV are distinct viruses, and parallels between them may not apply.\nData Availability\nAll data underlying our research can be found or reproduced in these sections: Materials and\nMethods and Supplementary Materials.\nInstructions for accessing the code supporting the genome-sequence analysis can be found\nunder Materials and Methods.\nConflicts of Interest Statement\nThe authors have no conflicts of interest to declare.\nFunding\nThis work was supported by Hotpot.ai.\nAcknowledgements\nThe funder, Hotpot.ai, through its founder and senior author C.H., played a role in the design of\nthe study; the collection, analysis, and interpretation of the data; the writing of the manuscript;\nand the decision to submit the manuscript for publication.\nReferences\n1. Plummer M, De Martel C, Vignat J, Ferlay J, Bray F , Franceschi S. Global burden of cancers\nattributable to infections in 2012: a synthetic analysis. Lancet Glob Health. 2016\nSep;4(9):e609–16.\n2. Zapatka M, Borozan I, Brewer DS, Iskar M, Grundhoff A, Alawi M, et al. The landscape of\nviral associations in human cancers. Nat Genet. 2020 Mar 2;52(3):320–30.\n3. Rossi NM, Dai J, Xie Y , Lou H, Boland JF , Yeager M, et al. Extrachromosomal Amplification\nof Human Papillomavirus Episomes as a Mechanism of Cervical Carcinogenesis [Internet].\n2021 [cited 2024 Jun 26]. Available from:\nhttp://biorxiv.org/lookup/doi/10.1101/2021.10.22.465367\n4. Aninye IO, Berry-Lawhorn JM, Blumenthal P , Felder T , Jay N, Merrill J, et al. Gaps and\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nOpportunities to Improve Prevention of Human Papillomavirus-Related Cancers. J Womens\nHealth. 2021 Dec 1;30(12):1667–72.\n5. Kennedy G, Komano J, Sugden B. Epstein-Barr virus provides a survival factor to Burkitt’s\nlymphomas. Proc Natl Acad Sci. 2003 Nov 25;100(24):14269–74.\n6. Sausen DG, Basith A, Muqeemuddin S. EBV and Lymphomagenesis. Cancers. 2023 Apr\n4;15(7):2133.\n7. Sun K, Jia K, Lv H, Wang SQ, Wu Y , Lei H, et al. EBV-Positive Gastric Cancer: Current\nKnowledge and Future Perspectives. Front Oncol. 2020 Dec 14;10:583463.\n8. Jary A, Veyri M, Gothland A, Leducq V, Calvez V, Marcelin AG. Kaposi’s\nSarcoma-Associated Herpesvirus, the Etiological Agent of All Epidemiological Forms of\nKaposi’s Sarcoma. Cancers. 2021 Dec 9;13(24):6208.\n9. Yang T , You C, Meng S, Lai Z, Ai W, Zhang J. EBV Infection and Its Regulated Metabolic\nReprogramming in Nasopharyngeal Tumorigenesis. Front Cell Infect Microbiol. 2022 Jul\n1;12:935205.\n10. Yuan L, Li S, Chen Q, Xia T , Luo D, Li L, et al. EBV infection-induced GPX4 promotes\nchemoresistance and tumor progression in nasopharyngeal carcinoma. Cell Death Differ.\n2022 Aug;29(8):1513–27.\n11. Hau PM, Lung HL, Wu M, T sang CM, Wong KL, Mak NK, et al. T argeting Epstein-Barr Virus\nin Nasopharyngeal Carcinoma. Front Oncol. 2020 May 14;10:600.\n12. Kirtane K, St John M, Fuentes-Bayne H, Patel SP , Mardiros A, Xu H, et al. Genomic\nImmune Evasion: Diagnostic and Therapeutic Opportunities in Head and Neck Squamous\nCell Carcinomas. J Clin Med. 2022 Dec 7;11(24):7259.\n13. Suresh A, Dhanasekaran R. Implications of genetic heterogeneity in hepatocellular cancer.\nAdv Cancer Res. 2022;156:103–35.\n14. Ruf IK, Rhyne PW, Yang H, Borza CM, Hutt-Fletcher LM, Cleveland JL, et al. Epstein-Barr\nVirus Regulates c-MYC, Apoptosis, and Tumorigenicity in Burkitt Lymphoma. Mol Cell Biol.\n1999 Mar 1;19(3):1651–60.\n15. Prusinkiewicz MA, Mymryk JS. Metabolic Control by DNA Tumor Virus-Encoded Proteins.\nPathogens. 2021 May 6;10(5):560.\n16. Beer S, Wange LE, Zhang X, Kuklik-Roos C, Enard W, Hammerschmidt W, et al.\nEBNA2-EBF1 complexes promote MYC expression and metabolic processes driving\nS-phase progression of Epstein-Barr virus–infected B cells. Proc Natl Acad Sci. 2022 Jul\n26;119(30):e2200512119.\n17. Wang LW, Shen H, Nobre L, Ersing I, Paulo JA, Trudeau S, et al.