{"paper_id":"198cfa76-760e-49a3-a636-4de0b2de11de","body_text":"HIF1α/MIF/CD74 signaling mediated OSA-induced atrial fibrillation by promoting M1 macrophages polarization | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Method Article HIF1α/MIF/CD74 signaling mediated OSA-induced atrial fibrillation by promoting M1 macrophages polarization Hangyuan He, Lin Zhang, Zhengjie Lu, Bin Li, Xufei Li This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3896162/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Obstructive sleep apnea (OSA) is known to contribute to the increased occurrence and recurrence of atrial fibrillation (AF). However, the mechanism of chronic OSA-induced AF remains unknown. We constructed a rat model of chronic OSA and found that chronic OSA altered the pathological phenotype of atrial myocardial tissues, rendering it more susceptible to AF. Furthermore, we observed that chronic OSA promoted the polarization of M1 macrophages in the atrial tissue of rats, and the AF susceptibility induced by chronic OSA was reversed upon clearance of macrophages. Then, we found that macrophages induced an atrial fibrillation-like phenotype in atrial myocytes, while atrial myocytes promoted M1 polarization of macrophages, under hypoxia/reoxygenation treatment in vitro . Moreover, hypoxia/reoxygenation upregulated the expression of hypoxia-inducible factor 1-alpha (HIF1α) in atrial myocytes, which subsequently stimulated the transcription and expression of macrophage migration inhibitory factor (MIF) by binding to the promoter region of the MIF gene. The increased expression of MIF in atrial myocytes further activated the expression of nuclear factor-kappa B (NF-κB) through interaction with the macrophage surface receptor CD74, ultimately leading to M1 macrophages polarization. In summary, chronic OSA activated M1 macrophage polarization through the HIF1α/MIF/CD74 signaling pathway, thereby mediating the increased susceptibility to AF. This study offers novel insights into early prevention strategies and potential therapeutic targets for OSA-induced AF. Obstructive sleep apnea Atrial fibrillation Macrophage polarization Hypoxia-inducible factor-1α Macrophage migration inhibitory factor Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Atrial fibrillation (AF) stands as one of the most prevalent enduring arrhythmias, contributing to a substantial global health burden [1]. Current epidemiological evidence reveals an exceeding 30 million individuals affected by AF worldwide, which is anticipated to surge with the aging demographic [2]. Recognized as a pivotal risk factor for stroke and heart failure, AF bears a heightened mortality and morbidity risk, thereby imposing a substantial economic strain on society. Consequently, there exists an imperative societal demand to mitigate the onset and recurrence of AF. Obstructive sleep apnea (OSA) is a clinical syndrome of repeated apnea or hypopnea caused by periodic narrowing or collapse of the upper airway during sleep, which manifests in a series of clinical symptoms such as hypoxemia, hypercapnia and disturbance of sleep structure [3]. Epidemiological data demonstrates demonstrated a high prevalence of OSA, affecting approximately 14% of men and 5% of women [4]. Clinical investigations have revealed that OSA patients have had a twofold increased incidence of atrial fibrillation (AF) compared to non-OSA individuals. Moreover, 32% to 49% of AF patients had comorbid OSA [5, 6]. Notably, OSA has been linked to reduced medication response and higher AF recurrence rates following radiofrequency ablation [7, 8]. These studies collectively indicated that OSA played a significant role in the increased occurrence and recurrence of AF. However, the precise mechanisms underlying OSA-induced AF remain inadequately understood. Macrophages, classified as M1 and M2, play critical roles in the body's innate immune system [9]. M1 macrophages primarily mediate robust inflammatory and Th1 immune responses [10], while M2 macrophages contribute to inflammation inhibition, tissue repair, and angiogenesis [10]. Notably, a significant increase in M1 macrophage infiltration was observed in the left auricular tissue and mural thrombi of AF and rheumatic mitral stenosis patients [11]. Moreover, M1 macrophages can secrete IL-1β, inhibiting atrial myocyte tremor protein expression and reducing L-type calcium channel current, ultimately exacerbating atrial electrical remodeling and triggering AF [12]. These findings underscore the critical involvement of M1 macrophages in AF pathogenesis. Additionally, studies have indicated that OSA can elevate M1 macrophage infiltration in subcutaneous adipose tissue [13] and cause M1 macrophage aggregation in the aortic wall in a chronic OSA mouse model [14]. This suggests that OSA might mediate AF occurrence by influencing M1 macrophage polarization. However, the precise molecular mechanism remains unclear. In our previous study, we demonstrated that acute OSA can contribute to the development of AF through an animal model [15]. However, our clinical observations revealed that AF patients with OSA typically experienced a longer duration of OSA onset. To further investigate this matter, we established a chronic OSA rat model and aimed to elucidate the involvement of macrophages in OSA-induced AF. Moreover, to shed light on the molecular mechanisms underlying the abnormal polarization of macrophages induced by chronic OSA, we created a co-culture cell model consisting of macrophages and atrial myocytes. Hypoxia/reoxygenation was applied to simulate the conditions of chronic OSA. Through this comprehensive study, we aim to provide valuable insights into developing early prevention and treatment strategies, ultimately reducing the incidence and recurrence rate of OSA-induced AF. Methods and Materials 1. Chemicals and Reagents The antibodies of hypoxia-inducible factor-1α (HIF1α) (A22041), macrophage migration inhibitory factor (MIF) (A22623), CD74 (A5667), nuclear factor-kappa B (NF-κB) (A6667), phospho-NF-κB (P-NF-κB) (AP1355), Collagen I (COL I) (A16891), Collagen III (COL III) (A0871), CD68 (A20803), and CD163 (A8383) were obtained by Abclonal Inc.(China). SiRNA for NF-κB, MIF and HIF1α were purchased from Sigma(USA). Clodronate liposomes (Clod) (283539) was purchased VU Medical Central Inc.(NZ). DMEM/F12 (1:1), PBS and fetal bovine serum were provided by Gibco (St. Louis, Missouri, USA). 2. Animals and Treatment All animal experiments were performed according to the National Defense Medical College guidelines for the care and use of laboratory animals in research. 12-week-old male Sprague-Dawley rats were used for animal experiments with the approval of the Animal Research Committee at Tongji Medical College, Huazhong University of Science and Technology. All rats were randomly and equally divided into three groups: (a) the control group, (b) the OSA group, (c) the OSA + Clod group. The establishment of the chronic OSA model was modified from a previously described method [16]. Briefly, the intermittent hypoxia group rats were treated with hypoxia after a 1-week adaptation period. First, nitrogen was added to reduce the oxygen concentration in the chamber to 7-8% and maintain hypoxia for 60 s. Secondly, oxygen was added, the oxygen concentration in the cavity was increased to 20-21%, and the oxygen was maintained for 30 seconds. The cycle was lasted for 8 hours a day (9:00-17:00). During the experiment, fasting and water were prohibited, and the blank control group was left in a plexiglass chamber of the same specification, and normal air passed through it daily. On day 28, the heart was quickly separated after anesthesia and fixed with 10% neutral formalin fixative. For the treatment of Clod, the rats were injected Clod (40 mg/kg) on days 1, 3 and 6 before the OSA treatment was given [17, 18]. 3. Electrophysiology AF was induced with essentially the same protocol as described by Li et al [19] . Briefly, rats underwent open-chest electrophysiological programmed stimulation under 1% sodium pentobarbital (30 mg/kg) anesthesia. The 1.9-F octapolar catheter (Transonic Systems Inc, New York, USA) was placed on the right atrium for programmed stimulation. To assess AF inducibility, 50-Hz burst pacing was applied for 3 seconds with 12 bursts separated by a 2 seconds interval. AF was defined as >1 second of irregular atrial electrograms (>800 beats/min) with irregular ventricular response. AF duration was defined as the mean duration of all AF episodes within 60 second s in each rat. 4. Histological and immunohistochemical staining Atrial tissue was fixed overnight in 10% neutral formalin fixative and embedded in paraffin, sectioned into 4 μm thick slices and stained with hematoxylin and eosin (HE) and Masson's trichrome (Masson). After the gradient alcohol was dehydrated, transparent, and sealed, Image-Pro image analysis software was used to observe the pathological conditions of the specimens. For immunohistochemical staining, sections were deparaffinized, antigen retrieved, blocked, and incubated with primary antibodies of COL 1, COL III, HIF1α, MIF and CD74 and relevant biotinylated secondary antibodies. Finally, sections were stained with DAB and counterstained with hematoxylin. 5. Immunofluorescence (IF) Staining For the immunofluorescence of atrial tissue, the paraffin-embedded atrial tissue was cut into 4 μm sections, deparaffinized in xylene and rehydrated. Samples were boiled in Tris-EDTA (pH 9) for 10 min, rinsed with PBS 3 times and incubated in 3% H2O2 for 10 min. After blocking in 5% BSA for 20 min at room temperature, the sections were then incubated overnight at 4 °C with the primary antibodies against rat CD68 (1:50) and CD163 (1:100), followed by subsequent incubation with the Cy3-conjugated second antibody (1:100) for 2 h at room temperature. Additional sections were incubated with nonspecific IgG instead of the primary antibody to act as negative controls. Five areas of each slice were taken and photographed. The mean optical density (MOD) of immunohistochemistry was quantified by two individuals under the double-blind principle. For the immunofluorescence of cells, cells were washed with PBS and fixed with 4% paraformaldehyde for 15 min. Cells were washed and permeated with 0.5% Triton X-100 in PBS for 20 min at room temperature, and then, the cells were blocked with 5% BSA in PBS for 1 h. Antibodies were added and incubated overnight at 4 °C. Fluorescent secondary antibody (1:100, Bioss Inc., Beijing, China) was added for 2 h at room temperature. Cells were then incubated with DAPI for 5 min at room temperature. 6. Cell Culture and Treatment Rat atrial myocytes were isolated as previously described [20]. Briefly, hearts were rapidly excised under terminal anesthesia, mounted on a modified Langendorff perfusion apparatus, and perfused retrogradely via the aorta with a series of solutions at 37°C, based on an isolation solution composed of (in mmol/L) 130 NaCl, 5.4 KCl, 1.4 MgCl2, 0.4 NaH2PO4, 4.2 HEPES, 10 d-glucose, 20 taurine, and 10 creatine (pH 7.3). Hearts were initially perfused for ≈ 4 minutes with a solution containing 0.75 mmol/L of CaCl 2 . The hearts were then perfused for 4 minutes with a Ca 2 +-free isolation solution containing 0.1 mmol/L of EGTA; which was followed by perfusion with low [Ca 2 +] isolation solution ([Ca 2 +] ≈5 to 10 μmol/L) containing 0.4 mg/mL of Worthington type 1 collagenase (Lorne Laboratories). After 12 to 20 minutes, the heart was removed from the apparatus. The left atrium was dissected from the heart, finely chopped, and gently triturated using a glass Pasteur pipette at room temperature in Kraftbruhe (KB) medium of composition (mmol/L) 70 l-glutamic acid, 30 KCl, 10 HEPES, 1 EGTA, 5 MgCl2, 5 Na-pyruvate, 20 taurine, 10 d-glucose, 5 succinic acid, 5 creatine, 2Na + , 2ATP, and 5 β-hydroxybutyric acid (pH 7.2). To obtain enough macrophages, 4-week-old Sprague-Dawley rats were sacrificed and the tibia and femur were isolated. Then, we flushed the bone marrow cavity with a syringe. After flushing and lysing the red blood cells, macrophages were cultured in a T25 culture flask for 24 h. After that, 50 ng/ml M-CSF was added for 7 days to induce mononuclear macrophages. The medium was changed every two days. For M1 polarization, we stimulated BMDMs with 100 ng/ml LPS and 40 ng/ml IFN-γ for 24 h. Regarding inhibiting CD74, MIF and HIF1α, macrophages and atrial myocyte were transfected with siRNA, respectively. According to the manufacturer, Lipofectamine 3000, (Invitrogen, Carlsbad, CA, USA) was used at 50 nM in the final episode. 7. RNA Isolation and RT-qPCR Total RNA was isolated from tissue and cells using TRIzol Reagent following the manufacturer’s protocol. The total RNA was reverse transcribed using a first-strand cDNA synthesis kit. Then, RT-qPCR was performed using a SYBR Green qPCR Master Mix Kit and ABI StepOnePlus cycler (Applied Biosystems, Foster City, CA, USA) with 40 cycles. Relative gene expression was calculated for each gene by the 2- ΔΔ CT method with β-actin for normalization. The results were expressed as fold values relative to the control group. Primers of RT-qPCR were listed in Table 1. 8. Western Blot Cells were washed twice with ice-cold PBS and lysed in 200 μl RIPA Lysis Buffer and 1 mM phenylmethylsulfonyl fluoride for 5 min on ice to extract total protein. Cytoplasmic protein and nucleic protein were respectively extracted by the nuclear and cytoplasmic protein extraction kit following the manufacturer’s protocols. Equal amounts of protein lysates (30 μg per lane) were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis on 10% polyacrylamide gels, transferred to polyvinylidene difluoride membranes and blotted with the primary antibodies at 4 °C overnight. Band intensity was quantified by using Quantity One (Bio-Rad, Shanghai, China). 