\nEpstein-Barr-Virus-Induced One-Carbon Metabolism Drives B Cell Transformation. Cell\nMetab. 2019 Sep;30(3):539-555.e11.\n18. Aloni-Grinstein R, Charni-Natan M, Solomon H, Rotter V. p53 and the Viral Connection:\nBack into the Future ‡. Cancers. 2018 Jun 4;10(6):178.\n19. Saridakis V, Sheng Y , Sarkari F , Holowaty MN, Shire K, Nguyen T , et al. Structure of the p53\nBinding Domain of HAUSP/USP7 Bound to Epstein-Barr Nuclear Antigen 1. Mol Cell. 2005\nApr;18(1):25–36.\n20. Schönrich G, Raftery MJ. The PD-1/PD-L1 Axis and Virus Infections: A Delicate Balance.\nFront Cell Infect Microbiol. 2019 Jun 13;9:207.\n21. Sasaki S, Nishikawa J, Sakai K, Iizasa H, Yoshiyama H, Yanagihara M, et al.\nEBV-associated gastric cancer evades T-cell immunity by PD-1/PD-L1 interactions. Gastric\nCancer. 2019 May;22(3):486–96.\n22. Wang J, Ge J, Wang Y , Xiong F , Guo J, Jiang X, et al. EBV miRNAs BART11 and\nBART17-3p promote immune escape through the enhancer-mediated transcription of\nPD-L1. Nat Commun. 2022 Feb 14;13(1):866.\n23. Bi XW, Wang H, Zhang WW, Xia Z, Zhang Y jing, Wang L. PD-L1 Is up-Regulated By\nEBV-Driven LMP1 through NF-κb Pathway and Correlates with Poor Prognosis in Natural\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nKiller/T-Cell Lymphoma. Blood. 2016 Dec 2;128(22):4134–4134.\n24. Nakano H, Saito M, Nakajima S, Saito K, Nakayama Y , Kase K, et al. PD-L1 overexpression\nin EBV-positive gastric cancer is caused by unique genomic or epigenomic mechanisms. Sci\nRep. 2021 Jan 21;11(1):1982.\n25. Yanagi Y , Hara Y , Mabuchi S, Watanabe T , Sato Y , Kimura H, et al. PD-L1 upregulation by\nlytic induction of Epstein-Barr Virus. Virology. 2022 Mar;568:31–40.\n26. Polansky H, Schwab H. How latent viruses cause breast cancer: An explanation based on\nthe microcompetition model. Bosn J Basic Med Sci [Internet]. 2018 Dec 23 [cited 2024 Jun\n26]; Available from: http://www.bjbms.org/ojs/index.php/bjbms/article/view/3950\n27. Friedenson B. In BRCA1 and BRCA2 breast cancers, chromosome breaks occur near\nherpes tumor virus sequences [Internet]. 2021 [cited 2024 Jun 26]. Available from:\nhttp://biorxiv.org/lookup/doi/10.1101/2021.04.19.440499\n28. Lai KM, Lee WL. The roles of epidermal growth factor receptor in viral infections. Growth\nFactors. 2022 May 4;40(1–2):46–72.\n29. Ho J, Moyes DL, T avassoli M, Naglik JR. The Role of ErbB Receptors in Infection. Trends\nMicrobiol. 2017 Nov;25(11):942–52.\n30. Pekkonen P , Järviluoma A, Zinovkina N, Cvrljevic A, Prakash S, Westermarck J, et al.\nKSHV viral cyclin interferes with T-cell development and induces lymphoma through Cdk6\nand Notch activation in vivo. Cell Cycle. 2014 Dec;13(23):3670–84.\n31. Komatsu H, Imadome KI, Shibayama H, Yada T , Yamada M, Yamamoto K, et al. STAT3 Is\nActivated By EBV in T or NK Cells Leading to Development of\nEBV-T/NK-Lymphoproliferative Disorders. Blood. 2014 Dec 6;124(21):3026–3026.\n32. Li JSZ, Abbasi A, Kim DH, Lippman SM, Alexandrov LB, Cleveland DW. Chromosomal\nfragile site breakage by EBV-encoded EBNA1 at clustered repeats. Nature. 2023 Apr\n20;616(7957):504–9.\n33. Portis T , Longnecker R. Epstein–Barr virus (EBV) LMP2A mediates B-lymphocyte survival\nthrough constitutive activation of the Ras/PI3K/Akt pathway. Oncogene. 2004 Nov\n11;23(53):8619–28.\n34. Vaysberg M, Lambert SL, Krams SM, Martinez OM. Activation of the JAK/STAT Pathway in\nEpstein Barr Virus+-Associated Posttransplant Lymphoproliferative Disease: Role of\nInterferon-γ. Am J Transplant. 2009 Oct;9(10):2292–302.\n35. Arbach H, Viglasky V, Lefeu F , Guinebretière JM, Ramirez V, Bride N, et al. Epstein-Barr\nVirus (EBV) Genome and Expression in Breast Cancer Tissue: Effect of EBV Infection of\nBreast Cancer Cells on Resistance to Paclitaxel (T axol). J Virol. 2006 Jan 15;80(2):845–53.\n36. Rüeger S, Hammer C, Loetscher A, McLaren PJ, Lawless D, Naret O, et al. The influence of\nhuman genetic variation on Epstein–Barr virus sequence diversity. Sci Rep. 2021 Feb\n25;11(1):4586.\n37. Balfour HH, Sifakis F , Sliman JA, Knight JA, Schmeling DO, Thomas W. Age-specific\nprevalence of Epstein-Barr virus infection among individuals aged 6-19 years in the United\nStates and factors affecting its acquisition. J Infect Dis. 2013 Oct 15;208(8):1286–93.\n38. Robinson WH, Steinman L. Epstein-Barr virus and multiple sclerosis. Science. 2022 Jan\n21;375(6578):264–5.\n39. Soldan SS, Lieberman PM. Epstein–Barr virus and multiple sclerosis. Nat Rev Microbiol.\n2023 Jan;21(1):51–64.\n40. Proceedings of the IARC Working Group on the Evaluation of Carcinogenic Risks to\nHumans. Epstein-Barr Virus and Kaposi’s Sarcoma Herpesvirus/Human Herpesvirus 8.\nLyon, France, 17-24 June 1997. Iarc Monogr Eval Carcinog Risks Hum. 1997;70:1–492.\n41. Farahmand M, Monavari SH, Shoja Z, Ghaffari H, T avakoli M, T avakoli A. Epstein–Barr\nVirus and Risk of Breast Cancer: A Systematic Review and Meta-Analysis. Future Oncol.\n2019 Aug 31;15(24):2873–85.\n42. Arias-Calvachi C, Blanco R, Calaf GM, Aguayo F . Epstein–Barr Virus Association with\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nBreast Cancer: Evidence and Perspectives. Biology. 2022 May 24;11(6):799.\n43. Sinclair AJ, Moalwi MH, Amoaten T . Is EBV Associated with Breast Cancer in Specific\nGeographic Locations? Cancers. 2021 Feb 16;13(4):819.\n44. Gupta I, Ulamec M, Peric-Balja M, Ramic S, Al Moustafa AE, Vranic S, et al. Presence of\nhigh-risk HPVs, EBV, and MMTV in human triple-negative breast cancer. Hum Vaccines\nImmunother. 2021 Nov 2;17(11):4457–66.\n45. Mekrazi S, Kallel I, Jamai D, Yengui M, Khabir A, Gdoura R. Epstein-Barr virus in breast\ncarcinoma and in triple negative cases impact on clinical outcomes. Pathol Res Pract. 2023\nMay;245:154484.\n46. Hu H, Luo ML, Desmedt C, Nabavi S, Yadegarynia S, Hong A, et al. Epstein-Barr Virus\nInfection of Mammary Epithelial Cells Promotes Malignant Transformation. EBioMedicine.\n2016 Jul;9:148–60.\n47. Farrell PJ. Epstein–Barr Virus and Cancer. Annu Rev Pathol Mech Dis. 2019 Jan\n24;14(1):29–53.\n48. Nanbo A, Inoue K, Adachi-T akasawa K, T akada K. Epstein–Barr virus RNA confers\nresistance to interferon-α-induced apoptosis in Burkitt’s lymphoma. EMBO J. 2002 Mar\n1;21(5):954.\n49. Kitagawa N, Goto M, Kurozumi K, Maruo S, Fukayama M, Naoe T , et al. Epstein–Barr\nvirus-encoded poly(A)– RNA supports Burkitt’s lymphoma growth through interleukin-10\ninduction. EMBO J. 2000 Dec 15;19(24):6742.\n50. Farrell PJ, White RE. Do Epstein–Barr Virus Mutations and Natural Genome Sequence\nVariations Contribute to Disease? Biomolecules. 2021 Dec 23;12(1):17.\n51. Borozan I, Zapatka M, Frappier L, Ferretti V. Analysis of Epstein-Barr Virus Genomes and\nExpression Profiles in Gastric Adenocarcinoma. Longnecker RM, editor. J Virol. 2018 Jan\n15;92(2):e01239-17.\n52. Wang HY , Sun L, Li P , Liu W, Zhang ZG, Luo B. Sequence Variations of Epstein-Barr\nVirus-Encoded Small Noncoding RNA and Latent Membrane Protein 1 in Hematologic\nTumors in Northern China. Intervirology. 2021;64(2):69–80.\n53. Young LS. A novel Epstein‐ Barr virus subtype associated with nasopharyngeal carcinoma\nfound in South China. Cancer Commun. 2020 Jan;40(1):60–2.\n54. Kwok H, Chiang A. From Conventional to Next Generation Sequencing of Epstein-Barr\nVirus Genomes. Viruses. 2016 Feb 24;8(3):60.\n55. Young LS, Yap LF , Murray PG. Epstein-Barr virus: more than 50 years old and still providing\nsurprises. Nat Rev Cancer. 2016 Dec;16(12):789–802.\n56. Tu C, Zeng Z, Qi P , Li X, Guo C, Xiong F , et al. Identification of genomic alterations in\nnasopharyngeal carcinoma and nasopharyngeal carcinoma-derived Epstein–Barr virus by\nwhole-genome sequencing. Carcinogenesis. 2018 Dec 31;39(12):1517–28.