9. Chromatin Immunoprecipitation (ChIP) Assay Cell suspensions were collected and fixed in 1% formaldehyde for chromatin cross-linking and added 125 mM glycine to stop the reaction. The samples were centrifuged and resuspended in 0.5 ml lysis buffer containing protease inhibitors. Cell lysates were sonicated to shear DNA to lengths of ~ 200 base pairs and transferred to a new tube with ChIP dilution buffer. Chromatin was incubated overnight at 4 °C on nutator/rocker with specific antibody for HIF1α (1:50 dilution) and BSA-treated Protein G beads to reduce nonspecific background binding. The immunoprecipitated DNA–protein complex with beads was collected by centrifugation and washed sequentially with low-salt, high-salt, LiCl immune complex, and Tris–ethylenediaminetetraacetic acid washing buffer solutions. Freshly prepared elution buffer (1% sodium dodecyl sulphate, 0.1 M NaHCO3) was used to elute the DNA–protein complex. The samples were then placed in 65 °C water baths overnight to reverse formaldehyde cross-linking and subsequently were purified using DNA purification kits. The isolated DNA was then assayed using RT-qPCR. The isolated DNA was then assayed using RT-qPCR. The primer sequences of the promoters were as follows: primer1, forward, TACTGGTCATAATCACTGACC, reverse, ATCGAGAGCTCTTCGAACCTC, primer2, forward, ATCGACCCCAACCTACTGTGG, reverse, TTACGAAGCTCTACTGACCTC, primer3, forward, CCTACCCCCAAATCACTGTAC, reverse, CCTGAGAGCTCTTGCTAGCTC. The input values were compared to the immunoprecipitated samples, with the IgG negative controls values subtracted as background. The calculated errors in all graphs depicting ChIP data represent the standard deviations for three replicate RT-qPCRs for precipitated chromatin, input chromatin, and background (i.e., chromatin precipitated with nonspecific IgG). 10. Statistical Analysis In this study, Prism 8.0 was used for data analysis. Quantitative data were expressed as mean ± S.E.M. Multiple comparisons were performed using one-way analysis of variance (ANOVA). The unpaired two-tailed student’s t -test was used to compare the control group and the other single groups. P <0.05 was considered statistically significant. Results 1. Chronic OSA increased the susceptibility to AF in rats To investigate the impact of OSA on atrial fibrillation susceptibility, we conducted a rat model of chronic OSA. Histological and electrophysiological changes in the rat heart were assessed to determine the effects. Results from HE and Masson staining revealed a disorganized arrangement of atrial muscle fibers and increased collagen deposition in the interstitial space of muscle fibers in rats with chronic OSA compared to the control group (Fig. 1A-B). Immunohistochemical staining showed a significant increase in the levels of COL I and COL III in atrial fibers under chronic OSA treatment (Fig. 1C-F, P ＜0.01). Additionally, OSA treatment led to a notable elevation in the ΣWOVs, a surrogate for AF inducibility, and incidence of AF compared to the control group (Fig. 1G-H, P ＜0.01, P ＜0.05). At the same time, the incidence of AF in the OSA group was also significantly higher than that in the control group (Fig. 1I). It is worth noting that the occurrence of AF could trigger significant changes in the expression of neurofactors associated with atrial remodeling [21]. Hence, we examined the impact of OSA on atrial neurogenesis and found that OSA treatment significantly increased the expression of atrial nerve remodeling indicators, c-fos and NGF (Fig. 1J-K, P ＜0.01, P ＜0.05). In conclusion, chronic OSA in rats promoted atrial fibrosis, increased the incidence of AF, and induced atrial nerve remodeling. 2. Increased M1 macrophage polarization mediated the susceptibility to AF induced by chronic OSA M1 macrophages are characterized by the expression of marker genes such as CD68, TNFα, IL6, and iNOS, whereas M2 macrophages are identified by the expression of CD163, TGFβ, IL10, and Arg1 [22]. To investigate the potential roles of macrophages in AF substantial induced by OSA, we initially evaluated the polarization of macrophages in atrial tissues. Immunofluorescence staining results demonstrated a significant increase in CD68 expression and a significant decrease in CD163 expression in the atrial tissue of the OSA group compared to the control group (Fig. 2A-I, P ＜0.01). Additionally, we examined the gene expression levels of other macrophage markers. Our findings revealed that the mRNA expression of TNFα, IL6, and iNOS were significantly higher in the OSA group (Fig. 2J-M, Q, P ＜0.01, P ＜0.05). Conversely, the mRNA expression levels of TGFβ, IL10, and Arg1 were significantly decreased in the OSA group (Fig. 2N-P, P ＜0.05). These results suggested that OSA treatment led to an infiltration of M1 macrophages and a reduction of M2 macrophages in the atrial tissue. To further investigate the potential involvement of M1 macrophages in OSA-induced AF susceptibility, we employed intravenous injection of clodronate liposome (Clod) to eliminate macrophages in rats [23]. Immunofluorescence staining results demonstrated a significant decrease in CD68 expression in the atrial tissue of the OSA plus Clod treatment group compared to the OSA group alone (Fig. 3A-B, P ＜0.01, P ＜0.05). RT-qPCR analysis revealed a marked reduction in the mRNA expression levels of CD68, TNFα, and IL6 in the atrial tissues of the OSA plus Clod treatment group (Fig. 3C, E-F, P ＜0.01, P ＜0.05). These findings indicated that Clod treatment effectively eliminated M1 macrophages from the atrial tissue. Histological examination, using HE and Masson staining, demonstrated that Clod treatment significantly ameliorated the disorganized arrangement of atrial muscle fibers and reduced collagen deposition induced by OSA (Fig. 3D, G). Clod treatment effectively reversed the increased expression of COL I and COL III induced by OSA in atrial fibrillation (Fig. 3J-O, P ＜0.01, P ＜0.05). Finally, we assessed the changes in atrial electrophysiology and found that the OSA plus Clod treatment group exhibited a significant decrease in the ΣWOVs, and incidence of AF, as compared to the OSA group (Fig. 3H-I, P ＜0.01, P ＜0.05). Overall, these results demonstrated that the polarization of M1 macrophages mediated the susceptibility to AF induced by chronic OSA. 3. Hypoxia and reoxygenation induced the interaction of M1 macrophages and atrial myocytes. To further investigate the contribution of M1 macrophages to AF susceptibility induced by OSA, we established an in vitro co-culture model using primary macrophages and atrial myocytes. The cells were subjected to hypoxia/reoxygenation to mimic the OSA environment in rat models. RT-qPCR analysis revealed that hypoxia/reoxygenation significantly increased the expression of COL1 and COL III in the alone atrial myocytes, compared to the control group (Fig.4A-B, P ＜0.01, P ＜0.05). Furthermore, hypoxia/reoxygenation also induced the expression of neurofactors related to atrial remodeling, such as NGF and c-fos (Fig.4C-D, P ＜0.01). Interestingly, these indexes were further aggravated in the atrial myocytes co-cultured with macrophages under hypoxia/reoxygenation, compared to the group of alone atrial myocytes (Fig.4A-D, P ＜0.01). These findings suggested that hypoxia/reoxygenation induced neuro remodeling and tissue remodeling in atrial myocytes, and co-cultured macrophages exacerbated these effects. Simultaneously, we observed that hypoxia/reoxygenation resulted in an upregulation of M1 macrophage marker genes, including IL6, TNFα, and iNOS, with concomitant downregulation of M2 macrophage marker genes, such as TGFβ, IL10, and Arg1, in alone macrophages compared to the control group (Fig.4E-J, P ＜0.01). In the presence of co-cultured atrial myocytes under hypoxia/reoxygenation conditions, the expression of IL6, TNFα, and iNOS in macrophages was further increased, while the expression of M2 macrophage marker genes, TGFβ, IL10, and Arg1, was further reduced compared to the group of alone macrophages (Fig.4E-J, P ＜0.01). These findings indicated that hypoxia/reoxygenation induces M1 macrophage polarization, and co-cultured atrial myocytes intensified these effects. Overall, these results suggested a reciprocal interaction between atrial myocytes and macrophages under hypoxia/reoxygenation conditions, contributing to the development of their respective pathological roles. 4. High expression of MIF in atrial myocytes mediated the increased polarization of M1 macrophage polarization induced by OSA Previous studies have indicated that M1 macrophages exacerbated atrial remodeling through the secretion of IL1β in AF [24]. Therefore, we focused on how atrial myocytes regulated M1 macrophage polarization under OSA and its subsequent contribution to AF susceptibility. Macrophage migration inhibitory factor (MIF) is an immunomodulatory cytokine with multiple effects and can be produced and released by cardiomyocytes, endothelial cells, epithelial cells, and vascular smooth muscle cells [25]. It has been reported that increased serum MIF levels in OSA patients were observed [26]. CD74, a transmembrane glycoprotein, is a critical MIF receptor and could be expressed in macrophages [27]. The MIF/CD74 pathway could activate the downstream NF-κB pathway [28], a crucial transcription factor involved in M1 macrophage polarization [29]. Based on these findings, we hypothesized that OSA might induce the expression of MIF in atrial myocytes, leading to the activation of the NF-κB pathway downstream and subsequent M1 macrophage polarization via interaction with CD74. To test our hypothesis, we initially investigated the expression of MIF in the above rat models. Immunohistochemistry staining revealed a significant increase in MIF protein and mRNA expression in atrial tissues following OSA treatment (Fig.5A-C, P ＜0.01, P ＜0.05). Subsequently, we examined relevant indexes in the co-culture model under hypoxia/reoxygenation conditions. Hypoxia/reoxygenation notably enhanced the mRNA and protein expression of MIF in atrial myocytes, along with an increase in MIF content in the supernatant compared to the control group (Fig.5D-G, P ＜0.05). Additionally, hypoxia/reoxygenation promoted the protein expression of p-NF-κB in macrophages (Fig.5H-I, P ＜0.05). Subsequently, in the co-culture system, we utilized MIF siRNA to suppress MIF expression in atrial myocytes and CD74 siRNA to inhibit CD74 expression in macrophages. Western blot analysis indicated that MIF and CD74 siRNA effectively reversed the upregulation of p-NF-κB protein induced by hypoxia/reoxygenation in macrophages (Fig.5J-K). Furthermore, MIF SiRNA and CD74 siRNA significantly mitigated the hypoxia/reoxygenation-induced increase in mRNA expression of M1 macrophage marker genes, namely CD68, IL6, TNFα, and iNOS (Fig.5L-M, P ＜0.01, P ＜0.05). These findings proved that the upregulation of MIF in atrial myocytes triggered by hypoxia/reoxygenation activated the NF-κB pathway via the CD74 in macrophage, ultimately promoting M1 macrophage polarization. 5. HIF1α mediated the high expression of MIF in atrial tissues induced by OSA HIF1α, a crucial member of the hypoxia-inducible factor family, functions as a core transcription factor that induces hypoxia-related genes [30]. To investigate whether HIF1α participated in the elevated expression of MIF caused by OSA, we initially examined the expression of HIF1α in atrial tissues of the rat OSA model. The findings showed a significant increase in HIF1α protein expression in the atrial tissue of the OSA group (Fig.6A-B, P ＜0.05). Furthermore, we observed that hypoxia/reoxygenation significantly enhanced the mRNA and protein expression of HIF1α in atrial myocytes (Fig.6C-E, P ＜0.05). Subsequently, we silenced HIF1α expression in atrial myocytes using HIF1α siRNA. The results showed that HIF1α siRNA effectively reversed the upregulation of MIF expression caused by hypoxia/reoxygenation (Fig.6F-H, P ＜0.05). These outcomes indicated that hypoxia/reoxygenation promoted the MIF expression through HIF1α. Subsequently, to elucidate the molecular mechanism of HIF1α in promoting MIF gene expression, we predicted potential binding sites of HIF1α in the MIF gene promoter region using the Jaspar website. Prediction results suggested three binding sites in the MIF gene promoter region:- 1937/-1930 nt, -1049/-1042 nt, and -446/-439 nt, respectively (Fig. 6J). Then, we observed a significant increase in HIF1α protein binding to these sites following hypoxia/reoxygenation treatment through ChIP-PCR (Fig.6K, P ＜0.01). These findings demonstrated that OSA induced the expression of HIF1α, which promoted MIF expression by binding to the promoter region of the MIF gene. Discussion 1. Increased M1 macrophage polarization mediated susceptibility to AF induced by chronic OSA AF is a prevalent supraventricular arrhythmia that exhibits an increased prevalence with advancing age and the presence of comorbidities, including heart failure [ 31 ]. Previous research has highlighted a significant association between sleep-disordered breathing and the occurrence of AF [ 31 – 33 ]. Notably, OSA is one of the most common forms of sleep-disordered breathing, frequently accompanying AF [ 31 ]. Prevalence rates of OSA in AF patients have been reported to range from 21% to over 80% [ 31 ]. In a study by Iwasaki et al. , rats were subjected to simulated OSA using a mechanical ventilator, resulting in left ventricular hypertrophy, dilation, diastolic dysfunction, and increased inducibility of AF during acute OSA episodes in 82.4% of rats [ 34 ]. Building upon our previous research [ 15 ], we established a chronic OSA model in rats. Moreover, we developed an in vitro atrial myocyte-macrophage co-culture model to replicate the hypoxic conditions associated with OSA. Our findings demonstrated a significant increase in the AF-prone window and AF incidence following OSA treatment. Histologically, OSA treatment led to a disordered arrangement of atrial myocardial fiber tissue and collagen fiber deposition in the myocardial septum of rats. In vitro experiments further revealed elevated collagen I and III secretion from atrial myocytes, signifying the induction of atrial structural remodeling by OSA. The expression of c-fos and NGF, markers associated with rapid neuronal activation and sympathetic neuron growth, survival, and differentiation [ 15 ], was significantly upregulated in atrial myocytes treated with OSA. These collective findings indicated that OSA contributes to neuro remodeling in atrial tissue, thus elevating the susceptibility to AF. Macrophages can polarize into two distinct states (M1 and M2 macrophages) based on the local microenvironment, each engaging in different immune response processes [ 35 ]. Clinical studies have identified an augmented accumulation of macrophages in the atria of AF patients [ 36 ]. Animal investigations have revealed that AF induced the polarization of proinflammatory macrophages, which, in turn, intensify atrial electrical remodeling through the secretion of IL-1β [ 24 ]. Inhibition of M1 macrophage polarization could reduce type I and type III collagen expression in atrial fibroblasts, ameliorating myocardial fibrosis and improving atrial structural remodeling (Sun et al., 2019). In our current study, we observed a significant upregulation in M1 macrophage markers and a concurrent downregulation in M2 macrophage markers in atrial myocardial tissue following OSA treatment, coinciding with the development of AF. Clod is widely acknowledged as an effective method for the in vivo depletion of macrophages in various studies [ 23 , 37 ]. Our findings revealed that Clod could reverse the pathological effects induced by OSA. Furthermore, in vitro experiments demonstrated that hypoxia/reoxygenation stimulated the polarization of M1 macrophages, with the presence of macrophages exacerbating the fibrillation phenotype in atrial myocytes. These results showed that the polarization of M1 macrophages contributed to the susceptibility to AF induced by OSA. 2. Activation of MIF/CD74 pathway mediated M1 macrophage polarization induced by OSA The polarization state of macrophages is determined by molecules within the microenvironment, including cytokines and chemokines [ 38 ]. Initially identified as a soluble factor in the culture medium of activated T lymphocytes, MIF could inhibit macrophage migration [ 39 ]. However, recent studies have highlighted the association between MIF and macrophage polarization. Specifically, the upregulated expression of MIF in adipose tissue stimulated the polarization of M1 macrophages by interacting with its receptor CD74, further contributing to inflammation and insulin resistance [ 27 ]. In this study, we observed a significantly increased expression of MIF in atrial myocardial tissues following OSA treatment. Additionally, utilizing an in vitro co-culture model, we found that hypoxia/reoxygenation induced a substantial rise in M1 macrophage polarization and activated the MIF/CD74 pathway. Notably, the augmented M1 polarization resulting from hypoxia/reoxygenation was effectively reversed by silencing either MIF through siRNA in atrial myocytes or CD74 through siRNA in macrophages. Thus, we concluded that activating the MIF/CD74 pathway mediated the OSA-induced increase in M1 macrophage polarization. 