\n57. Fitzpatrick MB, Hahn Z, Mandishora RSD, Dao J, Weber J, Huang C, et al. Whole-Genome\nAnalysis of Cervical Human Papillomavirus Type 35 from rural Zimbabwean Women. Sci\nRep. 2020 Apr 24;10(1):7001.\n58. Kanda T , Yajima M, Ikuta K. Epstein‐ Barr virus strain variation and cancer. Cancer Sci.\n2019 Apr;110(4):1132–9.\n59. Palser AL, Grayson NE, White RE, Corton C, Correia S, Ba Abdullah MM, et al. Genome\nDiversity of Epstein-Barr Virus from Multiple Tumor Types and Normal Infection. Longnecker\nRM, editor. J Virol. 2015 May 15;89(10):5222–37.\n60. Santpere G, Darre F , Blanco S, Alcami A, Villoslada P , Mar Albà M, et al. Genome-Wide\nAnalysis of Wild-Type Epstein–Barr Virus Genomes Derived from Healthy Individuals of the\n1000 Genomes Project. Genome Biol Evol. 2014 Apr;6(4):846–60.\n61. Tzellos S, Farrell P . Epstein-Barr Virus Sequence Variation—Biology and Disease.\nPathogens. 2012 Nov 8;1(2):156–74.\n62. Hui KF , Chan TF , Yang W, Shen JJ, Lam KP , Kwok H, et al. High risk Epstein‐ Barr virus\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nvariants characterized by distinct polymorphisms in the EBER locus are strongly associated\nwith nasopharyngeal carcinoma. Int J Cancer. 2019 Jun 15;144(12):3031–42.\n63. Wang Y , Zhang X, Chao Y , Jia Y , Xing X, Luo B. New variations of Epstein–Barr\nvirus‐encoded small RNA genes in nasopharyngeal carcinomas, gastric carcinomas, and\nhealthy donors in northern China. J Med Virol. 2010 May;82(5):829–36.\n64. Wang Y , Ungerleider N, Hoffman BA, Kara M, Farrell PJ, Flemington EK, et al. A\nPolymorphism in the Epstein-Barr Virus EBER2 Noncoding RNA Drives In Vivo Expansion\nof Latently Infected B Cells. Ackerman ME, editor. mBio. 2022 Jun 28;13(3):e00836-22.\n65. Salnikov MY , MacNeil KM, Mymryk JS. The viral etiology of EBV-associated gastric cancers\ncontributes to their unique pathology, clinical outcomes, treatment responses and immune\nlandscape. Front Immunol. 2024 Mar 26;15:1358511.\n66. Kondo S, Okuno Y , Murata T , Dochi H, Wakisaka N, Mizokami H, et al. EBV genome\nvariations enhance clinicopathological features of nasopharyngeal carcinoma in a\nnon‐endemic region. Cancer Sci. 2022 Jul;113(7):2446–56.\n67. Dheekollu J, Malecka K, Wiedmer A, Delecluse HJ, Chiang AKS, Altieri DC, et al.\nCarcinoma-risk variant of EBNA1 deregulates Epstein-Barr Virus episomal latency.\nOncotarget. 2017 Jan 31;8(5):7248–64.\n68. Bristol JA, Djavadian R, Albright ER, Coleman CB, Ohashi M, Hayes M, et al. A\ncancer-associated Epstein-Barr virus BZLF1 promoter variant enhances lytic infection.\nFlemington EK, editor. PLOS Pathog. 2018 Jul 27;14(7):e1007179.\n69. Liu Y , Yang W, Pan Y , Ji J, Lu Z, Ke Y . Genome-wide analysis of Epstein-Barr virus (EBV)\nisolated from EBV-associated gastric carcinoma (EBVaGC). Oncotarget. 2016 Jan\n26;7(4):4903–14.\n70. Sousa H, T avares A, Campos C, Marinho-Dias J, Brito M, Medeiros R, et al. High-Risk\nhuman papillomavirus genotype distribution in the Northern region of Portugal: Data from\nregional cervical cancer screening program. Papillomavirus Res. 2019 Dec;8:100179.\n71. Romero-Masters JC, Huebner SM, Ohashi M, Bristol JA, Benner BE, Barlow EA, et al. B\ncells infected with Type 2 Epstein-Barr virus (EBV) have increased NFAT c1/NFAT c2 activity\nand enhanced lytic gene expression in comparison to Type 1 EBV infection. Swaminathan\nS, editor. PLOS Pathog. 2020 Feb 14;16(2):e1008365.\n72. Singh DR, Nelson SE, Pawelski AS, Cantres-Velez JA, Kansra AS, Pauly NP , et al. Type 1\nand Type 2 Epstein-Barr viruses induce proliferation, and inhibit differentiation, in infected\ntelomerase-immortalized normal oral keratinocytes. Sample CE, editor. PLOS Pathog. 2022\nOct 3;18(10):e1010868.\n73. Rickinson AB, Young LS, Rowe M. Influence of the Epstein-Barr virus nuclear antigen EBNA\n2 on the growth phenotype of virus-transformed B cells. J Virol. 1987 May;61(5):1310–7.\n74. Xu M, Yao Y , Chen H, Zhang S, Cao SM, Zhang Z, et al. Genome sequencing analysis\nidentifies Epstein-Barr virus subtypes associated with high risk of nasopharyngeal\ncarcinoma. Nat Genet. 2019 Jul;51(7):1131–6.\n75. Kwok H, Wu CW, Palser AL, Kellam P , Sham PC, Kwong DLW, et al. Genomic Diversity of\nEpstein-Barr Virus Genomes Isolated from Primary Nasopharyngeal Carcinoma Biopsy\nSamples. Hutt-Fletcher LM, editor. J Virol. 2014 Sep 15;88(18):10662–72.\n76. Correia S, Bridges R, Wegner F , Venturini C, Palser A, Middeldorp JM, et al. Sequence\nVariation of Epstein-Barr Virus: Viral Types, Geography, Codon Usage, and Diseases.\nLongnecker RM, editor. J Virol. 2018 Nov 15;92(22):e01132-18.\n77. Xue WQ, Wang TM, Huang JW, Zhang JB, He YQ, Wu ZY , et al. A comprehensive analysis\nof genetic diversity of EBV reveals potential high-risk subtypes associated with\nnasopharyngeal carcinoma in China. Virus Evol. 2021 Jan 20;7(1):veab010.\n78. T sai MH, Raykova A, Klinke O, Bernhardt K, Gärtner K, Leung CS, et al. Spontaneous Lytic\nReplication and Epitheliotropism Define an Epstein-Barr Virus Strain Found in Carcinomas.\nCell Rep. 2013 Oct;5(2):458–70.\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\n79. White RE, Rämer PC, Naresh KN, Meixlsperger S, Pinaud L, Rooney C, et al.\nEBNA3B-deficient EBV promotes B cell lymphomagenesis in humanized mice and is found\nin human tumors. J Clin Invest. 2012 Apr 2;122(4):1487–502.\n80. Li Z, Baccianti F , Delecluse S, T sai MH, Shumilov A, Cheng X, et al. The Epstein–Barr virus\nnoncoding RNA EBER2 transactivates the UCHL1 deubiquitinase to accelerate cell growth.\nProc Natl Acad Sci. 2021 Oct 26;118(43):e2115508118.\n81. McCall LI, Siqueira-Neto JL, McKerrow JH. Location, Location, Location: Five Facts about\nTissue Tropism and Pathogenesis. Knoll LJ, editor. PLOS Pathog. 2016 May\n26;12(5):e1005519.\n82. Bu GL, Xie C, Kang YF , Zeng MS, Sun C. How EBV Infects: The Tropism and Underlying\nMolecular Mechanism for Viral Infection. Viruses. 2022 Oct 27;14(11):2372.\n83. NCBI [Internet]. [cited 2024 Jul 25]. Genome. Available from:\nhttps://www.ncbi.nlm.nih.gov/datasets/genome/?taxon=10376\n84. Zanella L, Riquelme I, Buchegger K, Abanto M, Ili C, Brebi P . A reliable Epstein-Barr Virus\nclassification based on phylogenomic and population analyses. Sci Rep. 2019 Jul\n8;9(1):9829.\n85. Allen UD, Hu P , Pereira SL, Robinson JL, Paton TA, Beyene J, et al. The genetic diversity of\nEpstein-Barr virus in the setting of transplantation relative to non-transplant settings: A\nfeasibility study. Pediatr Transplant. 2016 Feb;20(1):124–9.\n86. Osunkoya BO. The preservation of Burkitt tumour cells at moderately low temperature. Br J\nCancer. 1965 Dec;19(4):749–53.\n87. Fryer JF , Heath AB, Wilkinson DE, Minor PD. A collaborative study to establish the 1st WHO\nInternational Standard for Epstein–Barr virus for nucleic acid amplification techniques.\nBiologicals. 2016 Sep;44(5):423–33.\n88. Delecluse HJ, Hilsendegen T , Pich D, Zeidler R, Hammerschmidt W. Propagation and\nrecovery of intact, infectious Epstein–Barr virus from prokaryotic to human cells. Proc Natl\nAcad Sci. 1998 Jul 7;95(14):8245–50.\n89. Pulvertaft RJV. CYTOLOGY OF BURKITT’S TUMOUR (AFRICAN LYMPHOMA). The\nLancet. 1964 Feb;283(7327):238–40.\n90. Young LS, Yao QY , Rooney CM, Sculley TB, Moss DJ, Rupani H, et al. New type B isolates\nof Epstein-Barr virus from Burkitt’s lymphoma and from normal individuals in endemic areas.\nJ Gen Virol. 1987 Nov;68 ( Pt 11):2853–62.\n91. Delecluse HJ, Bartnizke S, Hammerschmidt W, Bullerdiek J, Bornkamm GW. Episomal and\nintegrated copies of Epstein-Barr virus coexist in Burkitt lymphoma cell lines. J Virol. 1993\nMar;67(3):1292–9.\n92. Henderson A, Ripley S, Heller M, Kieff E. Chromosome site for Epstein-Barr virus DNA in a\nBurkitt tumor cell line and in lymphocytes growth-transformed in vitro. Proc Natl Acad Sci.\n1983 Apr;80(7):1987–91.