3. HIF1α mediated the high expression of MIF induced by OSA HIF1 is comprised of two subunits, α and β, with HIF-1β exhibiting stable expression in the nucleus that is independent of oxygen levels, while HIF-1α is expressed in the cytoplasm, and the availability of oxygen influences its activity. Under normoxic conditions, HIF-1α undergoes rapid degradation in the cytoplasm. However, in hypoxic environments, HIF-1α translocates to the nucleus, forming a complex with HIF-1β, referred to as activated HIF1. This complex initiates the expression of downstream target genes [ 40 ]. It has been indicated that hypoxia enhances the efficacy of macrophages in killing Leishmania amazonica through upregulating HIF-1α expression and subsequent elevation of MIF levels [ 41 ]. In human vascular smooth muscle cells, hypoxia could upregulate MIF expression via the HIF1α pathway [ 42 ]. In our study, we observed a significant increase in HIF1α expression in atrial myocytes in vitro and in vivo following OSA induction. Moreover, the upregulation of MIF expression induced by OSA was reversed upon introducing HIF1α siRNA. These findings strongly suggest that OSA induced the MIF expression through HIF1α. Finally, our results confirmed the existence of three HIF1α binding sites in the MIF gene promoter. Therefore, our findings proved that OSA stimulated the expression of HIF1α in atrial myocytes, which directly bound to the MIF gene promoter region and promoted its transcription translation and expression. Conclusion In our study, we observed that increased polarization of M1-type macrophages was involved in the increased susceptibility to AF induced by OSA, with the mechanism related to the interaction between atrial myocytes and macrophages. Specifically, OSA induced the upregulation of HIF1α expression in atrial myocytes, thereby promoting the binding of HIF1α to the MIF gene promoter binding site and increasing MIF expression. Then, the elevated levels of MIF activated NF-κB expression by binding to the transmembrane receptor CD74 in macrophages, consequently driving the polarization of M1-type macrophages. In turn, the subsequent polarized M1 macrophages exacerbated atrial remodeling through the secretion of inflammatory cytokines, finally contributing to the increased susceptibility to AF (Fig. 7 ). Declarations Author Contributions: X.L. and B.L. designed the research; X.L. and H.H. conducted the analysis with help from L.Z. and X.L.; H.H. wrote the manuscript and had primary responsibility for the final content. All authors have read and agreed to the published version of the manuscript. Funding: This work was supported by grants from the National Natural Science Foundation of China (No. 82000324). Conflicts of Interest: The authors declare no conflict of interest. References Wang, X., et al., Prevalence of atrial fibrillation in different socioeconomic regions of China and its association with stroke: Results from a national stroke screening survey. 2018: p. S0167527318309963-. Miyasaka and Y.J. Circulation, Secular Trends in Incidence of Atrial Fibrillation in Olmsted County, Minnesota, 1980 to 2000, and Implications on the Projections for Future Prevalence. 2006. 114 (2): p. 119-125. Baldi, S.J.M.m., Obstructive sleep apnea syndromes. 2004. 95 (3): p. 173-175. Peppard, P.E., et al., Increased Prevalence of Sleep-Disordered Breathing in Adults. 2013(9): p. 1006-1014. Szymański, F.M., et al., Obstructive sleep apnoea in patients with atrial fibrillation: prevalence, determinants and clinical characteristics of patients in Polish population. 2014. 72 (8). Gami, A.S., G. Pressman, and S.M.J.A.C.J.R. Caples, Association of atrial fibrillation and obstructive sleep apnea. 2004. 13 (11): p. 62-63. Monahan, K., et al., Relation of the severity of obstructive sleep apnea in response to anti-arrhythmic drugs in patients with atrial fibrillation or atrial flutter. 2012. 110 (3): p. 369-372. Ng, C.Y., et al., Meta-analysis of obstructive sleep apnea as predictor of atrial fibrillation recurrence after catheter ablation. 2011. 108 (1): p. 47-51. Sica, A. and A.J.J.o.C.I. Mantovani, Macrophage plasticity and polarization: in vivo veritas. 2012. 122 (3): p. 787-795. Alberto, et al., Macrophage plasticity and polarization in tissue repair and remodelling. 2013. He, G., et al., Increased M1 Macrophages Infiltration Is Associated with Thrombogenesis in Rheumatic Mitral Stenosis Patients with Atrial Fibrillation. 2016. 11 (3): p. e0149910. Sun, Z., et al., Cross-talk between macrophages and atrial myocytes in atrial fibrillation. 2016. 111 (6): p. 63. Wang, Y., et al., Low-Frequency Intermittent Hypoxia Suppresses Subcutaneous Adipogenesis and Induces Macrophage Polarization in Lean Mice. Diabetes Metab J, 2019. 43 (5): p. 659-674. Cortese, R., et al., Aorta macrophage inflammatory and epigenetic changes in a murine model of obstructive sleep apnea: Potential role of CD36. Sci Rep, 2017. 7 : p. 43648. Yu, L., et al., Atrial Fibrillation in Acute Obstructive Sleep Apnea: Autonomic Nervous Mechanism and Modulation. J Am Heart Assoc, 2017. 6 (9). Wu, J.G., et al., Effects of small interfering RNA targeting TLR4 on expressions of adipocytokines in obstructive sleep apnea hyponea syndrome with hypertension in a rat model. J Cell Physiol, 2018. 233 (10): p. 6613-6620. Rodriguez-Menocal, L., et al., Macrophage-derived IL-18 and increased fibrinogen deposition are age-related inflammatory signatures of vascular remodeling. Am J Physiol Heart Circ Physiol, 2014. 306 (5): p. H641-53. Cheng, Y., et al., Early depletion of M1 macrophages retards the progression of glucocorticoid-associated osteonecrosis of the femoral head. Int Immunopharmacol, 2023. 122 : p. 110639. Luo, Y., et al., Akkermansia muciniphila prevents cold-related atrial fibrillation in rats by modulation of TMAO induced cardiac pyroptosis. EBioMedicine, 2022. 82 : p. 104087. Bond, R.C., et al., Reduced density and altered regulation of rat atrial L-type Ca(2+) current in heart failure. Am J Physiol Heart Circ Physiol, 2017. 312 (3): p. H384-h391. Zhao, J., et al., Chronic obstructive sleep apnea causes atrial remodeling in canines: mechanisms and implications. Basic Res Cardiol, 2014. 109 (5): p. 427. Li, Z., et al., BMSC-derived exosomes promote tendon-bone healing after anterior cruciate ligament reconstruction by regulating M1/M2 macrophage polarization in rats. Stem Cell Res Ther, 2022. 13 (1): p. 295. Takagi, S., et al., Depletion of microglia and macrophages with clodronate liposomes attenuates zymosan-induced Fos expression and hypothermia in the adult mouse. J Neuroimmunol, 2020. 344 : p. 577244. Sun, Z., et al., Cross-talk between macrophages and atrial myocytes in atrial fibrillation. Basic Res Cardiol, 2016. 111 (6): p. 63. Florez-Sampedro, L., et al., The role of MIF in chronic lung diseases: looking beyond inflammation. Am J Physiol Lung Cell Mol Physiol, 2020. 318 (6): p. L1183-l1197. Edwards, K.M., et al., Macrophage migratory inhibitory factor (MIF) may be a key factor in inflammation in obstructive sleep apnea. Sleep, 2011. 34 (2): p. 161-3. Chan, P.C., et al., Targetted inhibition of CD74 attenuates adipose COX-2-MIF-mediated M1 macrophage polarization and retards obesity-related adipose tissue inflammation and insulin resistance. Clin Sci (Lond), 2018. 132 (14): p. 1581-1596. Gore, Y., et al., Macrophage migration inhibitory factor induces B cell survival by activation of a CD74-CD44 receptor complex. J Biol Chem, 2008. 283 (5): p. 2784-92. Olefsky, J.M. and C.K.J.A.R.o.P. Glass, Macrophages, Inflammation, and Insulin Resistance. 2010. 72 (1): p. 219-246. Eltzschig, H.K. and P. Carmeliet, Hypoxia and inflammation. N Engl J Med, 2011. 364 (7): p. 656-65. Lavergne, F., et al., Atrial fibrillation and sleep-disordered breathing. J Thorac Dis, 2015. 7 (12): p. E575-84. Huang, B., et al., Atrial fibrillation in obstructive sleep apnea: Neural mechanisms and emerging therapies. Trends Cardiovasc Med, 2021. 31 (2): p. 127-132. Goudis, C.A. and D.G. Ketikoglou, Obstructive sleep and atrial fibrillation: Pathophysiological mechanisms and therapeutic implications. Int J Cardiol, 2017. 230 : p. 293-300. Iwasaki, Y.K., et al., Atrial fibrillation promotion with long-term repetitive obstructive sleep apnea in a rat model. J Am Coll Cardiol, 2014. 64 (19): p. 2013-23. Sun, F., et al., LncRNA NRON alleviates atrial fibrosis through suppression of M1 macrophages activated by atrial myocytes. Biosci Rep, 2019. 39 (11). Camm, A.J., et al., 2012 focused update of the ESC Guidelines for the management of atrial fibrillation: an update of the 2010 ESC Guidelines for the management of atrial fibrillation--developed with the special contribution of the European Heart Rhythm Association. Europace, 2012. 14 (10): p. 1385-413. Zhou, D., et al., Macrophage polarization and function: new prospects for fibrotic disease. Immunol Cell Biol, 2017. 95 (10): p. 864-869. Wang, C., et al., Macrophage Polarization and Its Role in Liver Disease. Front Immunol, 2021. 12 : p. 803037. Kim, K.W. and H.R. Kim, Macrophage migration inhibitory factor: a potential therapeutic target for rheumatoid arthritis. Korean J Intern Med, 2016. 31 (4): p. 634-42. Påhlman, S. and S. Mohlin, Hypoxia and hypoxia-inducible factors in neuroblastoma. Cell Tissue Res, 2018. 372 (2): p. 269-275. Alonso, D., et al., HIF-1α-regulated MIF activation and Nox2-dependent ROS generation promote Leishmania amazonensis killing by macrophages under hypoxia. Cell Immunol, 2019. 335 : p. 15-21. Fu, H., et al., Hypoxia stimulates the expression of macrophage migration inhibitory factor in human vascular smooth muscle cells via HIF-1alpha dependent pathway. BMC Cell Biol, 2010. 11 : p. 66. Table Table 1. Oligonucleotide primers in RT-qPCR. Genes Forward primer (5′-3′） Reverse primer（5′-3′） COL I CCCAGCATCCTGTACATTTC CAGCGTCAACACCATCATT COL III GTGGCCCTGGACACAGAGAT CATGCAGGGTAGAGACATTC HIF1α GGCAGTAAGGTGGTGAATAG CTAAACGGTGGTGCCATAG MIF CTACATCAGAGACCCAATGC GTGACTGTCTCAGCTTCTTC CD74 GGTCCTGTCTGGAAGAGTTTAG TGAACATCTCGCTTCTCTCTATG CD68 GACCAAGGGGCTTTTACTTCAC TTTGTAGGCTTCAGCGGAGCAC c-fos GTCTCCAGTGCCAACTTCATCC GCAGCCATCTTATTCCTTTCCC NGF ACAGGAGCAAGCGGTCTTCG TGGGTGGTGGTGCAGTAGGA TNFα AACAAGGAGGAGAAGTTCCCAAA CTCCTCCGCTTGGTGGTTT IL6 AGGATACCACCCACAACAGACC TTGCCATTGCACAACTCTTTTC iNOS TCCTCAGGCTTGGGTCTTGT ATCCTGTGTTGTTGGGCTGG TGFβ CTGCTGACCCCCACTGATAC AGCCCTGTATTCCGTCTCCT IL10 CGACGCTGTCATCGATTTCTC CAGTAGATGCCGGGTGGTTC Arg1 CAAGCCAAAGCCCATAGAGATT CATTGGCTTTTCCCACAGACC CD163 GACAGACCCAACGGCTTACA GGTCACAAAACTTCAACCGGA β-actin CTACAATGAGCTGCGTGTGGC CAGGTCCAGACGCAGGATGGC COL I, Collagen I; COL III, Collagen III; HIF1α, hypoxia-inducible factor-1α; MIF, macrophage migration inhibitory factor; NGF, Nerve growth factor; TNFα, tumor necrosis factor α; IL6, Interleukin 6; iNOS, inducible nitric oxide synthase; TGFβ, transforming growth factor β; IL10, Interleukin 10; Arg1, arginase 1; Additional Declarations No competing interests reported. Supplementary Files supplementaryfile.zip Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {\"props\":{\"pageProps\":{\"initialData\":{\"identity\":\"rs-3896162\",\"acceptedTermsAndConditions\":true,\"allowDirectSubmit\":true,\"archivedVersions\":[],\"articleType\":\"Method Article\",\"associatedPublications\":[],\"authors\":[{\"id\":269963496,\"identity\":\"06e99743-fd33-461d-9f94-f09b38477ba7\",\"order_by\":0,\"name\":\"Hangyuan He\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Huazhong University of Science and Technology\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Hangyuan\",\"middleName\":\"\",\"lastName\":\"He\",\"suffix\":\"\"},{\"id\":269963497,\"identity\":\"624230e2-a9d1-469b-ad99-0725e370ea98\",\"order_by\":1,\"name\":\"Lin Zhang\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Zhongnan Hospital of Wuhan University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Lin\",\"middleName\":\"\",\"lastName\":\"Zhang\",\"suffix\":\"\"},{\"id\":269963498,\"identity\":\"98f437bd-8354-4469-a415-ac7fbef2f10a\",\"order_by\":2,\"name\":\"Zhengjie Lu\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Zhongnan Hospital of Wuhan University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Zhengjie\",\"middleName\":\"\",\"lastName\":\"Lu\",\"suffix\":\"\"},{\"id\":269963499,\"identity\":\"f0954283-30f6-4d75-8e46-fbdff5a0337f\",\"order_by\":3,\"name\":\"Bin Li\",\"email\":\"\",\"orcid\":\"\",\"institution\":\"Zhongnan Hospital of Wuhan University\",\"correspondingAuthor\":false,\"prefix\":\"\",\"firstName\":\"Bin\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"},{\"id\":269963500,\"identity\":\"9141339e-bcd1-481c-8446-7d181e966691\",\"order_by\":4,\"name\":\"Xufei Li\",\"email\":\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtUlEQVRIiWNgGAWjYBACPmYGhg8gBj8z8+EHRGlhY2ZgnAFiSLazpRkQp4UBqsXgPI+CBHFa2HkMm3nb7kUbH+ZhMGCosYkmwmFsiUAtxbnbDvMeeMBwLC23gbAW5uOPc9sSgFr4EgwYGw4To4WxsRmkZXMzj4EEkVqYD4K1bGAmXgvQL3/OJeTOOAwM5ARi/MLPf8awcUZZQm5//+HDDz7U2BDWggoSSFM+CkbBKBgFowAXAAD4Pzl2PYQGVQAAAABJRU5ErkJggg==\",\"orcid\":\"\",\"institution\":\"Huazhong University of Science and Technology\",\"correspondingAuthor\":true,\"prefix\":\"\",\"firstName\":\"Xufei\",\"middleName\":\"\",\"lastName\":\"Li\",\"suffix\":\"\"}],\"badges\":[],\"createdAt\":\"2024-01-25 05:59:15\",\"currentVersionCode\":1,\"declarations\":\"\",\"doi\":\"10.21203/rs.3.rs-3896162/v1\",\"doiUrl\":\"https://doi.org/10.21203/rs.3.rs-3896162/v1\",\"draftVersion\":[],\"editorialEvents\":[],\"editorialNote\":\"\",\"failedWorkflow\":false,\"files\":[{\"id\":50476135,\"identity\":\"284c2f2d-075c-4ea7-9a0d-75ea6dae920b\",\"added_by\":\"auto\",\"created_at\":\"2024-02-01 06:03:50\",\"extension\":\"png\",\"order_by\":1,\"title\":\"Figure 1\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":4401278,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eChronic OSA increased the susceptibility to atrial fibrillation in rats. A:\\u003c/strong\\u003e Representative images of hematoxylin and eosin (HE) staining in atrial tissue. Bar = 100 μm. \\u003cstrong\\u003eB:\\u003c/strong\\u003e Representative images of Masson staining for atrial tissue.