\n93. Pirog EC. Cervical Adenocarcinoma: Diagnosis of Human Papillomavirus–Positive and\nHuman Papillomavirus–Negative Tumors. Arch Pathol Lab Med. 2017 Dec\n1;141(12):1653–67.\n94. Chow CK, Qin K, Lau LT , Cheung-Hoi Yu A. Significance of a Single-Nucleotide Primer\nMismatch in Hepatitis B Virus Real-Time PCR Diagnostic Assays. J Clin Microbiol. 2011\nDec;49(12):4418–9.\n95. Walling DM, Brown AL, Etienne W, Keitel WA, Ling PD. Multiple Epstein-Barr Virus\nInfections in Healthy Individuals. J Virol. 2003 Jun;77(11):6546–50.\n96. RNA Integrity Number - an overview | ScienceDirect T opics [Internet]. [cited 2024 Jul 25].\nAvailable from:\nhttps://www.sciencedirect.com/topics/biochemistry-genetics-and-molecular-biology/rna-integ\nrity-number\n97. Fleige S, Pfaffl MW. RNA integrity and the effect on the real-time qRT-PCR performance.\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nMol Aspects Med. 2006 Apr;27(2–3):126–39.\n98. Speck P , Callen DF , Longnecker R. Absence of the Epstein-Barr virus genome in breast\ncancer-derived cell lines. J Natl Cancer Inst. 2003 Aug 20;95(16):1253–4; author reply\n1254-1255.\n99. Huang J, Chen H, Hutt-Fletcher L, Ambinder RF , Hayward SD. Lytic viral replication as a\ncontributor to the detection of Epstein-Barr virus in breast cancer. J Virol. 2003\nDec;77(24):13267–74.\n100. Thorne LB, Ryan JL, Elmore SH, Glaser SL, Gulley ML. Real-time PCR measures\nEpstein-Barr Virus DNA in archival breast adenocarcinomas. Diagn Mol Pathol Am J Surg\nPathol Part B. 2005 Mar;14(1):29–33.\n101. Perrigoue JG, den Boon JA, Friedl A, Newton MA, Ahlquist P , Sugden B. Lack of\nassociation between EBV and breast carcinoma. Cancer Epidemiol Biomark Prev Publ Am\nAssoc Cancer Res Cosponsored Am Soc Prev Oncol. 2005 Apr;14(4):809–14.\n102. Perkins RS, Sahm K, Marando C, Dickson-Witmer D, Pahnke GR, Mitchell M, et al.\nAnalysis of Epstein-Barr virus reservoirs in paired blood and breast cancer primary biopsy\nspecimens by real time PCR. Breast Cancer Res BCR. 2006;8(6):R70.\n103. Baltzell K, Buehring GC, Krishnamurthy S, Kuerer H, Shen HM, Sison JD. Epstein-Barr\nvirus is seldom found in mammary epithelium of breast cancer tissue using in situ molecular\nmethods. Breast Cancer Res Treat. 2012 Feb;132(1):267–74.\n104. Glaser SL, Canchola AJ, Keegan THM, Clarke CA, Longacre TA, Gulley ML. Variation in\nrisk and outcomes of Epstein-Barr virus-associated breast cancer by epidemiologic\ncharacteristics and virus detection strategies: an exploratory study. Cancer Causes Control\nCCC. 2017 Apr;28(4):273–87.\n105. Chen Y , Liu T , Xu Z, Dong M. Association of Epstein-Barr virus (EBV) with lung cancer:\nmeta-analysis. Front Oncol. 2023;13:1177521.\n106. Kim KY , Le QT , Yom SS, Pinsky BA, Bratman SV, Ng RHW, et al. Current State of\nPCR-Based Epstein-Barr Virus DNA T esting for Nasopharyngeal Cancer. JNCI J Natl\nCancer Inst. 2017 Mar 14;109(4):djx007.\n107. Giannella L, Di Giuseppe J, Delli Carpini G, Grelloni C, Fichera M, Sartini G, et al.\nHPV-Negative Adenocarcinomas of the Uterine Cervix: From Molecular Characterization to\nClinical Implications. Int J Mol Sci. 2022 Nov 30;23(23):15022.\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nSupplementary Material\nSupplementary Table 1: Results of Genome Exact Match Analysis. This table compiles the\nassay sequences for each study and analyzes the number of EBV genomes with exact\nmatches. An orientation of “Original” reflects the original sequence listed in the study. “RC”\nrepresents the reverse complement of “Original.” We test both orientations because some\nstudies did not report orientation, and this approach ensures a consistent method across\nstudies. For each “Original/RC” pair, we report the higher number of genomes with exact\nmatches. Within each study, the bolded pair designates the sequence with the fewest number of\nexact matches. Percentages are based on the 512 complete genomes available in May 2024 in\nNCBI GenBank.\nStudy T arget Orientation Oligonucleotide Sequence\nGenomes\nWith Exact\nMatches\nGenomes\nWithout Exact\nMatches\nPercentage\nWithout Exact\nMatches\nLytic viral replication as a contributor to the\ndetection of Epstein-Barr virus in breast cancer(99) EBER1 - E1 Original AGGACCTACGCTGCCCTAGAG 494 18 3.5%\nEBER1 - E1 RC CTCTAGGGCAGCGTAGGTCCT 11 501 97.9%\nEBER1 - E1 Original AGAGGTTTTGCTAGGGAGG 490 22 4.3%\nEBER1 - E1 RC CCTCCCTAGCAAAACCTCT 11 501 97.9%\nEBER1 - E2 Original AAAACATGCGGACCACCAGC 10 502 98.0%\nEBER1 - E2 RC GCTGGTGGTCCGCATGTTTT 493 19 3.7%\nEBER1 - E2 Original GACCACCAGCTGGTACTTG 10 502 98.0%\nEBER1 - E2 RC CAAGTACCAGCTGGTGGTC 494 18 3.5%\nBARF0 - P3 Original GTGAGGGAAATAACCAGGATC 499 13 2.5%\nBARF0 - P3 RC GATCCTGGTTATTTCCCTCAC 10 502 98.0%\nBARF0 - P3 Original CAGGACCAGAATGAGCATGC 495 17 3.3%\nBARF0 - P3 RC GCATGCTCATTCTGGTCCTG 9 503 98.2%\nBARF0 - P4 Original GCTTTCCTTTCCGAGTCTGC 5 507 99.0%\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nBARF0 - P4 RC GCAGACTCGGAAAGGAAAGC 490 22 4.3%\nBARF0 - P4 Original CTTCTCCTCGGACATCCAGTG 6 506 98.8%\nBARF0 - P4 RC CACTGGATGTCCGAGGAGAAG 498 14 2.7%\nRPMS1 - P1 Original CACGATGTCCTGGTCAGAGTG 492 20 3.9%\nRPMS1 - P1 RC CACTCTGACCAGGACATCGTG 7 505 98.6%\nRPMS1 - P1 Original GGCTTGAGGAATACCTCGTTG 492 20 3.9%\nRPMS1 - P1 RC CAACGAGGTATTCCTCAAGCC 7 505 98.6%\nRPMS1 - P2 Original TGGCCTTCGATATCGAGTGTC 3 509 99.4%\nRPMS1 - P2 RC GACACTCGATATCGAAGGCCA 243 269 52.5%\nRPMS1 - P2 Original ACCAACGAGGCTGACCTGATC 11 501 97.9%\nRPMS1 - P2 RC GATCAGGTCAGCCTCGTTGGT 493 19 3.7%\nEBNA1 (Q-Kexon) - Qp Original GCGGGATAGCGTGCGCTA 495 17 3.3%\nEBNA1 (Q-Kexon) - Qp RC TAGCGCACGCTATCCCGC 9 503 98.2%\nEBNA1 (Q-Kexon) - Qp Original GTGCGCTACCGGATGGCG 493 19 3.7%\nEBNA1 (Q-Kexon) - Qp RC CGCCATCCGGTAGCGCAC 9 503 98.2%\nEBNA1 (Q-Kexon) - K1 Original CTCTTCTTTGAGGTCCACTG 6 506 98.8%\nEBNA1 (Q-Kexon) - K1 RC CAGTGGACCTCAAAGAAGAG 495 17 3.3%\nEBNA1 (Q-Kexon) - K1 Original CTTCTGGTCCAGATGTGT 0 512 100.0%\nEBNA1 (Q-Kexon) - K1 RC ACACATCTGGACCAGAAG 93 419 81.8%\nWp/Cp (Y-K exon) - Y2 Original ATTAGAGACCACTTTGAGCC 52 460 89.8%\nWp/Cp (Y-K exon) - Y2 RC GGCTCAAAGTGGTCTCTAAT 0 512 100.0%\nWp/Cp (Y-K exon) - Y2 Original TGGCGTGTGACGTGGTGTAA 468 44 8.6%\nWp/Cp (Y-K exon) - Y2 RC TTACACCACGTCACACGCCA 5 507 99.0%\nWp/Cp (Y-K exon) - K1 Original CTCTTCTTTGAGGTCCACTG 6 506 98.8%\nWp/Cp (Y-K exon) - K1 RC CAGTGGACCTCAAAGAAGAG 495 17 3.3%\nWp/Cp (Y-K exon) - K1 Original CTTCTGGTCCAGATGTGT 0 512 100.0%\nWp/Cp (Y-K exon) - K1 RC ACACATCTGGACCAGAAG 93 419 81.8%\nLMP1 - L1 Original CTGAGATCTATGGAACACGACCTTGAG 0 512 100.0%\nLMP1 - L1 RC CTCAAGGTCGTGTTCCATAGATCTCAG 0 512 100.0%\nLMP1 - L1 Original CTAGGCCTTGCTCTCCTTCTC 0 512 100.0%\nLMP1 - L1 RC GAGAAGGAGAGCAAGGCCTAG 337 175 34.2%\nLMP1 - L2 Original GCAGAGCATCTCCAATAAGTAG 0 512 100.0%\nLMP1 - L2 RC CTACTTATTGGAGATGCTCTGC 0 512 100.0%\nLMP1 - L2 Original GGAACAATGCCTGTCCGTG 11 501 97.9%\nLMP1 - L2 RC CACGGACAGGCATTGTTCC 0 512 100.0%\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nZTA - Z1 Original AGCAGACATTTGGTGTTCCAC 0 512 100.0%\nZTA - Z1 RC GTGGAACACCAAATGTCTGCT 0 512 100.0%\nZTA - Z1 Original ACGCACGGAAACCACAAC 0 512 100.0%\nZTA - Z1 RC GTTGTGGTTTCCGTGCGT 0 512 100.0%\nZTA - Z2 Original ACATCTGCTTCAACAGGAGG 500 12 2.3%\nZTA - Z2 RC CCTCCTGTTGAAGCAGATGT 6 506 98.8%\nZTA - Z2 Original GCGCAGCCTGTCATTTTCAG 500 12 2.3%\nZTA - Z2 RC CTGAAAATGACAGGCTGCGC 6 506 98.8%\nAbsence of the Epstein-Barr virus genome in breast\ncancer-derived cell lines(98) LMP2 - PS003 Original TTCTTGCCCGTTCTCTTTCTTAG 368 144 28.1%\nLMP2 - PS003 RC CTAAGAAAGAGAACGGGCAAGAA 4 508 99.2%\nLMP2 - PS004 Original CTTCTGTACGCTAGTATCAGGAGC 0 512 100.0%\nLMP2 - PS004 RC GCTCCTGATACTAGCGTACAGAAG 227 285 55.7%\nBHRF1 - BHFR1-C Original TGCATGGAAATGGTA 482 30 5.9%\nBHRF1 - BHFR1-C RC TACCATTTCCATGCA 11 