\\u003cem\\u003e\\u003cstrong\\u003e \\u003c/strong\\u003e\\u003c/em\\u003eBar = 100 μm. \\u003cstrong\\u003eC-F: \\u003c/strong\\u003eImmunostaining of Collagen I (COL I) and Collagen III (COL III) in atrial tissue. Bar = 100 μm. Mean ± S.E.M. \\u003cem\\u003en \\u003c/em\\u003e= 5. \\u003cstrong\\u003eG:\\u003c/strong\\u003e ∑WOVs changes in rats. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 8. \\u003cstrong\\u003eH:\\u003c/strong\\u003e Mean AF duration in rats. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 8. \\u003cstrong\\u003eI: \\u003c/strong\\u003eRepresentative examples of the neural recordings from the anterior right GP.\\u003cstrong\\u003e J-K: \\u003c/strong\\u003emRNA expressions of c-fos, NGF in atrial tissue. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 8-12.\\u003cstrong\\u003e \\u003c/strong\\u003e\\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01\\u003cem\\u003e vs\\u003c/em\\u003e CON.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure1.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3896162/v1/d2dd05a671fb8ca539fc3cce.png\"},{\"id\":50476134,\"identity\":\"62a5b1f4-6d88-49bb-a299-5445fca80931\",\"added_by\":\"auto\",\"created_at\":\"2024-02-01 06:03:50\",\"extension\":\"png\",\"order_by\":2,\"title\":\"Figure 2\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1548506,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eChronic OSA resulted in the abnormal polarization of macrophages in atrial tissue. A-H:\\u003c/strong\\u003e Immunofluorescence staining of CD68 and CD163 in atrial tissue. Bar = 400 μm. Mean ± S.E.M. \\u003cem\\u003en\\u003c/em\\u003e = 5.\\u003cem\\u003e\\u003cstrong\\u003e \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003eI-N: \\u003c/strong\\u003emRNA expressions of TNFα, IL6, iNOS, TGFβ, IL10, and Arg1 in atrial tissue. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 8-12.\\u003cstrong\\u003e \\u003c/strong\\u003e\\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01\\u003cem\\u003e vs\\u003c/em\\u003e CON.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure2.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3896162/v1/7ced79b57be31f705307f4c8.png\"},{\"id\":50476302,\"identity\":\"23b16af8-8029-4374-a70f-e9c4846960dd\",\"added_by\":\"auto\",\"created_at\":\"2024-02-01 06:11:50\",\"extension\":\"png\",\"order_by\":3,\"title\":\"Figure 3\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":6365844,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eIncreased polarization of M1 macrophages mediated the susceptibility to atrial fibrillation induced by chronic OSA. A-B:\\u003c/strong\\u003e Immunofluorescence staining of CD68 in atrial tissue. Bar = 400 μm. Mean ± S.E.M. \\u003cem\\u003en\\u003c/em\\u003e = 5. \\u003cstrong\\u003eC: \\u003c/strong\\u003emRNA expression of CD68 in atrial tissue. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 8-12.\\u003cstrong\\u003e D:\\u003c/strong\\u003e Representative images of hematoxylin and eosin (HE) staining for atrial tissue. Bar = 100 μm. \\u003cstrong\\u003eE-F: \\u003c/strong\\u003emRNA expressions of TNFα and IL6 in atrial tissue. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 8-12. \\u003cstrong\\u003eG:\\u003c/strong\\u003e Representative images of Masson staining for atrial tissue.\\u003cem\\u003e\\u003cstrong\\u003e \\u003c/strong\\u003e\\u003c/em\\u003eBar = 100 μm. \\u003cstrong\\u003eH:\\u003c/strong\\u003e The ∑WOVs changes of rats. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 8. \\u003cstrong\\u003eI:\\u003c/strong\\u003e Mean AF duration of rats. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 8. \\u003cstrong\\u003eJ-K: \\u003c/strong\\u003eImmunostaining of Collagen I (COL I) in atrial tissue. Bar = 100 μm. Mean ± S.E.M. \\u003cem\\u003en \\u003c/em\\u003e= 5. \\u003cstrong\\u003eL: \\u003c/strong\\u003emRNA expression of COL I in atrial tissue. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 8-12. \\u003cstrong\\u003eM-N: \\u003c/strong\\u003eImmunostaining of Collagen III (COL III) in atrial tissue. Bar = 100 μm. Mean ± S.E.M. \\u003cem\\u003en \\u003c/em\\u003e= 5. \\u003cstrong\\u003eO: \\u003c/strong\\u003emRNA expression of COL III in atrial tissue. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 8-12. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01\\u003cem\\u003e vs\\u003c/em\\u003e CON, \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05 \\u003cem\\u003evs\\u003c/em\\u003e OSA group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure3.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3896162/v1/85400efbda90e8a5dc56cd35.png\"},{\"id\":50476142,\"identity\":\"75616bb7-ea84-40e1-ad68-265c29db315b\",\"added_by\":\"auto\",\"created_at\":\"2024-02-01 06:03:52\",\"extension\":\"png\",\"order_by\":4,\"title\":\"Figure 4\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":909504,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eHypoxia and reoxygenation induced a reciprocal interaction of M1 macrophages and atrial myocytes. A-B:\\u003c/strong\\u003e mRNA expressions of Collagen (COLI) and Collagen (COLIII) in atrial myocyte. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 6. mRNA expressions of NFG and c-fos in atrial myocytes. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 6.\\u003cem\\u003e\\u003cstrong\\u003e \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003eC-D: \\u003c/strong\\u003emRNA expressions of NFG and c-fos in atrial myocytes. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 6.\\u003cem\\u003e\\u003cstrong\\u003e \\u003c/strong\\u003e\\u003c/em\\u003e\\u003cstrong\\u003eE-J: \\u003c/strong\\u003emRNA expressions of TNFα, IL6, iNOS, TGFβ, IL10, and Arg1 in macrophages. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 6. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01\\u003cem\\u003e vs\\u003c/em\\u003e CON.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure4.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3896162/v1/94bc83934f57424a7a1af416.png\"},{\"id\":50476136,\"identity\":\"22818eff-d6b6-4c24-aeab-10108cf94510\",\"added_by\":\"auto\",\"created_at\":\"2024-02-01 06:03:50\",\"extension\":\"png\",\"order_by\":5,\"title\":\"Figure 5\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1649215,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eMIF/CD74 signaling mediated M1 macrophage polarization induced by OSA. A-B: \\u003c/strong\\u003eImmunostaining of macrophage migration inhibitory factor (MIF) in atrial tissue. Bar = 100 μm. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 5. \\u003cstrong\\u003eC:\\u003c/strong\\u003e mRNA expression of MIF in atrial myocytes. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 6. \\u003cstrong\\u003eD-E: \\u003c/strong\\u003eProtein expression of MIF in atrial myocytes. Mean ± S.E.M. \\u003cem\\u003en \\u003c/em\\u003e= 3. \\u003cstrong\\u003eF:\\u003c/strong\\u003e mRNA expression of MIF in atrial myocytes. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 3. \\u003cstrong\\u003eG: \\u003c/strong\\u003eThe\\u003cstrong\\u003e \\u003c/strong\\u003econtent of MIF in cellular supernatant. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 6. \\u003cstrong\\u003eH-K:\\u003c/strong\\u003e Protein expression of nuclear factor of kappa B (NF-κB) and phospho-NF-κB (p-NF-κB) in macrophages. Mean ± S.E.M. \\u003cem\\u003en \\u003c/em\\u003e= 3. \\u003cstrong\\u003eL-M: \\u003c/strong\\u003emRNA expressions of CD68, IL6, TNFα, iNOS, in macrophages. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 3.. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01\\u003cem\\u003e vs\\u003c/em\\u003e CON, \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05 \\u003cem\\u003evs\\u003c/em\\u003e OSA group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure5.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3896162/v1/b9dbad6d9bd3d7ca177e670a.png\"},{\"id\":50476140,\"identity\":\"f195a1cb-c387-4ce1-a293-13cdbce7e73e\",\"added_by\":\"auto\",\"created_at\":\"2024-02-01 06:03:50\",\"extension\":\"png\",\"order_by\":6,\"title\":\"Figure 6\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":1469999,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eHIF1α promoted the expression of MIF by binding to the gene promoter of MIF. A-B: \\u003c/strong\\u003eImmunostaining of hypoxia-inducible factor 1α (HIF1α) in atrial tissue. Bar = 100 μm. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 5. \\u003cstrong\\u003eC:\\u003c/strong\\u003e mRNA of expression HIF1α in atrial myocytes. Mean ± S.E.M., \\u003cem\\u003en \\u003c/em\\u003e= 3. \\u003cstrong\\u003eD-E: \\u003c/strong\\u003eProtein expression of HIF1α in atrial myocytes. Mean ± S.E.M. \\u003cem\\u003en\\u003c/em\\u003e = 3. \\u003cstrong\\u003eF:\\u003c/strong\\u003e mRNA expression of MIF in atrial myocytes and CD74 in macrophages. Mean ± S.E.M. \\u003cem\\u003en\\u003c/em\\u003e = 3. \\u003cstrong\\u003eG: \\u003c/strong\\u003eProtein expression of MIF in atrial myocytes. Mean ± S.E.M. \\u003cem\\u003en\\u003c/em\\u003e = 3. \\u003cstrong\\u003eH: \\u003c/strong\\u003emRNA expression of MIF in atrial myocytes. Mean ± S.E.M. \\u003cem\\u003en\\u003c/em\\u003e = 3. \\u003cstrong\\u003eJ-K: \\u003c/strong\\u003eThe predicted binding sites for HIF1α in the core region of \\u003cem\\u003eRattus norvegicus\\u003c/em\\u003e MIF promoter. \\u003csup\\u003e*\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05, \\u003csup\\u003e**\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.01\\u003cem\\u003e vs\\u003c/em\\u003e CON, \\u003csup\\u003e#\\u003c/sup\\u003e\\u003cem\\u003eP\\u003c/em\\u003e \\u0026lt; 0.05 \\u003cem\\u003evs\\u003c/em\\u003e OSA group.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure6.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3896162/v1/ca4d442bb1e70b09a9e5f1f2.png\"},{\"id\":50476303,\"identity\":\"066b4b1a-9958-417e-b110-8d734a4c7f31\",\"added_by\":\"auto\",\"created_at\":\"2024-02-01 06:11:50\",\"extension\":\"png\",\"order_by\":7,\"title\":\"Figure 7\",\"display\":\"\",\"copyAsset\":false,\"role\":\"figure\",\"size\":759744,\"visible\":true,\"origin\":\"\",\"legend\":\"\\u003cp\\u003e\\u003cstrong\\u003eHIF1α/MIF/CD74 signaling mediated OSA-induced atrial fibrillation\\u003c/strong\\u003e \\u003cstrong\\u003esusceptibility by promoting M1 macrophages polarization. \\u003c/strong\\u003eOSA:\\u003cstrong\\u003e \\u003c/strong\\u003eObstructive sleep apnea; HIF1α: hypoxia-inducible factor-1α; MIF: macrophage migration inhibitory factor;\\u003cstrong\\u003e \\u003c/strong\\u003ep-NF-κB:\\u003cstrong\\u003e \\u003c/strong\\u003ephosphor\\u003cstrong\\u003e-\\u003c/strong\\u003eNF-κB;\\u003cstrong\\u003e \\u003c/strong\\u003eAF:\\u003cstrong\\u003e \\u003c/strong\\u003eAtrial fibrillation.\\u003c/p\\u003e\",\"description\":\"\",\"filename\":\"figure7.png\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3896162/v1/16471c9f84c5d21c8724fd91.png\"},{\"id\":50629873,\"identity\":\"d7cecbfc-0d27-4cd6-88b7-b11909852dd3\",\"added_by\":\"auto\",\"created_at\":\"2024-02-04 20:52:22\",\"extension\":\"pdf\",\"order_by\":0,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"manuscript-pdf\",\"size\":5346157,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"manuscript.pdf\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3896162/v1/f0954dea-ca4b-4910-91bd-6b7c94cbec61.pdf\"},{\"id\":50476141,\"identity\":\"adaa2ccd-b623-406f-94da-e65e5584487f\",\"added_by\":\"auto\",\"created_at\":\"2024-02-01 06:03:50\",\"extension\":\"zip\",\"order_by\":1,\"title\":\"\",\"display\":\"\",\"copyAsset\":false,\"role\":\"supplement\",\"size\":4561756,\"visible\":true,\"origin\":\"\",\"legend\":\"\",\"description\":\"\",\"filename\":\"supplementaryfile.zip\",\"url\":\"https://assets-eu.researchsquare.com/files/rs-3896162/v1/db0856387c0d1829f3838e3b.zip\"}],\"financialInterests\":\"No competing interests reported.\",\"formattedTitle\":\"HIF1α/MIF/CD74 signaling mediated OSA-induced atrial fibrillation by promoting M1 macrophages polarization\",\"fulltext\":[{\"header\":\"Introduction\",\"content\":\"\\u003cp\\u003eAtrial fibrillation (AF) stands as one of the most prevalent enduring arrhythmias, contributing to a substantial global health burden\\u0026nbsp;[1]. Current epidemiological evidence reveals an exceeding 30 million individuals affected by AF worldwide, which is anticipated to surge with the aging demographic\\u0026nbsp;[2]. Recognized as a pivotal risk factor for stroke and heart failure, AF bears a heightened mortality and morbidity risk, thereby imposing a substantial economic strain on society. Consequently, there exists an imperative societal demand to mitigate the onset and recurrence of AF.\\u003c/p\\u003e\\n\\u003cp\\u003eObstructive sleep apnea (OSA) is a clinical syndrome of repeated apnea or hypopnea caused by periodic narrowing or collapse of the upper airway during sleep, which manifests in a series of clinical symptoms such as hypoxemia, hypercapnia and disturbance of sleep structure\\u0026nbsp;[3]. Epidemiological data demonstrates demonstrated a high prevalence of OSA, affecting approximately 14% of men and 5% of women\\u0026nbsp;[4]. Clinical investigations have revealed that OSA patients have had a twofold increased incidence of atrial fibrillation (AF) compared to non-OSA individuals. Moreover, 32% to 49% of AF patients had comorbid OSA\\u0026nbsp;[5, 6]. Notably, OSA has been linked to reduced medication response and higher AF recurrence rates following radiofrequency ablation\\u0026nbsp;[7, 8]. These studies collectively indicated that OSA played a significant role in the increased occurrence and recurrence of AF. However, the precise mechanisms underlying OSA-induced AF remain inadequately understood.\\u003c/p\\u003e\\n\\u003cp\\u003eMacrophages, classified as M1 and M2, play critical roles in the body\\u0026apos;s innate immune system\\u0026nbsp;[9]. M1 macrophages primarily mediate robust inflammatory and Th1 immune responses\\u0026nbsp;[10], while M2 macrophages contribute to inflammation inhibition, tissue repair, and angiogenesis\\u0026nbsp;[10]. Notably, a significant increase in M1 macrophage infiltration was observed in the left auricular tissue and mural thrombi of AF and rheumatic mitral stenosis patients\\u0026nbsp;[11]. Moreover, M1 macrophages can secrete IL-1\\u0026beta;, inhibiting atrial myocyte tremor protein expression and reducing L-type calcium channel current, ultimately exacerbating atrial electrical remodeling and triggering AF\\u0026nbsp;[12]. These findings underscore the critical involvement of M1 macrophages in AF pathogenesis. Additionally, studies have indicated that OSA can elevate M1 macrophage infiltration in subcutaneous adipose tissue\\u0026nbsp;[13]\\u0026nbsp;and cause M1 macrophage aggregation in the aortic wall in a chronic OSA mouse model\\u0026nbsp;[14]. This suggests that OSA might mediate AF occurrence by influencing M1 macrophage polarization. However, the precise molecular mechanism remains unclear.\\u003c/p\\u003e\\n\\u003cp\\u003eIn our previous study, we demonstrated that acute OSA can contribute to the development of AF through an animal model [15]. However, our clinical observations revealed that AF patients with OSA typically experienced a longer duration of OSA onset. To further investigate this matter, we established a chronic OSA rat model and aimed to elucidate the involvement of macrophages in OSA-induced AF. Moreover, to shed light on the molecular mechanisms underlying the abnormal polarization of macrophages induced by chronic OSA, we created a co-culture cell model consisting of macrophages and atrial myocytes. Hypoxia/reoxygenation was applied to simulate the conditions of chronic OSA. Through this comprehensive study, we aim to provide valuable insights into developing early prevention and treatment strategies, ultimately reducing the incidence and recurrence rate of OSA-induced AF.\\u003c/p\\u003e\"},{\"header\":\"Methods and Materials\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003e1. Chemicals and Reagents\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eThe antibodies of hypoxia-inducible factor-1\\u0026alpha;\\u0026nbsp;(HIF1\\u0026alpha;) (A22041), macrophage migration inhibitory factor (MIF) (A22623), CD74 (A5667), nuclear factor-kappa B (NF-\\u0026kappa;B) (A6667), phospho-NF-\\u0026kappa;B (P-NF-\\u0026kappa;B) (AP1355), Collagen I (COL I) (A16891), Collagen III (COL III) (A0871), CD68 (A20803), and CD163 (A8383) were obtained by Abclonal Inc.(China). SiRNA for NF-\\u0026kappa;B, MIF and\\u0026nbsp;HIF1\\u0026alpha;\\u0026nbsp;were purchased from Sigma(USA). Clodronate liposomes (Clod) (283539) was purchased VU Medical Central Inc.(NZ). DMEM/F12 (1:1), PBS and fetal bovine serum were provided by Gibco (St. Louis, Missouri, USA).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e2. Animals and Treatment\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAll animal experiments were performed according to the National Defense Medical College guidelines for the care and use of laboratory animals in research. 12-week-old male Sprague-Dawley rats were used for animal experiments with the approval of the Animal Research Committee at Tongji Medical College, Huazhong University of Science and Technology. All rats were randomly and equally divided into three groups: (a) the control group, (b) the OSA group, (c) the OSA + Clod group. The establishment of the chronic OSA model was modified from a previously described method\\u0026nbsp;[16]. Briefly, the intermittent hypoxia group rats were treated with hypoxia after a 1-week adaptation period. First, nitrogen was added to reduce the oxygen concentration in the chamber to 7-8% and maintain hypoxia for 60 s. \\u0026nbsp; \\u0026nbsp;Secondly, oxygen was added, the oxygen concentration in the cavity was increased to 20-21%, and the oxygen was maintained for 30 seconds. The cycle was lasted for 8 hours a day (9:00-17:00). During the experiment, fasting and water were prohibited, and the blank control group was left in a plexiglass chamber of the same specification, and normal air passed through it daily. On day 28, the heart was quickly separated after anesthesia and fixed with 10% neutral formalin fixative. For the treatment of Clod, the rats were injected Clod (40 mg/kg) on days 1, 3 and 6 before the OSA treatment was given\\u0026nbsp;[17, 18].\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e3. Electrophysiology\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u0026nbsp;AF was induced with essentially the same protocol as described by \\u003cem\\u003eLi et al\\u0026nbsp;\\u003c/em\\u003e[19]\\u003cem\\u003e.\\u003c/em\\u003e Briefly, rats underwent open-chest electrophysiological programmed stimulation under 1% sodium pentobarbital (30 mg/kg) anesthesia. The 1.9-F octapolar catheter (Transonic Systems Inc, New York, USA) was placed on the right atrium for programmed stimulation. To assess AF inducibility, 50-Hz burst pacing was applied for 3 seconds with 12 bursts separated by a 2 seconds interval. AF was defined as \\u0026gt;1 second of irregular atrial electrograms (\\u0026gt;800 beats/min) with irregular ventricular response. AF duration was defined as the mean duration of all AF episodes within 60 second s in each rat.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e4. Histological and immunohistochemical staining\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eAtrial tissue was fixed overnight in 10% neutral formalin fixative and embedded in paraffin, sectioned into 4 \\u0026mu;m thick slices and stained with hematoxylin and eosin (HE) and Masson\\u0026apos;s trichrome (Masson). After the gradient alcohol was dehydrated, transparent, and sealed, Image-Pro image analysis software was used to observe the pathological conditions of the specimens. For immunohistochemical staining, sections were deparaffinized, antigen retrieved, blocked, and incubated with primary antibodies of COL 1, COL III,\\u0026nbsp;HIF1\\u0026alpha;, MIF\\u0026nbsp;and CD74 and relevant biotinylated secondary antibodies. Finally, sections were stained with DAB and counterstained with hematoxylin.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e5. Immunofluorescence (IF) Staining\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u0026nbsp;\\u003c/strong\\u003eFor the immunofluorescence of atrial tissue, the paraffin-embedded atrial tissue was cut into 4\\u0026thinsp;\\u0026mu;m sections, deparaffinized in xylene and rehydrated. Samples were boiled in Tris-EDTA (pH 9) for 10\\u0026thinsp;min, rinsed with PBS 3 times and incubated in 3% H2O2 for 10\\u0026thinsp;min. After blocking in 5% BSA for 20\\u0026thinsp;min at room temperature, the sections were then incubated overnight at 4\\u0026thinsp;\\u0026deg;C with the primary antibodies against rat CD68 (1:50) and CD163 (1:100), followed by subsequent incubation with the Cy3-conjugated second antibody (1:100) for 2\\u0026thinsp;h at room temperature. Additional sections were incubated with nonspecific IgG instead of the primary antibody to act as negative controls. Five areas of each slice were taken and photographed. The mean optical density (MOD) of immunohistochemistry was quantified by two individuals under the double-blind principle.\\u003c/p\\u003e\\n\\u003cp\\u003eFor the immunofluorescence of cells, cells were washed with PBS and fixed with 4% paraformaldehyde for 15 min. Cells were washed and permeated with 0.5% Triton X-100 in PBS for 20 min at room temperature, and then, the cells were blocked with 5% BSA in PBS for 1 h. Antibodies were added and incubated overnight at 4 \\u0026deg;C. Fluorescent secondary antibody (1:100, Bioss Inc., Beijing, China) was added for 2 h at room temperature. Cells were then incubated with DAPI for 5 min at room temperature.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e6. Cell Culture and Treatment\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u0026nbsp;\\u003c/strong\\u003eRat atrial myocytes were isolated as previously described\\u0026nbsp;[20]. Briefly, hearts were rapidly excised under terminal anesthesia, mounted on a modified Langendorff perfusion apparatus, and perfused retrogradely via the aorta with a series of solutions at 37\\u0026deg;C, based on an isolation solution composed of (in mmol/L) 130 NaCl, 5.4 KCl, 1.4 MgCl2, 0.4 NaH2PO4, 4.2 HEPES, 10 d-glucose, 20 taurine, and 10 creatine (pH 7.3). Hearts were initially perfused for\\u0026nbsp;\\u0026asymp;\\u0026nbsp;4 minutes with a solution containing 0.75 mmol/L of CaCl\\u003csub\\u003e2\\u003c/sub\\u003e. The hearts were then perfused for 4 minutes with a Ca\\u003csup\\u003e2\\u003c/sup\\u003e+-free isolation solution containing 0.1 mmol/L of EGTA; which was followed by perfusion with low [Ca\\u003csup\\u003e2\\u003c/sup\\u003e+] isolation solution ([Ca\\u003csup\\u003e2\\u003c/sup\\u003e+]\\u0026nbsp;\\u0026asymp;5 to 10 \\u0026mu;mol/L) containing 0.4 mg/mL of Worthington type 1 collagenase (Lorne Laboratories). After 12 to 20 minutes, the heart was removed from the apparatus. The left atrium was dissected from the heart, finely chopped, and gently triturated using a glass Pasteur pipette at room temperature in Kraftbruhe (KB) medium of composition (mmol/L) 70 l-glutamic acid, 30 KCl, 10 HEPES, 1 EGTA, 5 MgCl2, 5 Na-pyruvate, 20 taurine, 10 d-glucose, 5 succinic acid, 5 creatine, 2Na\\u003csup\\u003e+\\u003c/sup\\u003e, 2ATP, and 5 \\u0026beta;-hydroxybutyric acid (pH 7.2).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTo obtain enough macrophages, 4-week-old Sprague-Dawley rats were sacrificed and the tibia and femur were isolated. Then, we flushed the bone marrow cavity with a syringe. After flushing and lysing the red blood cells, macrophages were cultured in a T25 culture flask for 24 h. After that, 50 ng/ml M-CSF was added for 7 days to induce mononuclear macrophages. The medium was changed every two days. For M1 polarization, we stimulated BMDMs with 100 ng/ml LPS and 40 ng/ml IFN-\\u0026gamma; for 24 h. Regarding inhibiting CD74, MIF and HIF1\\u0026alpha;, macrophages and atrial myocyte were transfected with siRNA, respectively. According to the manufacturer, Lipofectamine 3000, (Invitrogen, Carlsbad, CA, USA) was used at 50 nM in the final episode.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e7. RNA Isolation and RT-qPCR\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTotal RNA was isolated from tissue and cells using TRIzol Reagent following the manufacturer\\u0026rsquo;s protocol. The total RNA was reverse transcribed using a first-strand cDNA synthesis kit. Then, RT-qPCR was performed using a SYBR Green qPCR Master Mix Kit and ABI StepOnePlus cycler (Applied Biosystems, Foster City, CA, USA) with 40 cycles. Relative gene expression was calculated for each gene by the 2-\\u003csup\\u003e\\u0026Delta;\\u0026Delta;\\u003c/sup\\u003eCT method with\\u0026nbsp;\\u0026beta;-actin\\u0026nbsp;for normalization. The results were expressed as fold values relative to the control group. Primers of RT-qPCR were listed in Table 1.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e8. Western Blot\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCells were washed twice with ice-cold PBS and lysed in 200\\u0026thinsp;\\u0026mu;l RIPA Lysis Buffer and 1\\u0026thinsp;mM phenylmethylsulfonyl fluoride for 5\\u0026thinsp;min on ice to extract total protein. Cytoplasmic protein and nucleic protein were respectively extracted by the nuclear and cytoplasmic protein extraction kit following the manufacturer\\u0026rsquo;s protocols. Equal amounts of protein lysates (30\\u0026thinsp;\\u0026mu;g per lane) were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis on 10% polyacrylamide gels, transferred to polyvinylidene difluoride membranes and blotted with the primary antibodies at 4\\u0026thinsp;\\u0026deg;C overnight. Band intensity was quantified by using Quantity One (Bio-Rad, Shanghai, China).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e9. Chromatin Immunoprecipitation (ChIP) Assay\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eCell suspensions were collected and fixed in 1% formaldehyde for chromatin cross-linking and added 125\\u0026thinsp;mM glycine to stop the reaction. The samples were centrifuged and resuspended in 0.5\\u0026thinsp;ml lysis buffer containing protease inhibitors. Cell lysates were sonicated to shear DNA to lengths of ~\\u0026thinsp;200 base pairs and transferred to a new tube with ChIP dilution buffer. Chromatin was incubated overnight at 4\\u0026thinsp;\\u0026deg;C on nutator/rocker with specific antibody for HIF1\\u0026alpha; (1:50 dilution) and BSA-treated Protein G beads to reduce nonspecific background binding. The immunoprecipitated DNA\\u0026ndash;protein complex with beads was collected by centrifugation and washed sequentially with low-salt, high-salt, LiCl immune complex, and Tris\\u0026ndash;ethylenediaminetetraacetic acid washing buffer solutions. Freshly prepared elution buffer (1% sodium dodecyl sulphate, 0.1\\u0026thinsp;M NaHCO3) was used to elute the DNA\\u0026ndash;protein complex. The samples were then placed in 65\\u0026thinsp;\\u0026deg;C water baths overnight to reverse formaldehyde cross-linking and subsequently were purified using DNA purification kits. The isolated DNA was then assayed using RT-qPCR. The isolated DNA was then assayed using RT-qPCR. The primer sequences of the promoters were as follows: primer1, forward, TACTGGTCATAATCACTGACC, reverse, ATCGAGAGCTCTTCGAACCTC, primer2, forward, ATCGACCCCAACCTACTGTGG, reverse, TTACGAAGCTCTACTGACCTC, primer3, forward, CCTACCCCCAAATCACTGTAC, reverse, CCTGAGAGCTCTTGCTAGCTC. The input values were compared to the immunoprecipitated samples, with the IgG negative controls values subtracted as background. The calculated errors in all graphs depicting ChIP data represent the standard deviations for three replicate RT-qPCRs for precipitated chromatin, input chromatin, and background (i.e., chromatin precipitated with nonspecific IgG).