501 97.9%\nBHRF1 - BHRF1-D Original AAGGCTTGGGTCTCC 9 503 98.2%\nBHRF1 - BHRF1-D RC GGAGACCCAAGCCTT 498 14 2.7%\nReal-time PCR measures Epstein-Barr Virus DNA\nin archival breast adenocarcinomas(100) BamH1W - Forward Original GCAGCCGCCCAGTCTCT 386 126 24.6%\nBamH1W - Forward RC AGAGACTGGGCGGCTGC 4 508 99.2%\nBamH1W - Reverse Original ACAGACAGTGCACAGGAGCCT 5 507 99.0%\nBamH1W - Reverse RC AGGCTCCTGTGCACTGTCTGT 150 362 70.7%\nBamH1W - Probe Original AAAAGCTGGCGCCCTTGCCTG 5 507 99.0%\nBamH1W - Probe RC CAGGCAAGGGCGCCAGCTTTT 387 125 24.4%\nEBNA1 - Forward Original TACAGGACCTGGAAATGGCC 489 23 4.5%\nEBNA1 - Forward RC GGCCATTTCCAGGTCCTGTA 6 506 98.8%\nEBNA1 - Reverse Original TCTTTGAGGTCCACTGCCG 6 506 98.8%\nEBNA1 - Reverse RC CGGCAGTGGACCTCAAAGA 495 17 3.3%\nEBNA1 - Probe Original AGGGAGACACATCTGGACCAGAAGGC 91 421 82.2%\nEBNA1 - Probe RC GCCTTCTGGTCCAGATGTGTCTCCCT 0 512 100.0%\nLMP1 - Forward Original CAGTCAGGCAAGCCTATGA 482 30 5.9%\nLMP1 - Forward RC TCATAGGCTTGCCTGACTG 16 496 96.9%\nLMP1 - Reverse Original CTGGTTCCGGTGGAGATGA 16 496 96.9%\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nLMP1 - Reverse RC TCATCTCCACCGGAACCAG 478 34 6.6%\nLMP1 - Probe Original GTCATAGTAGCTTAGCTGAAC 485 27 5.3%\nLMP1 - Probe RC GTTCAGCTAAGCTACTATGAC 16 496 96.9%\nLMP2 - Forward Original AGCTGTAACTGTGGTTTCCATGAC 498 14 2.7%\nLMP2 - Forward RC GTCATGGAAACCACAGTTACAGCT 5 507 99.0%\nLMP2 - Reverse Original GCCCCCTGGCGAAGAG 5 507 99.0%\nLMP2 - Reverse RC CTCTTCGCCAGGGGGC 493 19 3.7%\nLMP2 - Probe Original CTGCTGCTACTGGCTTTCGTCCTCTGG 495 17 3.3%\nLMP2 - Probe RC CCAGAGGACGAAAGCCAGTAGCAGCAG 5 507 99.0%\nBZLF1 - Forward Original AAATTTAAGAGATCCTCGTGTAAAACATC 495 17 3.3%\nBZLF1 - Forward RC GATGTTTTACACGAGGATCTCTTAAATTT 5 507 99.0%\nBZLF1 - Reverse Original CGCCTCCTGTTGAAGCAGAT 6 506 98.8%\nBZLF1 - Reverse RC ATCTGCTTCAACAGGAGGCG 500 12 2.3%\nBZLF1 - Probe Original ATAATGGAGTCAACATCCAGGCTTGGGC 501 11 2.1%\nBZLF1 - Probe RC GCCCAAGCCTGGATGTTGACTCCATTAT 5 507 99.0%\nLack of association between EBV and breast\ncarcinoma(101) Raji - Forward Primer Original TGACCTACTTGGACCATGTGGA 474 38 7.4%\nRaji - Forward Primer RC TCCACATGGTCCAAGTAGGTCA 5 507 99.0%\nRaji - Reverse Primer Original TGATGAGACTTCCGAGTGCACT 6 506 98.8%\nRaji - Reverse Primer RC AGTGCACTCGGAAGTCTCATCA 487 25 4.9%\nRaji - Probe Original\nCAGTGTCCTGATCCTGGACCTTGACTATG\nAA 487 25 4.9%\nRaji - Probe RC\nTTCATAGTCAAGGTCCAGGATCAGGACAC\nTG 5 507 99.0%\nBALF 5 - Forward Primer Original CGGAAGCCCTCTGGACTTC 3 509 99.4%\nBALF 5 - Forward Primer RC GAAGTCCAGAGGGCTTCCG 236 276 53.9%\nBALF 5 - Reverse Primer Original CCCTGTTTATCCGATGGAATG 496 16 3.1%\nBALF 5 - Reverse Primer RC CATTCCATCGGATAAACAGGG 9 503 98.2%\nBALF 5 - Probe Original TGTACACGCACGAGAAATGCGCC 10 502 98.0%\nBALF 5 - Probe RC GGCGCATTTCTCGTGCGTGTACA 495 17 3.3%\nAnalysis of Epstein-Barr virus reservoirs in paired\nblood and breast cancer primary biopsy specimens\nby real time PCR(102)\nBAMHIW - Forward\nPrimer Original CCCAACACTCCACCACACC 382 130 25.4%\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint \n\nBAMHIW - Forward\nPrimer RC GGTGTGGTGGAGTGTTGGG 7 505 98.6%\nBAMHIW - Reverse\nPrimer Original TCTTAGGAGCTGTCCGAGGG 5 507 99.0%\nBAMHIW - Reverse\nPrimer RC CCCTCGGACAGCTCCTAAGA 382 130 25.4%\nEpstein-Barr virus is seldom found in mammary\nepithelium of breast cancer tissue using in situ\nmolecular methods(103) BamH1 W - 1 Original TGTGACTTCACCAAAGGTCAGG 386 126 24.6%\nBamH1 W - 1 RC CCTGACCTTTGGTGAAGTCACA 4 508 99.2%\nBamH1 W - 2 Original ACGTAAACGCGCTGGACTG 4 508 99.2%\nBamH1 W - 2 RC CAGTCCAGCGCGTTTACGT 383 129 25.2%\n.CC-BY 4.0 International licenseavailable under a \n(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made \nThe copyright holder for this preprintthis version posted December 2, 2024. ; https://doi.org/10.1101/2024.11.28.625954doi: bioRxiv preprint","source_license":"CC-BY-4.0","license_restricted":false}