\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e10. Statistical Analysis\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eIn this study, Prism 8.0 was used for data analysis. Quantitative data were expressed as mean \\u0026plusmn; S.E.M. Multiple comparisons were performed using one-way analysis of variance (ANOVA). The unpaired two-tailed student\\u0026rsquo;s \\u003cem\\u003et\\u003c/em\\u003e-test was used to compare the control group and the other single groups. \\u003cem\\u003eP\\u003c/em\\u003e\\u0026lt;0.05 was considered statistically significant.\\u003c/p\\u003e\"},{\"header\":\"Results\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003e1. Chronic OSA increased the susceptibility to AF in rats\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eTo investigate the impact of OSA on atrial fibrillation susceptibility, we conducted a rat model of chronic OSA. Histological and electrophysiological changes in the rat heart were assessed to determine the effects. Results from HE and Masson staining revealed a disorganized arrangement of atrial muscle fibers and increased collagen deposition in the interstitial space of muscle fibers in rats with chronic OSA compared to the control group (Fig. 1A-B). Immunohistochemical staining showed a significant increase in the levels of COL I and COL III in atrial fibers under chronic OSA treatment (Fig. 1C-F,\\u003cem\\u003e\\u0026nbsp;P\\u003c/em\\u003e＜0.01). Additionally, OSA treatment led to a notable elevation in the ΣWOVs, a surrogate for AF inducibility, and incidence of AF compared to the control group (Fig. 1G-H, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05). At the same time, the incidence of AF in the OSA group was also significantly higher than that in the control group (Fig. 1I). It is worth noting that the occurrence of AF could trigger significant changes in the expression of neurofactors associated with atrial remodeling\\u0026nbsp;[21].\\u0026nbsp;Hence, we examined the impact of OSA on atrial neurogenesis and found that OSA treatment significantly increased the expression of atrial nerve remodeling indicators, c-fos and NGF (Fig. 1J-K, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05). In conclusion, chronic OSA in rats promoted atrial fibrosis, increased the incidence of AF, and induced atrial nerve remodeling.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e2. Increased M1 macrophage polarization mediated the susceptibility to AF induced by chronic OSA\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eM1 macrophages are characterized by the expression of marker genes such as CD68, TNFα, IL6, and iNOS, whereas M2 macrophages are identified by the expression of CD163, TGFβ, IL10, and Arg1\\u0026nbsp;[22]. To investigate the potential roles of macrophages in AF substantial induced by OSA, we initially evaluated the polarization of macrophages in atrial tissues. Immunofluorescence staining results demonstrated a significant increase in CD68 expression and a significant decrease in CD163 expression in the atrial tissue of the OSA group compared to the control group (Fig. 2A-I, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01).\\u0026nbsp;Additionally, we examined the gene expression levels of other macrophage markers. Our findings revealed that the mRNA expression of TNFα, IL6, and iNOS were significantly higher in the OSA group (Fig. 2J-M, Q, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05).\\u0026nbsp;Conversely, the mRNA expression levels of TGFβ, IL10, and Arg1 were significantly decreased in the OSA group (Fig. 2N-P,\\u003cem\\u003e\\u0026nbsp;P\\u003c/em\\u003e＜0.05). These results suggested that OSA treatment led to an infiltration of M1 macrophages and a reduction of M2 macrophages in the atrial tissue.\\u003c/p\\u003e\\n\\u003cp\\u003eTo further investigate the potential involvement of M1 macrophages in OSA-induced AF susceptibility, we employed intravenous injection of clodronate liposome (Clod) to eliminate macrophages in rats\\u0026nbsp;[23]. Immunofluorescence staining results demonstrated a significant decrease in CD68 expression in the atrial tissue of the OSA plus Clod treatment group compared to the OSA group alone (Fig. 3A-B, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05). RT-qPCR analysis revealed a marked reduction in the mRNA expression levels of CD68, TNFα, and IL6 in the atrial tissues of the OSA plus Clod treatment group (Fig. 3C, E-F, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05).\\u0026nbsp;These findings indicated that Clod treatment effectively eliminated M1 macrophages from the atrial tissue. Histological examination, using HE and Masson staining, demonstrated that Clod treatment significantly ameliorated the disorganized arrangement of atrial muscle fibers and reduced collagen deposition induced by OSA (Fig. 3D, G). Clod treatment effectively reversed the increased expression of COL I and COL III induced by OSA in atrial fibrillation (Fig. 3J-O, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05). Finally, we assessed the changes in atrial electrophysiology and found that the OSA plus Clod treatment group exhibited a significant decrease in the ΣWOVs, and incidence of AF, as compared to the OSA group (Fig. 3H-I, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05). Overall, these results demonstrated that the polarization of M1 macrophages mediated the susceptibility to AF induced by chronic OSA.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e3. Hypoxia and reoxygenation induced the interaction of M1 macrophages and atrial myocytes.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003e\\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp; \\u0026nbsp;\\u0026nbsp;To further investigate the contribution of M1 macrophages to AF susceptibility induced by OSA, we established an in vitro co-culture model using primary macrophages and atrial myocytes. The cells were subjected to hypoxia/reoxygenation to mimic the OSA environment in rat models. RT-qPCR analysis revealed that hypoxia/reoxygenation significantly increased the expression of COL1 and COL III in the alone atrial myocytes, compared to the control group (Fig.4A-B, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05).\\u0026nbsp;Furthermore, hypoxia/reoxygenation also induced the expression of neurofactors related to atrial remodeling, such as NGF and c-fos (Fig.4C-D, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01).\\u0026nbsp;Interestingly, these indexes were further aggravated in the atrial myocytes co-cultured with macrophages under hypoxia/reoxygenation, compared to the group of alone atrial myocytes (Fig.4A-D, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01).\\u0026nbsp;These findings suggested that hypoxia/reoxygenation induced neuro remodeling and tissue remodeling in atrial myocytes, and co-cultured macrophages exacerbated these effects.\\u003c/p\\u003e\\n\\u003cp\\u003eSimultaneously, we observed that hypoxia/reoxygenation resulted in an upregulation of M1 macrophage marker genes, including IL6, TNFα, and iNOS, with concomitant downregulation of M2 macrophage marker genes, such as TGFβ, IL10, and Arg1, in alone macrophages compared to the control group (Fig.4E-J, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01).\\u0026nbsp;In the presence of co-cultured atrial myocytes under hypoxia/reoxygenation conditions, the expression of IL6, TNFα, and iNOS in macrophages was further increased, while the expression of M2 macrophage marker genes, TGFβ, IL10, and Arg1, was further reduced compared to the group of alone macrophages (Fig.4E-J, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01).\\u0026nbsp;These findings indicated that hypoxia/reoxygenation induces M1 macrophage polarization, and co-cultured atrial myocytes intensified these effects. Overall, these results suggested a reciprocal interaction between atrial myocytes and macrophages under hypoxia/reoxygenation conditions, contributing to the development of their respective pathological roles.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e4. High expression of MIF in atrial myocytes mediated the increased polarization of M1 macrophage polarization induced by OSA\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003ePrevious studies have indicated that M1 macrophages exacerbated atrial remodeling through the secretion of IL1β in AF\\u0026nbsp;[24].\\u0026nbsp;Therefore, we focused on how atrial myocytes regulated M1 macrophage polarization under OSA and its subsequent contribution to AF susceptibility. Macrophage migration inhibitory factor (MIF) is an immunomodulatory cytokine with multiple effects and can be produced and released by cardiomyocytes, endothelial cells, epithelial cells, and vascular smooth muscle cells\\u0026nbsp;[25]. It has been reported that increased serum MIF levels in OSA patients were observed\\u0026nbsp;[26].\\u0026nbsp;CD74, a transmembrane glycoprotein, is a critical MIF receptor and could be expressed in macrophages\\u0026nbsp;[27]. The MIF/CD74 pathway could activate the downstream NF-κB pathway\\u0026nbsp;[28],\\u0026nbsp;a crucial transcription factor involved in M1 macrophage polarization\\u0026nbsp;[29]. Based on these findings, we hypothesized that OSA might induce the expression of MIF in atrial myocytes, leading to the activation of the NF-κB pathway downstream and subsequent M1 macrophage polarization via interaction with CD74.\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003eTo test our hypothesis, we initially investigated the expression of MIF in the above rat models. Immunohistochemistry staining revealed a significant increase in MIF protein and mRNA expression in atrial tissues following OSA treatment (Fig.5A-C, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05).\\u003c/p\\u003e\\n\\u003cp\\u003eSubsequently, we examined relevant indexes in the co-culture model under hypoxia/reoxygenation conditions. Hypoxia/reoxygenation notably enhanced the mRNA and protein expression of MIF in atrial myocytes, along with an increase in MIF content in the supernatant compared to the control group (Fig.5D-G, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05). Additionally, hypoxia/reoxygenation promoted the protein expression of p-NF-κB in macrophages (Fig.5H-I, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05).\\u0026nbsp;Subsequently, in the co-culture system, we utilized MIF siRNA to suppress MIF expression in atrial myocytes and CD74 siRNA to inhibit CD74 expression in macrophages. Western blot analysis indicated that MIF and CD74 siRNA effectively reversed the upregulation of p-NF-κB protein induced by hypoxia/reoxygenation in macrophages (Fig.5J-K).\\u0026nbsp;Furthermore, MIF SiRNA and CD74 siRNA significantly mitigated the hypoxia/reoxygenation-induced increase in mRNA expression of M1 macrophage marker genes, namely CD68, IL6, TNFα, and iNOS (Fig.5L-M, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05).\\u0026nbsp;These findings proved that the upregulation of MIF in atrial myocytes triggered by hypoxia/reoxygenation activated the NF-κB pathway via the CD74 in macrophage, ultimately promoting M1 macrophage polarization.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003e5. HIF1α mediated the high expression of MIF in atrial tissues induced by OSA\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003cp\\u003eHIF1α, a crucial member of the hypoxia-inducible factor family, functions as a core transcription factor that induces hypoxia-related genes\\u0026nbsp;[30]. To investigate whether HIF1α participated in the elevated expression of MIF caused by OSA, we initially examined the expression of HIF1α in atrial tissues of the rat OSA model. The findings showed a significant increase in HIF1α protein expression in the atrial tissue of the OSA group (Fig.6A-B, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05).\\u0026nbsp;Furthermore, we observed that hypoxia/reoxygenation significantly enhanced the mRNA and protein expression of HIF1α in atrial myocytes (Fig.6C-E, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05). Subsequently, we silenced HIF1α expression in atrial myocytes using HIF1α siRNA. The results showed that HIF1α siRNA effectively reversed the upregulation of MIF expression caused by hypoxia/reoxygenation (Fig.6F-H, \\u003cem\\u003eP\\u003c/em\\u003e＜0.05). These outcomes indicated that hypoxia/reoxygenation promoted the MIF expression through HIF1α. Subsequently, to elucidate the molecular mechanism of HIF1α in promoting MIF gene expression, we predicted potential binding sites of HIF1α in the MIF gene promoter region using the Jaspar website. Prediction results suggested three binding sites in the MIF gene promoter region:- 1937/-1930 nt, -1049/-1042 nt, and -446/-439 nt, respectively (Fig. 6J). Then, we observed a significant increase in HIF1α protein binding to these sites following hypoxia/reoxygenation treatment through ChIP-PCR (Fig.6K, \\u003cem\\u003eP\\u003c/em\\u003e＜0.01). These findings demonstrated that OSA induced the expression of HIF1α, which promoted MIF expression by binding to the promoter region of the MIF gene.\\u003c/p\\u003e\"},{\"header\":\"Discussion\",\"content\":\"\\u003cdiv id=\\\"Sec17\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e1. Increased M1 macrophage polarization mediated susceptibility to AF induced by chronic OSA\\u003c/h2\\u003e \\u003cp\\u003eAF is a prevalent supraventricular arrhythmia that exhibits an increased prevalence with advancing age and the presence of comorbidities, including heart failure [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. Previous research has highlighted a significant association between sleep-disordered breathing and the occurrence of AF [\\u003cspan additionalcitationids=\\\"CR32\\\" citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e\\u0026ndash;\\u003cspan citationid=\\\"CR33\\\" class=\\\"CitationRef\\\"\\u003e33\\u003c/span\\u003e]. Notably, OSA is one of the most common forms of sleep-disordered breathing, frequently accompanying AF [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. Prevalence rates of OSA in AF patients have been reported to range from 21% to over 80% [\\u003cspan citationid=\\\"CR31\\\" class=\\\"CitationRef\\\"\\u003e31\\u003c/span\\u003e]. In a study by Iwasaki \\u003cem\\u003eet al.\\u003c/em\\u003e, rats were subjected to simulated OSA using a mechanical ventilator, resulting in left ventricular hypertrophy, dilation, diastolic dysfunction, and increased inducibility of AF during acute OSA episodes in 82.4% of rats [\\u003cspan citationid=\\\"CR34\\\" class=\\\"CitationRef\\\"\\u003e34\\u003c/span\\u003e]. Building upon our previous research [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e], we established a chronic OSA model in rats. Moreover, we developed an in vitro atrial myocyte-macrophage co-culture model to replicate the hypoxic conditions associated with OSA. Our findings demonstrated a significant increase in the AF-prone window and AF incidence following OSA treatment. Histologically, OSA treatment led to a disordered arrangement of atrial myocardial fiber tissue and collagen fiber deposition in the myocardial septum of rats. \\u003cem\\u003eIn vitro\\u003c/em\\u003e experiments further revealed elevated collagen I and III secretion from atrial myocytes, signifying the induction of atrial structural remodeling by OSA. The expression of c-fos and NGF, markers associated with rapid neuronal activation and sympathetic neuron growth, survival, and differentiation [\\u003cspan citationid=\\\"CR15\\\" class=\\\"CitationRef\\\"\\u003e15\\u003c/span\\u003e], was significantly upregulated in atrial myocytes treated with OSA. These collective findings indicated that OSA contributes to neuro remodeling in atrial tissue, thus elevating the susceptibility to AF.\\u003c/p\\u003e \\u003cp\\u003eMacrophages can polarize into two distinct states (M1 and M2 macrophages) based on the local microenvironment, each engaging in different immune response processes [\\u003cspan citationid=\\\"CR35\\\" class=\\\"CitationRef\\\"\\u003e35\\u003c/span\\u003e]. Clinical studies have identified an augmented accumulation of macrophages in the atria of AF patients [\\u003cspan citationid=\\\"CR36\\\" class=\\\"CitationRef\\\"\\u003e36\\u003c/span\\u003e]. Animal investigations have revealed that AF induced the polarization of proinflammatory macrophages, which, in turn, intensify atrial electrical remodeling through the secretion of IL-1β [\\u003cspan citationid=\\\"CR24\\\" class=\\\"CitationRef\\\"\\u003e24\\u003c/span\\u003e]. Inhibition of M1 macrophage polarization could reduce type I and type III collagen expression in atrial fibroblasts, ameliorating myocardial fibrosis and improving atrial structural remodeling (Sun et al., 2019). In our current study, we observed a significant upregulation in M1 macrophage markers and a concurrent downregulation in M2 macrophage markers in atrial myocardial tissue following OSA treatment, coinciding with the development of AF. Clod is widely acknowledged as an effective method for the \\u003cem\\u003ein vivo\\u003c/em\\u003e depletion of macrophages in various studies [\\u003cspan citationid=\\\"CR23\\\" class=\\\"CitationRef\\\"\\u003e23\\u003c/span\\u003e, \\u003cspan citationid=\\\"CR37\\\" class=\\\"CitationRef\\\"\\u003e37\\u003c/span\\u003e]. Our findings revealed that Clod could reverse the pathological effects induced by OSA. Furthermore, \\u003cem\\u003ein vitro\\u003c/em\\u003e experiments demonstrated that hypoxia/reoxygenation stimulated the polarization of M1 macrophages, with the presence of macrophages exacerbating the fibrillation phenotype in atrial myocytes. These results showed that the polarization of M1 macrophages contributed to the susceptibility to AF induced by OSA.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec18\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e2. Activation of MIF/CD74 pathway mediated M1 macrophage polarization induced by OSA\\u003c/h2\\u003e \\u003cp\\u003eThe polarization state of macrophages is determined by molecules within the microenvironment, including cytokines and chemokines [\\u003cspan citationid=\\\"CR38\\\" class=\\\"CitationRef\\\"\\u003e38\\u003c/span\\u003e]. Initially identified as a soluble factor in the culture medium of activated T lymphocytes, MIF could inhibit macrophage migration [\\u003cspan citationid=\\\"CR39\\\" class=\\\"CitationRef\\\"\\u003e39\\u003c/span\\u003e]. However, recent studies have highlighted the association between MIF and macrophage polarization. Specifically, the upregulated expression of MIF in adipose tissue stimulated the polarization of M1 macrophages by interacting with its receptor CD74, further contributing to inflammation and insulin resistance [\\u003cspan citationid=\\\"CR27\\\" class=\\\"CitationRef\\\"\\u003e27\\u003c/span\\u003e]. In this study, we observed a significantly increased expression of MIF in atrial myocardial tissues following OSA treatment. Additionally, utilizing an in vitro co-culture model, we found that hypoxia/reoxygenation induced a substantial rise in M1 macrophage polarization and activated the MIF/CD74 pathway. Notably, the augmented M1 polarization resulting from hypoxia/reoxygenation was effectively reversed by silencing either MIF through siRNA in atrial myocytes or CD74 through siRNA in macrophages. Thus, we concluded that activating the MIF/CD74 pathway mediated the OSA-induced increase in M1 macrophage polarization.\\u003c/p\\u003e \\u003c/div\\u003e \\u003cdiv id=\\\"Sec19\\\" class=\\\"Section2\\\"\\u003e \\u003ch2\\u003e3. HIF1α mediated the high expression of MIF induced by OSA\\u003c/h2\\u003e \\u003cp\\u003eHIF1 is comprised of two subunits, α and β, with HIF-1β exhibiting stable expression in the nucleus that is independent of oxygen levels, while HIF-1α is expressed in the cytoplasm, and the availability of oxygen influences its activity. Under normoxic conditions, HIF-1α undergoes rapid degradation in the cytoplasm. However, in hypoxic environments, HIF-1α translocates to the nucleus, forming a complex with HIF-1β, referred to as activated HIF1. This complex initiates the expression of downstream target genes [\\u003cspan citationid=\\\"CR40\\\" class=\\\"CitationRef\\\"\\u003e40\\u003c/span\\u003e]. It has been indicated that hypoxia enhances the efficacy of macrophages in killing Leishmania amazonica through upregulating HIF-1α expression and subsequent elevation of MIF levels [\\u003cspan citationid=\\\"CR41\\\" class=\\\"CitationRef\\\"\\u003e41\\u003c/span\\u003e]. In human vascular smooth muscle cells, hypoxia could upregulate MIF expression via the HIF1α pathway [\\u003cspan citationid=\\\"CR42\\\" class=\\\"CitationRef\\\"\\u003e42\\u003c/span\\u003e]. In our study, we observed a significant increase in HIF1α expression in atrial myocytes \\u003cem\\u003ein vitro\\u003c/em\\u003e and \\u003cem\\u003ein vivo\\u003c/em\\u003e following OSA induction. Moreover, the upregulation of MIF expression induced by OSA was reversed upon introducing HIF1α siRNA. These findings strongly suggest that OSA induced the MIF expression through HIF1α. Finally, our results confirmed the existence of three HIF1α binding sites in the MIF gene promoter. Therefore, our findings proved that OSA stimulated the expression of HIF1α in atrial myocytes, which directly bound to the MIF gene promoter region and promoted its transcription translation and expression.\\u003c/p\\u003e \\u003c/div\\u003e\"},{\"header\":\"Conclusion\",\"content\":\"\\u003cp\\u003eIn our study, we observed that increased polarization of M1-type macrophages was involved in the increased susceptibility to AF induced by OSA, with the mechanism related to the interaction between atrial myocytes and macrophages. Specifically, OSA induced the upregulation of HIF1α expression in atrial myocytes, thereby promoting the binding of HIF1α to the MIF gene promoter binding site and increasing MIF expression. Then, the elevated levels of MIF activated NF-κB expression by binding to the transmembrane receptor CD74 in macrophages, consequently driving the polarization of M1-type macrophages. In turn, the subsequent polarized M1 macrophages exacerbated atrial remodeling through the secretion of inflammatory cytokines, finally contributing to the increased susceptibility to AF (Fig.\\u0026nbsp;\\u003cspan refid=\\\"Fig7\\\" class=\\\"InternalRef\\\"\\u003e7\\u003c/span\\u003e).\\u003c/p\\u003e \\u003cp\\u003e \\u003c/p\\u003e\"},{\"header\":\"Declarations\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eAuthor Contributions:\\u0026nbsp;\\u003c/strong\\u003eX.L. and B.L. designed the research; X.L. and H.H. conducted the analysis with help from L.Z. and X.L.; H.H. wrote the manuscript and had primary responsibility for the final content. All authors have read and agreed to the published version of the manuscript.\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eFunding:\\u0026nbsp;\\u003c/strong\\u003eThis work was supported by grants from the National Natural Science Foundation of China (No. 82000324).\\u0026nbsp;\\u003c/p\\u003e\\n\\u003cp\\u003e\\u003cstrong\\u003eConflicts of Interest:\\u0026nbsp;\\u003c/strong\\u003eThe authors declare no conflict of interest.\\u003c/p\\u003e\"},{\"header\":\"References\",\"content\":\"\\u003col\\u003e\\n\\u003cli\\u003eWang, X., et al., \\u003cem\\u003ePrevalence of atrial fibrillation in different socioeconomic regions of China and its association with stroke: Results from a national stroke screening survey.\\u003c/em\\u003e 2018: p. S0167527318309963-.\\u003c/li\\u003e\\n\\u003cli\\u003eMiyasaka and Y.J. Circulation, \\u003cem\\u003eSecular Trends in Incidence of Atrial Fibrillation in Olmsted County, Minnesota, 1980 to 2000, and Implications on the Projections for Future Prevalence.\\u003c/em\\u003e 2006. \\u003cstrong\\u003e114\\u003c/strong\\u003e(2): p. 119-125.\\u003c/li\\u003e\\n\\u003cli\\u003eBaldi, S.J.M.m., \\u003cem\\u003eObstructive sleep apnea syndromes.\\u003c/em\\u003e 2004. \\u003cstrong\\u003e95\\u003c/strong\\u003e(3): p. 173-175.\\u003c/li\\u003e\\n\\u003cli\\u003ePeppard, P.E., et al., \\u003cem\\u003eIncreased Prevalence of Sleep-Disordered Breathing in Adults.\\u003c/em\\u003e 2013(9): p. 1006-1014.\\u003c/li\\u003e\\n\\u003cli\\u003eSzymański, F.M., et al., \\u003cem\\u003eObstructive sleep apnoea in patients with atrial fibrillation: prevalence, determinants and clinical characteristics of patients in Polish population.\\u003c/em\\u003e 2014. \\u003cstrong\\u003e72\\u003c/strong\\u003e(8).\\u003c/li\\u003e\\n\\u003cli\\u003eGami, A.S., G. Pressman, and S.M.J.A.C.J.R. Caples, \\u003cem\\u003eAssociation of atrial fibrillation and obstructive sleep apnea.\\u003c/em\\u003e 2004. \\u003cstrong\\u003e13\\u003c/strong\\u003e(11): p. 62-63.\\u003c/li\\u003e\\n\\u003cli\\u003eMonahan, K., et al., \\u003cem\\u003eRelation of the severity of obstructive sleep apnea in response to anti-arrhythmic drugs in patients with atrial fibrillation or atrial flutter.\\u003c/em\\u003e 2012. \\u003cstrong\\u003e110\\u003c/strong\\u003e(3): p. 369-372.\\u003c/li\\u003e\\n\\u003cli\\u003eNg, C.Y., et al., \\u003cem\\u003eMeta-analysis of obstructive sleep apnea as predictor of atrial fibrillation recurrence after catheter ablation.\\u003c/em\\u003e 2011. \\u003cstrong\\u003e108\\u003c/strong\\u003e(1): p. 47-51.\\u003c/li\\u003e\\n\\u003cli\\u003eSica, A. and A.J.J.o.C.I. Mantovani, \\u003cem\\u003eMacrophage plasticity and polarization: in vivo veritas.\\u003c/em\\u003e 2012. \\u003cstrong\\u003e122\\u003c/strong\\u003e(3): p. 787-795.\\u003c/li\\u003e\\n\\u003cli\\u003eAlberto, et al., \\u003cem\\u003eMacrophage plasticity and polarization in tissue repair and remodelling.\\u003c/em\\u003e 2013.\\u003c/li\\u003e\\n\\u003cli\\u003eHe, G., et al., \\u003cem\\u003eIncreased M1 Macrophages Infiltration Is Associated with Thrombogenesis in Rheumatic Mitral Stenosis Patients with Atrial Fibrillation.\\u003c/em\\u003e 2016. \\u003cstrong\\u003e11\\u003c/strong\\u003e(3): p. e0149910.\\u003c/li\\u003e\\n\\u003cli\\u003eSun, Z., et al., \\u003cem\\u003eCross-talk between macrophages and atrial myocytes in atrial fibrillation.\\u003c/em\\u003e 2016. \\u003cstrong\\u003e111\\u003c/strong\\u003e(6): p. 63.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, Y., et al., \\u003cem\\u003eLow-Frequency Intermittent Hypoxia Suppresses Subcutaneous Adipogenesis and Induces Macrophage Polarization in Lean Mice.\\u003c/em\\u003e Diabetes Metab J, 2019. \\u003cstrong\\u003e43\\u003c/strong\\u003e(5): p. 659-674.\\u003c/li\\u003e\\n\\u003cli\\u003eCortese, R., et al., \\u003cem\\u003eAorta macrophage inflammatory and epigenetic changes in a murine model of obstructive sleep apnea: Potential role of CD36.\\u003c/em\\u003e Sci Rep, 2017. \\u003cstrong\\u003e7\\u003c/strong\\u003e: p. 43648.\\u003c/li\\u003e\\n\\u003cli\\u003eYu, L., et al., \\u003cem\\u003eAtrial Fibrillation in Acute Obstructive Sleep Apnea: Autonomic Nervous Mechanism and Modulation.\\u003c/em\\u003e J Am Heart Assoc, 2017. \\u003cstrong\\u003e6\\u003c/strong\\u003e(9).\\u003c/li\\u003e\\n\\u003cli\\u003eWu, J.G., et al., \\u003cem\\u003eEffects of small interfering RNA targeting TLR4 on expressions of adipocytokines in obstructive sleep apnea hyponea syndrome with hypertension in a rat model.\\u003c/em\\u003e J Cell Physiol, 2018. \\u003cstrong\\u003e233\\u003c/strong\\u003e(10): p. 6613-6620.\\u003c/li\\u003e\\n\\u003cli\\u003eRodriguez-Menocal, L., et al., \\u003cem\\u003eMacrophage-derived IL-18 and increased fibrinogen deposition are age-related inflammatory signatures of vascular remodeling.\\u003c/em\\u003e Am J Physiol Heart Circ Physiol, 2014. \\u003cstrong\\u003e306\\u003c/strong\\u003e(5): p. H641-53.\\u003c/li\\u003e\\n\\u003cli\\u003eCheng, Y., et al., \\u003cem\\u003eEarly depletion of M1 macrophages retards the progression of glucocorticoid-associated osteonecrosis of the femoral head.\\u003c/em\\u003e Int Immunopharmacol, 2023. \\u003cstrong\\u003e122\\u003c/strong\\u003e: p. 110639.\\u003c/li\\u003e\\n\\u003cli\\u003eLuo, Y., et al., \\u003cem\\u003eAkkermansia muciniphila prevents cold-related atrial fibrillation in rats by modulation of TMAO induced cardiac pyroptosis.\\u003c/em\\u003e EBioMedicine, 2022. \\u003cstrong\\u003e82\\u003c/strong\\u003e: p. 104087.\\u003c/li\\u003e\\n\\u003cli\\u003eBond, R.C., et al., \\u003cem\\u003eReduced density and altered regulation of rat atrial L-type Ca(2+) current in heart failure.\\u003c/em\\u003e Am J Physiol Heart Circ Physiol, 2017. \\u003cstrong\\u003e312\\u003c/strong\\u003e(3): p. H384-h391.\\u003c/li\\u003e\\n\\u003cli\\u003eZhao, J., et al., \\u003cem\\u003eChronic obstructive sleep apnea causes atrial remodeling in canines: mechanisms and implications.\\u003c/em\\u003e Basic Res Cardiol, 2014. \\u003cstrong\\u003e109\\u003c/strong\\u003e(5): p. 427.\\u003c/li\\u003e\\n\\u003cli\\u003eLi, Z., et al., \\u003cem\\u003eBMSC-derived exosomes promote tendon-bone healing after anterior cruciate ligament reconstruction by regulating M1/M2 macrophage polarization in rats.\\u003c/em\\u003e Stem Cell Res Ther, 2022. \\u003cstrong\\u003e13\\u003c/strong\\u003e(1): p. 295.\\u003c/li\\u003e\\n\\u003cli\\u003eTakagi, S., et al., \\u003cem\\u003eDepletion of microglia and macrophages with clodronate liposomes attenuates zymosan-induced Fos expression and hypothermia in the adult mouse.\\u003c/em\\u003e J Neuroimmunol, 2020. \\u003cstrong\\u003e344\\u003c/strong\\u003e: p. 577244.\\u003c/li\\u003e\\n\\u003cli\\u003eSun, Z., et al., \\u003cem\\u003eCross-talk between macrophages and atrial myocytes in atrial fibrillation.\\u003c/em\\u003e Basic Res Cardiol, 2016. \\u003cstrong\\u003e111\\u003c/strong\\u003e(6): p. 63.\\u003c/li\\u003e\\n\\u003cli\\u003eFlorez-Sampedro, L., et al., \\u003cem\\u003eThe role of MIF in chronic lung diseases: looking beyond inflammation.\\u003c/em\\u003e Am J Physiol Lung Cell Mol Physiol, 2020. \\u003cstrong\\u003e318\\u003c/strong\\u003e(6): p. L1183-l1197.\\u003c/li\\u003e\\n\\u003cli\\u003eEdwards, K.M., et al., \\u003cem\\u003eMacrophage migratory inhibitory factor (MIF) may be a key factor in inflammation in obstructive sleep apnea.\\u003c/em\\u003e Sleep, 2011. \\u003cstrong\\u003e34\\u003c/strong\\u003e(2): p. 161-3.\\u003c/li\\u003e\\n\\u003cli\\u003eChan, P.C., et al., \\u003cem\\u003eTargetted inhibition of CD74 attenuates adipose COX-2-MIF-mediated M1 macrophage polarization and retards obesity-related adipose tissue inflammation and insulin resistance.\\u003c/em\\u003e Clin Sci (Lond), 2018. \\u003cstrong\\u003e132\\u003c/strong\\u003e(14): p. 1581-1596.\\u003c/li\\u003e\\n\\u003cli\\u003eGore, Y., et al., \\u003cem\\u003eMacrophage migration inhibitory factor induces B cell survival by activation of a CD74-CD44 receptor complex.\\u003c/em\\u003e J Biol Chem, 2008. \\u003cstrong\\u003e283\\u003c/strong\\u003e(5): p. 2784-92.\\u003c/li\\u003e\\n\\u003cli\\u003eOlefsky, J.M. and C.K.J.A.R.o.P. Glass, \\u003cem\\u003eMacrophages, Inflammation, and Insulin Resistance.\\u003c/em\\u003e 2010. \\u003cstrong\\u003e72\\u003c/strong\\u003e(1): p. 219-246.\\u003c/li\\u003e\\n\\u003cli\\u003eEltzschig, H.K. and P. Carmeliet, \\u003cem\\u003eHypoxia and inflammation.\\u003c/em\\u003e N Engl J Med, 2011. \\u003cstrong\\u003e364\\u003c/strong\\u003e(7): p. 656-65.\\u003c/li\\u003e\\n\\u003cli\\u003eLavergne, F., et al., \\u003cem\\u003eAtrial fibrillation and sleep-disordered breathing.\\u003c/em\\u003e J Thorac Dis, 2015. \\u003cstrong\\u003e7\\u003c/strong\\u003e(12): p. E575-84.\\u003c/li\\u003e\\n\\u003cli\\u003eHuang, B., et al., \\u003cem\\u003eAtrial fibrillation in obstructive sleep apnea: Neural mechanisms and emerging therapies.\\u003c/em\\u003e Trends Cardiovasc Med, 2021. \\u003cstrong\\u003e31\\u003c/strong\\u003e(2): p. 127-132.\\u003c/li\\u003e\\n\\u003cli\\u003eGoudis, C.A. and D.G. Ketikoglou, \\u003cem\\u003eObstructive sleep and atrial fibrillation: Pathophysiological mechanisms and therapeutic implications.\\u003c/em\\u003e Int J Cardiol, 2017. \\u003cstrong\\u003e230\\u003c/strong\\u003e: p. 293-300.\\u003c/li\\u003e\\n\\u003cli\\u003eIwasaki, Y.K., et al., \\u003cem\\u003eAtrial fibrillation promotion with long-term repetitive obstructive sleep apnea in a rat model.\\u003c/em\\u003e J Am Coll Cardiol, 2014. \\u003cstrong\\u003e64\\u003c/strong\\u003e(19): p. 2013-23.\\u003c/li\\u003e\\n\\u003cli\\u003eSun, F., et al., \\u003cem\\u003eLncRNA NRON alleviates atrial fibrosis through suppression of M1 macrophages activated by atrial myocytes.\\u003c/em\\u003e Biosci Rep, 2019. \\u003cstrong\\u003e39\\u003c/strong\\u003e(11).\\u003c/li\\u003e\\n\\u003cli\\u003eCamm, A.J., et al., \\u003cem\\u003e2012 focused update of the ESC Guidelines for the management of atrial fibrillation: an update of the 2010 ESC Guidelines for the management of atrial fibrillation--developed with the special contribution of the European Heart Rhythm Association.\\u003c/em\\u003e Europace, 2012. \\u003cstrong\\u003e14\\u003c/strong\\u003e(10): p. 1385-413.\\u003c/li\\u003e\\n\\u003cli\\u003eZhou, D., et al., \\u003cem\\u003eMacrophage polarization and function: new prospects for fibrotic disease.\\u003c/em\\u003e Immunol Cell Biol, 2017. \\u003cstrong\\u003e95\\u003c/strong\\u003e(10): p. 864-869.\\u003c/li\\u003e\\n\\u003cli\\u003eWang, C., et al., \\u003cem\\u003eMacrophage Polarization and Its Role in Liver Disease.\\u003c/em\\u003e Front Immunol, 2021. \\u003cstrong\\u003e12\\u003c/strong\\u003e: p. 803037.\\u003c/li\\u003e\\n\\u003cli\\u003eKim, K.W. and H.R. Kim, \\u003cem\\u003eMacrophage migration inhibitory factor: a potential therapeutic target for rheumatoid arthritis.\\u003c/em\\u003e Korean J Intern Med, 2016. \\u003cstrong\\u003e31\\u003c/strong\\u003e(4): p. 634-42.\\u003c/li\\u003e\\n\\u003cli\\u003eP\\u0026aring;hlman, S. and S. Mohlin, \\u003cem\\u003eHypoxia and hypoxia-inducible factors in neuroblastoma.\\u003c/em\\u003e Cell Tissue Res, 2018. \\u003cstrong\\u003e372\\u003c/strong\\u003e(2): p. 269-275.\\u003c/li\\u003e\\n\\u003cli\\u003eAlonso, D., et al., \\u003cem\\u003eHIF-1\\u0026alpha;-regulated MIF activation and Nox2-dependent ROS generation promote Leishmania amazonensis killing by macrophages under hypoxia.\\u003c/em\\u003e Cell Immunol, 2019. \\u003cstrong\\u003e335\\u003c/strong\\u003e: p. 15-21.\\u003c/li\\u003e\\n\\u003cli\\u003eFu, H., et al., \\u003cem\\u003eHypoxia stimulates the expression of macrophage migration inhibitory factor in human vascular smooth muscle cells via HIF-1alpha dependent pathway.\\u003c/em\\u003e BMC Cell Biol, 2010. \\u003cstrong\\u003e11\\u003c/strong\\u003e: p. 66.\\u003c/li\\u003e\\n\\u003c/ol\\u003e\"},{\"header\":\"Table\",\"content\":\"\\u003cp\\u003e\\u003cstrong\\u003eTable 1. Oligonucleotide primers in RT-qPCR.\\u003c/strong\\u003e\\u003c/p\\u003e\\n\\u003ctable border=\\\"1\\\" cellspacing=\\\"0\\\" cellpadding=\\\"0\\\" width=\\\"718\\\"\\u003e\\n \\u003ctbody\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGenes\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eForward primer (5\\u0026prime;-3\\u0026prime;）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eReverse primer（5\\u0026prime;-3\\u0026prime;）\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCOL I\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCCCAGCATCCTGTACATTTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCAGCGTCAACACCATCATT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCOL III\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGTGGCCCTGGACACAGAGAT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCATGCAGGGTAGAGACATTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eHIF1\\u0026alpha;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGGCAGTAAGGTGGTGAATAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"32.86908077994429%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCTAAACGGTGGTGCCATAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"17.13091922005571%\\\"\\u003e\\n \\u003cp\\u003e\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eMIF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCTACATCAGAGACCCAATGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGTGACTGTCTCAGCTTCTTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCD74\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGGTCCTGTCTGGAAGAGTTTAG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTGAACATCTCGCTTCTCTCTATG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCD68\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGACCAAGGGGCTTTTACTTCAC\\u0026nbsp;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTTTGTAGGCTTCAGCGGAGCAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003ec-fos\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGTCTCCAGTGCCAACTTCATCC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGCAGCCATCTTATTCCTTTCCC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eNGF\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eACAGGAGCAAGCGGTCTTCG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTGGGTGGTGGTGCAGTAGGA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTNF\\u0026alpha;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAACAAGGAGGAGAAGTTCCCAAA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCTCCTCCGCTTGGTGGTTT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eIL6\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAGGATACCACCCACAACAGACC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTTGCCATTGCACAACTCTTTTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eiNOS\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTCCTCAGGCTTGGGTCTTGT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eATCCTGTGTTGTTGGGCTGG\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eTGF\\u0026beta;\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCTGCTGACCCCCACTGATAC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eAGCCCTGTATTCCGTCTCCT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eIL10\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCGACGCTGTCATCGATTTCTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCAGTAGATGCCGGGTGGTTC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eArg1\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCAAGCCAAAGCCCATAGAGATT\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCATTGGCTTTTCCCACAGACC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCD163\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGACAGACCCAACGGCTTACA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eGGTCACAAAACTTCAACCGGA\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003ctr\\u003e\\n \\u003ctd width=\\\"10.584958217270195%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003e\\u0026beta;-actin\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"39.41504178272981%\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCTACAATGAGCTGCGTGTGGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003ctd width=\\\"50%\\\" colspan=\\\"2\\\" valign=\\\"top\\\"\\u003e\\n \\u003cp\\u003eCAGGTCCAGACGCAGGATGGC\\u003c/p\\u003e\\n \\u003c/td\\u003e\\n \\u003c/tr\\u003e\\n \\u003c/tbody\\u003e\\n\\u003c/table\\u003e\\n\\u003cp\\u003eCOL I, Collagen I; COL III, Collagen III; HIF1\\u0026alpha;, hypoxia-inducible factor-1\\u0026alpha;; MIF, macrophage migration inhibitory factor; NGF, Nerve growth factor; TNF\\u0026alpha;, tumor necrosis factor \\u0026alpha;; IL6, Interleukin 6; iNOS, inducible nitric oxide synthase; TGF\\u0026beta;, transforming growth factor \\u0026beta;; IL10, Interleukin 10; Arg1, arginase 1;\\u0026nbsp;\\u003c/p\\u003e\"}],\"fulltextSource\":\"\",\"fullText\":\"\",\"funders\":[],\"hasAdminPriorityOnWorkflow\":false,\"hasManuscriptDocX\":true,\"hasOptedInToPreprint\":true,\"hasPassedJournalQc\":\"\",\"hasAnyPriority\":false,\"hideJournal\":true,\"highlight\":\"\",\"institution\":\"\",\"isAcceptedByJournal\":false,\"isAuthorSuppliedPdf\":false,\"isDeskRejected\":\"\",\"isHiddenFromSearch\":false,\"isInQc\":false,\"isInWorkflow\":false,\"isPdf\":false,\"isPdfUpToDate\":true,\"isWithdrawnOrRetracted\":false,\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true},\"keywords\":\"Obstructive sleep apnea, Atrial fibrillation, Macrophage polarization, Hypoxia-inducible factor-1α, Macrophage migration inhibitory factor\",\"lastPublishedDoi\":\"10.21203/rs.3.rs-3896162/v1\",\"lastPublishedDoiUrl\":\"https://doi.org/10.21203/rs.3.rs-3896162/v1\",\"license\":{\"name\":\"CC BY 4.0\",\"url\":\"https://creativecommons.org/licenses/by/4.0/\"},\"manuscriptAbstract\":\"\\u003cp\\u003eObstructive sleep apnea (OSA) is known to contribute to the increased occurrence and recurrence of atrial fibrillation (AF). However, the mechanism of chronic OSA-induced AF remains unknown. We constructed a rat model of chronic OSA and found that chronic OSA altered the pathological phenotype of atrial myocardial tissues, rendering it more susceptible to AF. Furthermore, we observed that chronic OSA promoted the polarization of M1 macrophages in the atrial tissue of rats, and the AF susceptibility induced by chronic OSA was reversed upon clearance of macrophages. Then, we found that macrophages induced an atrial fibrillation-like phenotype in atrial myocytes, while atrial myocytes promoted M1 polarization of macrophages, under hypoxia/reoxygenation treatment \\u003cem\\u003ein vitro\\u003c/em\\u003e. Moreover, hypoxia/reoxygenation upregulated the expression of hypoxia-inducible factor 1-alpha (HIF1α) in atrial myocytes, which subsequently stimulated the transcription and expression of macrophage migration inhibitory factor (MIF) by binding to the promoter region of the MIF gene. The increased expression of MIF in atrial myocytes further activated the expression of nuclear factor-kappa B (NF-κB) through interaction with the macrophage surface receptor CD74, ultimately leading to M1 macrophages polarization. In summary, chronic OSA activated M1 macrophage polarization through the HIF1α/MIF/CD74 signaling pathway, thereby mediating the increased susceptibility to AF. This study offers novel insights into early prevention strategies and potential therapeutic targets for OSA-induced AF.\\u003c/p\\u003e\",\"manuscriptTitle\":\"HIF1α/MIF/CD74 signaling mediated OSA-induced atrial fibrillation by promoting M1 macrophages polarization\",\"msid\":\"\",\"msnumber\":\"\",\"nonDraftVersions\":[{\"code\":1,\"date\":\"2024-02-01 06:03:45\",\"doi\":\"10.21203/rs.3.rs-3896162/v1\",\"editorialEvents\":[{\"type\":\"communityComments\",\"content\":0}],\"status\":\"published\",\"journal\":{\"display\":true,\"email\":\"info@researchsquare.com\",\"identity\":\"researchsquare\",\"isNatureJournal\":false,\"hasQc\":true,\"allowDirectSubmit\":true,\"externalIdentity\":\"\",\"sideBox\":\"\",\"snPcode\":\"\",\"submissionUrl\":\"/submission\",\"title\":\"Research Square\",\"twitterHandle\":\"researchsquare\",\"acdcEnabled\":true,\"dfaEnabled\":false,\"editorialSystem\":\"\",\"reportingPortfolio\":\"\",\"inReviewEnabled\":false,\"inReviewRevisionsEnabled\":true}}],\"origin\":\"\",\"ownerIdentity\":\"02827e7a-8b5a-43a2-8b32-f8babb035eea\",\"owner\":[],\"postedDate\":\"February 1st, 2024\",\"published\":true,\"recentEditorialEvents\":[],\"rejectedJournal\":[],\"revision\":\"\",\"amendment\":\"\",\"status\":\"posted\",\"subjectAreas\":[],\"tags\":[],\"updatedAt\":\"2024-02-04T20:44:13+00:00\",\"versionOfRecord\":[],\"versionCreatedAt\":\"2024-02-01 06:03:45\",\"video\":\"\",\"vorDoi\":\"\",\"vorDoiUrl\":\"\",\"workflowStages\":[]},\"version\":\"v1\",\"identity\":\"rs-3896162\",\"journalConfig\":\"researchsquare\"},\"__N_SSP\":true},\"page\":\"/article/[identity]/[[...version]]\",\"query\":{\"redirect\":\"/article/rs-3896162\",\"identity\":\"rs-3896162\",\"version\":[\"v1\"]},\"buildId\":\"qtupq5eGEP_6zYnWcrvyt\",\"isFallback\":false,\"isExperimentalCompile\":false,\"dynamicIds\":[84888],\"gssp\":true,\"scriptLoader\":[]}","source_license":"CC-BY-4.0","license_restricted":false}